From Axel.Kowald at rub.de Wed Apr 2 08:14:20 2008 From: Axel.Kowald at rub.de (Axel Kowald) Date: Wed, 02 Apr 2008 14:14:20 +0200 Subject: [EMBOSS] How to start Jemboss-MS.jar in standalone modus ? Message-ID: <47F3789C.1030005@rub.de> Hello everybody, I just downloaded and installed EMBOSS version 5 for Windows on my XP SP2 machine and all programs run fine on the command line. However, I can't figure out how to start the Jemboss GUI. When I start the jar it seems to be in client/server mode looking for a server, which I don't have. Somewhere I read that the GUI can also be started as a standalone application, but it was not explained how :-( So the question is: How do I start Jemboss as standalone application ? C:\Programme\EMBOSS\jemboss\jar>java -jar Jemboss-MS.jar calling the server Exception in thread "Thread-4" java.lang.NoClassDefFoundError: org/apache/axis/client/Service at org.emboss.jemboss.soap.PublicRequest.(Unknown Source) at org.emboss.jemboss.soap.PublicRequest.(Unknown Source) at org.emboss.jemboss.soap.PublicRequest.(Unknown Source) at org.emboss.jemboss.soap.ShowDB.(Unknown Source) at org.emboss.jemboss.gui.BuildProgramMenu$1$1.construct(Unknown Source) at org.emboss.jemboss.gui.SwingWorker$2.run(Unknown Source) at java.lang.Thread.run(Unknown Source) Exception in thread "Thread-3" java.lang.NoClassDefFoundError: org/apache/axis/client/Service at org.emboss.jemboss.soap.PublicRequest.(Unknown Source) at org.emboss.jemboss.soap.PublicRequest.(Unknown Source) at org.emboss.jemboss.soap.PublicRequest.(Unknown Source) at org.emboss.jemboss.soap.GetWossname.(Unknown Source) at org.emboss.jemboss.gui.BuildProgramMenu$1.construct(Unknown Source) at org.emboss.jemboss.gui.SwingWorker$2.run(Unknown Source) at java.lang.Thread.run(Unknown Source) Many thanks, Axel From ajb at ebi.ac.uk Wed Apr 2 09:33:15 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Wed, 2 Apr 2008 14:33:15 +0100 (BST) Subject: [EMBOSS] How to start Jemboss-MS.jar in standalone modus ? In-Reply-To: <47F3789C.1030005@rub.de> References: <47F3789C.1030005@rub.de> Message-ID: <34594.86.14.232.77.1207143195.squirrel@webmail.ebi.ac.uk> Hello Axel, The installation should have produced an icon on your desktop to launch Jemboss. There should also be an (m)EMBOSS entry in the start menu for launching Jemboss. If not then uninstalling and reinstalling might help. If, on the other hand, the links were accidentally or intentionally deleted then the shortcut information is: Target: PATH-TO-JAVA\bin\javaw.exe Jemboss-MS.jar local Start in: PATH-TO-mEMBOSS\jemboss\jar obviously you need to modify the path information above to suit your installation. It is the 'local' word that tells Jemboss to start in standalone mode. HTH Alan Hello everybody, > > I just downloaded and installed EMBOSS version 5 for Windows on my XP > SP2 machine and all programs run fine on the command line. > However, I can't figure out how to start the Jemboss GUI. When I start > the jar it seems to be in client/server mode looking for a server, which > I don't have. Somewhere I read that the GUI can also be started as a > standalone application, but it was not explained how :-( > > So the question is: How do I start Jemboss as standalone application ? > > C:\Programme\EMBOSS\jemboss\jar>java -jar Jemboss-MS.jar > calling the server > Exception in thread "Thread-4" java.lang.NoClassDefFoundError: > org/apache/axis/client/Service > at org.emboss.jemboss.soap.PublicRequest.(Unknown Source) > at org.emboss.jemboss.soap.PublicRequest.(Unknown Source) > at org.emboss.jemboss.soap.PublicRequest.(Unknown Source) > at org.emboss.jemboss.soap.ShowDB.(Unknown Source) > at org.emboss.jemboss.gui.BuildProgramMenu$1$1.construct(Unknown > Source) > at org.emboss.jemboss.gui.SwingWorker$2.run(Unknown Source) > at java.lang.Thread.run(Unknown Source) > Exception in thread "Thread-3" java.lang.NoClassDefFoundError: > org/apache/axis/client/Service > at org.emboss.jemboss.soap.PublicRequest.(Unknown Source) > at org.emboss.jemboss.soap.PublicRequest.(Unknown Source) > at org.emboss.jemboss.soap.PublicRequest.(Unknown Source) > at org.emboss.jemboss.soap.GetWossname.(Unknown Source) > at org.emboss.jemboss.gui.BuildProgramMenu$1.construct(Unknown > Source) > at org.emboss.jemboss.gui.SwingWorker$2.run(Unknown Source) > at java.lang.Thread.run(Unknown Source) > > Many thanks, > > Axel > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From ajb at ebi.ac.uk Wed Apr 2 09:43:44 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Wed, 2 Apr 2008 14:43:44 +0100 (BST) Subject: [EMBOSS] How to start Jemboss-MS.jar in standalone modus ? In-Reply-To: <34594.86.14.232.77.1207143196.squirrel@webmail.ebi.ac.uk> References: <47F3789C.1030005@rub.de> <34594.86.14.232.77.1207143196.squirrel@webmail.ebi.ac.uk> Message-ID: <40597.86.14.232.77.1207143824.squirrel@webmail.ebi.ac.uk> > Target: PATH-TO-JAVA\bin\javaw.exe Jemboss-MS.jar local > Start in: PATH-TO-mEMBOSS\jemboss\jar Of course you need the '-jar' switch in the target too. Target: PATH-TO-JAVA\bin\javaw.exe -jar Jemboss-MS.jar local Alan From Axel.Kowald at rub.de Wed Apr 2 09:49:46 2008 From: Axel.Kowald at rub.de (Axel Kowald) Date: Wed, 02 Apr 2008 15:49:46 +0200 Subject: [EMBOSS] How to start Jemboss-MS.jar in standalone modus ? In-Reply-To: <34594.86.14.232.77.1207143195.squirrel@webmail.ebi.ac.uk> References: <47F3789C.1030005@rub.de> <34594.86.14.232.77.1207143195.squirrel@webmail.ebi.ac.uk> Message-ID: <47F38EFA.1000002@rub.de> Ah, the desktop icon somehow got lost :-( Now everything is working fine. Many thanks, axel > If, on the other hand, the links were accidentally or > intentionally deleted then the shortcut information is: > > Target: PATH-TO-JAVA\bin\javaw.exe Jemboss-MS.jar local > Start in: PATH-TO-mEMBOSS\jemboss\jar > > From Axel.Kowald at rub.de Wed Apr 2 10:14:38 2008 From: Axel.Kowald at rub.de (Axel Kowald) Date: Wed, 02 Apr 2008 16:14:38 +0200 Subject: [EMBOSS] Adding new programs to Jemboss ? Message-ID: <47F394CE.2070604@rub.de> Hi, I'm just playing around with Jemboss and it is really a neat interface to the EMBOSS programs. I wonder if it is possible to add more programs to the GUI. Maybe by playing around with the files in the 'acd' folder? Any ideas or did I just not find the documentation ? Axel From db60 at st-andrews.ac.uk Thu Apr 10 07:10:11 2008 From: db60 at st-andrews.ac.uk (Daniel Barker) Date: Thu, 