From Axel.Kowald at rub.de  Wed Apr  2 08:14:20 2008
From: Axel.Kowald at rub.de (Axel Kowald)
Date: Wed, 02 Apr 2008 14:14:20 +0200
Subject: [EMBOSS] How to start Jemboss-MS.jar in standalone modus ?
Message-ID: <47F3789C.1030005@rub.de>

Hello everybody,

I just downloaded and installed EMBOSS version 5 for Windows on my XP 
SP2 machine and all programs run fine on the command line.
However, I can't figure out how to start the Jemboss GUI. When I start 
the jar it seems to be in client/server mode looking for a server, which 
I don't have. Somewhere I read that the GUI can also be started as a 
standalone application, but it was not explained how :-(

So the question is: How do I start Jemboss as standalone application ?

C:\Programme\EMBOSS\jemboss\jar>java -jar Jemboss-MS.jar
calling the server
Exception in thread "Thread-4" java.lang.NoClassDefFoundError: 
org/apache/axis/client/Service
        at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
        at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
        at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
        at org.emboss.jemboss.soap.ShowDB.<init>(Unknown Source)
        at org.emboss.jemboss.gui.BuildProgramMenu$1$1.construct(Unknown 
Source)
        at org.emboss.jemboss.gui.SwingWorker$2.run(Unknown Source)
        at java.lang.Thread.run(Unknown Source)
Exception in thread "Thread-3" java.lang.NoClassDefFoundError: 
org/apache/axis/client/Service
        at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
        at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
        at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
        at org.emboss.jemboss.soap.GetWossname.<init>(Unknown Source)
        at org.emboss.jemboss.gui.BuildProgramMenu$1.construct(Unknown 
Source)
        at org.emboss.jemboss.gui.SwingWorker$2.run(Unknown Source)
        at java.lang.Thread.run(Unknown Source)

Many thanks,

Axel



From ajb at ebi.ac.uk  Wed Apr  2 09:33:15 2008
From: ajb at ebi.ac.uk (ajb at ebi.ac.uk)
Date: Wed, 2 Apr 2008 14:33:15 +0100 (BST)
Subject: [EMBOSS] How to start Jemboss-MS.jar in standalone modus ?
In-Reply-To: <47F3789C.1030005@rub.de>
References: <47F3789C.1030005@rub.de>
Message-ID: <34594.86.14.232.77.1207143195.squirrel@webmail.ebi.ac.uk>

Hello Axel,

The installation should have produced an icon on your desktop to
launch Jemboss. There should also be an (m)EMBOSS entry in the
start menu for launching Jemboss. If not then uninstalling and
reinstalling might help.

If, on the other hand, the links were accidentally or
intentionally deleted then the shortcut information is:

Target:  PATH-TO-JAVA\bin\javaw.exe Jemboss-MS.jar local
Start in: PATH-TO-mEMBOSS\jemboss\jar

obviously you need to modify the path information above to suit your
installation. It is the 'local' word that tells Jemboss to start
in standalone mode.

HTH

Alan



 Hello everybody,
>
> I just downloaded and installed EMBOSS version 5 for Windows on my XP
> SP2 machine and all programs run fine on the command line.
> However, I can't figure out how to start the Jemboss GUI. When I start
> the jar it seems to be in client/server mode looking for a server, which
> I don't have. Somewhere I read that the GUI can also be started as a
> standalone application, but it was not explained how :-(
>
> So the question is: How do I start Jemboss as standalone application ?
>
> C:\Programme\EMBOSS\jemboss\jar>java -jar Jemboss-MS.jar
> calling the server
> Exception in thread "Thread-4" java.lang.NoClassDefFoundError:
> org/apache/axis/client/Service
>         at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
>         at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
>         at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
>         at org.emboss.jemboss.soap.ShowDB.<init>(Unknown Source)
>         at org.emboss.jemboss.gui.BuildProgramMenu$1$1.construct(Unknown
> Source)
>         at org.emboss.jemboss.gui.SwingWorker$2.run(Unknown Source)
>         at java.lang.Thread.run(Unknown Source)
> Exception in thread "Thread-3" java.lang.NoClassDefFoundError:
> org/apache/axis/client/Service
>         at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
>         at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
>         at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
>         at org.emboss.jemboss.soap.GetWossname.<init>(Unknown Source)
>         at org.emboss.jemboss.gui.BuildProgramMenu$1.construct(Unknown
> Source)
>         at org.emboss.jemboss.gui.SwingWorker$2.run(Unknown Source)
>         at java.lang.Thread.run(Unknown Source)
>
> Many thanks,
>
> Axel
>
>
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
>



From ajb at ebi.ac.uk  Wed Apr  2 09:43:44 2008
From: ajb at ebi.ac.uk (ajb at ebi.ac.uk)
Date: Wed, 2 Apr 2008 14:43:44 +0100 (BST)
Subject: [EMBOSS] How to start Jemboss-MS.jar in standalone modus ?
In-Reply-To: <34594.86.14.232.77.1207143196.squirrel@webmail.ebi.ac.uk>
References: <47F3789C.1030005@rub.de>
	<34594.86.14.232.77.1207143196.squirrel@webmail.ebi.ac.uk>
Message-ID: <40597.86.14.232.77.1207143824.squirrel@webmail.ebi.ac.uk>


> Target:  PATH-TO-JAVA\bin\javaw.exe Jemboss-MS.jar local
> Start in: PATH-TO-mEMBOSS\jemboss\jar

Of course you need the '-jar' switch in the target too.

Target:  PATH-TO-JAVA\bin\javaw.exe -jar Jemboss-MS.jar local


Alan



From Axel.Kowald at rub.de  Wed Apr  2 09:49:46 2008
From: Axel.Kowald at rub.de (Axel Kowald)
Date: Wed, 02 Apr 2008 15:49:46 +0200
Subject: [EMBOSS] How to start Jemboss-MS.jar in standalone modus ?
In-Reply-To: <34594.86.14.232.77.1207143195.squirrel@webmail.ebi.ac.uk>
References: <47F3789C.1030005@rub.de>
	<34594.86.14.232.77.1207143195.squirrel@webmail.ebi.ac.uk>
Message-ID: <47F38EFA.1000002@rub.de>

Ah, the desktop icon somehow got lost :-(
Now everything is working fine.

Many thanks,
 axel

> If, on the other hand, the links were accidentally or
> intentionally deleted then the shortcut information is:
>
> Target:  PATH-TO-JAVA\bin\javaw.exe Jemboss-MS.jar local
> Start in: PATH-TO-mEMBOSS\jemboss\jar
>
>   


From Axel.Kowald at rub.de  Wed Apr  2 10:14:38 2008
From: Axel.Kowald at rub.de (Axel Kowald)
Date: Wed, 02 Apr 2008 16:14:38 +0200
Subject: [EMBOSS] Adding new programs to Jemboss ?
Message-ID: <47F394CE.2070604@rub.de>

Hi,

I'm just playing around with Jemboss and it is really a neat interface 
to the EMBOSS programs.
I wonder if it is possible to add more programs to the GUI. Maybe by 
playing around with the files in the 'acd' folder?

Any ideas or did I just not find the documentation ?

Axel


From db60 at st-andrews.ac.uk  Thu Apr 10 07:10:11 2008
From: db60 at st-andrews.ac.uk (Daniel Barker)
Date: Thu, 10 Apr 2008 12:10:11 +0100
Subject: [EMBOSS] prophet BLOSUM question
Message-ID: <47FDF593.70204@st-andrews.ac.uk>

Dear EMBOSS users,

I am new to protein profile searches and am using prophecy and prophet 
for a distant similarity search. I'm trying to use BLOSUM45, but prophet 
is reporting BLOSUM62.

I'm generating profiles using prophecy and the BLOSUM45 matrix, thus:

prophecy -auto -warning -type H -datafile EBLOSUM45 -name 
homologene_1825.aln -outfile homologene_1825.prophecy

This seems fine.

I'm using the profiles to search a protein database, thus:

prophet -auto -warning -infile homologene_1825.prophecy -outfile 
prophet_out.txt -sequence 
NC_000909_Methanocaldococcus_jannaschii_DSM_2661_prots.fasta

I am puzzled by this line I get in my prophet output (prophet_out.txt in 
this case):

# Matrix: EBLOSUM62

I can't seem to make it go away. The profile file itself 
(homologene_1825.prophecy) does correctly report BLOSUM45:

Matrix          EBLOSUM45

Is there any way to make prophet also use BLOSUM45? (Does it in fact 
make any difference to prophet?)

Thank you very much for advice.

Best regards,

Daniel

-- 
Daniel Barker
http://bio.st-andrews.ac.uk/staff/db60.htm
The University of St Andrews is a charity registered in Scotland :
No SC013532

From Johanne.Duhaime at ircm.qc.ca  Thu Apr 10 10:27:45 2008
From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne)
Date: Thu, 10 Apr 2008 10:27:45 -0400
Subject: [EMBOSS] emma doest not work for nucleic sequences
Message-ID: <CD4C6F201C8D2A48AC3D804B7A00714B01C6F1C182FB@HERMES.ircm.priv>

Hello

I installed version 5 of Emboss on Solaris 9. I compiled a 64 bits version. When I run emma with a protein file it work fine. But when I use nucleic sequences it does not. Clustawl, by itself, work fine with nucleic sequences.

Emma  (protein)
Multiple alignment program - interface to ClustalW program
Input (gapped) sequence(s): multipleprotein.tfa
output sequence set [hs70_achkl.aln]:
Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]:

 CLUSTAL W 2.0 Multiple Sequence Alignments
Sequence type explicitly set to Protein
Sequence format is Pearson
number of seqs is: 5
(...)

Emma (nucleic)
Multiple alignment program - interface to ClustalW program
Input (gapped) sequence(s): multiplenucleic.tfa
output sequence set [ai632122.aln]:
Dendrogram (tree file) from clustalw output file [ai632122.dnd]:

 CLUSTAL W 2.0 Multiple Sequence Alignments

Error: parameter required for /dnamatrix
Error: Failed to open filename '00025815B'
Problem writing out EMBOSS alignment fileSegmentation fault

I have looked in the last year mail forum but could not see anything related.

Thank you in advance

Johanne
duhaimj at ircm.qc.ca<mailto:duhaimj at ircm.qc.ca>



From golharam at umdnj.edu  Thu Apr 10 12:27:02 2008
From: golharam at umdnj.edu (Ryan Golhar)
Date: Thu, 10 Apr 2008 12:27:02 -0400
Subject: [EMBOSS] EmbossExplorer: running problem (or installation
	problem?)
In-Reply-To: <CD4C6F201C8D2A48AC3D804B7A00714B018ABDC02DC4@HERMES.ircm.priv>
References: <CD4C6F201C8D2A48AC3D804B7A00714B018ABDC02DC4@HERMES.ircm.priv>
Message-ID: <47FE3FD6.7000004@umdnj.edu>

> Here is my first question.
> 
> "index.html" file in my Emboss web directory contains the following:
> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Frameset//EN"
>  "http://www.w3.org/TR/xhtml1/DTD/xhtml1-frameset.dtd">
> <html xmlns='http://www.w3.org/1999/xhtml' xml:lang='en' lang='en'>
>   <head>
>     <title>EMBOSS Explorer</title>
>   </head>
>   <frameset cols="170, *">
>     <frame src="/cgi-bin/emboss/menu" name="menu" />
>     <frame src="/cgi-bin/emboss/intro" name="main" />
>   </frameset>
> </html>
> in my "cgi-bin" I only have "emboss" as a perl program after the installation. How could that work?

The main page (index.html) directs your browser to use two frames.  Both 
frames are generates by the /cgi-bin/emboss script.  The script 
recognizes the URL as either /menu or /intro and displays the pages 
accordingly.  The script uses the ACD files installed by EMBOSS to 
determine what application are available, their groups, etc.

> Of course if I rename emboss by, let's say intro (as in the index.html), it does work. But I have three frames.  What am I missing?

You shouldn't rename the script.  If you do, it can break the whole 
package.  I don't know why you would have three frames. What browser are 
you using?  Here is a proper installation, http://emboss.umdnj.edu

Did the additional frame appear after you renamed the script?

> My second question
> I want to change the default output for "emma". For this I have put "SET emboss_OUTFORMAT clustal"  in my "emboss.default" file. This work perfectly when I use "emma" at the command line. But it has no effect in the EmbossExplorer Interface. Is there a way to correct that?

The web server doesn't see that environment variable hence it never gets 
passed to emma.  You can either set the environment variable in a 
startup script for your web server, or (the more proper way is to) 
modify your emma.acd file to include that output format as an option. 
(Please refer to the appropriate documentation on how to accomplish 
either method)


Ryan

From Johanne.Duhaime at ircm.qc.ca  Thu Apr 10 13:19:24 2008
From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne)
Date: Thu, 10 Apr 2008 13:19:24 -0400
Subject: [EMBOSS] EmbossExplorer: running problem (or installation
 problem?)
In-Reply-To: <47FE3FD6.7000004@umdnj.edu>
References: <CD4C6F201C8D2A48AC3D804B7A00714B018ABDC02DC4@HERMES.ircm.priv>
	<47FE3FD6.7000004@umdnj.edu>
Message-ID: <CD4C6F201C8D2A48AC3D804B7A00714B01C6F1C182FC@HERMES.ircm.priv>

Thank so much for your answers. Regarding the first one, I really appreciate.
As you can see in my email, the index.html was set as in the example you proposed me.
Then saying:
"The main page (index.html) directs your browser to use two frames.  Both
frames are generates by the /cgi-bin/emboss script."
Just wakes me up.
My installation was /cgi-bin/emboss/emboss!!!
So in my index.html I changed:
"/cgi-bin/emboss/menu" for "/cgi-bin/emboss/emboss/menu"

Such a lost of time for such trivial thing...

Thanks again

Johanne
-----Message d'origine-----
De : Ryan Golhar [mailto:golharam at umdnj.edu]
Envoy? : Thursday, 10 April 2008 12:27
? : Duhaime Johanne
Cc : 'emboss at emboss.open-bio.org'
Objet : Re: [EMBOSS] EmbossExplorer: running problem (or installation problem?)

> Here is my first question.
>
> "index.html" file in my Emboss web directory contains the following:
> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Frameset//EN"
>  "http://www.w3.org/TR/xhtml1/DTD/xhtml1-frameset.dtd">
> <html xmlns='http://www.w3.org/1999/xhtml' xml:lang='en' lang='en'>
>   <head>
>     <title>EMBOSS Explorer</title>
>   </head>
>   <frameset cols="170, *">
>     <frame src="/cgi-bin/emboss/menu" name="menu" />
>     <frame src="/cgi-bin/emboss/intro" name="main" />
>   </frameset>
> </html>
> in my "cgi-bin" I only have "emboss" as a perl program after the installation. How could that work?