10 Apr 2008 12:10:11 +0100 Subject: [EMBOSS] prophet BLOSUM question Message-ID: <47FDF593.70204@st-andrews.ac.uk> Dear EMBOSS users, I am new to protein profile searches and am using prophecy and prophet for a distant similarity search. I'm trying to use BLOSUM45, but prophet is reporting BLOSUM62. I'm generating profiles using prophecy and the BLOSUM45 matrix, thus: prophecy -auto -warning -type H -datafile EBLOSUM45 -name homologene_1825.aln -outfile homologene_1825.prophecy This seems fine. I'm using the profiles to search a protein database, thus: prophet -auto -warning -infile homologene_1825.prophecy -outfile prophet_out.txt -sequence NC_000909_Methanocaldococcus_jannaschii_DSM_2661_prots.fasta I am puzzled by this line I get in my prophet output (prophet_out.txt in this case): # Matrix: EBLOSUM62 I can't seem to make it go away. The profile file itself (homologene_1825.prophecy) does correctly report BLOSUM45: Matrix EBLOSUM45 Is there any way to make prophet also use BLOSUM45? (Does it in fact make any difference to prophet?) Thank you very much for advice. Best regards, Daniel -- Daniel Barker http://bio.st-andrews.ac.uk/staff/db60.htm The University of St Andrews is a charity registered in Scotland : No SC013532 From Johanne.Duhaime at ircm.qc.ca Thu Apr 10 10:27:45 2008 From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne) Date: Thu, 10 Apr 2008 10:27:45 -0400 Subject: [EMBOSS] emma doest not work for nucleic sequences Message-ID: Hello I installed version 5 of Emboss on Solaris 9. I compiled a 64 bits version. When I run emma with a protein file it work fine. But when I use nucleic sequences it does not. Clustawl, by itself, work fine with nucleic sequences. Emma (protein) Multiple alignment program - interface to ClustalW program Input (gapped) sequence(s): multipleprotein.tfa output sequence set [hs70_achkl.aln]: Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]: CLUSTAL W 2.0 Multiple Sequence Alignments Sequence type explicitly set to Protein Sequence format is Pearson number of seqs is: 5 (...) Emma (nucleic) Multiple alignment program - interface to ClustalW program Input (gapped) sequence(s): multiplenucleic.tfa output sequence set [ai632122.aln]: Dendrogram (tree file) from clustalw output file [ai632122.dnd]: CLUSTAL W 2.0 Multiple Sequence Alignments Error: parameter required for /dnamatrix Error: Failed to open filename '00025815B' Problem writing out EMBOSS alignment fileSegmentation fault I have looked in the last year mail forum but could not see anything related. Thank you in advance Johanne duhaimj at ircm.qc.ca From golharam at umdnj.edu Thu Apr 10 12:27:02 2008 From: golharam at umdnj.edu (Ryan Golhar) Date: Thu, 10 Apr 2008 12:27:02 -0400 Subject: [EMBOSS] EmbossExplorer: running problem (or installation problem?) In-Reply-To: References: Message-ID: <47FE3FD6.7000004@umdnj.edu> > Here is my first question. > > "index.html" file in my Emboss web directory contains the following: > "http://www.w3.org/TR/xhtml1/DTD/xhtml1-frameset.dtd"> > > > EMBOSS Explorer > > > > > > > in my "cgi-bin" I only have "emboss" as a perl program after the installation. How could that work? The main page (index.html) directs your browser to use two frames. Both frames are generates by the /cgi-bin/emboss script. The script recognizes the URL as either /menu or /intro and displays the pages accordingly. The script uses the ACD files installed by EMBOSS to determine what application are available, their groups, etc. > Of course if I rename emboss by, let's say intro (as in the index.html), it does work. But I have three frames. What am I missing? You shouldn't rename the script. If you do, it can break the whole package. I don't know why you would have three frames. What browser are you using? Here is a proper installation, http://emboss.umdnj.edu Did the additional frame appear after you renamed the script? > My second question > I want to change the default output for "emma". For this I have put "SET emboss_OUTFORMAT clustal" in my "emboss.default" file. This work perfectly when I use "emma" at the command line. But it has no effect in the EmbossExplorer Interface. Is there a way to correct that? The web server doesn't see that environment variable hence it never gets passed to emma. You can either set the environment variable in a startup script for your web server, or (the more proper way is to) modify your emma.acd file to include that output format as an option. (Please refer to the appropriate documentation on how to accomplish either method) Ryan From Johanne.Duhaime at ircm.qc.ca Thu Apr 10 13:19:24 2008 From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne) Date: Thu, 10 Apr 2008 13:19:24 -0400 Subject: [EMBOSS] EmbossExplorer: running problem (or installation problem?) In-Reply-To: <47FE3FD6.7000004@umdnj.edu> References: <47FE3FD6.7000004@umdnj.edu> Message-ID: Thank so much for your answers. Regarding the first one, I really appreciate. As you can see in my email, the index.html was set as in the example you proposed me. Then saying: "The main page (index.html) directs your browser to use two frames. Both frames are generates by the /cgi-bin/emboss script." Just wakes me up. My installation was /cgi-bin/emboss/emboss!!! So in my index.html I changed: "/cgi-bin/emboss/menu" for "/cgi-bin/emboss/emboss/menu" Such a lost of time for such trivial thing... Thanks again Johanne -----Message d'origine----- De : Ryan Golhar [mailto:golharam at umdnj.edu] Envoy? : Thursday, 10 April 2008 12:27 ? : Duhaime Johanne Cc : 'emboss at emboss.open-bio.org' Objet : Re: [EMBOSS] EmbossExplorer: running problem (or installation problem?) > Here is my first question. > > "index.html" file in my Emboss web directory contains the following: > "http://www.w3.org/TR/xhtml1/DTD/xhtml1-frameset.dtd"> > > > EMBOSS Explorer > > > > > > > in my "cgi-bin" I only have "emboss" as a perl program after the installation. How could that work? The main page (index.html) directs your browser to use two frames. Both frames are generates by the /cgi-bin/emboss script. The script recognizes the URL as either /menu or /intro and displays the pages accordingly. The script uses the ACD files installed by EMBOSS to determine what application are available, their groups, etc. > Of course if I rename emboss by, let's say intro (as in the index.html), it does work. But I have three frames. What am I missing? You shouldn't rename the script. If you do, it can break the whole package. I don't know why you would have three frames. What browser are you using? Here is a proper installation, http://emboss.umdnj.edu Did the additional frame appear after you renamed the script? > My second question > I want to change the default output for "emma". For this I have put "SET emboss_OUTFORMAT clustal" in my "emboss.default" file. This work perfectly when I use "emma" at the command line. But it has no effect in the EmbossExplorer Interface. Is there a way to correct that? The web server doesn't see that environment variable hence it never gets passed to emma. You can either set the environment variable in a startup script for your web server, or (the more proper way is to) modify your emma.acd file to include that output format as an option. (Please refer to the appropriate documentation on how to accomplish either method) Ryan From Johanne.Duhaime at ircm.qc.ca Wed Apr 16 08:13:29 2008 From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne) Date: Wed, 16 Apr 2008 08:13:29 -0400 Subject: [EMBOSS] emma: problem with filename : please help Message-ID: Hello I have a problem with emma and filename. I have seen other users having the same problem but their mail are from 2002. I also looked at the bug reports but nothing regarding the problem. In the old mail 2002. It was reported that the problem could be sold by changing the code in emma.c. ( static AjPStr emma_getUniqueFileName(void) { /* static char ext[2] = "A"; */ --> static char ext[6] = "A0000";) this do not work. And I do not C well. Here is the output of emma. %emma Multiple alignment program - interface to ClustalW program Input (gapped) sequence(s): multipleprotein.tfa output sequence set [hs70_achkl.aln]: Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]: Error: Failed to open filename '00022023B' Problem writing out EMBOSS alignment fileSegmentation fault The only file created is: %ls -l 000* -rw-rw---- 1 duhaimj si 3648 Apr 15 08:23 00022023A This is for emboss 5, compiled in 64 bits on Solaris 9. I would really appreciate your help. Johanne Duhaime duhaimj at ircm.qc.ca From ajb at ebi.ac.uk Wed Apr 16 08:44:38 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Wed, 16 Apr 2008 13:44:38 +0100 (BST) Subject: [EMBOSS] emma: problem with filename : please help In-Reply-To: References: Message-ID: <53818.86.14.232.77.1208349878.squirrel@webmail.ebi.ac.uk> Hi, The first thing to check is the version of CLUSTALW you are using. The problem you refer to was a bug in an old version of Clustalw. The EMBOSS code changes suggested/incorporated by some were not a fix at all (as you've seen). You need to get Clustalw 1.83 HTH Alan Hello > > I have a problem with emma and filename. I have seen other users having > the same problem but their mail are from 2002. I also looked at the bug > reports but nothing regarding the problem. > > In the old mail 2002. It was reported that the problem could be sold by > changing the code in emma.c. > ( static AjPStr emma_getUniqueFileName(void) > { /* static char ext[2] = "A"; */ --> static char ext[6] = "A0000";) > this do not work. And I do not C well. > > Here is the output of emma. > > %emma > Multiple alignment program - interface to ClustalW program > Input (gapped) sequence(s): multipleprotein.tfa > output sequence set [hs70_achkl.aln]: > Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]: > > Error: Failed to open filename '00022023B' > > Problem writing out EMBOSS alignment fileSegmentation fault > > The only file created is: > > %ls -l 000* > -rw-rw---- 1 duhaimj si 3648 Apr 15 08:23 00022023A > > > This is for emboss 5, compiled in 64 bits on Solaris 9. > > I would really appreciate your help. > > > Johanne Duhaime > duhaimj at ircm.qc.ca > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From Johanne.Duhaime at ircm.qc.ca Wed Apr 16 10:40:33 2008 From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne) Date: Wed, 16 Apr 2008 10:40:33 -0400 Subject: [EMBOSS] emma: problem with filename : please help In-Reply-To: <4805F7C2.5090903@ebi.ac.uk> References: <4805F7C2.5090903@ebi.ac.uk> Message-ID: Thank you to both of you. You were right: it depends on the clustalw version. I had installed version 2 but version 1 was also in my path. Clustalw 2.0 was the first in the path but there was a permission problem so clustalw 1 was used. Sorry! Now it works fine for protein alignement. But I still have a problem with a nucleic acid file mercure{duhaimj}111: emma multiplenucleic.tfa Multiple alignment program - interface to ClustalW program output sequence set [ai632122.aln]: Dendrogram (tree file) from clustalw output file [ai632122.dnd]: CLUSTAL W 2.0 Multiple Sequence Alignments Error: parameter required for /dnamatrix Error: Failed to open filename '00019719B' Problem writing out EMBOSS alignment fileSegmentation fault mercure{duhaimj}112: more multiplenucleic.tfa >AI632122 Description: ts85b08.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2238039 3', TTCATTAATTTGCATTTATTTTCGGGAAGTAATGTAGATAAAGAGGAGGAGGGAGACTGC CTTACATTTCAACAAGTAATTTGTGATCTTCACATCAGACAAATCAAATTTACAAATTAC TTTCCCACCTACTGGACGAAGCGGCCAAAGCCAAAATTGATACACAGGCGCGCGGGCTCT CCGCAGATTTCGGAGAACGAAGGTGCACTAAAAACTCACTAGACAAAACAAGGGTGTTGA AAGAGAGAAGCCGACAGAGGAGTTGGAACTGGGTTTGGGGCCTGGGTTTGTTTGTTTTTC CCTAATGCTGTACTTTTACGGATTTTGTTTTGTTTTGT >AI813505 LOCUS AI813505 530 bp mRNA EST 21-DEC-1999 GCGGCCGCCACCGGGTTCCCACCTAGTCCCGCAGCCGCTGCAGCCGCTGGGTTGGCGGAA GAGCTGGACGCCGAGCTAGAGGACGAGGCAGAGCTGGACACAGCTGGCGGCGTGAATTGG CCACTGCTTTCGGAGCCCGAGCTCTCCCGCACTGGAGAGGACTTCTTCTTGGCTGGGCGG CTCTTGGTTCCGCTCCCGCTCTGCTGCTGCTGGCGGCATTTGTCGCGGCGGTTCTTGAAC CAGACCTGGACTCTAGACTCCGGCAGGTTGATCTTGAGCGCCACCTCCTCCCGCATGAAG ATGTCAGGGTAGCGAGTCTTGGCGAAGAGCGCCTCGAGCACGTCCAGCTGTGAACGCGTG AAGGTGGTGCGCTCCCGCCGCTGCTTCCGCGGAGTGGCCGGATAGCCCACGGATGGGTGC AGGAGGTCCATGGCGGGCCCGGCCAGGCCCAGCCCGTTCATGCCGTATGGGGGTTGTTTG AGGTAAGACATCATGCTAACAGCTGGGTGGAGGCGCCCCGACGGATCCAG >AI813507 LOCUS AI813505 530 bp mRNA EST 21-DEC-1999 GCGGCCGCCACCGGGTTCCCACCTAGTCCCGCAGCCGCTGCAGCCGCTGGGTTGGCGGAA GAGCTGGACGCCGAGCTAGAGGACGAGGCAGAGCTGGACACAGCTGGCGGCGTGAATTGG CCACTGCTTTCGGAGCCCGAGCTCTCCCGCACTGGAGAGGACTTCTTCTTGGCTGGGCGG CTCTTGGTTCCGCTCCCGCTCTGCTGCTGCTGGCGGCATTTGTCGCGGCGGTTCTTGAAC CAGACCTGGACTCTAGACTCCGGCAGGTTGATCTTGAGCGCCACCTCCTCCCGCATGAAG ATGTCAGGGTAGCGAGTCTTGGCGAAGAGCGCCTCGAGCACGTCCAGCTGTGAACGCGTG AAGGTGGTGCGCTCCCGCCGCTGCTTCCGCGGAGTGGCCGGATAGCCCACGGATGGGTGC