The main page (index.html) directs your browser to use two frames.  Both
frames are generates by the /cgi-bin/emboss script.  The script
recognizes the URL as either /menu or /intro and displays the pages
accordingly.  The script uses the ACD files installed by EMBOSS to
determine what application are available, their groups, etc.

> Of course if I rename emboss by, let's say intro (as in the index.html), it does work. But I have three frames.  What am I missing?

You shouldn't rename the script.  If you do, it can break the whole
package.  I don't know why you would have three frames. What browser are
you using?  Here is a proper installation, http://emboss.umdnj.edu

Did the additional frame appear after you renamed the script?

> My second question
> I want to change the default output for "emma". For this I have put "SET emboss_OUTFORMAT clustal"  in my "emboss.default" file. This work perfectly when I use "emma" at the command line. But it has no effect in the EmbossExplorer Interface. Is there a way to correct that?

The web server doesn't see that environment variable hence it never gets
passed to emma.  You can either set the environment variable in a
startup script for your web server, or (the more proper way is to)
modify your emma.acd file to include that output format as an option.
(Please refer to the appropriate documentation on how to accomplish
either method)


Ryan


From Johanne.Duhaime at ircm.qc.ca  Wed Apr 16 08:13:29 2008
From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne)
Date: Wed, 16 Apr 2008 08:13:29 -0400
Subject: [EMBOSS] emma: problem with filename : please help
Message-ID: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0A@HERMES.ircm.priv>

Hello

I have a problem with emma and filename. I have seen other users having the same problem but their mail are from 2002. I also looked  at the bug reports but nothing regarding the problem.

In the old mail 2002. It was reported that the problem could be sold by changing the code in emma.c.
( static AjPStr emma_getUniqueFileName(void)
   { /* static char ext[2] = "A"; */  -->  static char ext[6] = "A0000";) this do not work. And I do not C well.

Here is the output of emma.

%emma
Multiple alignment program - interface to ClustalW program
Input (gapped) sequence(s): multipleprotein.tfa
output sequence set [hs70_achkl.aln]:
Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]:

Error: Failed to open filename '00022023B'

Problem writing out EMBOSS alignment fileSegmentation fault

The only file created is:

%ls -l 000*
-rw-rw----   1 duhaimj  si          3648 Apr 15 08:23 00022023A


This is for emboss 5, compiled in 64 bits on Solaris 9.

I  would really appreciate your help.


Johanne Duhaime
duhaimj at ircm.qc.ca<mailto:duhaimj at ircm.qc.ca>



From ajb at ebi.ac.uk  Wed Apr 16 08:44:38 2008
From: ajb at ebi.ac.uk (ajb at ebi.ac.uk)
Date: Wed, 16 Apr 2008 13:44:38 +0100 (BST)
Subject: [EMBOSS] emma: problem with filename : please help
In-Reply-To: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0A@HERMES.ircm.priv>
References: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0A@HERMES.ircm.priv>
Message-ID: <53818.86.14.232.77.1208349878.squirrel@webmail.ebi.ac.uk>

Hi,

The first thing to check is the version of CLUSTALW you are using.
The problem you refer to was a bug in an old version of Clustalw.
The EMBOSS code changes suggested/incorporated by some were not
a fix at all (as you've seen). You need to get Clustalw 1.83

HTH

Alan

 Hello
>
> I have a problem with emma and filename. I have seen other users having
> the same problem but their mail are from 2002. I also looked  at the bug
> reports but nothing regarding the problem.
>
> In the old mail 2002. It was reported that the problem could be sold by
> changing the code in emma.c.
> ( static AjPStr emma_getUniqueFileName(void)
>    { /* static char ext[2] = "A"; */  -->  static char ext[6] = "A0000";)
> this do not work. And I do not C well.
>
> Here is the output of emma.
>
> %emma
> Multiple alignment program - interface to ClustalW program
> Input (gapped) sequence(s): multipleprotein.tfa
> output sequence set [hs70_achkl.aln]:
> Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]:
>
> Error: Failed to open filename '00022023B'
>
> Problem writing out EMBOSS alignment fileSegmentation fault
>
> The only file created is:
>
> %ls -l 000*
> -rw-rw----   1 duhaimj  si          3648 Apr 15 08:23 00022023A
>
>
> This is for emboss 5, compiled in 64 bits on Solaris 9.
>
> I  would really appreciate your help.
>
>
> Johanne Duhaime
> duhaimj at ircm.qc.ca<mailto:duhaimj at ircm.qc.ca>
>
>
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
>



From Johanne.Duhaime at ircm.qc.ca  Wed Apr 16 10:40:33 2008
From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne)
Date: Wed, 16 Apr 2008 10:40:33 -0400
Subject: [EMBOSS] emma: problem with filename : please help
In-Reply-To: <4805F7C2.5090903@ebi.ac.uk>
References: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0A@HERMES.ircm.priv>
	<4805F7C2.5090903@ebi.ac.uk>
Message-ID: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0B@HERMES.ircm.priv>

Thank you to both of you.

You were right: it depends on the clustalw version. I had installed version 2 but version 1 was also in my path. Clustalw 2.0 was the first in the path but there was a permission problem so clustalw 1 was used. Sorry!

Now it works fine for protein alignement. But I still have a problem with a nucleic acid file

mercure{duhaimj}111: emma multiplenucleic.tfa
Multiple alignment program - interface to ClustalW program
output sequence set [ai632122.aln]:
Dendrogram (tree file) from clustalw output file [ai632122.dnd]:



 CLUSTAL W 2.0 Multiple Sequence Alignments


Error: parameter required for /dnamatrix
Error: Failed to open filename '00019719B'
Problem writing out EMBOSS alignment fileSegmentation fault
mercure{duhaimj}112: more multiplenucleic.tfa
>AI632122 Description:  ts85b08.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2238039 3',
TTCATTAATTTGCATTTATTTTCGGGAAGTAATGTAGATAAAGAGGAGGAGGGAGACTGC
CTTACATTTCAACAAGTAATTTGTGATCTTCACATCAGACAAATCAAATTTACAAATTAC
TTTCCCACCTACTGGACGAAGCGGCCAAAGCCAAAATTGATACACAGGCGCGCGGGCTCT
CCGCAGATTTCGGAGAACGAAGGTGCACTAAAAACTCACTAGACAAAACAAGGGTGTTGA
AAGAGAGAAGCCGACAGAGGAGTTGGAACTGGGTTTGGGGCCTGGGTTTGTTTGTTTTTC
CCTAATGCTGTACTTTTACGGATTTTGTTTTGTTTTGT
>AI813505 LOCUS       AI813505      530 bp    mRNA            EST       21-DEC-1999
GCGGCCGCCACCGGGTTCCCACCTAGTCCCGCAGCCGCTGCAGCCGCTGGGTTGGCGGAA
GAGCTGGACGCCGAGCTAGAGGACGAGGCAGAGCTGGACACAGCTGGCGGCGTGAATTGG
CCACTGCTTTCGGAGCCCGAGCTCTCCCGCACTGGAGAGGACTTCTTCTTGGCTGGGCGG
CTCTTGGTTCCGCTCCCGCTCTGCTGCTGCTGGCGGCATTTGTCGCGGCGGTTCTTGAAC
CAGACCTGGACTCTAGACTCCGGCAGGTTGATCTTGAGCGCCACCTCCTCCCGCATGAAG
ATGTCAGGGTAGCGAGTCTTGGCGAAGAGCGCCTCGAGCACGTCCAGCTGTGAACGCGTG
AAGGTGGTGCGCTCCCGCCGCTGCTTCCGCGGAGTGGCCGGATAGCCCACGGATGGGTGC
AGGAGGTCCATGGCGGGCCCGGCCAGGCCCAGCCCGTTCATGCCGTATGGGGGTTGTTTG
AGGTAAGACATCATGCTAACAGCTGGGTGGAGGCGCCCCGACGGATCCAG
>AI813507 LOCUS       AI813505      530 bp    mRNA            EST       21-DEC-1999
GCGGCCGCCACCGGGTTCCCACCTAGTCCCGCAGCCGCTGCAGCCGCTGGGTTGGCGGAA
GAGCTGGACGCCGAGCTAGAGGACGAGGCAGAGCTGGACACAGCTGGCGGCGTGAATTGG
CCACTGCTTTCGGAGCCCGAGCTCTCCCGCACTGGAGAGGACTTCTTCTTGGCTGGGCGG
CTCTTGGTTCCGCTCCCGCTCTGCTGCTGCTGGCGGCATTTGTCGCGGCGGTTCTTGAAC
CAGACCTGGACTCTAGACTCCGGCAGGTTGATCTTGAGCGCCACCTCCTCCCGCATGAAG
ATGTCAGGGTAGCGAGTCTTGGCGAAGAGCGCCTCGAGCACGTCCAGCTGTGAACGCGTG
AAGGTGGTGCGCTCCCGCCGCTGCTTCCGCGGAGTGGCCGGATAGCCCACGGATGGGTGC
AGGAGGTCCATGGCGGGCCCGGCCAGGCCCAGCCCGTTCATGCCGTATGGGGGTTGTTTG
AGGTAAGACATCATGCTAACAGCTGGGTGGAGGCGCCCCGACGGATCCAG

Thank you so much...
Johanne


-----Message d'origine-----
De : Peter Rice [mailto:pmr at ebi.ac.uk]
Envoy? : Wednesday, 16 April 2008 08:58
? : Duhaime Johanne
Cc : emboss-bug at emboss.open-bio.org
Objet : Re: [EMBOSS] emma: problem with filename : please help

Duhaime Johanne wrote:

> In the old mail 2002. It was reported that the problem could be sold by changing the code in emma.c.

That was a different problem with temporary filenames on Linux.

> %emma
> Multiple alignment program - interface to ClustalW program
> Input (gapped) sequence(s): multipleprotein.tfa
> output sequence set [hs70_achkl.aln]:
> Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]:
>
> Error: Failed to open filename '00022023B'

Do you have clustalw installed? Emma needs clustalw installed as it is a
wrapper.

The 00023023A file is the input to clustalw. The missing 00023023B file
is the alignment output by clustalw.

Can you send the input file you used (multipleprotein.tfa), and if
possible the version of clustalw you have installed (running clustalw
from the command line should tell you).

regards,

Peter Rice


From Johanne.Duhaime at ircm.qc.ca  Wed Apr 16 13:28:53 2008
From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne)
Date: Wed, 16 Apr 2008 13:28:53 -0400
Subject: [EMBOSS] emma doest not work for nucleic sequences
In-Reply-To: <480619BA.4040400@ebi.ac.uk>
References: <CD4C6F201C8D2A48AC3D804B7A00714B01C6F1C182FB@HERMES.ircm.priv>
	<480619BA.4040400@ebi.ac.uk>
Message-ID: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0C@HERMES.ircm.priv>

Hello

emma works fine with clustawl 1.83 but not with 1.82 or 2.0. Thank you very much!

Johanne
-----Message d'origine-----
De : Peter Rice [mailto:pmr at ebi.ac.uk]
Envoy? : Wednesday, 16 April 2008 11:23
? : Duhaime Johanne
Cc : emboss-bug at emboss.open-bio.org
Objet : Re: [EMBOSS] emma doest not work for nucleic sequences

Duhaime Johanne wrote:
> Hello
>
> I installed version 5 of Emboss on Solaris 9. I compiled a 64 bits version. When I run emma with a protein file it work fine. But when I use nucleic sequences it does not. Clustawl, by itself, work fine with nucleic sequences.
>
> Emma  (protein)
> Multiple alignment program - interface to ClustalW program
> Input (gapped) sequence(s): multipleprotein.tfa
> output sequence set [hs70_achkl.aln]:
> Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]:
>
>  CLUSTAL W 2.0 Multiple Sequence Alignments
> Sequence type explicitly set to Protein
> Sequence format is Pearson
> number of seqs is: 5
> (...)
>
> Emma (nucleic)
> Multiple alignment program - interface to ClustalW program
> Input (gapped) sequence(s): multiplenucleic.tfa
> output sequence set [ai632122.aln]:
> Dendrogram (tree file) from clustalw output file [ai632122.dnd]:
>
>  CLUSTAL W 2.0 Multiple Sequence Alignments
>
> Error: parameter required for /dnamatrix

Ah, so you are using clustalw 2.0

Emma was designed for clustalw 1.83

Perhaps we need to look at the differences between clustal versions and
provide some extra logic in emma (we will try to avoid running two
different 'emma's)

regards,

Peter


From charles-listes-emboss at plessy.org  Fri Apr 18 01:16:37 2008
From: charles-listes-emboss at plessy.org (Charles Plessy)
Date: Fri, 18 Apr 2008 14:16:37 +0900
Subject: [EMBOSS] emma: problem with filename : please help
In-Reply-To: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0B@HERMES.ircm.priv>
References: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0A@HERMES.ircm.priv>
	<4805F7C2.5090903@ebi.ac.uk>
	<CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0B@HERMES.ircm.priv>
Message-ID: <20080418051637.GA3914@kunpuu.plessy.org>

Le Wed, Apr 16, 2008 at 10:40:33AM -0400, Duhaime Johanne a ?crit :
>
>  CLUSTAL W 2.0 Multiple Sequence Alignments
>
>
> Error: parameter required for /dnamatrix

Hello,

apparently, emma passes an empty '-dnamatrix=' argument that is accepted
by clustalw 1.83, but not 2.0. I do not know if it is a regression in
clustalw or a problem of emma.

Have a nice day,

--
Charles Plessy
Debian-Med packaging team
http://www.debian.org/devel/debian-med/

From Sebastien.Moretti at unil.ch  Wed Apr 23 08:31:19 2008
From: Sebastien.Moretti at unil.ch (Sebastien Moretti)
Date: Wed, 23 Apr 2008 14:31:19 +0200
Subject: [EMBOSS] How to use toggle properly ?
Message-ID: <480F2C17.9010407@unil.ch>

Hi,

I have an option (string symbcons) in my application that must be used
only if another option is chosen (boolean cons).

toggle seems to be the right way to do this but its use is a little bit
confusing for me.


I have followed example from emma application but I cannot do the same 
kind of thing.

How could I do this ?