AGGAGGTCCATGGCGGGCCCGGCCAGGCCCAGCCCGTTCATGCCGTATGGGGGTTGTTTG AGGTAAGACATCATGCTAACAGCTGGGTGGAGGCGCCCCGACGGATCCAG Thank you so much... Johanne -----Message d'origine----- De : Peter Rice [mailto:pmr at ebi.ac.uk] Envoy? : Wednesday, 16 April 2008 08:58 ? : Duhaime Johanne Cc : emboss-bug at emboss.open-bio.org Objet : Re: [EMBOSS] emma: problem with filename : please help Duhaime Johanne wrote: > In the old mail 2002. It was reported that the problem could be sold by changing the code in emma.c. That was a different problem with temporary filenames on Linux. > %emma > Multiple alignment program - interface to ClustalW program > Input (gapped) sequence(s): multipleprotein.tfa > output sequence set [hs70_achkl.aln]: > Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]: > > Error: Failed to open filename '00022023B' Do you have clustalw installed? Emma needs clustalw installed as it is a wrapper. The 00023023A file is the input to clustalw. The missing 00023023B file is the alignment output by clustalw. Can you send the input file you used (multipleprotein.tfa), and if possible the version of clustalw you have installed (running clustalw from the command line should tell you). regards, Peter Rice From Johanne.Duhaime at ircm.qc.ca Wed Apr 16 13:28:53 2008 From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne) Date: Wed, 16 Apr 2008 13:28:53 -0400 Subject: [EMBOSS] emma doest not work for nucleic sequences In-Reply-To: <480619BA.4040400@ebi.ac.uk> References: <480619BA.4040400@ebi.ac.uk> Message-ID: Hello emma works fine with clustawl 1.83 but not with 1.82 or 2.0. Thank you very much! Johanne -----Message d'origine----- De : Peter Rice [mailto:pmr at ebi.ac.uk] Envoy? : Wednesday, 16 April 2008 11:23 ? : Duhaime Johanne Cc : emboss-bug at emboss.open-bio.org Objet : Re: [EMBOSS] emma doest not work for nucleic sequences Duhaime Johanne wrote: > Hello > > I installed version 5 of Emboss on Solaris 9. I compiled a 64 bits version. When I run emma with a protein file it work fine. But when I use nucleic sequences it does not. Clustawl, by itself, work fine with nucleic sequences. > > Emma (protein) > Multiple alignment program - interface to ClustalW program > Input (gapped) sequence(s): multipleprotein.tfa > output sequence set [hs70_achkl.aln]: > Dendrogram (tree file) from clustalw output file [hs70_achkl.dnd]: > > CLUSTAL W 2.0 Multiple Sequence Alignments > Sequence type explicitly set to Protein > Sequence format is Pearson > number of seqs is: 5 > (...) > > Emma (nucleic) > Multiple alignment program - interface to ClustalW program > Input (gapped) sequence(s): multiplenucleic.tfa > output sequence set [ai632122.aln]: > Dendrogram (tree file) from clustalw output file [ai632122.dnd]: > > CLUSTAL W 2.0 Multiple Sequence Alignments > > Error: parameter required for /dnamatrix Ah, so you are using clustalw 2.0 Emma was designed for clustalw 1.83 Perhaps we need to look at the differences between clustal versions and provide some extra logic in emma (we will try to avoid running two different 'emma's) regards, Peter From charles-listes-emboss at plessy.org Fri Apr 18 01:16:37 2008 From: charles-listes-emboss at plessy.org (Charles Plessy) Date: Fri, 18 Apr 2008 14:16:37 +0900 Subject: [EMBOSS] emma: problem with filename : please help In-Reply-To: References: <4805F7C2.5090903@ebi.ac.uk> Message-ID: <20080418051637.GA3914@kunpuu.plessy.org> Le Wed, Apr 16, 2008 at 10:40:33AM -0400, Duhaime Johanne a ?crit : > > CLUSTAL W 2.0 Multiple Sequence Alignments > > > Error: parameter required for /dnamatrix Hello, apparently, emma passes an empty '-dnamatrix=' argument that is accepted by clustalw 1.83, but not 2.0. I do not know if it is a regression in clustalw or a problem of emma. Have a nice day, -- Charles Plessy Debian-Med packaging team http://www.debian.org/devel/debian-med/ From Sebastien.Moretti at unil.ch Wed Apr 23 08:31:19 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Wed, 23 Apr 2008 14:31:19 +0200 Subject: [EMBOSS] How to use toggle properly ? Message-ID: <480F2C17.9010407@unil.ch> Hi, I have an option (string symbcons) in my application that must be used only if another option is chosen (boolean cons). toggle seems to be the right way to do this but its use is a little bit confusing for me. I have followed example from emma application but I cannot do the same kind of thing. How could I do this ? Thanks Here is the ACD code: string: symbcons [ knowntype: "string" default: "B.*" minlength: 3 maxlength: 3 comment: "defaults" prompt: "Consensus symbols ?" information: "Consensus symbols for mismatches(B), similarity(.) and identical(*) (B means blank & must be used instead of blank !)" comment: 'method -&&=$"$"' ] boolean: cons [ default: "false" comment: "defaults" prompt: "Create consensus line ?" information: "Create consensus line" comment: "method -&& $symbcons" ] -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 ------------------------------------------------------------------------- This SF.net email is sponsored by the 2008 JavaOne(SM) Conference Don't miss this year's exciting event. There's still time to save $100. Use priority code J8TL2D2. http://ad.doubleclick.net/clk;198757673;13503038;p?http://java.sun.com/javaone _______________________________________________ Soaplab-users mailing list Soaplab-users at lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/soaplab-users From staffa at niehs.nih.gov Wed Apr 23 10:33:54 2008 From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS)) Date: Wed, 23 Apr 2008 10:33:54 -0400 Subject: [EMBOSS] Jemboss In-Reply-To: <480F2C17.9010407@unil.ch> Message-ID: My sysadmin guy installed Jemboss but it doesn't seem to know about dataset and datafiles (like Rebase) . Command line emboss does just fine finding stuff like REBASE. The emboss doc at http://emboss.sourceforge.net/docs/adminguide/node69.html says: >>Graphical interfaces to EMBOSS This chapter needs to be written. It will be written when the available GUIs are stable enough to document. << Does this mean that Jemboss is not to be trusted? Is not ready for prime-time? Does anyone know what where and what resource file Jemboss must see so that it can run programs like remap successfully? Nick Staffa Telephone: 919-316-4569 (NIEHS: 6-4569) Scientific Computing Support Group NIEHS Information Technology Support Services Contract (Science Task