Thanks


Here is the ACD code:
      string: symbcons [
          knowntype: "string"
          default: "B.*"
          minlength: 3
          maxlength: 3
          comment: "defaults"
          prompt: "Consensus symbols ?"
          information: "Consensus symbols for mismatches(B),
similarity(.) and identical(*) (B means blank & must be used instead of
blank !)"
          comment: 'method -&&=$"$"'
      ]

      boolean: cons [
          default: "false"
          comment: "defaults"
          prompt: "Create consensus line ?"
          information: "Create consensus line"
          comment: "method -&& $symbcons"
      ]

-- 
S?bastien Moretti
SIB, Quartier Sorge - Genopode
CH-1015 Lausanne, Switzerland
Tel.: +41 (21) 692 4056/4221

-------------------------------------------------------------------------
This SF.net email is sponsored by the 2008 JavaOne(SM) Conference
Don't miss this year's exciting event. There's still time to save $100.
Use priority code J8TL2D2.
http://ad.doubleclick.net/clk;198757673;13503038;p?http://java.sun.com/javaone
_______________________________________________
Soaplab-users mailing list
Soaplab-users at lists.sourceforge.net
https://lists.sourceforge.net/lists/listinfo/soaplab-users

From staffa at niehs.nih.gov  Wed Apr 23 10:33:54 2008
From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS))
Date: Wed, 23 Apr 2008 10:33:54 -0400
Subject: [EMBOSS] Jemboss
In-Reply-To: <480F2C17.9010407@unil.ch>
Message-ID: <C434C112.92D3%staffa@niehs.nih.gov>

My sysadmin guy installed Jemboss but it doesn't seem to know about dataset
and datafiles (like Rebase) .
Command line emboss does just fine finding stuff like REBASE.

The emboss doc at http://emboss.sourceforge.net/docs/adminguide/node69.html
says:
>>Graphical interfaces to EMBOSS
This chapter needs to be written. It will be written when the available GUIs
are stable enough to document.
<<

Does this mean that Jemboss is not to be trusted? Is not ready for
prime-time? 

Does anyone know what where and what resource file Jemboss must see so that
it can run programs like remap successfully?


 
Nick Staffa 
Telephone: 919-316-4569  (NIEHS: 6-4569)
Scientific Computing Support Group
NIEHS Information Technology Support Services Contract
(Science Task Monitor: Roy W. Reter (reter at niehs.nih.gov)
National Institute of Environmental Health Sciences
National Institutes of Health
Research Triangle Park, North Carolina







From gbottu at vub.ac.be  Wed Apr 23 12:46:08 2008
From: gbottu at vub.ac.be (Guy Bottu)
Date: Wed, 23 Apr 2008 18:46:08 +0200
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <480F2C17.9010407@unil.ch>
References: <480F2C17.9010407@unil.ch>
Message-ID: <480F67D0.4060002@vub.ac.be>

Sebastien Moretti wrote:
> I have an option (string symbcons) in my application that must be used
> only if another option is chosen (boolean cons).

	Dear Sebastien,

I have some experience with writing EMBOSS programs and I think I can help you. 
   EMBOSS parses the ACD files from top to bottom, so you must write the object 
"boolean: cons" first and "string: symbcons" later. To make sure that the 
program at the command line will only prompt for symbcons when cons is set to y, 
you must include in the objects cons an attribute
standdard: "Y"
and in the object "string: symbcons" an attribute
standard: "$cons"
Or you put additional instead of standard.
Note that in case the user chooses n for cons, symbcons will not be prompted for 
and will be set to its default value. You must hence make sure that the C code 
of the program does something intelligent with that.

Note that the objects of type boolean and toggle are handled the same by EMBOSS. 
The distinction was introduced for the sake of GUI developers. Note also that 
since there exist "expert" parameters that are neither standard or optional. 
They are never prompted at the command line. To allow GUI's to hide them the 
attribute "needed" was invented, but it depends on the GUI whether it is supported.

	Regards,
	Guy Bottu,
	Belgian EMnet Node


From pmr at ebi.ac.uk  Thu Apr 24 03:48:58 2008
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 24 Apr 2008 08:48:58 +0100
Subject: [EMBOSS] Jemboss
In-Reply-To: <C434C112.92D3%staffa@niehs.nih.gov>
References: <C434C112.92D3%staffa@niehs.nih.gov>
Message-ID: <48103B6A.9090303@ebi.ac.uk>

Hi Nick,

Staffa, Nick (NIH/NIEHS) wrote:
> My sysadmin guy installed Jemboss but it doesn't seem to know about dataset
> and datafiles (like Rebase) .
> Command line emboss does just fine finding stuff like REBASE.

This suggests they are using some different setup. If the database files 
were installed in the default directories, and you have only one EMBOSS 
installation, this is very strange. If there is some other location for 
the files and EMBOSS_* environment variables are being used to redirect 
that would explain the behaviour.

What is the message you get from Jemboss?

> The emboss doc at http://emboss.sourceforge.net/docs/adminguide/node69.html
> says:
>>> Graphical interfaces to EMBOSS
> This chapter needs to be written. It will be written when the available GUIs
> are stable enough to document.
> <<
> 
> Does this mean that Jemboss is not to be trusted? Is not ready for
> prime-time? 

Jemboss is fine. We are updating all our documentation at the moment :-)

> Does anyone know what where and what resource file Jemboss must see so that
> it can run programs like remap successfully?

You will get a more detailed reply from the Jemboss experts.

regards,

Peter

From pmr at ebi.ac.uk  Thu Apr 24 03:58:31 2008
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 24 Apr 2008 08:58:31 +0100
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <480F2C17.9010407@unil.ch>
References: <480F2C17.9010407@unil.ch>
Message-ID: <48103DA7.3040800@ebi.ac.uk>

Sebastien Moretti wrote:
> Hi,
> 
> I have an option (string symbcons) in my application that must be used
> only if another option is chosen (boolean cons).

Guy Bottu has already given you a complete answer.

Just one further point - the user can still change the value of symbcons 
by putting -symbcons=value on the commandline so you need to use the 
-cons toggle (or boolean) value to test whether to use the value in your 
program.

> I have followed example from emma application but I cannot do the same 
> kind of thing.

I will take a look at emma ... it was the first complex ACD file we 
wrote (a major, and successful, test that ACD could handle the number of 
options clustalw uses). Some of the options could be cleaned up.

regards,

Peter

From Sebastien.Moretti at unil.ch  Thu Apr 24 08:41:18 2008
From: Sebastien.Moretti at unil.ch (Sebastien Moretti)
Date: Thu, 24 Apr 2008 14:41:18 +0200
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <480F67D0.4060002@vub.ac.be>
References: <480F2C17.9010407@unil.ch> <480F67D0.4060002@vub.ac.be>
Message-ID: <48107FEE.5080300@unil.ch>

>> I have an option (string symbcons) in my application that must be used
>> only if another option is chosen (boolean cons).
> 
>     Dear Sebastien,
> 
> I have some experience with writing EMBOSS programs and I think I can 
> help you.   EMBOSS parses the ACD files from top to bottom, so you must 
> write the object "boolean: cons" first and "string: symbcons" later. To 
> make sure that the program at the command line will only prompt for 
> symbcons when cons is set to y, you must include in the objects cons an 
> attribute
> standdard: "Y"
> and in the object "string: symbcons" an attribute
> standard: "$cons"
> Or you put additional instead of standard.
> Note that in case the user chooses n for cons, symbcons will not be 
> prompted for and will be set to its default value. You must hence make 
> sure that the C code of the program does something intelligent with that.
> 
> Note that the objects of type boolean and toggle are handled the same by 
> EMBOSS. The distinction was introduced for the sake of GUI developers. 
> Note also that since there exist "expert" parameters that are neither 
> standard or optional. They are never prompted at the command line. To 
> allow GUI's to hide them the attribute "needed" was invented, but it 
> depends on the GUI whether it is supported.
> 
>     Regards,
>     Guy Bottu,
>     Belgian EMnet Node

Object order was reversed for tests.
I am close to what I want now.
Thanks

It seems to work better with
	standard: "$(cons)"
instead of
	standard: "$cons"
What is the difference between them ?


I use applications with an ACD syntax through Soaplab2.
This add another level of ACD management.
If symbcons is used with a non-default value, cons is overstepped.

Thanks.

-- 
S?bastien Moretti
SIB, Quartier Sorge - Genopode
CH-1015 Lausanne, Switzerland
Tel.: +41 (21) 692 4056/4221

From Sebastien.Moretti at unil.ch  Thu Apr 24 08:46:38 2008
From: Sebastien.Moretti at unil.ch (Sebastien Moretti)
Date: Thu, 24 Apr 2008 14:46:38 +0200
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <48103DA7.3040800@ebi.ac.uk>
References: <480F2C17.9010407@unil.ch> <48103DA7.3040800@ebi.ac.uk>
Message-ID: <4810812E.3010201@unil.ch>

>> Hi,
>>
>> I have an option (string symbcons) in my application that must be used
>> only if another option is chosen (boolean cons).
> 
> Guy Bottu has already given you a complete answer.
> 
> Just one further point - the user can still change the value of symbcons 
> by putting -symbcons=value on the commandline so you need to use the 
> -cons toggle (or boolean) value to test whether to use the value in your 
> program.

How can I do this ?

>> I have followed example from emma application but I cannot do the same 
>> kind of thing.
> 
> I will take a look at emma ... it was the first complex ACD file we 
> wrote (a major, and successful, test that ACD could handle the number of 
> options clustalw uses). Some of the options could be cleaned up.
> 
> regards,
> 
> Peter

Thanks

-- 
S?bastien Moretti
SIB, Quartier Sorge - Genopode
CH-1015 Lausanne, Switzerland
Tel.: +41 (21) 692 4056/4221

From pmr at ebi.ac.uk  Thu Apr 24 09:59:09 2008
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 24 Apr 2008 14:59:09 +0100
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <48107FEE.5080300@unil.ch>
References: <480F2C17.9010407@unil.ch> <480F67D0.4060002@vub.ac.be>
	<48107FEE.5080300@unil.ch>
Message-ID: <4810922D.2030405@ebi.ac.uk>

Sebastien Moretti wrote:
> It seems to work better with
>     standard: "$(cons)"
> instead of
>     standard: "$cons"
> What is the difference between them ?

$(cons) is the correct syntax.

> I use applications with an ACD syntax through Soaplab2.
> This add another level of ACD management.
> If symbcons is used with a non-default value, cons is overstepped.

The same advice as for the commandline applies - test the value of con 
in your code, because symbcons can still be set by the user.

The cons boolean only stops them being prompted.

regards,

Peter

From Sebastien.Moretti at unil.ch  Thu Apr 24 10:14:01 2008
From: Sebastien.Moretti at unil.ch (Sebastien Moretti)
Date: Thu, 24 Apr 2008 16:14:01 +0200
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <4810922D.2030405@ebi.ac.uk>
References: <480F2C17.9010407@unil.ch> <480F67D0.4060002@vub.ac.be>
	<48107FEE.5080300@unil.ch> <4810922D.2030405@ebi.ac.uk>
Message-ID: <481095A9.8070509@unil.ch>

>> It seems to work better with
>>     standard: "$(cons)"
>> instead of
>>     standard: "$cons"
>> What is the difference between them ?
> 
> $(cons) is the correct syntax.
> 
>> I use applications with an ACD syntax through Soaplab2.
>> This add another level of ACD management.
>> If symbcons is used with a non-default value, cons is overstepped.
> 
> The same advice as for the commandline applies - test the value of con 
> in your code, because symbcons can still be set by the user.

You mean in the program code, or in the ACD code ?

> The cons boolean only stops them being prompted.
> 
> regards,
> 
> Peter


-- 
S?bastien Moretti
SIB, Quartier Sorge - Genopode
CH-1015 Lausanne, Switzerland
Tel.: +41 (21) 692 4056/4221

From pmr at ebi.ac.uk  Thu Apr 24 10:29:30 2008
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 24 Apr 2008 15:29:30 +0100
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <4810812E.3010201@unil.ch>
References: <480F2C17.9010407@unil.ch> <48103DA7.3040800@ebi.ac.uk>
	<4810812E.3010201@unil.ch>
Message-ID: <4810994A.4030900@ebi.ac.uk>

Sebastien Moretti wrote:
>> Just one further point - the user can still change the value of 
>> symbcons by putting -symbcons=value on the commandline so you need to 
>> use the -cons toggle (or boolean) value to test whether to use the 
>> value in your program.
> 
> How can I do this ?

Simply test the value of cons in your application, and ignore the value 
of symbcons if cons if false.

regards,

Peter Rice

From staffa at niehs.nih.gov  Thu Apr 24 11:02:31 2008
From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS) [C])
Date: Thu, 24 Apr 2008 11:02:31 -0400
Subject: [EMBOSS] Jemboss
In-Reply-To: <48103B6A.9090303@ebi.ac.uk>
References: <C434C112.92D3%staffa@niehs.nih.gov> <48103B6A.9090303@ebi.ac.uk>
Message-ID: <7930EE6CD7CA354D93B444D0433C0611068484CB@NIHCESMLBX6.nih.gov>

Right now I am most concerned about restriction analysis. This is what
my most favored customers need. There is no meaningful output when doing
remap from Jemboss, whilst there is good output from command line. 
There is hardly any meaningful error message.

Message from Jemboss:

Input: local GCG file (previously converted from Genbank file.
Program: remap with all defaults.
Result: Saved Results window: 3 tabs:
	Filename.remap  shows only the locus name
	C_RestoredFile.....    shows the original sequence file.
	Cmd shows   
remap -sequence C__RestoredFiles_staffa_Desktop_PC_Sequences_hspgk2g.seq
-enzymes all -sitelen 4 -mincuts 1 -maxcuts 2000000000 -nosingle  -blunt
-sticky  -ambiguity  -noplasmid  -commercial  -table 0 -frame 6 -cutlist
-noflatreformat  -limit  -translation  -reverse  -orfminsize 0
-nothreeletter  -nonumber  -width 60 -length 0 -margin 10 -name
-description  -offset 1 -nohtml  -auto

Entering an outputfilename makes no difference; no local output file was
generated.

Selecting a remote file, even fasta, from the File Manager and clicking
on Load Sequence Attributes gives Error Message Sequence Not Found
Check the sequence entered. [OK].   Whereas double clicking on the entry
gives a nice picture of the sequence in Remote File window. 

Using a fasta remote sequence the Saved Results has two tabs:
	EF015887.remap   has only the name of the sequence
	Cmd		contains the command. 
Running command line remap on the same sequence using all defaults gives
a nice output showing many cuts many places.

Using the File Manager to move the same fasta file to local C drive and
running remap.  Clicking Load Sequence Attributes does not give any
error.
The output Saved Results now has 3 tabs, but no real output.






-----Original Message-----
From: Peter Rice [mailto:pmr at ebi.ac.uk] 
Sent: Thursday, April 24, 2008 3:49 AM
To: Staffa, Nick (NIH/NIEHS) [C]
Cc: emboss at lists.open-bio.org; Wright, Douglas (NIH/NIEHS) [C]
Subject: Re: [EMBOSS] Jemboss

Hi Nick,

Staffa, Nick (NIH/NIEHS) wrote:
> My sysadmin guy installed Jemboss but it doesn't seem to know about
dataset
> and datafiles (like Rebase) .
> Command line emboss does just fine finding stuff like REBASE.

This suggests they are using some different setup. If the database files

were installed in the default directories, and you have only one EMBOSS 
installation, this is very strange. If there is some other location for 
the files and EMBOSS_* environment variables are being used to redirect 
that would explain the behaviour.

What is the message you get from Jemboss?

> The emboss doc at
http://emboss.sourceforge.net/docs/adminguide/node69.html
> says:
>>> Graphical interfaces to EMBOSS
> This chapter needs to be written. It will be written when the
available GUIs
> are stable enough to document.
> <<
> 
> Does this mean that Jemboss is not to be trusted? Is not ready for
> prime-time? 

Jemboss is fine. We are updating all our documentation at the moment :-)

> Does anyone know what where and what resource file Jemboss must see so
that
> it can run programs like remap successfully?

You will get a more detailed reply from the Jemboss experts.

regards,

Peter


From gbottu at vub.ac.be  Thu Apr 24 11:33:53 2008
From: gbottu at vub.ac.be (Guy Bottu)
Date: Thu, 24 Apr 2008 17:33:53 +0200
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <4810994A.4030900@ebi.ac.uk>
References: <480F2C17.9010407@unil.ch>
	<48103DA7.3040800@ebi.ac.uk>	<4810812E.3010201@unil.ch>
	<4810994A.4030900@ebi.ac.uk>
Message-ID: <4810A861.8040002@vub.ac.be>

Peter Rice wrote:
> Sebastien Moretti wrote:
> 
>>> Just one further point - the user can still change the value of 
>>> symbcons by putting -symbcons=value on the commandline so you need to 
>>> use the -cons toggle (or boolean) value to test whether to use the 
>>> value in your program.
>>
>>>> How can I do this ?
> 
> > Simply test the value of cons in your application, and ignore the value 
> of symbcons if cons if false.

As Peter points out, the
standard: "$(cons)"
in the ACD is only for preventing the program to prompt for symbcons when run 
interactively in a text terminal or presenting the symbcons box in a GUI 
(provided that the GUI handles the ACD correctly). But the program can still 
obtain a value for probcons. So, inside the C code of the program we need :

if (ajAcdGetBool("cons") {
   myconsensussymbolstring = ajAcdGetString("symbcons");
   HERE SOME CODE THAT COMPUTES THE CONSENSUS
} else {
   OPTIONALLY SOMETHING TO DO IF YOU DO NOT WANT A CONSENSUS
}

if you use a toggle instead of a boolean it would be ajAcdGetToggle

	Guy Bottu

From tjc at sanger.ac.uk  Thu Apr 24 11:48:26 2008
From: tjc at sanger.ac.uk (Tim Carver)
Date: Thu, 24 Apr 2008 16:48:26 +0100
Subject: [EMBOSS] Jemboss
In-Reply-To: <7930EE6CD7CA354D93B444D0433C0611068484CB@NIHCESMLBX6.nih.gov>
Message-ID: <C4366A5A.75EF7%tjc@sanger.ac.uk>

Hi Nick

I would check 'jemboss.properties' to ensure that embossData is set to the
correct directory. See the description at:

http://emboss.sourceforge.net/Jemboss/install/properties.html

Regards
Tim

On 24/4/08 16:02, "Staffa, Nick (NIH/NIEHS) [C]" <staffa at niehs.nih.gov>
wrote:

> Right now I am most concerned about restriction analysis. This is what
> my most favored customers need. There is no meaningful output when doing
> remap from Jemboss, whilst there is good output from command line.
> There is hardly any meaningful error message.
> 
> Message from Jemboss:
> 
> Input: local GCG file (previously converted from Genbank file.
> Program: remap with all defaults.
> Result: Saved Results window: 3 tabs:
> Filename.remap  shows only the locus name
> C_RestoredFile.....    shows the original sequence file.
> Cmd shows   
> remap -sequence C__RestoredFiles_staffa_Desktop_PC_Sequences_hspgk2g.seq
> -enzymes all -sitelen 4 -mincuts 1 -maxcuts 2000000000 -nosingle  -blunt
> -sticky  -ambiguity  -noplasmid  -commercial  -table 0 -frame 6 -cutlist
> -noflatreformat  -limit  -translation  -reverse  -orfminsize 0
> -nothreeletter  -nonumber  -width 60 -length 0 -margin 10 -name
> -description  -offset 1 -nohtml  -auto
> 
> Entering an outputfilename makes no difference; no local output file was
> generated.
> 
> Selecting a remote file, even fasta, from the File Manager and clicking
> on Load Sequence Attributes gives Error Message Sequence Not Found
> Check the sequence entered. [OK].   Whereas double clicking on the entry
> gives a nice picture of the sequence in Remote File window.
> 
> Using a fasta remote sequence the Saved Results has two tabs:
> EF015887.remap   has only the name of the sequence
> Cmd  contains the command.
> Running command line remap on the same sequence using all defaults gives
> a nice output showing many cuts many places.
> 
> Using the File Manager to move the same fasta file to local C drive and
> running remap.  Clicking Load Sequence Attributes does not give any
> error.
> The output Saved Results now has 3 tabs, but no real output.
> 
> 
> 
> 
> 
> 
> -----Original Message-----
> From: Peter Rice [mailto:pmr at ebi.ac.uk]
> Sent: Thursday, April 24, 2008 3:49 AM
> To: Staffa, Nick (NIH/NIEHS) [C]
> Cc: emboss at lists.open-bio.org; Wright, Douglas (NIH/NIEHS) [C]
> Subject: Re: [EMBOSS] Jemboss
> 
> Hi Nick,
> 
> Staffa, Nick (NIH/NIEHS) wrote:
>> My sysadmin guy installed Jemboss but it doesn't seem to know about
> dataset
>> and datafiles (like Rebase) .
>> Command line emboss does just fine finding stuff like REBASE.
> 
> This suggests they are using some different setup. If the database files
> 
> were installed in the default directories, and you have only one EMBOSS
> installation, this is very strange. If there is some other location for
> the files and EMBOSS_* environment variables are being used to redirect
> that would explain the behaviour.
> 
> What is the message you get from Jemboss?
> 
>> The emboss doc at
> http://emboss.sourceforge.net/docs/adminguide/node69.html
>> says:
>>>> Graphical interfaces to EMBOSS
>> This chapter needs to be written. It will be written when the
> available GUIs
>> are stable enough to document.
>> <<
>> 
>> Does this mean that Jemboss is not to be trusted? Is not ready for
>> prime-time? 
> 
> Jemboss is fine. We are updating all our documentation at the moment :-)
> 
>> Does anyone know what where and what resource file Jemboss must see so
> that
>> it can run programs like remap successfully?
> 
> You will get a more detailed reply from the Jemboss experts.
> 
> regards,
> 
> Peter
> 
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss




-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

From staffa at niehs.nih.gov  Thu Apr 24 13:59:37 2008
From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS))
Date: Thu, 24 Apr 2008 13:59:37 -0400
Subject: [EMBOSS] Jemboss
In-Reply-To: <C4366A5A.75EF7%tjc@sanger.ac.uk>
Message-ID: <C43642C9.9327%staffa@niehs.nih.gov>

You have hit the nail on the head.
(probably) 
or to quote Jeeves:
"Rem acu tetigisti."


On 4/24/08 11:48 AM, "Tim Carver" <tjc at sanger.ac.uk> wrote:

> Hi Nick
> 
> I would check 'jemboss.properties' to ensure that embossData is set to the
> correct directory. See the description at:
> 
> http://emboss.sourceforge.net/Jemboss/install/properties.html
> 
> Regards
> Tim
> 
> On 24/4/08 16:02, "Staffa, Nick (NIH/NIEHS) [C]" <staffa at niehs.nih.gov>
> wrote:
> 
>> Right now I am most concerned about restriction analysis. This is what
>> my most favored customers need. There is no meaningful output when doing
>> remap from Jemboss, whilst there is good output from command line.
>> There is hardly any meaningful error message.
>> 
>> Message from Jemboss:
>> 
>> Input: local GCG file (previously converted from Genbank file.
>> Program: remap with all defaults.
>> Result: Saved Results window: 3 tabs:
>> Filename.remap  shows only the locus name
>> C_RestoredFile.....    shows the original sequence file.
>> Cmd shows   
>> remap -sequence C__RestoredFiles_staffa_Desktop_PC_Sequences_hspgk2g.seq
>> -enzymes all -sitelen 4 -mincuts 1 -maxcuts 2000000000 -nosingle  -blunt
>> -sticky  -ambiguity  -noplasmid  -commercial  -table 0 -frame 6 -cutlist
>> -noflatreformat  -limit  -translation  -reverse  -orfminsize 0
>> -nothreeletter  -nonumber  -width 60 -length 0 -margin 10 -name
>> -description  -offset 1 -nohtml  -auto
>> 
>> Entering an outputfilename makes no difference; no local output file was
>> generated.
>> 
>> Selecting a remote file, even fasta, from the File Manager and clicking
>> on Load Sequence Attributes gives Error Message Sequence Not Found
>> Check the sequence entered. [OK].   Whereas double clicking on the entry
>> gives a nice picture of the sequence in Remote File window.
>> 
>> Using a fasta remote sequence the Saved Results has two tabs:
>> EF015887.remap   has only the name of the sequence
>> Cmd  contains the command.
>> Running command line remap on the same sequence using all defaults gives
>> a nice output showing many cuts many places.
>> 
>> Using the File Manager to move the same fasta file to local C drive and
>> running remap.  Clicking Load Sequence Attributes does not give any
>> error.
>> The output Saved Results now has 3 tabs, but no real output.
>> 
>> 
>> 
>> 
>> 
>> 
>> -----Original Message-----
>> From: Peter Rice [mailto:pmr at ebi.ac.uk]
>> Sent: Thursday, April 24, 2008 3:49 AM
>> To: Staffa, Nick (NIH/NIEHS) [C]
>> Cc: emboss at lists.open-bio.org; Wright, Douglas (NIH/NIEHS) [C]
>> Subject: Re: [EMBOSS] Jemboss
>> 
>> Hi Nick,
>> 
>> Staffa, Nick (NIH/NIEHS) wrote:
>>> My sysadmin guy installed Jemboss but it doesn't seem to know about
>> dataset
>>> and datafiles (like Rebase) .
>>> Command line emboss does just fine finding stuff like REBASE.
>> 
>> This suggests they are using some different setup. If the database files
>> 
>> were installed in the default directories, and you have only one EMBOSS
>> installation, this is very strange. If there is some other location for
>> the files and EMBOSS_* environment variables are being used to redirect
>> that would explain the behaviour.
>> 
>> What is the message you get from Jemboss?
>> 
>>> The emboss doc at
>> http://emboss.sourceforge.net/docs/adminguide/node69.html
>>> says:
>>>>> Graphical interfaces to EMBOSS
>>> This chapter needs to be written. It will be written when the
>> available GUIs
>>> are stable enough to document.
>>> <<
>>> 
>>> Does this mean that Jemboss is not to be trusted? Is not ready for
>>> prime-time? 
>> 
>> Jemboss is fine. We are updating all our documentation at the moment :-)
>> 
>>> Does anyone know what where and what resource file Jemboss must see so
>> that
>>> it can run programs like remap successfully?
>> 
>> You will get a more detailed reply from the Jemboss experts.
>> 
>> regards,
>> 
>> Peter
>> 
>> _______________________________________________
>> EMBOSS mailing list
>> EMBOSS at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/emboss
> 
> 
> 


From pmr at ebi.ac.uk  Wed Apr 30 07:03:40 2008
From: pmr at ebi.ac.uk (Peter Rice)
Date: Wed, 30 Apr 2008 12:03:40 +0100
Subject: [EMBOSS] emma: problem with filename : please help
In-Reply-To: <20080418051637.GA3914@kunpuu.plessy.org>
References: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0A@HERMES.ircm.priv>	<4805F7C2.5090903@ebi.ac.uk>	<CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0B@HERMES.ircm.priv>
	<20080418051637.GA3914@kunpuu.plessy.org>
Message-ID: <4818520C.5090200@ebi.ac.uk>

Charles Plessy wrote:
> Le Wed, Apr 16, 2008 at 10:40:33AM -0400, Duhaime Johanne a ?crit :
>>  CLUSTAL W 2.0 Multiple Sequence Alignments
>>
>>
>> Error: parameter required for /dnamatrix
> 
> Hello,
> 
> apparently, emma passes an empty '-dnamatrix=' argument that is accepted
> by clustalw 1.83, but not 2.0. I do not know if it is a regression in
> clustalw or a problem of emma.

Ah, many thanks. Clustalw may be happy, but that is a bug. Clustalw 1.83
defaults to the correct matrix but does not complain about the
incomplete commandline qualifier.

With this fixed, emma appears to work well with later versions of
clustalw ... but we would need to check the results and look for any
similar problems that show up only in the 2.0 clustalw release..

In emma.c the wrong characters are tested.

release 5.0.0:
     if(m2c=='b')
	ajStrAssignC(&m2str,"iub");
     else if(m2c=='p')
	ajStrAssignC(&m2str,"clustalw");
     else if(m2c=='g')
	ajStrAssignC(&m2str,"own");

corrected:
     if(m2c=='i')
	ajStrAssignC(&m2str,"iub");
     else if(m2c=='c')
	ajStrAssignC(&m2str,"clustalw");
     else if(m2c=='o')
	ajStrAssignC(&m2str,"own");

regards,

Peter

From staffa at niehs.nih.gov  Wed Apr 30 16:17:30 2008
From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS))
Date: Wed, 30 Apr 2008 16:17:30 -0400
Subject: [EMBOSS] Help/Info in Jemboss
In-Reply-To: <7930EE6CD7CA354D93B444D0433C06110684850A@NIHCESMLBX6.nih.gov>
Message-ID: <C43E4C1A.9536%staffa@niehs.nih.gov>


When on goes to run an EMBOSS program from Jemboss, there is a little dark
blue icon with an ?i?  in it. Clicking on this produces this message:
 

 
A  real web site is
http://emboss.sourceforge.net/apps/release/4.0/emboss/apps/seqret.html
BUT the URL in the window has a tandem duplication of ?apps/?
 
How can this be ameliorated?

The part up thru the first apps is embossURL in jemboss.resources.
Should this be truncated?
 


Nickolas G. Staffa, Jr. Ph.D.
Telephone: 919-316-4569  (NIEHS: 6-4569)
Scientific Computing Support Group
NIEHS Information Technology Support Services Contract
Science Task Monitor: Roy W. Reter ( reter at niehs.nih.gov
<mailto:reter at niehs.nih.gov>  )
National Institute of Environmental Health Sciences
National Institutes of Health
Research Triangle Park, North Carolina
 

-------------- next part --------------
A non-text attachment was scrubbed...
Name: not available
Type: image/jpeg
Size: 10601 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/emboss/attachments/20080430/9c8862c9/attachment.jpe>

From Axel.Kowald at rub.de  Wed Apr  2 12:14:20 2008
From: Axel.Kowald at rub.de (Axel Kowald)
Date: Wed, 02 Apr 2008 14:14:20 +0200
Subject: [EMBOSS] How to start Jemboss-MS.jar in standalone modus ?
Message-ID: <47F3789C.1030005@rub.de>

Hello everybody,

I just downloaded and installed EMBOSS version 5 for Windows on my XP 
SP2 machine and all programs run fine on the command line.
However, I can't figure out how to start the Jemboss GUI. When I start 
the jar it seems to be in client/server mode looking for a server, which 
I don't have. Somewhere I read that the GUI can also be started as a 
standalone application, but it was not explained how :-(

So the question is: How do I start Jemboss as standalone application ?