Monitor: Roy W. Reter (reter at niehs.nih.gov) National Institute of Environmental Health Sciences National Institutes of Health Research Triangle Park, North Carolina From gbottu at vub.ac.be Wed Apr 23 12:46:08 2008 From: gbottu at vub.ac.be (Guy Bottu) Date: Wed, 23 Apr 2008 18:46:08 +0200 Subject: [EMBOSS] How to use toggle properly ? In-Reply-To: <480F2C17.9010407@unil.ch> References: <480F2C17.9010407@unil.ch> Message-ID: <480F67D0.4060002@vub.ac.be> Sebastien Moretti wrote: > I have an option (string symbcons) in my application that must be used > only if another option is chosen (boolean cons). Dear Sebastien, I have some experience with writing EMBOSS programs and I think I can help you. EMBOSS parses the ACD files from top to bottom, so you must write the object "boolean: cons" first and "string: symbcons" later. To make sure that the program at the command line will only prompt for symbcons when cons is set to y, you must include in the objects cons an attribute standdard: "Y" and in the object "string: symbcons" an attribute standard: "$cons" Or you put additional instead of standard. Note that in case the user chooses n for cons, symbcons will not be prompted for and will be set to its default value. You must hence make sure that the C code of the program does something intelligent with that. Note that the objects of type boolean and toggle are handled the same by EMBOSS. The distinction was introduced for the sake of GUI developers. Note also that since there exist "expert" parameters that are neither standard or optional. They are never prompted at the command line. To allow GUI's to hide them the attribute "needed" was invented, but it depends on the GUI whether it is supported. Regards, Guy Bottu, Belgian EMnet Node From pmr at ebi.ac.uk Thu Apr 24 03:48:58 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 24 Apr 2008 08:48:58 +0100 Subject: [EMBOSS] Jemboss In-Reply-To: References: Message-ID: <48103B6A.9090303@ebi.ac.uk> Hi Nick, Staffa, Nick (NIH/NIEHS) wrote: > My sysadmin guy installed Jemboss but it doesn't seem to know about dataset > and datafiles (like Rebase) . > Command line emboss does just fine finding stuff like REBASE. This suggests they are using some different setup. If the database files were installed in the default directories, and you have only one EMBOSS installation, this is very strange. If there is some other location for the files and EMBOSS_* environment variables are being used to redirect that would explain the behaviour. What is the message you get from Jemboss? > The emboss doc at http://emboss.sourceforge.net/docs/adminguide/node69.html > says: >>> Graphical interfaces to EMBOSS > This chapter needs to be written. It will be written when the available GUIs > are stable enough to document. > << > > Does this mean that Jemboss is not to be trusted? Is not ready for > prime-time? Jemboss is fine. We are updating all our documentation at the moment :-) > Does anyone know what where and what resource file Jemboss must see so that > it can run programs like remap successfully? You will get a more detailed reply from the Jemboss experts. regards, Peter From pmr at ebi.ac.uk Thu Apr 24 03:58:31 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 24 Apr 2008 08:58:31 +0100 Subject: [EMBOSS] How to use toggle properly ? In-Reply-To: <480F2C17.9010407@unil.ch> References: <480F2C17.9010407@unil.ch> Message-ID: <48103DA7.3040800@ebi.ac.uk> Sebastien Moretti wrote: > Hi, > > I have an option (string symbcons) in my application that must be used > only if another option is chosen (boolean cons). Guy Bottu has already given you a complete answer. Just one further point - the user can still change the value of symbcons by putting -symbcons=value on the commandline so you need to use the -cons toggle (or boolean) value to test whether to use the value in your program. > I have followed example from emma application but I cannot do the same > kind of thing. I will take a look at emma ... it was the first complex ACD file we wrote (a major, and successful, test that ACD could handle the number of options clustalw uses). Some of the options could be cleaned up. regards, Peter From Sebastien.Moretti at unil.ch Thu Apr 24 08:41:18 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Thu, 24 Apr 2008 14:41:18 +0200 Subject: [EMBOSS] How to use toggle properly ? In-Reply-To: <480F67D0.4060002@vub.ac.be> References: <480F2C17.9010407@unil.ch> <480F67D0.4060002@vub.ac.be> Message-ID: <48107FEE.5080300@unil.ch> >> I have an option (string symbcons) in my application that must be used >> only if another option is chosen (boolean cons). > > Dear Sebastien, > > I have some experience with writing EMBOSS programs and I think I can > help you. EMBOSS parses the ACD files from top to bottom, so you must > write the object "boolean: cons" first and "string: symbcons" later. To > make sure that the program at the command line will only prompt for > symbcons when cons is set to y, you must include in the objects cons an > attribute > standdard: "Y" > and in the object "string: symbcons" an attribute > standard: "$cons" > Or you put additional instead of standard. > Note that in case the user chooses n for cons, symbcons will not be > prompted for and will be set to its default value. You must hence make > sure that the C code of the program does something intelligent with that. > > Note that the objects of type boolean and toggle are handled the same by > EMBOSS. The distinction was introduced for the sake of GUI developers. > Note also that since there exist "expert" parameters that are neither > standard or optional. They are never prompted at the command line. To > allow GUI's to hide them the attribute "needed" was invented, but it > depends on the GUI whether it is supported. > > Regards, > Guy Bottu, > Belgian EMnet Node Object order was reversed for tests. I am close to what I want now. Thanks It seems to work better with standard: "$(cons)" instead of standard: "$cons" What is the difference between them ? I use applications with an ACD syntax through Soaplab2. This add another level of ACD management. If symbcons is used with a non-default value, cons is overstepped. Thanks. -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 From Sebastien.Moretti at unil.ch Thu Apr 24 08:46:38 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Thu, 24 Apr 2008 14:46:38 +0200 Subject: [EMBOSS] How to use toggle properly ? In-Reply-To: <48103DA7.3040800@ebi.ac.uk> References: <480F2C17.9010407@unil.ch> <48103DA7.3040800@ebi.ac.uk> Message-ID: <4810812E.3010201@unil.ch> >> Hi, >> >> I have an option (string symbcons) in my application that must be used >> only if another option is chosen (boolean cons). > > Guy Bottu has already given you a complete answer. > > Just one further point - the user can still change the value of symbcons > by putting -symbcons=value on the commandline so you need to use the > -cons toggle (or boolean) value to test whether to use the value in your > program. How can I do this ? >> I have followed example from emma application but I cannot do the same >> kind of thing. > > I will take a look at emma ... it was the first complex ACD file we > wrote (a major, and successful, test that ACD could handle the number of > options clustalw uses). Some of the options could be cleaned up. > > regards, > > Peter Thanks -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 From pmr at ebi.ac.uk Thu Apr 24 09:59:09 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 24 Apr 2008 14:59:09 +0100 Subject: [EMBOSS] How to use toggle properly ? In-Reply-To: <48107FEE.5080300@unil.ch> References: <480F2C17.9010407@unil.ch> <480F67D0.4060002@vub.ac.be> <48107FEE.5080300@unil.ch> Message-ID: <4810922D.2030405@ebi.ac.uk> Sebastien Moretti wrote: > It seems to work better with > standard: "$(cons)" > instead of > standard: "$cons" > What is the difference between them ? $(cons) is the correct syntax. > I use applications with an ACD syntax through Soaplab2. > This add another level of ACD management. > If symbcons is used with a non-default value, cons is overstepped. The same advice as for the commandline applies - test the value of con in your code, because symbcons can still be set by the user. The cons boolean only stops them being prompted. regards, Peter From Sebastien.Moretti at unil.ch Thu Apr 24 10:14:01 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Thu, 24 Apr 2008 16:14:01 +0200 Subject: [EMBOSS] How to use toggle properly ? In-Reply-To: <4810922D.2030405@ebi.ac.uk> References: <480F2C17.9010407@unil.ch> <480F67D0.4060002@vub.ac.be> <48107FEE.5080300@unil.ch> <4810922D.2030405@ebi.ac.uk> Message-ID: <481095A9.8070509@unil.ch> >> It seems to work better with >> standard: "$(cons)" >> instead of >> standard: "$cons" >> What is the difference between them ? > > $(cons) is the correct syntax. > >> I use applications with an ACD syntax through Soaplab2. >> This add another level of ACD management. >> If symbcons is used with a non-default value, cons is overstepped. > > The same advice as for the commandline applies - test the value of con > in your code, because symbcons can still be set by the user. You mean in the program code, or in the ACD code ? > The cons boolean only stops them being prompted. > > regards, > > Peter -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 From pmr at ebi.ac.uk Thu Apr 24 10:29:30 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 24 Apr 2008 15:29:30 +0100 Subject: [EMBOSS] How to use toggle properly ? In-Reply-To: <4810812E.3010201@unil.ch> References: <480F2C17.9010407@unil.ch> <48103DA7.3040800@ebi.ac.uk> <4810812E.3010201@unil.ch> Message-ID: <4810994A.4030900@ebi.ac.uk> Sebastien Moretti wrote: >> Just one further point - the user can still change the value of >> symbcons by putting -symbcons=value on the commandline so you need to >> use the -cons toggle (or boolean) value to test whether to use the >> value in your program. > > How can I do this ? Simply test the value of cons in your application, and ignore the value of symbcons if cons if false. regards, Peter Rice From staffa at niehs.nih.gov Thu Apr 24 11:02:31 2008 From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS) [C]) Date: Thu, 24 Apr 2008 11:02:31 -0400 Subject: [EMBOSS] Jemboss In-Reply-To: <48103B6A.9090303@ebi.ac.uk> References: <48103B6A.9090303@ebi.ac.uk> Message-ID: <7930EE6CD7CA354D93B444D0433C0611068484CB@NIHCESMLBX6.nih.gov> Right now I am most concerned about restriction analysis. This is what my most favored customers need. There is no meaningful output when doing remap from Jemboss, whilst there is good output from command line. There is hardly any meaningful error message. Message from Jemboss: Input: local GCG file (previously converted from Genbank file. Program: remap with all defaults. Result: Saved Results window: 3 tabs: Filename.remap shows only the locus name C_RestoredFile..... shows the original sequence file. Cmd shows remap -sequence C__RestoredFiles_staffa_Desktop_PC_Sequences_hspgk2g.seq -enzymes all -sitelen 4 -mincuts 1 -maxcuts 2000000000 -nosingle -blunt -sticky -ambiguity -noplasmid -commercial -table 0 -frame 6 -cutlist -noflatreformat -limit -translation -reverse -orfminsize 0 -nothreeletter -nonumber -width 60 -length 0 -margin 10 -name -description -offset 1 -nohtml -auto Entering an outputfilename makes no difference; no local output file was generated. Selecting a remote file, even fasta, from the File Manager and clicking on Load Sequence Attributes gives Error Message Sequence Not Found Check the sequence entered. [OK]. Whereas double clicking on the entry gives a nice picture of the sequence in Remote File window. Using a fasta remote sequence the Saved Results has two tabs: EF015887.remap has only the name of the sequence Cmd contains the command. Running command line remap on the same sequence using all defaults gives a nice output showing many cuts many places. Using the File Manager to move the same fasta file to local C drive and running remap. Clicking Load Sequence Attributes does not give any error. The output Saved Results now has 3 tabs, but no real output. -----Original Message----- From: Peter Rice [mailto:pmr at ebi.ac.uk] Sent: Thursday, April 24, 2008 3:49 AM To: Staffa, Nick (NIH/NIEHS) [C] Cc: emboss at lists.open-bio.org; Wright, Douglas (NIH/NIEHS) [C] Subject: Re: [EMBOSS] Jemboss Hi Nick, Staffa, Nick (NIH/NIEHS) wrote: > My sysadmin guy installed Jemboss but it doesn't seem to know about dataset > and datafiles (like Rebase) . > Command line emboss does just fine finding stuff like REBASE. This suggests they are using some different setup. If the database files were installed in the default directories, and you have only one EMBOSS installation, this is very strange. If there is some other