C:\Programme\EMBOSS\jemboss\jar>java -jar Jemboss-MS.jar
calling the server
Exception in thread "Thread-4" java.lang.NoClassDefFoundError: 
org/apache/axis/client/Service
        at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
        at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
        at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
        at org.emboss.jemboss.soap.ShowDB.<init>(Unknown Source)
        at org.emboss.jemboss.gui.BuildProgramMenu$1$1.construct(Unknown 
Source)
        at org.emboss.jemboss.gui.SwingWorker$2.run(Unknown Source)
        at java.lang.Thread.run(Unknown Source)
Exception in thread "Thread-3" java.lang.NoClassDefFoundError: 
org/apache/axis/client/Service
        at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
        at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
        at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
        at org.emboss.jemboss.soap.GetWossname.<init>(Unknown Source)
        at org.emboss.jemboss.gui.BuildProgramMenu$1.construct(Unknown 
Source)
        at org.emboss.jemboss.gui.SwingWorker$2.run(Unknown Source)
        at java.lang.Thread.run(Unknown Source)

Many thanks,

Axel




From ajb at ebi.ac.uk  Wed Apr  2 13:33:15 2008
From: ajb at ebi.ac.uk (ajb at ebi.ac.uk)
Date: Wed, 2 Apr 2008 14:33:15 +0100 (BST)
Subject: [EMBOSS] How to start Jemboss-MS.jar in standalone modus ?
In-Reply-To: <47F3789C.1030005@rub.de>
References: <47F3789C.1030005@rub.de>
Message-ID: <34594.86.14.232.77.1207143195.squirrel@webmail.ebi.ac.uk>

Hello Axel,

The installation should have produced an icon on your desktop to
launch Jemboss. There should also be an (m)EMBOSS entry in the
start menu for launching Jemboss. If not then uninstalling and
reinstalling might help.

If, on the other hand, the links were accidentally or
intentionally deleted then the shortcut information is:

Target:  PATH-TO-JAVA\bin\javaw.exe Jemboss-MS.jar local
Start in: PATH-TO-mEMBOSS\jemboss\jar

obviously you need to modify the path information above to suit your
installation. It is the 'local' word that tells Jemboss to start
in standalone mode.

HTH

Alan



 Hello everybody,
>
> I just downloaded and installed EMBOSS version 5 for Windows on my XP
> SP2 machine and all programs run fine on the command line.
> However, I can't figure out how to start the Jemboss GUI. When I start
> the jar it seems to be in client/server mode looking for a server, which
> I don't have. Somewhere I read that the GUI can also be started as a
> standalone application, but it was not explained how :-(
>
> So the question is: How do I start Jemboss as standalone application ?
>
> C:\Programme\EMBOSS\jemboss\jar>java -jar Jemboss-MS.jar
> calling the server
> Exception in thread "Thread-4" java.lang.NoClassDefFoundError:
> org/apache/axis/client/Service
>         at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
>         at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
>         at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
>         at org.emboss.jemboss.soap.ShowDB.<init>(Unknown Source)
>         at org.emboss.jemboss.gui.BuildProgramMenu$1$1.construct(Unknown
> Source)
>         at org.emboss.jemboss.gui.SwingWorker$2.run(Unknown Source)
>         at java.lang.Thread.run(Unknown Source)
> Exception in thread "Thread-3" java.lang.NoClassDefFoundError:
> org/apache/axis/client/Service
>         at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
>         at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
>         at org.emboss.jemboss.soap.PublicRequest.<init>(Unknown Source)
>         at org.emboss.jemboss.soap.GetWossname.<init>(Unknown Source)
>         at org.emboss.jemboss.gui.BuildProgramMenu$1.construct(Unknown
> Source)
>         at org.emboss.jemboss.gui.SwingWorker$2.run(Unknown Source)
>         at java.lang.Thread.run(Unknown Source)
>
> Many thanks,
>
> Axel
>
>
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
>




From ajb at ebi.ac.uk  Wed Apr  2 13:43:44 2008
From: ajb at ebi.ac.uk (ajb at ebi.ac.uk)
Date: Wed, 2 Apr 2008 14:43:44 +0100 (BST)
Subject: [EMBOSS] How to start Jemboss-MS.jar in standalone modus ?
In-Reply-To: <34594.86.14.232.77.1207143196.squirrel@webmail.ebi.ac.uk>
References: <47F3789C.1030005@rub.de>
	<34594.86.14.232.77.1207143196.squirrel@webmail.ebi.ac.uk>
Message-ID: <40597.86.14.232.77.1207143824.squirrel@webmail.ebi.ac.uk>


> Target:  PATH-TO-JAVA\bin\javaw.exe Jemboss-MS.jar local
> Start in: PATH-TO-mEMBOSS\jemboss\jar

Of course you need the '-jar' switch in the target too.

Target:  PATH-TO-JAVA\bin\javaw.exe -jar Jemboss-MS.jar local


Alan




From Axel.Kowald at rub.de  Wed Apr  2 13:49:46 2008
From: Axel.Kowald at rub.de (Axel Kowald)
Date: Wed, 02 Apr 2008 15:49:46 +0200
Subject: [EMBOSS] How to start Jemboss-MS.jar in standalone modus ?
In-Reply-To: <34594.86.14.232.77.1207143195.squirrel@webmail.ebi.ac.uk>
References: <47F3789C.1030005@rub.de>
	<34594.86.14.232.77.1207143195.squirrel@webmail.ebi.ac.uk>
Message-ID: <47F38EFA.1000002@rub.de>

Ah, the desktop icon somehow got lost :-(
Now everything is working fine.

Many thanks,
 axel

> If, on the other hand, the links were accidentally or
> intentionally deleted then the shortcut information is:
>
> Target:  PATH-TO-JAVA\bin\javaw.exe Jemboss-MS.jar local
> Start in: PATH-TO-mEMBOSS\jemboss\jar
>
>   



From Axel.Kowald at rub.de  Wed Apr  2 14:14:38 2008
From: Axel.Kowald at rub.de (Axel Kowald)
Date: Wed, 02 Apr 2008 16:14:38 +0200
Subject: [EMBOSS] Adding new programs to Jemboss ?
Message-ID: <47F394CE.2070604@rub.de>

Hi,

I'm just playing around with Jemboss and it is really a neat interface 
to the EMBOSS programs.
I wonder if it is possible to add more programs to the GUI. Maybe by 
playing around with the files in the 'acd' folder?

Any ideas or did I just not find the documentation ?

Axel



From db60 at st-andrews.ac.uk  Thu Apr 10 11:10:11 2008
From: db60 at st-andrews.ac.uk (Daniel Barker)
Date: Thu, 10 Apr 2008 12:10:11 +0100
Subject: [EMBOSS] prophet BLOSUM question
Message-ID: <47FDF593.70204@st-andrews.ac.uk>

Dear EMBOSS users,

I am new to protein profile searches and am using prophecy and prophet 
for a distant similarity search. I'm trying to use BLOSUM45, but prophet 
is reporting BLOSUM62.

I'm generating profiles using prophecy and the BLOSUM45 matrix, thus:

prophecy -auto -warning -type H -datafile EBLOSUM45 -name 
homologene_1825.aln -outfile homologene_1825.prophecy

This seems fine.

I'm using the profiles to search a protein database, thus:

prophet -auto -warning -infile homologene_1825.prophecy -outfile 
prophet_out.txt -sequence 
NC_000909_Methanocaldococcus_jannaschii_DSM_2661_prots.fasta

I am puzzled by this line I get in my prophet output (prophet_out.txt in 
this case):

# Matrix: EBLOSUM62

I can't seem to make it go away. The profile file itself 
(homologene_1825.prophecy) does correctly report BLOSUM45:

Matrix          EBLOSUM45

Is there any way to make prophet also use BLOSUM45? (Does it in fact 
make any difference to prophet?)

Thank you very much for advice.

Best regards,

Daniel

-- 
Daniel Barker
http://bio.st-andrews.ac.uk/staff/db60.htm
The University of St Andrews is a charity registered in Scotland :
No SC013532


From Johanne.Duhaime at ircm.qc.ca  Thu Apr 10 14:27:45 2008
From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne)
Date: Thu, 10 Apr 2008 10:27:45 -0400
Subject: [EMBOSS] emma doest not work for nucleic sequences
Message-ID: <CD4C6F201C8D2A48AC3D804B7A00714B01C6F1C182FB@HERMES.ircm.priv>

Hello

I installed version 5 of Emboss on Solaris 9. I compiled a 64 bits version. When I run emma with a protein file it work fine. But when I use nucleic sequences it does not. Clustawl, by itself, work fine with nucleic sequences.

Emma  (protein)
Multiple alignment program - interface to ClustalW program
Input (gapped) sequence(s): multipleprotein.tfa
output sequence set [hs70_achkl.aln]:
Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]:

 CLUSTAL W 2.0 Multiple Sequence Alignments
Sequence type explicitly set to Protein
Sequence format is Pearson
number of seqs is: 5
(...)

Emma (nucleic)
Multiple alignment program - interface to ClustalW program
Input (gapped) sequence(s): multiplenucleic.tfa
output sequence set [ai632122.aln]:
Dendrogram (tree file) from clustalw output file [ai632122.dnd]:

 CLUSTAL W 2.0 Multiple Sequence Alignments

Error: parameter required for /dnamatrix
Error: Failed to open filename '00025815B'
Problem writing out EMBOSS alignment fileSegmentation fault

I have looked in the last year mail forum but could not see anything related.

Thank you in advance

Johanne
duhaimj at ircm.qc.ca<mailto:duhaimj at ircm.qc.ca>




From golharam at umdnj.edu  Thu Apr 10 16:27:02 2008
From: golharam at umdnj.edu (Ryan Golhar)
Date: Thu, 10 Apr 2008 12:27:02 -0400
Subject: [EMBOSS] EmbossExplorer: running problem (or installation
	problem?)
In-Reply-To: <CD4C6F201C8D2A48AC3D804B7A00714B018ABDC02DC4@HERMES.ircm.priv>
References: <CD4C6F201C8D2A48AC3D804B7A00714B018ABDC02DC4@HERMES.ircm.priv>
Message-ID: <47FE3FD6.7000004@umdnj.edu>

> Here is my first question.
> 
> "index.html" file in my Emboss web directory contains the following:
> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Frameset//EN"
>  "http://www.w3.org/TR/xhtml1/DTD/xhtml1-frameset.dtd">
> <html xmlns='http://www.w3.org/1999/xhtml' xml:lang='en' lang='en'>
>   <head>
>     <title>EMBOSS Explorer</title>
>   </head>
>   <frameset cols="170, *">
>     <frame src="/cgi-bin/emboss/menu" name="menu" />
>     <frame src="/cgi-bin/emboss/intro" name="main" />
>   </frameset>
> </html>
> in my "cgi-bin" I only have "emboss" as a perl program after the installation. How could that work?

The main page (index.html) directs your browser to use two frames.  Both 
frames are generates by the /cgi-bin/emboss script.  The script 
recognizes the URL as either /menu or /intro and displays the pages 
accordingly.  The script uses the ACD files installed by EMBOSS to 
determine what application are available, their groups, etc.

> Of course if I rename emboss by, let's say intro (as in the index.html), it does work. But I have three frames.  What am I missing?

You shouldn't rename the script.  If you do, it can break the whole 
package.  I don't know why you would have three frames. What browser are 
you using?  Here is a proper installation, http://emboss.umdnj.edu

Did the additional frame appear after you renamed the script?

> My second question
> I want to change the default output for "emma". For this I have put "SET emboss_OUTFORMAT clustal"  in my "emboss.default" file. This work perfectly when I use "emma" at the command line. But it has no effect in the EmbossExplorer Interface. Is there a way to correct that?

The web server doesn't see that environment variable hence it never gets 
passed to emma.  You can either set the environment variable in a 
startup script for your web server, or (the more proper way is to) 
modify your emma.acd file to include that output format as an option. 
(Please refer to the appropriate documentation on how to accomplish 
either method)


Ryan


From Johanne.Duhaime at ircm.qc.ca  Thu Apr 10 17:19:24 2008
From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne)
Date: Thu, 10 Apr 2008 13:19:24 -0400
Subject: [EMBOSS] EmbossExplorer: running problem (or installation
 problem?)
In-Reply-To: <47FE3FD6.7000004@umdnj.edu>
References: <CD4C6F201C8D2A48AC3D804B7A00714B018ABDC02DC4@HERMES.ircm.priv>
	<47FE3FD6.7000004@umdnj.edu>
Message-ID: <CD4C6F201C8D2A48AC3D804B7A00714B01C6F1C182FC@HERMES.ircm.priv>

Thank so much for your answers. Regarding the first one, I really appreciate.
As you can see in my email, the index.html was set as in the example you proposed me.
Then saying:
"The main page (index.html) directs your browser to use two frames.  Both
frames are generates by the /cgi-bin/emboss script."
Just wakes me up.
My installation was /cgi-bin/emboss/emboss!!!
So in my index.html I changed:
"/cgi-bin/emboss/menu" for "/cgi-bin/emboss/emboss/menu"

Such a lost of time for such trivial thing...

Thanks again

Johanne
-----Message d'origine-----
De : Ryan Golhar [mailto:golharam at umdnj.edu]
Envoy? : Thursday, 10 April 2008 12:27
? : Duhaime Johanne
Cc : 'emboss at emboss.open-bio.org'
Objet : Re: [EMBOSS] EmbossExplorer: running problem (or installation problem?)

> Here is my first question.
>
> "index.html" file in my Emboss web directory contains the following:
> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Frameset//EN"
>  "http://www.w3.org/TR/xhtml1/DTD/xhtml1-frameset.dtd">
> <html xmlns='http://www.w3.org/1999/xhtml' xml:lang='en' lang='en'>
>   <head>
>     <title>EMBOSS Explorer</title>
>   </head>
>   <frameset cols="170, *">
>     <frame src="/cgi-bin/emboss/menu" name="menu" />
>     <frame src="/cgi-bin/emboss/intro" name="main" />
>   </frameset>
> </html>
> in my "cgi-bin" I only have "emboss" as a perl program after the installation. How could that work?

The main page (index.html) directs your browser to use two frames.  Both
frames are generates by the /cgi-bin/emboss script.  The script
recognizes the URL as either /menu or /intro and displays the pages
accordingly.  The script uses the ACD files installed by EMBOSS to
determine what application are available, their groups, etc.

> Of course if I rename emboss by, let's say intro (as in the index.html), it does work. But I have three frames.  What am I missing?

You shouldn't rename the script.  If you do, it can break the whole
package.  I don't know why you would have three frames. What browser are
you using?  Here is a proper installation, http://emboss.umdnj.edu

Did the additional frame appear after you renamed the script?

> My second question
> I want to change the default output for "emma". For this I have put "SET emboss_OUTFORMAT clustal"  in my "emboss.default" file. This work perfectly when I use "emma" at the command line. But it has no effect in the EmbossExplorer Interface. Is there a way to correct that?

The web server doesn't see that environment variable hence it never gets
passed to emma.  You can either set the environment variable in a
startup script for your web server, or (the more proper way is to)
modify your emma.acd file to include that output format as an option.
(Please refer to the appropriate documentation on how to accomplish
either method)


Ryan



From Johanne.Duhaime at ircm.qc.ca  Wed Apr 16 12:13:29 2008
From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne)
Date: Wed, 16 Apr 2008 08:13:29 -0400
Subject: [EMBOSS] emma: problem with filename : please help
Message-ID: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0A@HERMES.ircm.priv>

Hello

I have a problem with emma and filename. I have seen other users having the same problem but their mail are from 2002. I also looked  at the bug reports but nothing regarding the problem.

In the old mail 2002. It was reported that the problem could be sold by changing the code in emma.c.
( static AjPStr emma_getUniqueFileName(void)
   { /* static char ext[2] = "A"; */  -->  static char ext[6] = "A0000";) this do not work. And I do not C well.

Here is the output of emma.

%emma
Multiple alignment program - interface to ClustalW program
Input (gapped) sequence(s): multipleprotein.tfa
output sequence set [hs70_achkl.aln]:
Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]:

Error: Failed to open filename '00022023B'

Problem writing out EMBOSS alignment fileSegmentation fault

The only file created is:

%ls -l 000*
-rw-rw----   1 duhaimj  si          3648 Apr 15 08:23 00022023A


This is for emboss 5, compiled in 64 bits on Solaris 9.

I  would really appreciate your help.


Johanne Duhaime
duhaimj at ircm.qc.ca<mailto:duhaimj at ircm.qc.ca>




From ajb at ebi.ac.uk  Wed Apr 16 12:44:38 2008
From: ajb at ebi.ac.uk (ajb at ebi.ac.uk)
Date: Wed, 16 Apr 2008 13:44:38 +0100 (BST)
Subject: [EMBOSS] emma: problem with filename : please help
In-Reply-To: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0A@HERMES.ircm.priv>
References: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0A@HERMES.ircm.priv>
Message-ID: <53818.86.14.232.77.1208349878.squirrel@webmail.ebi.ac.uk>

Hi,

The first thing to check is the version of CLUSTALW you are using.
The problem you refer to was a bug in an old version of Clustalw.
The EMBOSS code changes suggested/incorporated by some were not
a fix at all (as you've seen). You need to get Clustalw 1.83

HTH

Alan

 Hello
>
> I have a problem with emma and filename. I have seen other users having
> the same problem but their mail are from 2002. I also looked  at the bug
> reports but nothing regarding the problem.
>
> In the old mail 2002. It was reported that the problem could be sold by
> changing the code in emma.c.
> ( static AjPStr emma_getUniqueFileName(void)
>    { /* static char ext[2] = "A"; */  -->  static char ext[6] = "A0000";)
> this do not work. And I do not C well.
>
> Here is the output of emma.
>
> %emma
> Multiple alignment program - interface to ClustalW program
> Input (gapped) sequence(s): multipleprotein.tfa
> output sequence set [hs70_achkl.aln]:
> Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]:
>
> Error: Failed to open filename '00022023B'
>
> Problem writing out EMBOSS alignment fileSegmentation fault
>
> The only file created is:
>
> %ls -l 000*
> -rw-rw----   1 duhaimj  si          3648 Apr 15 08:23 00022023A
>
>
> This is for emboss 5, compiled in 64 bits on Solaris 9.
>
> I  would really appreciate your help.
>
>
> Johanne Duhaime
> duhaimj at ircm.qc.ca<mailto:duhaimj at ircm.qc.ca>
>
>
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
>




From Johanne.Duhaime at ircm.qc.ca  Wed Apr 16 14:40:33 2008
From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne)
Date: Wed, 16 Apr 2008 10:40:33 -0400
Subject: [EMBOSS] emma: problem with filename : please help
In-Reply-To: <4805F7C2.5090903@ebi.ac.uk>
References: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0A@HERMES.ircm.priv>
	<4805F7C2.5090903@ebi.ac.uk>
Message-ID: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0B@HERMES.ircm.priv>

Thank you to both of you.

You were right: it depends on the clustalw version. I had installed version 2 but version 1 was also in my path. Clustalw 2.0 was the first in the path but there was a permission problem so clustalw 1 was used. Sorry!

Now it works fine for protein alignement. But I still have a problem with a nucleic acid file

mercure{duhaimj}111: emma multiplenucleic.tfa
Multiple alignment program - interface to ClustalW program
output sequence set [ai632122.aln]:
Dendrogram (tree file) from clustalw output file [ai632122.dnd]:



 CLUSTAL W 2.0 Multiple Sequence Alignments


Error: parameter required for /dnamatrix
Error: Failed to open filename '00019719B'
Problem writing out EMBOSS alignment fileSegmentation fault
mercure{duhaimj}112: more multiplenucleic.tfa
>AI632122 Description:  ts85b08.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2238039 3',
TTCATTAATTTGCATTTATTTTCGGGAAGTAATGTAGATAAAGAGGAGGAGGGAGACTGC
CTTACATTTCAACAAGTAATTTGTGATCTTCACATCAGACAAATCAAATTTACAAATTAC
TTTCCCACCTACTGGACGAAGCGGCCAAAGCCAAAATTGATACACAGGCGCGCGGGCTCT
CCGCAGATTTCGGAGAACGAAGGTGCACTAAAAACTCACTAGACAAAACAAGGGTGTTGA
AAGAGAGAAGCCGACAGAGGAGTTGGAACTGGGTTTGGGGCCTGGGTTTGTTTGTTTTTC
CCTAATGCTGTACTTTTACGGATTTTGTTTTGTTTTGT
>AI813505 LOCUS       AI813505      530 bp    mRNA            EST       21-DEC-1999
GCGGCCGCCACCGGGTTCCCACCTAGTCCCGCAGCCGCTGCAGCCGCTGGGTTGGCGGAA
GAGCTGGACGCCGAGCTAGAGGACGAGGCAGAGCTGGACACAGCTGGCGGCGTGAATTGG
CCACTGCTTTCGGAGCCCGAGCTCTCCCGCACTGGAGAGGACTTCTTCTTGGCTGGGCGG
CTCTTGGTTCCGCTCCCGCTCTGCTGCTGCTGGCGGCATTTGTCGCGGCGGTTCTTGAAC
CAGACCTGGACTCTAGACTCCGGCAGGTTGATCTTGAGCGCCACCTCCTCCCGCATGAAG
ATGTCAGGGTAGCGAGTCTTGGCGAAGAGCGCCTCGAGCACGTCCAGCTGTGAACGCGTG
AAGGTGGTGCGCTCCCGCCGCTGCTTCCGCGGAGTGGCCGGATAGCCCACGGATGGGTGC
AGGAGGTCCATGGCGGGCCCGGCCAGGCCCAGCCCGTTCATGCCGTATGGGGGTTGTTTG
AGGTAAGACATCATGCTAACAGCTGGGTGGAGGCGCCCCGACGGATCCAG
>AI813507 LOCUS       AI813505      530 bp    mRNA            EST       21-DEC-1999
GCGGCCGCCACCGGGTTCCCACCTAGTCCCGCAGCCGCTGCAGCCGCTGGGTTGGCGGAA
GAGCTGGACGCCGAGCTAGAGGACGAGGCAGAGCTGGACACAGCTGGCGGCGTGAATTGG
CCACTGCTTTCGGAGCCCGAGCTCTCCCGCACTGGAGAGGACTTCTTCTTGGCTGGGCGG
CTCTTGGTTCCGCTCCCGCTCTGCTGCTGCTGGCGGCATTTGTCGCGGCGGTTCTTGAAC
CAGACCTGGACTCTAGACTCCGGCAGGTTGATCTTGAGCGCCACCTCCTCCCGCATGAAG
ATGTCAGGGTAGCGAGTCTTGGCGAAGAGCGCCTCGAGCACGTCCAGCTGTGAACGCGTG
AAGGTGGTGCGCTCCCGCCGCTGCTTCCGCGGAGTGGCCGGATAGCCCACGGATGGGTGC
AGGAGGTCCATGGCGGGCCCGGCCAGGCCCAGCCCGTTCATGCCGTATGGGGGTTGTTTG
AGGTAAGACATCATGCTAACAGCTGGGTGGAGGCGCCCCGACGGATCCAG

Thank you so much...
Johanne


-----Message d'origine-----
De : Peter Rice [mailto:pmr at ebi.ac.uk]
Envoy? : Wednesday, 16 April 2008 08:58
? : Duhaime Johanne
Cc : emboss-bug at emboss.open-bio.org
Objet : Re: [EMBOSS] emma: problem with filename : please help

Duhaime Johanne wrote:

> In the old mail 2002. It was reported that the problem could be sold by changing the code in emma.c.

That was a different problem with temporary filenames on Linux.

> %emma
> Multiple alignment program - interface to ClustalW program
> Input (gapped) sequence(s): multipleprotein.tfa
> output sequence set [hs70_achkl.aln]:
> Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]:
>
> Error: Failed to open filename '00022023B'

Do you have clustalw installed? Emma needs clustalw installed as it is a
wrapper.

The 00023023A file is the input to clustalw. The missing 00023023B file
is the alignment output by clustalw.

Can you send the input file you used (multipleprotein.tfa), and if
possible the version of clustalw you have installed (running clustalw
from the command line should tell you).

regards,

Peter Rice



From Johanne.Duhaime at ircm.qc.ca  Wed Apr 16 17:28:53 2008
From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne)
Date: Wed, 16 Apr 2008 13:28:53 -0400
Subject: [EMBOSS] emma doest not work for nucleic sequences
In-Reply-To: <480619BA.4040400@ebi.ac.uk>
References: <CD4C6F201C8D2A48AC3D804B7A00714B01C6F1C182FB@HERMES.ircm.priv>
	<480619BA.4040400@ebi.ac.uk>
Message-ID: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0C@HERMES.ircm.priv>

Hello

emma works fine with clustawl 1.83 but not with 1.82 or 2.0. Thank you very much!

Johanne
-----Message d'origine-----
De : Peter Rice [mailto:pmr at ebi.ac.uk]
Envoy? : Wednesday, 16 April 2008 11:23
? : Duhaime Johanne
Cc : emboss-bug at emboss.open-bio.org
Objet : Re: [EMBOSS] emma doest not work for nucleic sequences

Duhaime Johanne wrote:
> Hello
>
> I installed version 5 of Emboss on Solaris 9. I compiled a 64 bits version. When I run emma with a protein file it work fine. But when I use nucleic sequences it does not. Clustawl, by itself, work fine with nucleic sequences.
>
> Emma  (protein)
> Multiple alignment program - interface to ClustalW program
> Input (gapped) sequence(s): multipleprotein.tfa
> output sequence set [hs70_achkl.aln]:
> Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]:
>
>  CLUSTAL W 2.0 Multiple Sequence Alignments
> Sequence type explicitly set to Protein
> Sequence format is Pearson
> number of seqs is: 5
> (...)
>
> Emma (nucleic)
> Multiple alignment program - interface to ClustalW program
> Input (gapped) sequence(s): multiplenucleic.tfa
> output sequence set [ai632122.aln]:
> Dendrogram (tree file) from clustalw output file [ai632122.dnd]:
>
>  CLUSTAL W 2.0 Multiple Sequence Alignments
>
> Error: parameter required for /dnamatrix

Ah, so you are using clustalw 2.0

Emma was designed for clustalw 1.83

Perhaps we need to look at the differences between clustal versions and
provide some extra logic in emma (we will try to avoid running two
different 'emma's)

regards,

Peter



From charles-listes-emboss at plessy.org  Fri Apr 18 05:16:37 2008
From: charles-listes-emboss at plessy.org (Charles Plessy)
Date: Fri, 18 Apr 2008 14:16:37 +0900
Subject: [EMBOSS] emma: problem with filename : please help
In-Reply-To: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0B@HERMES.ircm.priv>
References: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0A@HERMES.ircm.priv>
	<4805F7C2.5090903@ebi.ac.uk>
	<CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0B@HERMES.ircm.priv>
Message-ID: <20080418051637.GA3914@kunpuu.plessy.org>

Le Wed, Apr 16, 2008 at 10:40:33AM -0400, Duhaime Johanne a ?crit :
>
>  CLUSTAL W 2.0 Multiple Sequence Alignments
>
>
> Error: parameter required for /dnamatrix

Hello,

apparently, emma passes an empty '-dnamatrix=' argument that is accepted
by clustalw 1.83, but not 2.0. I do not know if it is a regression in
clustalw or a problem of emma.

Have a nice day,

--
Charles Plessy
Debian-Med packaging team
http://www.debian.org/devel/debian-med/


From Sebastien.Moretti at unil.ch  Wed Apr 23 12:31:19 2008
From: Sebastien.Moretti at unil.ch (Sebastien Moretti)
Date: Wed, 23 Apr 2008 14:31:19 +0200
Subject: [EMBOSS] How to use toggle properly ?
Message-ID: <480F2C17.9010407@unil.ch>

Hi,

I have an option (string symbcons) in my application that must be used
only if another option is chosen (boolean cons).

toggle seems to be the right way to do this but its use is a little bit
confusing for me.


I have followed example from emma application but I cannot do the same 
kind of thing.

How could I do this ?