location for the files and EMBOSS_* environment variables are being used to redirect that would explain the behaviour. What is the message you get from Jemboss? > The emboss doc at http://emboss.sourceforge.net/docs/adminguide/node69.html > says: >>> Graphical interfaces to EMBOSS > This chapter needs to be written. It will be written when the available GUIs > are stable enough to document. > << > > Does this mean that Jemboss is not to be trusted? Is not ready for > prime-time? Jemboss is fine. We are updating all our documentation at the moment :-) > Does anyone know what where and what resource file Jemboss must see so that > it can run programs like remap successfully? You will get a more detailed reply from the Jemboss experts. regards, Peter From gbottu at vub.ac.be Thu Apr 24 11:33:53 2008 From: gbottu at vub.ac.be (Guy Bottu) Date: Thu, 24 Apr 2008 17:33:53 +0200 Subject: [EMBOSS] How to use toggle properly ? In-Reply-To: <4810994A.4030900@ebi.ac.uk> References: <480F2C17.9010407@unil.ch> <48103DA7.3040800@ebi.ac.uk> <4810812E.3010201@unil.ch> <4810994A.4030900@ebi.ac.uk> Message-ID: <4810A861.8040002@vub.ac.be> Peter Rice wrote: > Sebastien Moretti wrote: > >>> Just one further point - the user can still change the value of >>> symbcons by putting -symbcons=value on the commandline so you need to >>> use the -cons toggle (or boolean) value to test whether to use the >>> value in your program. >> >>>> How can I do this ? > > > Simply test the value of cons in your application, and ignore the value > of symbcons if cons if false. As Peter points out, the standard: "$(cons)" in the ACD is only for preventing the program to prompt for symbcons when run interactively in a text terminal or presenting the symbcons box in a GUI (provided that the GUI handles the ACD correctly). But the program can still obtain a value for probcons. So, inside the C code of the program we need : if (ajAcdGetBool("cons") { myconsensussymbolstring = ajAcdGetString("symbcons"); HERE SOME CODE THAT COMPUTES THE CONSENSUS } else { OPTIONALLY SOMETHING TO DO IF YOU DO NOT WANT A CONSENSUS } if you use a toggle instead of a boolean it would be ajAcdGetToggle Guy Bottu From tjc at sanger.ac.uk Thu Apr 24 11:48:26 2008 From: tjc at sanger.ac.uk (Tim Carver) Date: Thu, 24 Apr 2008 16:48:26 +0100 Subject: [EMBOSS] Jemboss In-Reply-To: <7930EE6CD7CA354D93B444D0433C0611068484CB@NIHCESMLBX6.nih.gov> Message-ID: Hi Nick I would check 'jemboss.properties' to ensure that embossData is set to the correct directory. See the description at: http://emboss.sourceforge.net/Jemboss/install/properties.html Regards Tim On 24/4/08 16:02, "Staffa, Nick (NIH/NIEHS) [C]" wrote: > Right now I am most concerned about restriction analysis. This is what > my most favored customers need. There is no meaningful output when doing > remap from Jemboss, whilst there is good output from command line. > There is hardly any meaningful error message. > > Message from Jemboss: > > Input: local GCG file (previously converted from Genbank file. > Program: remap with all defaults. > Result: Saved Results window: 3 tabs: > Filename.remap shows only the locus name > C_RestoredFile..... shows the original sequence file. > Cmd shows > remap -sequence C__RestoredFiles_staffa_Desktop_PC_Sequences_hspgk2g.seq > -enzymes all -sitelen 4 -mincuts 1 -maxcuts 2000000000 -nosingle -blunt > -sticky -ambiguity -noplasmid -commercial -table 0 -frame 6 -cutlist > -noflatreformat -limit -translation -reverse -orfminsize 0 > -nothreeletter -nonumber -width 60 -length 0 -margin 10 -name > -description -offset 1 -nohtml -auto > > Entering an outputfilename makes no difference; no local output file was > generated. > > Selecting a remote file, even fasta, from the File Manager and clicking > on Load Sequence Attributes gives Error Message Sequence Not Found > Check the sequence entered. [OK]. Whereas double clicking on the entry > gives a nice picture of the sequence in Remote File window. > > Using a fasta remote sequence the Saved Results has two tabs: > EF015887.remap has only the name of the sequence > Cmd contains the command. > Running command line remap on the same sequence using all defaults gives > a nice output showing many cuts many places. > > Using the File Manager to move the same fasta file to local C drive and > running remap. Clicking Load Sequence Attributes does not give any > error. > The output Saved Results now has 3 tabs, but no real output. > > > > > > > -----Original Message----- > From: Peter Rice [mailto:pmr at ebi.ac.uk] > Sent: Thursday, April 24, 2008 3:49 AM > To: Staffa, Nick (NIH/NIEHS) [C] > Cc: emboss at lists.open-bio.org; Wright, Douglas (NIH/NIEHS) [C] > Subject: Re: [EMBOSS] Jemboss > > Hi Nick, > > Staffa, Nick (NIH/NIEHS) wrote: >> My sysadmin guy installed Jemboss but it doesn't seem to know about > dataset >> and datafiles (like Rebase) . >> Command line emboss does just fine finding stuff like REBASE. > > This suggests they are using some different setup. If the database files > > were installed in the default directories, and you have only one EMBOSS > installation, this is very strange. If there is some other location for > the files and EMBOSS_* environment variables are being used to redirect > that would explain the behaviour. > > What is the message you get from Jemboss? > >> The emboss doc at > http://emboss.sourceforge.net/docs/adminguide/node69.html >> says: >>>> Graphical interfaces to EMBOSS >> This chapter needs to be written. It will be written when the > available GUIs >> are stable enough to document. >> << >> >> Does this mean that Jemboss is not to be trusted? Is not ready for >> prime-time? > > Jemboss is fine. We are updating all our documentation at the moment :-) > >> Does anyone know what where and what resource file Jemboss must see so > that >> it can run programs like remap successfully? > > You will get a more detailed reply from the Jemboss experts. > > regards, > > Peter > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. From staffa at niehs.nih.gov Thu Apr 24 13:59:37 2008 From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS)) Date: Thu, 24 Apr 2008 13:59:37 -0400 Subject: [EMBOSS] Jemboss In-Reply-To: Message-ID: You have hit the nail on the head. (probably) or to quote Jeeves: "Rem acu tetigisti." On 4/24/08 11:48 AM, "Tim Carver" wrote: > Hi Nick > > I would check 'jemboss.properties' to ensure that