Thanks


Here is the ACD code:
      string: symbcons [
          knowntype: "string"
          default: "B.*"
          minlength: 3
          maxlength: 3
          comment: "defaults"
          prompt: "Consensus symbols ?"
          information: "Consensus symbols for mismatches(B),
similarity(.) and identical(*) (B means blank & must be used instead of
blank !)"
          comment: 'method -&&=$"$"'
      ]

      boolean: cons [
          default: "false"
          comment: "defaults"
          prompt: "Create consensus line ?"
          information: "Create consensus line"
          comment: "method -&& $symbcons"
      ]

-- 
S?bastien Moretti
SIB, Quartier Sorge - Genopode
CH-1015 Lausanne, Switzerland
Tel.: +41 (21) 692 4056/4221

-------------------------------------------------------------------------
This SF.net email is sponsored by the 2008 JavaOne(SM) Conference
Don't miss this year's exciting event. There's still time to save $100.
Use priority code J8TL2D2.
http://ad.doubleclick.net/clk;198757673;13503038;p?http://java.sun.com/javaone
_______________________________________________
Soaplab-users mailing list
Soaplab-users at lists.sourceforge.net
https://lists.sourceforge.net/lists/listinfo/soaplab-users


From staffa at niehs.nih.gov  Wed Apr 23 14:33:54 2008
From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS))
Date: Wed, 23 Apr 2008 10:33:54 -0400
Subject: [EMBOSS] Jemboss
In-Reply-To: <480F2C17.9010407@unil.ch>
Message-ID: <C434C112.92D3%staffa@niehs.nih.gov>

My sysadmin guy installed Jemboss but it doesn't seem to know about dataset
and datafiles (like Rebase) .
Command line emboss does just fine finding stuff like REBASE.

The emboss doc at http://emboss.sourceforge.net/docs/adminguide/node69.html
says:
>>Graphical interfaces to EMBOSS
This chapter needs to be written. It will be written when the available GUIs
are stable enough to document.
<<

Does this mean that Jemboss is not to be trusted? Is not ready for
prime-time? 

Does anyone know what where and what resource file Jemboss must see so that
it can run programs like remap successfully?


 
Nick Staffa 
Telephone: 919-316-4569  (NIEHS: 6-4569)
Scientific Computing Support Group
NIEHS Information Technology Support Services Contract
(Science Task Monitor: Roy W. Reter (reter at niehs.nih.gov)
National Institute of Environmental Health Sciences
National Institutes of Health
Research Triangle Park, North Carolina








From gbottu at vub.ac.be  Wed Apr 23 16:46:08 2008
From: gbottu at vub.ac.be (Guy Bottu)
Date: Wed, 23 Apr 2008 18:46:08 +0200
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <480F2C17.9010407@unil.ch>
References: <480F2C17.9010407@unil.ch>
Message-ID: <480F67D0.4060002@vub.ac.be>

Sebastien Moretti wrote:
> I have an option (string symbcons) in my application that must be used
> only if another option is chosen (boolean cons).

	Dear Sebastien,

I have some experience with writing EMBOSS programs and I think I can help you. 
   EMBOSS parses the ACD files from top to bottom, so you must write the object 
"boolean: cons" first and "string: symbcons" later. To make sure that the 
program at the command line will only prompt for symbcons when cons is set to y, 
you must include in the objects cons an attribute
standdard: "Y"
and in the object "string: symbcons" an attribute
standard: "$cons"
Or you put additional instead of standard.
Note that in case the user chooses n for cons, symbcons will not be prompted for 
and will be set to its default value. You must hence make sure that the C code 
of the program does something intelligent with that.

Note that the objects of type boolean and toggle are handled the same by EMBOSS. 
The distinction was introduced for the sake of GUI developers. Note also that 
since there exist "expert" parameters that are neither standard or optional. 
They are never prompted at the command line. To allow GUI's to hide them the 
attribute "needed" was invented, but it depends on the GUI whether it is supported.

	Regards,
	Guy Bottu,
	Belgian EMnet Node



From pmr at ebi.ac.uk  Thu Apr 24 07:48:58 2008
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 24 Apr 2008 08:48:58 +0100
Subject: [EMBOSS] Jemboss
In-Reply-To: <C434C112.92D3%staffa@niehs.nih.gov>
References: <C434C112.92D3%staffa@niehs.nih.gov>
Message-ID: <48103B6A.9090303@ebi.ac.uk>

Hi Nick,

Staffa, Nick (NIH/NIEHS) wrote:
> My sysadmin guy installed Jemboss but it doesn't seem to know about dataset
> and datafiles (like Rebase) .
> Command line emboss does just fine finding stuff like REBASE.

This suggests they are using some different setup. If the database files 
were installed in the default directories, and you have only one EMBOSS 
installation, this is very strange. If there is some other location for 
the files and EMBOSS_* environment variables are being used to redirect 
that would explain the behaviour.

What is the message you get from Jemboss?

> The emboss doc at http://emboss.sourceforge.net/docs/adminguide/node69.html
> says:
>>> Graphical interfaces to EMBOSS
> This chapter needs to be written. It will be written when the available GUIs
> are stable enough to document.
> <<
> 
> Does this mean that Jemboss is not to be trusted? Is not ready for
> prime-time? 

Jemboss is fine. We are updating all our documentation at the moment :-)

> Does anyone know what where and what resource file Jemboss must see so that
> it can run programs like remap successfully?

You will get a more detailed reply from the Jemboss experts.

regards,

Peter


From pmr at ebi.ac.uk  Thu Apr 24 07:58:31 2008
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 24 Apr 2008 08:58:31 +0100
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <480F2C17.9010407@unil.ch>
References: <480F2C17.9010407@unil.ch>
Message-ID: <48103DA7.3040800@ebi.ac.uk>

Sebastien Moretti wrote:
> Hi,
> 
> I have an option (string symbcons) in my application that must be used
> only if another option is chosen (boolean cons).

Guy Bottu has already given you a complete answer.

Just one further point - the user can still change the value of symbcons 
by putting -symbcons=value on the commandline so you need to use the 
-cons toggle (or boolean) value to test whether to use the value in your 
program.

> I have followed example from emma application but I cannot do the same 
> kind of thing.

I will take a look at emma ... it was the first complex ACD file we 
wrote (a major, and successful, test that ACD could handle the number of 
options clustalw uses). Some of the options could be cleaned up.

regards,

Peter


From Sebastien.Moretti at unil.ch  Thu Apr 24 12:41:18 2008
From: Sebastien.Moretti at unil.ch (Sebastien Moretti)
Date: Thu, 24 Apr 2008 14:41:18 +0200
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <480F67D0.4060002@vub.ac.be>
References: <480F2C17.9010407@unil.ch> <480F67D0.4060002@vub.ac.be>
Message-ID: <48107FEE.5080300@unil.ch>

>> I have an option (string symbcons) in my application that must be used
>> only if another option is chosen (boolean cons).
> 
>     Dear Sebastien,
> 
> I have some experience with writing EMBOSS programs and I think I can 
> help you.   EMBOSS parses the ACD files from top to bottom, so you must 
> write the object "boolean: cons" first and "string: symbcons" later. To 
> make sure that the program at the command line will only prompt for 
> symbcons when cons is set to y, you must include in the objects cons an 
> attribute
> standdard: "Y"
> and in the object "string: symbcons" an attribute
> standard: "$cons"
> Or you put additional instead of standard.
> Note that in case the user chooses n for cons, symbcons will not be 
> prompted for and will be set to its default value. You must hence make 
> sure that the C code of the program does something intelligent with that.
> 
> Note that the objects of type boolean and toggle are handled the same by 
> EMBOSS. The distinction was introduced for the sake of GUI developers. 
> Note also that since there exist "expert" parameters that are neither 
> standard or optional. They are never prompted at the command line. To 
> allow GUI's to hide them the attribute "needed" was invented, but it 
> depends on the GUI whether it is supported.
> 
>     Regards,
>     Guy Bottu,
>     Belgian EMnet Node

Object order was reversed for tests.
I am close to what I want now.
Thanks

It seems to work better with
	standard: "$(cons)"
instead of
	standard: "$cons"
What is the difference between them ?


I use applications with an ACD syntax through Soaplab2.
This add another level of ACD management.
If symbcons is used with a non-default value, cons is overstepped.

Thanks.

-- 
S?bastien Moretti
SIB, Quartier Sorge - Genopode
CH-1015 Lausanne, Switzerland
Tel.: +41 (21) 692 4056/4221


From Sebastien.Moretti at unil.ch  Thu Apr 24 12:46:38 2008
From: Sebastien.Moretti at unil.ch (Sebastien Moretti)
Date: Thu, 24 Apr 2008 14:46:38 +0200
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <48103DA7.3040800@ebi.ac.uk>
References: <480F2C17.9010407@unil.ch> <48103DA7.3040800@ebi.ac.uk>
Message-ID: <4810812E.3010201@unil.ch>

>> Hi,
>>
>> I have an option (string symbcons) in my application that must be used
>> only if another option is chosen (boolean cons).
> 
> Guy Bottu has already given you a complete answer.
> 
> Just one further point - the user can still change the value of symbcons 
> by putting -symbcons=value on the commandline so you need to use the 
> -cons toggle (or boolean) value to test whether to use the value in your 
> program.

How can I do this ?

>> I have followed example from emma application but I cannot do the same 
>> kind of thing.
> 
> I will take a look at emma ... it was the first complex ACD file we 
> wrote (a major, and successful, test that ACD could handle the number of 
> options clustalw uses). Some of the options could be cleaned up.
> 
> regards,
> 
> Peter

Thanks

-- 
S?bastien Moretti
SIB, Quartier Sorge - Genopode
CH-1015 Lausanne, Switzerland
Tel.: +41 (21) 692 4056/4221


From pmr at ebi.ac.uk  Thu Apr 24 13:59:09 2008
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 24 Apr 2008 14:59:09 +0100
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <48107FEE.5080300@unil.ch>
References: <480F2C17.9010407@unil.ch> <480F67D0.4060002@vub.ac.be>
	<48107FEE.5080300@unil.ch>
Message-ID: <4810922D.2030405@ebi.ac.uk>

Sebastien Moretti wrote:
> It seems to work better with
>     standard: "$(cons)"
> instead of
>     standard: "$cons"
> What is the difference between them ?

$(cons) is the correct syntax.

> I use applications with an ACD syntax through Soaplab2.
> This add another level of ACD management.
> If symbcons is used with a non-default value, cons is overstepped.

The same advice as for the commandline applies - test the value of con 
in your code, because symbcons can still be set by the user.

The cons boolean only stops them being prompted.

regards,

Peter


From Sebastien.Moretti at unil.ch  Thu Apr 24 14:14:01 2008
From: Sebastien.Moretti at unil.ch (Sebastien Moretti)
Date: Thu, 24 Apr 2008 16:14:01 +0200
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <4810922D.2030405@ebi.ac.uk>
References: <480F2C17.9010407@unil.ch> <480F67D0.4060002@vub.ac.be>
	<48107FEE.5080300@unil.ch> <4810922D.2030405@ebi.ac.uk>
Message-ID: <481095A9.8070509@unil.ch>

>> It seems to work better with
>>     standard: "$(cons)"
>> instead of
>>     standard: "$cons"
>> What is the difference between them ?
> 
> $(cons) is the correct syntax.
> 
>> I use applications with an ACD syntax through Soaplab2.
>> This add another level of ACD management.
>> If symbcons is used with a non-default value, cons is overstepped.
> 
> The same advice as for the commandline applies - test the value of con 
> in your code, because symbcons can still be set by the user.

You mean in the program code, or in the ACD code ?

> The cons boolean only stops them being prompted.
> 
> regards,
> 
> Peter


-- 
S?bastien Moretti
SIB, Quartier Sorge - Genopode
CH-1015 Lausanne, Switzerland
Tel.: +41 (21) 692 4056/4221


From pmr at ebi.ac.uk  Thu Apr 24 14:29:30 2008
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 24 Apr 2008 15:29:30 +0100
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <4810812E.3010201@unil.ch>
References: <480F2C17.9010407@unil.ch> <48103DA7.3040800@ebi.ac.uk>
	<4810812E.3010201@unil.ch>
Message-ID: <4810994A.4030900@ebi.ac.uk>

Sebastien Moretti wrote:
>> Just one further point - the user can still change the value of 
>> symbcons by putting -symbcons=value on the commandline so you need to 
>> use the -cons toggle (or boolean) value to test whether to use the 
>> value in your program.
> 
> How can I do this ?

Simply test the value of cons in your application, and ignore the value 
of symbcons if cons if false.

regards,

Peter Rice


From staffa at niehs.nih.gov  Thu Apr 24 15:02:31 2008
From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS) [C])
Date: Thu, 24 Apr 2008 11:02:31 -0400
Subject: [EMBOSS] Jemboss
In-Reply-To: <48103B6A.9090303@ebi.ac.uk>
References: <C434C112.92D3%staffa@niehs.nih.gov> <48103B6A.9090303@ebi.ac.uk>
Message-ID: <7930EE6CD7CA354D93B444D0433C0611068484CB@NIHCESMLBX6.nih.gov>

Right now I am most concerned about restriction analysis. This is what
my most favored customers need. There is no meaningful output when doing
remap from Jemboss, whilst there is good output from command line. 
There is hardly any meaningful error message.

Message from Jemboss:

Input: local GCG file (previously converted from Genbank file.
Program: remap with all defaults.
Result: Saved Results window: 3 tabs:
	Filename.remap  shows only the locus name
	C_RestoredFile.....    shows the original sequence file.
	Cmd shows   
remap -sequence C__RestoredFiles_staffa_Desktop_PC_Sequences_hspgk2g.seq
-enzymes all -sitelen 4 -mincuts 1 -maxcuts 2000000000 -nosingle  -blunt
-sticky  -ambiguity  -noplasmid  -commercial  -table 0 -frame 6 -cutlist
-noflatreformat  -limit  -translation  -reverse  -orfminsize 0
-nothreeletter  -nonumber  -width 60 -length 0 -margin 10 -name
-description  -offset 1 -nohtml  -auto

Entering an outputfilename makes no difference; no local output file was
generated.

Selecting a remote file, even fasta, from the File Manager and clicking
on Load Sequence Attributes gives Error Message Sequence Not Found
Check the sequence entered. [OK].   Whereas double clicking on the entry
gives a nice picture of the sequence in Remote File window. 

Using a fasta remote sequence the Saved Results has two tabs:
	EF015887.remap   has only the name of the sequence
	Cmd		contains the command. 
Running command line remap on the same sequence using all defaults gives
a nice output showing many cuts many places.

Using the File Manager to move the same fasta file to local C drive and
running remap.  Clicking Load Sequence Attributes does not give any
error.
The output Saved Results now has 3 tabs, but no real output.






-----Original Message-----
From: Peter Rice [mailto:pmr at ebi.ac.uk] 
Sent: Thursday, April 24, 2008 3:49 AM
To: Staffa, Nick (NIH/NIEHS) [C]
Cc: emboss at lists.open-bio.org; Wright, Douglas (NIH/NIEHS) [C]
Subject: Re: [EMBOSS] Jemboss

Hi Nick,

Staffa, Nick (NIH/NIEHS) wrote:
> My sysadmin guy installed Jemboss but it doesn't seem to know about
dataset
> and datafiles (like Rebase) .
> Command line emboss does just fine finding stuff like REBASE.

This suggests they are using some different setup. If the database files

were installed in the default directories, and you have only one EMBOSS 
installation, this is very strange. If there is some other location for 
the files and EMBOSS_* environment variables are being used to redirect 
that would explain the behaviour.

What is the message you get from Jemboss?

> The emboss doc at
http://emboss.sourceforge.net/docs/adminguide/node69.html
> says:
>>> Graphical interfaces to EMBOSS
> This chapter needs to be written. It will be written when the
available GUIs
> are stable enough to document.
> <<
> 
> Does this mean that Jemboss is not to be trusted? Is not ready for
> prime-time? 

Jemboss is fine. We are updating all our documentation at the moment :-)

> Does anyone know what where and what resource file Jemboss must see so
that
> it can run programs like remap successfully?

You will get a more detailed reply from the Jemboss experts.

regards,

Peter



From gbottu at vub.ac.be  Thu Apr 24 15:33:53 2008
From: gbottu at vub.ac.be (Guy Bottu)
Date: Thu, 24 Apr 2008 17:33:53 +0200
Subject: [EMBOSS] How to use toggle properly ?
In-Reply-To: <4810994A.4030900@ebi.ac.uk>
References: <480F2C17.9010407@unil.ch>
	<48103DA7.3040800@ebi.ac.uk>	<4810812E.3010201@unil.ch>
	<4810994A.4030900@ebi.ac.uk>
Message-ID: <4810A861.8040002@vub.ac.be>

Peter Rice wrote:
> Sebastien Moretti wrote:
> 
>>> Just one further point - the user can still change the value of 
>>> symbcons by putting -symbcons=value on the commandline so you need to 
>>> use the -cons toggle (or boolean) value to test whether to use the 
>>> value in your program.
>>
>>>> How can I do this ?
> 
> > Simply test the value of cons in your application, and ignore the value 
> of symbcons if cons if false.

As Peter points out, the
standard: "$(cons)"
in the ACD is only for preventing the program to prompt for symbcons when run 
interactively in a text terminal or presenting the symbcons box in a GUI 
(provided that the GUI handles the ACD correctly). But the program can still 
obtain a value for probcons. So, inside the C code of the program we need :

if (ajAcdGetBool("cons") {
   myconsensussymbolstring = ajAcdGetString("symbcons");
   HERE SOME CODE THAT COMPUTES THE CONSENSUS
} else {
   OPTIONALLY SOMETHING TO DO IF YOU DO NOT WANT A CONSENSUS
}

if you use a toggle instead of a boolean it would be ajAcdGetToggle

	Guy Bottu


From tjc at sanger.ac.uk  Thu Apr 24 15:48:26 2008
From: tjc at sanger.ac.uk (Tim Carver)
Date: Thu, 24 Apr 2008 16:48:26 +0100
Subject: [EMBOSS] Jemboss
In-Reply-To: <7930EE6CD7CA354D93B444D0433C0611068484CB@NIHCESMLBX6.nih.gov>
Message-ID: <C4366A5A.75EF7%tjc@sanger.ac.uk>

Hi Nick

I would check 'jemboss.properties' to ensure that embossData is set to the
correct directory. See the description at:

http://emboss.sourceforge.net/Jemboss/install/properties.html

Regards
Tim

On 24/4/08 16:02, "Staffa, Nick (NIH/NIEHS) [C]" <staffa at niehs.nih.gov>
wrote:

> Right now I am most concerned about restriction analysis. This is what
> my most favored customers need. There is no meaningful output when doing
> remap from Jemboss, whilst there is good output from command line.
> There is hardly any meaningful error message.
> 
> Message from Jemboss:
> 
> Input: local GCG file (previously converted from Genbank file.
> Program: remap with all defaults.
> Result: Saved Results window: 3 tabs:
> Filename.remap  shows only the locus name
> C_RestoredFile.....    shows the original sequence file.
> Cmd shows   
> remap -sequence C__RestoredFiles_staffa_Desktop_PC_Sequences_hspgk2g.seq
> -enzymes all -sitelen 4 -mincuts 1 -maxcuts 2000000000 -nosingle  -blunt
> -sticky  -ambiguity  -noplasmid  -commercial  -table 0 -frame 6 -cutlist
> -noflatreformat  -limit  -translation  -reverse  -orfminsize 0
> -nothreeletter  -nonumber  -width 60 -length 0 -margin 10 -name
> -description  -offset 1 -nohtml  -auto
> 
> Entering an outputfilename makes no difference; no local output file was
> generated.
> 
> Selecting a remote file, even fasta, from the File Manager and clicking
> on Load Sequence Attributes gives Error Message Sequence Not Found
> Check the sequence entered. [OK].   Whereas double clicking on the entry
> gives a nice picture of the sequence in Remote File window.
> 
> Using a fasta remote sequence the Saved Results has two tabs:
> EF015887.remap   has only the name of the sequence
> Cmd  contains the command.
> Running command line remap on the same sequence using all defaults gives
> a nice output showing many cuts many places.
> 
> Using the File Manager to move the same fasta file to local C drive and
> running remap.  Clicking Load Sequence Attributes does not give any
> error.
> The output Saved Results now has 3 tabs, but no real output.
> 
> 
> 
> 
> 
> 
> -----Original Message-----
> From: Peter Rice [mailto:pmr at ebi.ac.uk]
> Sent: Thursday, April 24, 2008 3:49 AM
> To: Staffa, Nick (NIH/NIEHS) [C]
> Cc: emboss at lists.open-bio.org; Wright, Douglas (NIH/NIEHS) [C]
> Subject: Re: [EMBOSS] Jemboss
> 
> Hi Nick,
> 
> Staffa, Nick (NIH/NIEHS) wrote:
>> My sysadmin guy installed Jemboss but it doesn't seem to know about
> dataset
>> and datafiles (like Rebase) .
>> Command line emboss does just fine finding stuff like REBASE.
> 
> This suggests they are using some different setup. If the database files
> 
> were installed in the default directories, and you have only one EMBOSS
> installation, this is very strange. If there is some other location for
> the files and EMBOSS_* environment variables are being used to redirect
> that would explain the behaviour.
> 
> What is the message you get from Jemboss?
> 
>> The emboss doc at
> http://emboss.sourceforge.net/docs/adminguide/node69.html
>> says:
>>>> Graphical interfaces to EMBOSS
>> This chapter needs to be written. It will be written when the
> available GUIs
>> are stable enough to document.
>> <<
>> 
>> Does this mean that Jemboss is not to be trusted? Is not ready for
>> prime-time? 
> 
> Jemboss is fine. We are updating all our documentation at the moment :-)
> 
>> Does anyone know what where and what resource file Jemboss must see so
> that
>> it can run programs like remap successfully?
> 
> You will get a more detailed reply from the Jemboss experts.
> 
> regards,
> 
> Peter
> 
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss




-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 


From staffa at niehs.nih.gov  Thu Apr 24 17:59:37 2008
From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS))
Date: Thu, 24 Apr 2008 13:59:37 -0400
Subject: [EMBOSS] Jemboss
In-Reply-To: <C4366A5A.75EF7%tjc@sanger.ac.uk>
Message-ID: <C43642C9.9327%staffa@niehs.nih.gov>

You have hit the nail on the head.
(probably) 
or to quote Jeeves:
"Rem acu tetigisti."


On 4/24/08 11:48 AM, "Tim Carver" <tjc at sanger.ac.uk> wrote:

> Hi Nick
> 
> I would check 'jemboss.properties' to ensure that embossData is set to the
> correct directory. See the description at:
> 
> http://emboss.sourceforge.net/Jemboss/install/properties.html
> 
> Regards
> Tim
> 
> On 24/4/08 16:02, "Staffa, Nick (NIH/NIEHS) [C]" <staffa at niehs.nih.gov>
> wrote:
> 
>> Right now I am most concerned about restriction analysis. This is what
>> my most favored customers need. There is no meaningful output when doing
>> remap from Jemboss, whilst there is good output from command line.
>> There is hardly any meaningful error message.
>> 
>> Message from Jemboss:
>> 
>> Input: local GCG file (previously converted from Genbank file.
>> Program: remap with all defaults.
>> Result: Saved Results window: 3 tabs:
>> Filename.remap  shows only the locus name
>> C_RestoredFile.....    shows the original sequence file.
>> Cmd shows   
>> remap -sequence C__RestoredFiles_staffa_Desktop_PC_Sequences_hspgk2g.seq
>> -enzymes all -sitelen 4 -mincuts 1 -maxcuts 2000000000 -nosingle  -blunt
>> -sticky  -ambiguity  -noplasmid  -commercial  -table 0 -frame 6 -cutlist
>> -noflatreformat  -limit  -translation  -reverse  -orfminsize 0
>> -nothreeletter  -nonumber  -width 60 -length 0 -margin 10 -name
>> -description  -offset 1 -nohtml  -auto
>> 
>> Entering an outputfilename makes no difference; no local output file was
>> generated.
>> 
>> Selecting a remote file, even fasta, from the File Manager and clicking
>> on Load Sequence Attributes gives Error Message Sequence Not Found
>> Check the sequence entered. [OK].   Whereas double clicking on the entry
>> gives a nice picture of the sequence in Remote File window.
>> 
>> Using a fasta remote sequence the Saved Results has two tabs:
>> EF015887.remap   has only the name of the sequence
>> Cmd  contains the command.
>> Running command line remap on the same sequence using all defaults gives
>> a nice output showing many cuts many places.
>> 
>> Using the File Manager to move the same fasta file to local C drive and
>> running remap.  Clicking Load Sequence Attributes does not give any
>> error.
>> The output Saved Results now has 3 tabs, but no real output.
>> 
>> 
>> 
>> 
>> 
>> 
>> -----Original Message-----
>> From: Peter Rice [mailto:pmr at ebi.ac.uk]
>> Sent: Thursday, April 24, 2008 3:49 AM
>> To: Staffa, Nick (NIH/NIEHS) [C]
>> Cc: emboss at lists.open-bio.org; Wright, Douglas (NIH/NIEHS) [C]
>> Subject: Re: [EMBOSS] Jemboss
>> 
>> Hi Nick,
>> 
>> Staffa, Nick (NIH/NIEHS) wrote:
>>> My sysadmin guy installed Jemboss but it doesn't seem to know about
>> dataset
>>> and datafiles (like Rebase) .
>>> Command line emboss does just fine finding stuff like REBASE.
>> 
>> This suggests they are using some different setup. If the database files
>> 
>> were installed in the default directories, and you have only one EMBOSS
>> installation, this is very strange. If there is some other location for
>> the files and EMBOSS_* environment variables are being used to redirect
>> that would explain the behaviour.
>> 
>> What is the message you get from Jemboss?
>> 
>>> The emboss doc at
>> http://emboss.sourceforge.net/docs/adminguide/node69.html
>>> says:
>>>>> Graphical interfaces to EMBOSS
>>> This chapter needs to be written. It will be written when the
>> available GUIs
>>> are stable enough to document.
>>> <<
>>> 
>>> Does this mean that Jemboss is not to be trusted? Is not ready for
>>> prime-time? 
>> 
>> Jemboss is fine. We are updating all our documentation at the moment :-)
>> 
>>> Does anyone know what where and what resource file Jemboss must see so
>> that
>>> it can run programs like remap successfully?
>> 
>> You will get a more detailed reply from the Jemboss experts.
>> 
>> regards,
>> 
>> Peter
>> 
>> _______________________________________________
>> EMBOSS mailing list
>> EMBOSS at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/emboss
> 
> 
> 



From pmr at ebi.ac.uk  Wed Apr 30 11:03:40 2008
From: pmr at ebi.ac.uk (Peter Rice)
Date: Wed, 30 Apr 2008 12:03:40 +0100
Subject: [EMBOSS] emma: problem with filename : please help
In-Reply-To: <20080418051637.GA3914@kunpuu.plessy.org>
References: <CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0A@HERMES.ircm.priv>	<4805F7C2.5090903@ebi.ac.uk>	<CD4C6F201C8D2A48AC3D804B7A00714B01F398D9EA0B@HERMES.ircm.priv>
	<20080418051637.GA3914@kunpuu.plessy.org>
Message-ID: <4818520C.5090200@ebi.ac.uk>

Charles Plessy wrote:
> Le Wed, Apr 16, 2008 at 10:40:33AM -0400, Duhaime Johanne a ?crit :
>>  CLUSTAL W 2.0 Multiple Sequence Alignments
>>
>>
>> Error: parameter required for /dnamatrix
> 
> Hello,
> 
> apparently, emma passes an empty '-dnamatrix=' argument that is accepted
> by clustalw 1.83, but not 2.0. I do not know if it is a regression in
> clustalw or a problem of emma.

Ah, many thanks. Clustalw may be happy, but that is a bug. Clustalw 1.83
defaults to the correct matrix but does not complain about the
incomplete commandline qualifier.

With this fixed, emma appears to work well with later versions of
clustalw ... but we would need to check the results and look for any
similar problems that show up only in the 2.0 clustalw release..

In emma.c the wrong characters are tested.

release 5.0.0:
     if(m2c=='b')
	ajStrAssignC(&m2str,"iub");
     else if(m2c=='p')
	ajStrAssignC(&m2str,"clustalw");
     else if(m2c=='g')
	ajStrAssignC(&m2str,"own");

corrected:
     if(m2c=='i')
	ajStrAssignC(&m2str,"iub");
     else if(m2c=='c')
	ajStrAssignC(&m2str,"clustalw");
     else if(m2c=='o')
	ajStrAssignC(&m2str,"own");

regards,

Peter


From staffa at niehs.nih.gov  Wed Apr 30 20:17:30 2008
From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS))
Date: Wed, 30 Apr 2008 16:17:30 -0400
Subject: [EMBOSS] Help/Info in Jemboss
In-Reply-To: <7930EE6CD7CA354D93B444D0433C06110684850A@NIHCESMLBX6.nih.gov>
Message-ID: <C43E4C1A.9536%staffa@niehs.nih.gov>


When on goes to run an EMBOSS program from Jemboss, there is a little dark
blue icon with an ?i?  in it. Clicking on this produces this message:
 

 
A  real web site is
http://emboss.sourceforge.net/apps/release/4.0/emboss/apps/seqret.html
BUT the URL in the window has a tandem duplication of ?apps/?
 
How can this be ameliorated?

The part up thru the first apps is embossURL in jemboss.resources.
Should this be truncated?
 


Nickolas G. Staffa, Jr. Ph.D.
Telephone: 919-316-4569  (NIEHS: 6-4569)
Scientific Computing Support Group
NIEHS Information Technology Support Services Contract
Science Task Monitor: Roy W. Reter ( reter at niehs.nih.gov
<mailto:reter at niehs.nih.gov>  )
National Institute of Environmental Health Sciences
National Institutes of Health
Research Triangle Park, North Carolina
 

-------------- next part --------------
A non-text attachment was scrubbed...
Name: image.jpg
Type: image/jpeg
Size: 10601 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/emboss/attachments/20080430/9c8862c9/attachment.jpg>