embossData is set to the > correct directory. See the description at: > > http://emboss.sourceforge.net/Jemboss/install/properties.html > > Regards > Tim > > On 24/4/08 16:02, "Staffa, Nick (NIH/NIEHS) [C]" > wrote: > >> Right now I am most concerned about restriction analysis. This is what >> my most favored customers need. There is no meaningful output when doing >> remap from Jemboss, whilst there is good output from command line. >> There is hardly any meaningful error message. >> >> Message from Jemboss: >> >> Input: local GCG file (previously converted from Genbank file. >> Program: remap with all defaults. >> Result: Saved Results window: 3 tabs: >> Filename.remap shows only the locus name >> C_RestoredFile..... shows the original sequence file. >> Cmd shows >> remap -sequence C__RestoredFiles_staffa_Desktop_PC_Sequences_hspgk2g.seq >> -enzymes all -sitelen 4 -mincuts 1 -maxcuts 2000000000 -nosingle -blunt >> -sticky -ambiguity -noplasmid -commercial -table 0 -frame 6 -cutlist >> -noflatreformat -limit -translation -reverse -orfminsize 0 >> -nothreeletter -nonumber -width 60 -length 0 -margin 10 -name >> -description -offset 1 -nohtml -auto >> >> Entering an outputfilename makes no difference; no local output file was >> generated. >> >> Selecting a remote file, even fasta, from the File Manager and clicking >> on Load Sequence Attributes gives Error Message Sequence Not Found >> Check the sequence entered. [OK]. Whereas double clicking on the entry >> gives a nice picture of the sequence in Remote File window. >> >> Using a fasta remote sequence the Saved Results has two tabs: >> EF015887.remap has only the name of the sequence >> Cmd contains the command. >> Running command line remap on the same sequence using all defaults gives >> a nice output showing many cuts many places. >> >> Using the File Manager to move the same fasta file to local C drive and >> running remap. Clicking Load Sequence Attributes does not give any >> error. >> The output Saved Results now has 3 tabs, but no real output. >> >> >> >> >> >> >> -----Original Message----- >> From: Peter Rice [mailto:pmr at ebi.ac.uk] >> Sent: Thursday, April 24, 2008 3:49 AM >> To: Staffa, Nick (NIH/NIEHS) [C] >> Cc: emboss at lists.open-bio.org; Wright, Douglas (NIH/NIEHS) [C] >> Subject: Re: [EMBOSS] Jemboss >> >> Hi Nick, >> >> Staffa, Nick (NIH/NIEHS) wrote: >>> My sysadmin guy installed Jemboss but it doesn't seem to know about >> dataset >>> and datafiles (like Rebase) . >>> Command line emboss does just fine finding stuff like REBASE. >> >> This suggests they are using some different setup. If the database files >> >> were installed in the default directories, and you have only one EMBOSS >> installation, this is very strange. If there is some other location for >> the files and EMBOSS_* environment variables are being used to redirect >> that would explain the behaviour. >> >> What is the message you get from Jemboss? >> >>> The emboss doc at >> http://emboss.sourceforge.net/docs/adminguide/node69.html >>> says: >>>>> Graphical interfaces to EMBOSS >>> This chapter needs to be written. It will be written when the >> available GUIs >>> are stable enough to document. >>> << >>> >>> Does this mean that Jemboss is not to be trusted? Is not ready for >>> prime-time? >> >> Jemboss is fine. We are updating all our documentation at the moment :-) >> >>> Does anyone know what where and what resource file Jemboss must see so >> that >>> it can run programs like remap successfully? >> >> You will get a more detailed reply from the Jemboss experts. >> >> regards, >> >> Peter >> >> _______________________________________________ >> EMBOSS mailing list >> EMBOSS at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/emboss > > > From pmr at ebi.ac.uk Wed Apr 30 07:03:40 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 30 Apr 2008 12:03:40 +0100 Subject: [EMBOSS] emma: problem with filename : please help In-Reply-To: <20080418051637.GA3914@kunpuu.plessy.org> References: <4805F7C2.5090903@ebi.ac.uk> <20080418051637.GA3914@kunpuu.plessy.org> Message-ID: <4818520C.5090200@ebi.ac.uk> Charles Plessy wrote: > Le Wed, Apr 16, 2008 at 10:40:33AM -0400, Duhaime Johanne a ?crit : >> CLUSTAL W 2.0 Multiple Sequence Alignments >> >> >> Error: parameter required for /dnamatrix > > Hello, > > apparently, emma passes an empty '-dnamatrix=' argument that is accepted > by clustalw 1.83, but not 2.0. I do not know if it is a regression in > clustalw or a problem of emma. Ah, many thanks. Clustalw may be happy, but that is a bug. Clustalw 1.83 defaults to the correct matrix but does not complain about the incomplete commandline qualifier. With this fixed, emma appears to work well with later versions of clustalw ... but we would need to check the results and look for any similar problems that show up only in the 2.0 clustalw release.. In emma.c the wrong characters are tested. release 5.0.0: if(m2c=='b') ajStrAssignC(&m2str,"iub"); else if(m2c=='p') ajStrAssignC(&m2str,"clustalw"); else if(m2c=='g') ajStrAssignC(&m2str,"own"); corrected: if(m2c=='i') ajStrAssignC(&m2str,"iub"); else if(m2c=='c') ajStrAssignC(&m2str,"clustalw"); else if(m2c=='o') ajStrAssignC(&m2str,"own"); regards, Peter From staffa at niehs.nih.gov Wed Apr 30 16:17:30 2008 From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS)) Date: Wed, 30 Apr 2008 16:17:30 -0400 Subject: [EMBOSS] Help/Info in Jemboss In-Reply-To: <7930EE6CD7CA354D93B444D0433C06110684850A@NIHCESMLBX6.nih.gov> Message-ID: When on goes to run an EMBOSS program from Jemboss, there is a little dark blue icon with an ?i? in it. Clicking on this produces this message: A real web site is http://emboss.sourceforge.net/apps/release/4.0/emboss/apps/seqret.html BUT the URL in the window has a tandem duplication of ?apps/? How can this be ameliorated? The part up thru the first apps is embossURL in jemboss.resources. Should this be truncated? Nickolas G. Staffa, Jr. Ph.D. Telephone: 919-316-4569 (NIEHS: 6-4569) Scientific Computing Support Group NIEHS Information Technology Support Services Contract Science Task Monitor: Roy W. Reter ( reter at niehs.nih.gov ) National Institute of Environmental Health Sciences National Institutes of Health Research Triangle Park, North Carolina -------------- next part -------------- A non-text attachment was scrubbed... Name: not available Type: image/jpeg Size: 10601 bytes Desc: not available URL: