From xinhong at indiana.edu Tue May 1 13:27:33 2007 From: xinhong at indiana.edu (Hong, Xin) Date: Tue, 1 May 2007 13:27:33 -0400 Subject: [EMBOSS] A question about configure of pnddriver Message-ID: <89F32E6A19D3B34283EA3C105E33F11DC1D332@iu-mssg-mbx105.ads.iu.edu> Hello there, I am responsible to install the EMBOSS-4.1.0 on our supurcomputers in Indiana University, I am not the administrator. I email them to ask for where the png, z and gd librarys are installed on and found out there are on the same directory. For the instruction file online, it states that "add the new directory to your confiture line for EMBOSS --with-pngdriver=my_dir where the z,png, and gd libraries where eachinstalled using --prefix=my_dir". I would like to know do they have to be together in my_dir, or I can state seperately, for instance ./configure --prefix=/miscapps/EMBOSS --with-pngdriver=my_d1 --with-pngdriver=my_d2 --with-pngdriver=my_d3 My second question is about Web interface of EMBOSS. As the policy of using supurcomputer, I have to put the web interface and database on another two seperate supurcomputers. I would like to know are there anyone sampled the difference of the webinterface and know which one is better. Or I would appreciate any suggestion for what I should pay attention to in this situation. Thanks a lots. Xin From golharam at umdnj.edu Thu May 3 07:05:42 2007 From: golharam at umdnj.edu (Ryan Golhar) Date: Thu, 03 May 2007 07:05:42 -0400 Subject: [EMBOSS] A question about configure of pnddriver In-Reply-To: <89F32E6A19D3B34283EA3C105E33F11DC1D332@iu-mssg-mbx105.ads.iu.edu> Message-ID: <002301c78d72$fe216ca0$f6028a0a@PICO> Xin, We have a similar setup here at UMDNJ. We prefer using EMBOSS-Explorer - it's a very clean easy-to-use interface requiring the minimum of resources and administrative overhead. As for the graphics libraries, if they are in different directories, I *think* you can specify them using "--with-pngdriver=my_d1 --with-pngdriver=my_d2 etc" or try "--with-pngdriver=my_d1;my_d2" Ryan -----Original Message----- From: emboss-bounces at lists.open-bio.org [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of Hong, Xin Sent: Tuesday, May 01, 2007 1:28 PM To: emboss at lists.open-bio.org Subject: [EMBOSS] A question about configure of pnddriver Hello there, I am responsible to install the EMBOSS-4.1.0 on our supurcomputers in Indiana University, I am not the administrator. I email them to ask for where the png, z and gd librarys are installed on and found out there are on the same directory. For the instruction file online, it states that "add the new directory to your confiture line for EMBOSS --with-pngdriver=my_dir where the z,png, and gd libraries where eachinstalled using --prefix=my_dir". I would like to know do they have to be together in my_dir, or I can state seperately, for instance ./configure --prefix=/miscapps/EMBOSS --with-pngdriver=my_d1 --with-pngdriver=my_d2 --with-pngdriver=my_d3 My second question is about Web interface of EMBOSS. As the policy of using supurcomputer, I have to put the web interface and database on another two seperate supurcomputers. I would like to know are there anyone sampled the difference of the webinterface and know which one is better. Or I would appreciate any suggestion for what I should pay attention to in this situation. Thanks a lots. Xin _______________________________________________ EMBOSS mailing list EMBOSS at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/emboss From ajb at ebi.ac.uk Thu May 3 08:46:18 2007 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 3 May 2007 13:46:18 +0100 (BST) Subject: [EMBOSS] A question about configure of pnddriver In-Reply-To: <002301c78d72$fe216ca0$f6028a0a@PICO> References: <89F32E6A19D3B34283EA3C105E33F11DC1D332@iu-mssg-mbx105.ads.iu.edu> <002301c78d72$fe216ca0$f6028a0a@PICO> Message-ID: <54963.81.98.241.17.1178196378.squirrel@webmail.ebi.ac.uk> Dear Xin, The configuration is only meant for one use of --with-pngdriver and only one location should be specified. If zlib, gd and libpng are all in standard system locations (e.g. under /usr/include & /usr/lib) then you don't need to specify --with-pngdriver at all. Any of those packages which are not in standard locations must then be installed under the same directory tree and --with-pngdriver used to point to that location. For example, if zlib and libpng are under /usr but gd is under /sw/packages then you can specify --with-pngdriver=/sw/packages and that should be fine. HTH Alan > -----Original Message----- > From: emboss-bounces at lists.open-bio.org > [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of Hong, Xin > Sent: Tuesday, May 01, 2007 1:28 PM > To: emboss at lists.open-bio.org > Subject: [EMBOSS] A question about configure of pnddriver > > > Hello there, > > I am responsible to install the EMBOSS-4.1.0 on our supurcomputers in > Indiana University, I am not the administrator. I email them to ask for > where the png, z and gd librarys are installed on and found out there are > on > the same directory. For the instruction file online, it states that "add > the > new directory to your confiture line for EMBOSS --with-pngdriver=my_dir > where the z,png, and gd libraries where eachinstalled using > --prefix=my_dir". > > I would like to know do they have to be together in my_dir, or I can state > seperately, for instance > > ./configure --prefix=/miscapps/EMBOSS --with-pngdriver=my_d1 > --with-pngdriver=my_d2 --with-pngdriver=my_d3 > > My second question is about Web interface of EMBOSS. As the policy of > using > supurcomputer, I have to put the web interface and database on another two > seperate supurcomputers. I would like to know are there anyone sampled the > difference of the webinterface and know which one is better. Or I would > appreciate any suggestion for what I should pay attention to in this > situation. > > Thanks a lots. > > Xin > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From xinhong at indiana.edu Thu May 3 12:20:18 2007 From: xinhong at indiana.edu (Hong, Xin) Date: Thu, 3 May 2007 12:20:18 -0400 Subject: [EMBOSS] A question about configure of pnddriver References: <89F32E6A19D3B34283EA3C105E33F11DC1D332@iu-mssg-mbx105.ads.iu.edu><002301c78d72$fe216ca0$f6028a0a@PICO> <54963.81.98.241.17.1178196378.squirrel@webmail.ebi.ac.uk> Message-ID: <89F32E6A19D3B34283EA3C105E33F11DC1D338@iu-mssg-mbx105.ads.iu.edu> Dear Alan, Thank you for the suggestions I get. I ask the administrator to install the updated version of z, png and gd in /usr/local/lib . The old version is still in /usr/local/lib for other use. However, I still could not get configure go through by ./configure --prefix=/miscapps/EMBOSS-4.1.0 --with-pngdriver=/usr/local/lib 2>&1 | tee configureembossmiscapps The following msg still show need to upgrade gd. I belive we use gd-2.0.4, the lastest one. checking if png driver is wanted... yes checking for inflateEnd in -lz... yes checking for png_destroy_read_struct in -lpng... yes checking for gdImageCreateFromPng in -lgd... no need to upgrade gd for png driver for plplot No png driver will be made due to librarys missing/old. checking if any authorisation type is given... no checking for gdome2... no Any one have any idea? Thanks, Xin -----Original Message----- From: emboss-bounces at lists.open-bio.org on behalf of ajb at ebi.ac.uk Sent: Thu 5/3/2007 8:46 To: emboss at emboss.open-bio.org Subject: Re: [EMBOSS] A question about configure of pnddriver Dear Xin, The configuration is only meant for one use of --with-pngdriver and only one location should be specified. If zlib, gd and libpng are all in standard system locations (e.g. under /usr/include & /usr/lib) then you don't need to specify --with-pngdriver at all. Any of those packages which are not in standard locations must then be installed under the same directory tree and --with-pngdriver used to point to that location. For example, if zlib and libpng are under /usr but gd is under /sw/packages then you can specify --with-pngdriver=/sw/packages and that should be fine. HTH Alan > -----Original Message----- > From: emboss-bounces at lists.open-bio.org > [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of Hong, Xin > Sent: Tuesday, May 01, 2007 1:28 PM > To: emboss at lists.open-bio.org > Subject: [EMBOSS] A question about configure of pnddriver > > > Hello there, > > I am responsible to install the EMBOSS-4.1.0 on our supurcomputers in > Indiana University, I am not the administrator. I email them to ask for > where the png, z and gd librarys are installed on and found out there are > on > the same directory. For the instruction file online, it states that "add > the > new directory to your confiture line for EMBOSS --with-pngdriver=my_dir > where the z,png, and gd libraries where eachinstalled using > --prefix=my_dir". > > I would like to know do they have to be together in my_dir, or I can state > seperately, for instance > > ./configure --prefix=/miscapps/EMBOSS --with-pngdriver=my_d1 > --with-pngdriver=my_d2 --with-pngdriver=my_d3 > > My second question is about Web interface of EMBOSS. As the policy of > using > supurcomputer, I have to put the web interface and database on another two > seperate supurcomputers. I would like to know are there anyone sampled the > difference of the webinterface and know which one is better. Or I would > appreciate any suggestion for what I should pay attention to in this > situation. > > Thanks a lots. > > Xin > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > _______________________________________________ EMBOSS mailing list EMBOSS at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/emboss From openlinuxsource at gmail.com Sun May 6 06:37:26 2007 From: openlinuxsource at gmail.com (Amy Lee) Date: Sun, 06 May 2007 18:37:26 +0800 Subject: [EMBOSS] Help: About EMBOSS Message-ID: <463DAFE6.7030800@gmail.com> Hello, I'm a Chinese student in an agricultural university. And I built a Linux Beowulf cluster for Bioinformatics Department. According to plan, we should use EMBOSS in this cluster. I'd like to know, whether I can use EMBOSS to do a big problem on these nodes? I mean the whole nodes can solve one problem together at the same time, not arrange different jobs to nodes. And how about Sun Grid Engine? Is it useful in this plan? Thanks in advance! Amy Lee From charles-listes-emboss at plessy.org Sun May 6 07:09:37 2007 From: charles-listes-emboss at plessy.org (Charles Plessy) Date: Sun, 6 May 2007 20:09:37 +0900 Subject: [EMBOSS] edialign does not take [Start:End] notation into account Message-ID: <20070506110937.GH29903@kunpuu.plessy.org> Dear EMBOSS developpers, I am using edialign with a listfile storing sequences in USA format, such as: SeqA.fasta[1:150] SeqB.fasta[1:150] However, edialign uses the full sequence, ignoring the [start:end] range. I think that this is a bug, since emma is able to correctly run clustalw with listfiles using [start:end] ranges. Have a nice day, -- Charles Plessy http://charles.plessy.org Wako, Saitama, Japan From tao.song at calibrant.com Wed May 9 15:57:01 2007 From: tao.song at calibrant.com (Tao Song) Date: Wed, 9 May 2007 15:57:01 -0400 Subject: [EMBOSS] A question about pepstats In-Reply-To: <54963.81.98.241.17.1178196378.squirrel@webmail.ebi.ac.uk> Message-ID: <000001c79274$380baf60$2d02a8c0@TAOLAPTOP> Hi, I have a quick question about pepstats. I got an error to use the following command: Pepstats AAAAAAAAGAGAGAK -filter I think it can take sequence as input but I got an "unable to read sequence" error. Thanks for help! Regards, Tao From pmr at ebi.ac.uk Wed May 9 18:06:07 2007 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Wed, 9 May 2007 23:06:07 +0100 (BST) Subject: [EMBOSS] A question about pepstats In-Reply-To: <000001c79274$380baf60$2d02a8c0@TAOLAPTOP> References: <54963.81.98.241.17.1178196378.squirrel@webmail.ebi.ac.uk> <000001c79274$380baf60$2d02a8c0@TAOLAPTOP> Message-ID: <52048.86.134.65.29.1178748367.squirrel@webmail.ebi.ac.uk> Dear Tao, > I have a quick question about pepstats. I got an error to use > the following command: > > Pepstats AAAAAAAAGAGAGAK -filter > > I think it can take sequence as input but I got an "unable to read > sequence" error. It assumes AAAAAAAAGAGAGAK is the name of a file. To put the sequence on the command line the syntax is pepstats asis::AAAAAAAAGAGAGAK -filter regards, Peter Rice From Veronique.Martin at jouy.inra.fr Wed May 16 11:31:36 2007 From: Veronique.Martin at jouy.inra.fr (Veronique.Martin at jouy.inra.fr) Date: Wed, 16 May 2007 17:31:36 +0200 (CEST) Subject: [EMBOSS] extractalign.html Message-ID: Hi, I run EMBOSS 4.1.0 release, every thing is ok but I don't have the extracalign.html file in the directory : /emboss-4.1.0/share/EMBOSS/doc/html/emboss/apps/ When I use command line it is the same : >tfm extractalign Displays a program's help documentation manual Only this command line is possbile : extractalign -h Do you know why? THanks VEronique ------------------------------------------------- V?ronique MARTIN INRA - Unit? Math?matique, Informatique et G?nome 78352 Jouy-en Josas cedex tel.: 01 34 65 29 74 ------------------------------------------------- From bernd.web at gmail.com Thu May 17 06:32:38 2007 From: bernd.web at gmail.com (Bernd Web) Date: Thu, 17 May 2007 12:32:38 +0200 Subject: [EMBOSS] Compseq DNA/Protein sequence problem In-Reply-To: <716af09c0704231428s101d5f5dnc2cbc7f572a60183@mail.gmail.com> References: <716af09c0704231428s101d5f5dnc2cbc7f572a60183@mail.gmail.com> Message-ID: <716af09c0705170332obf81f57xe58d8b564a41d934@mail.gmail.com> Hi, Regarding compseq I wonder how to count words in reading frame 0 only. The frame values can be 0,1,2 for words of length 2. I use "AGAGAG" as sequence and 1 as frame. This results in 2 times GA. Using frame 2 results in two times AG. But how to get a count of 3 times AG only? Frame zero returns a count of 3 for AG, but also a count of 2 for GA. I used emboss version 4.1.0 over the web with EMBOSS explorer. regards, bernd On 4/23/07, Bernd Web wrote: > Hi Annette, > > Your seq1 is incorrectly guessed to be a nucleotide sequence, since > you state it's protein. EMBOSS provides a boolean to state nucleotide > or protein nature of your sequence, see EMBOSS help: > > "-sequence" associated qualifiers > -snucleotide1 boolean Sequence is nucleotide > -sprotein1 boolean Sequence is protein > > regards, > bernd > > On 4/23/07, Becher, Anette wrote: > > Hi all, > > > > I believe I *may* have found a bug in compseq. > > > > I have been using compseq to calculate the frequency of amino acids in > > translated DNA sequences. I find that frequently compseq takes the amino > > acid sequence to be DNA (they are sequences with an unusual composition, > > but then I am looking for odd proteins). So instead of the expected > > output for all amino acids with most being zero, I often get output for > > A,C,G,T and 'other'. I cannot see an obvious pattern that would explain > > this behaviour, but maybe you can help. > > > > Command line: > > > > compseq -seq compseq_bug.in -word 1 -frame 1 -out compseq_bug.out > > > > An example input and output file are pasted in below - I can provide > > many more. > > > > It might help if the user could specify whether the input sequence is > > DNA or protein, rather than the program working it out somehow? > > > > > > Best wishes > > > > > > Anette > > > > > > > > Here is an example of the problem: > > > > > > >Seq1 > > GSGGGGGSGGRGMGGWGGGRGSGVGGRGWGVG > > > > > > # > > # Output from 'compseq' > > # > > # Only words in frame 1 will be counted. > > # The Expected frequencies are calculated on the (false) assumption that > > every > > # word has equal frequency. > > # > > # The input sequences are: > > # Seq1 > > > > > > Word size 1 > > Total count 31 > > > > # > > # Word Obs Count Obs Frequency Exp Frequency Obs/Exp > > Frequency > > # > > A 0 0.0000000 0.2500000 0.0000000 > > C 0 0.0000000 0.2500000 0.0000000 > > G 20 0.6451613 0.2500000 2.5806452 > > T 0 0.0000000 0.2500000 0.0000000 > > > > Other 11 0.3548387 0.0000000 > > 10000000000.0000000 > > > > > > > > > > Here is a similar sequence that works fine: > > > > > > >Seq2 > > VGSEGGGGGRRGEGGGGGGRGGGGGRWEEGAG > > > > > > > > # > > # Output from 'compseq' > > # > > # Only words in frame 1 will be counted. > > # The Expected frequencies are calculated on the (false) assumption that > > every > > # word has equal frequency. > > # > > # The input sequences are: > > # Seq2 > > > > > > Word size 1 > > Total count 31 > > > > # > > # Word Obs Count Obs Frequency Exp Frequency Obs/Exp > > Frequency > > # > > A 1 0.0322581 0.0476190 0.6774194 > > C 0 0.0000000 0.0476190 0.0000000 > > D 0 0.0000000 0.0476190 0.0000000 > > E 4 0.1290323 0.0476190 2.7096774 > > F 0 0.0000000 0.0476190 0.0000000 > > G 20 0.6451613 0.0476190 13.5483871 > > H 0 0.0000000 0.0476190 0.0000000 > > I 0 0.0000000 0.0476190 0.0000000 > > K 0 0.0000000 0.0476190 0.0000000 > > L 0 0.0000000 0.0476190 0.0000000 > > M 0 0.0000000 0.0476190 0.0000000 > > N 0 0.0000000 0.0476190 0.0000000 > > P 0 0.0000000 0.0476190 0.0000000 > > Q 0 0.0000000 0.0476190 0.0000000 > > R 4 0.1290323 0.0476190 2.7096774 > > S 1 0.0322581 0.0476190 0.6774194 > > T 0 0.0000000 0.0476190 0.0000000 > > U 0 0.0000000 0.0476190 0.0000000 > > V 0 0.0000000 0.0476190 0.0000000 > > W 1 0.0322581 0.0476190 0.6774194 > > Y 0 0.0000000 0.0476190 0.0000000 > > ======================================================================= > > Attention: The information contained in this message and/or attachments > > from AgResearch Limited is intended only for the persons or entities > > to which it is addressed and may contain confidential and/or privileged > > material. Any review, retransmission, dissemination or other use of, or > > taking of any action in reliance upon, this information by persons or > > entities other than the intended recipients is prohibited by AgResearch > > Limited. If you have received this message in error, please notify the > > sender immediately. > > ======================================================================= > > > > _______________________________________________ > > EMBOSS mailing list > > EMBOSS at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/emboss > > > From charles-listes-emboss at plessy.org Tue May 29 04:37:10 2007 From: charles-listes-emboss at plessy.org (Charles Plessy) Date: Tue, 29 May 2007 17:37:10 +0900 Subject: [EMBOSS] Indexing the ID field of EMBL-formatted databases. Message-ID: <20070529083710.GH2487@kunpuu.plessy.org> Dear list, I have tried to index mirbase, the miRNA database, with dbiflat, but in that case I can only retrieve the seqences by their accession numbers, and not by their IDs: gslc12?mirbase3?$ seqret mirbase:MI0004658 stdout Reads and writes (returns) sequences >mmu-mir-690 MI0004658 Mus musculus miR-690 stem-loop uguguuuuuguggagcuaauuggcuguauuaaagugcuaguaagaaacauucuccuccag cuggagagauggcucagcuguuaaaggcuaggcucacaaccaaaauaua gslc12?mirbase3?$ seqret mirbase:mmu-mir-690 stdout Reads and writes (returns) sequences Error: Unable to read sequence 'mirbase:mmu-mir-690' Died: seqret terminated: Bad value for '-sequence' and no prompt gslc12?mirbase3?$ seqret mirbase-ID:mmu-mir-690 stdout Reads and writes (returns) sequences Error: Unable to read sequence 'mirbase-ID:mmu-mir-690' Died: seqret terminated: Bad value for '-sequence' and no prompt gslc12?mirbase3?$ seqret mirbase-id:mmu-mir-690 stdout Reads and writes (returns) sequences Error: Unable to read sequence 'mirbase-id:mmu-mir-690' Died: seqret terminated: Bad value for '-sequence' and no prompt Here is the command line I used: dbiflat -dbname mirbase\ -idformat EMBL\ -directory .\ -filenames miRNA.dat\ -release 9.1\ -date `date +%d/%m/%y`\ -outfile /dev/stdout And here is the embossrc I use: DB mirbase [ type: N format: embl method: emblcd directory: /usr/share/mirbase/emboss file: *.dat ] Is it a bug, or did I miss something ? Have a nice day, -- Charles Plessy http://charles.plessy.org Wako, Saitama, Japan From hjenkins at uvic.ca Tue May 29 19:14:25 2007 From: hjenkins at uvic.ca (Hazel Hartman Jenkins) Date: Tue, 29 May 2007 17:14:25 -0600 Subject: [EMBOSS] Segmentation fault with multiple similarity matricies in fdnadist Message-ID: <200705291714.25677.hjenkins@uvic.ca> Hello, all, I have a replicable segmentation fault problem. If I run the following command; fneighbor -datafile tinytest.dat -replicates y -outfile filefrom.fnb using a tinytest.dat file containing; 3 1187Aquife 0.000000 0.368385 0.404489 BB213b06 0.368385 0.000000 0.151182 BB269b06 0.404489 0.151182 0.000000 then everything works. If, however, my tinytest.phy contains two similarity matricies (or, for that matter, the one hundred bootstrap replicates written by fdnadist by default), like this; 3 1187Aquife 0.000000 0.368385 0.404489 BB213b06 0.368385 0.000000 0.151182 BB269b06 0.404489 0.151182 0.000000 3 1187Aquife 0.000000 0.368385 0.404489 BB213b06 0.368385 0.000000 0.151182 BB269b06 0.404489 0.151182 0.000000 then fdnadist returns; Phylogenies from distance matrix by N-J or UPGMA method Segmentation fault The fault remains regardless of the "-replicates" setting. I am not familiar with the Emboss program; I am attempting to translate a Phylip algorhythm. It is possible that I am simply misusing fdnadist. I downloaded this through the Gentoo Linux distribution, so I've cross-posted the query on the Gentoo forums at http://forums.gentoo.org/viewtopic-p-4080556.html#4080556. I'll also cross-post the fix. Thank you for your time. Regards, H. Jenkins From david.bauer at bayerhealthcare.com Wed May 30 08:12:55 2007 From: david.bauer at bayerhealthcare.com (david.bauer at bayerhealthcare.com) Date: Wed, 30 May 2007 14:12:55 +0200 Subject: [EMBOSS] Antwort: Indexing the ID field of EMBL-formatted databases. In-Reply-To: <20070529083710.GH2487@kunpuu.plessy.org> Message-ID: Hi Charles, you should try the new indexing program dbxflat. I have miRNA.dat indexed with this and retrieval with ID and ACC work fine on my system (EMBOSS 4.1.0). HTH, David. emboss-bounces at lists.open-bio.org schrieb am 29/05/2007 10:37:10: > Dear list, > > I have tried to index mirbase, the miRNA database, with dbiflat, but in that > case I can only retrieve the seqences by their accession numbers, and not by > their IDs: > > gslc12?mirbase3?$ seqret mirbase:MI0004658 stdout > Reads and writes (returns) sequences > >mmu-mir-690 MI0004658 Mus musculus miR-690 stem-loop > uguguuuuuguggagcuaauuggcuguauuaaagugcuaguaagaaacauucuccuccag > cuggagagauggcucagcuguuaaaggcuaggcucacaaccaaaauaua > > gslc12?mirbase3?$ seqret mirbase:mmu-mir-690 stdout > Reads and writes (returns) sequences > Error: Unable to read sequence 'mirbase:mmu-mir-690' > Died: seqret terminated: Bad value for '-sequence' and no prompt > > gslc12?mirbase3?$ seqret mirbase-ID:mmu-mir-690 stdout > Reads and writes (returns) sequences > Error: Unable to read sequence 'mirbase-ID:mmu-mir-690' > Died: seqret terminated: Bad value for '-sequence' and no prompt > > gslc12?mirbase3?$ seqret mirbase-id:mmu-mir-690 stdout > Reads and writes (returns) sequences > Error: Unable to read sequence 'mirbase-id:mmu-mir-690' > Died: seqret terminated: Bad value for '-sequence' and no prompt > > Here is the command line I used: > > dbiflat -dbname mirbase\ > -idformat EMBL\ > -directory .\ > -filenames miRNA.dat\ > -release 9.1\ > -date `date +%d/%m/%y`\ > -outfile /dev/stdout > > And here is the embossrc I use: > > DB mirbase [ > type: N > format: embl > method: emblcd > directory: /usr/share/mirbase/emboss > file: *.dat > ] > > Is it a bug, or did I miss something ? > > Have a nice day, > > -- > Charles Plessy > http://charles.plessy.org > Wako, Saitama, Japan > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Wed May 30 09:33:11 2007 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 30 May 2007 14:33:11 +0100 Subject: [EMBOSS] Indexing the ID field of EMBL-formatted databases. In-Reply-To: <20070529083710.GH2487@kunpuu.plessy.org> References: <20070529083710.GH2487@kunpuu.plessy.org> Message-ID: <465D7D17.3020006@ebi.ac.uk> Charles Plessy wrote: > I have tried to index mirbase, the miRNA database, with dbiflat, but in that > case I can only retrieve the seqences by their accession numbers, and not by > their IDs: > > gslc12.mirbase3.$ seqret mirbase:mmu-mir-690 stdout > Reads and writes (returns) sequences > Error: Unable to read sequence 'mirbase:mmu-mir-690' > Died: seqret terminated: Bad value for '-sequence' and no prompt Aha ... mirbase is in EMBL format .. except the IDs are in lower case. All other EMBL/UniProt databases are in upper case. in emboss/dbiflat.c function dbiflat_ParseEmbl, add a conversion to upper case: if(lineType == FLATTYPE_ID) { ajRegExec(regEmblId, rline); ajRegSubI(regEmblId, 1, myid); ajStrFmtUpper(&myid); ajDebug("++id '%S'\n", *myid); ajRegSubI(regEmblId, 3, &tmpfd); (the ajStrFmtUpper line). Will be included in the July release. regards, Peter From charles-listes-emboss at plessy.org Wed May 30 21:13:04 2007 From: charles-listes-emboss at plessy.org (charles-listes-emboss at plessy.org) Date: Thu, 31 May 2007 10:13:04 +0900 Subject: [EMBOSS] Indexing the ID field of EMBL-formatted databases. In-Reply-To: <465D7D17.3020006@ebi.ac.uk> References: <20070529083710.GH2487@kunpuu.plessy.org> <465D7D17.3020006@ebi.ac.uk> Message-ID: <20070531011304.GD24131@kunpuu.plessy.org> Le Wed, May 30, 2007 at 02:33:11PM +0100, Peter Rice a ?crit : > > Aha ... mirbase is in EMBL format .. except the IDs are in lower case. All other > EMBL/UniProt databases are in upper case. > > in emboss/dbiflat.c function dbiflat_ParseEmbl, add a conversion to upper case: > > Will be included in the July release. Thanks to you and David for the answers ! By the way, where can I have informations about upcoming releases ? I am part of the team that makes Debian packages for EMBOSS, and it would help us to organise our work... Have a nice day, -- Charles Plessy http://charles.plessy.org Wako, Saitama, Japan From xinhong at indiana.edu Tue May 1 17:27:33 2007 From: xinhong at indiana.edu (Hong, Xin) Date: Tue, 1 May 2007 13:27:33 -0400 Subject: [EMBOSS] A question about configure of pnddriver Message-ID: <89F32E6A19D3B34283EA3C105E33F11DC1D332@iu-mssg-mbx105.ads.iu.edu> Hello there, I am responsible to install the EMBOSS-4.1.0 on our supurcomputers in Indiana University, I am not the administrator. I email them to ask for where the png, z and gd librarys are installed on and found out there are on the same directory. For the instruction file online, it states that "add the new directory to your confiture line for EMBOSS --with-pngdriver=my_dir where the z,png, and gd libraries where eachinstalled using --prefix=my_dir". I would like to know do they have to be together in my_dir, or I can state seperately, for instance ./configure --prefix=/miscapps/EMBOSS --with-pngdriver=my_d1 --with-pngdriver=my_d2 --with-pngdriver=my_d3 My second question is about Web interface of EMBOSS. As the policy of using supurcomputer, I have to put the web interface and database on another two seperate supurcomputers. I would like to know are there anyone sampled the difference of the webinterface and know which one is better. Or I would appreciate any suggestion for what I should pay attention to in this situation. Thanks a lots. Xin From golharam at umdnj.edu Thu May 3 11:05:42 2007 From: golharam at umdnj.edu (Ryan Golhar) Date: Thu, 03 May 2007 07:05:42 -0400 Subject: [EMBOSS] A question about configure of pnddriver In-Reply-To: <89F32E6A19D3B34283EA3C105E33F11DC1D332@iu-mssg-mbx105.ads.iu.edu> Message-ID: <002301c78d72$fe216ca0$f6028a0a@PICO> Xin, We have a similar setup here at UMDNJ. We prefer using EMBOSS-Explorer - it's a very clean easy-to-use interface requiring the minimum of resources and administrative overhead. As for the graphics libraries, if they are in different directories, I *think* you can specify them using "--with-pngdriver=my_d1 --with-pngdriver=my_d2 etc" or try "--with-pngdriver=my_d1;my_d2" Ryan -----Original Message----- From: emboss-bounces at lists.open-bio.org [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of Hong, Xin Sent: Tuesday, May 01, 2007 1:28 PM To: emboss at lists.open-bio.org Subject: [EMBOSS] A question about configure of pnddriver Hello there, I am responsible to install the EMBOSS-4.1.0 on our supurcomputers in Indiana University, I am not the administrator. I email them to ask for where the png, z and gd librarys are installed on and found out there are on the same directory. For the instruction file online, it states that "add the new directory to your confiture line for EMBOSS --with-pngdriver=my_dir where the z,png, and gd libraries where eachinstalled using --prefix=my_dir". I would like to know do they have to be together in my_dir, or I can state seperately, for instance ./configure --prefix=/miscapps/EMBOSS --with-pngdriver=my_d1 --with-pngdriver=my_d2 --with-pngdriver=my_d3 My second question is about Web interface of EMBOSS. As the policy of using supurcomputer, I have to put the web interface and database on another two seperate supurcomputers. I would like to know are there anyone sampled the difference of the webinterface and know which one is better. Or I would appreciate any suggestion for what I should pay attention to in this situation. Thanks a lots. Xin _______________________________________________ EMBOSS mailing list EMBOSS at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/emboss From ajb at ebi.ac.uk Thu May 3 12:46:18 2007 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 3 May 2007 13:46:18 +0100 (BST) Subject: [EMBOSS] A question about configure of pnddriver In-Reply-To: <002301c78d72$fe216ca0$f6028a0a@PICO> References: <89F32E6A19D3B34283EA3C105E33F11DC1D332@iu-mssg-mbx105.ads.iu.edu> <002301c78d72$fe216ca0$f6028a0a@PICO> Message-ID: <54963.81.98.241.17.1178196378.squirrel@webmail.ebi.ac.uk> Dear Xin, The configuration is only meant for one use of --with-pngdriver and only one location should be specified. If zlib, gd and libpng are all in standard system locations (e.g. under /usr/include & /usr/lib) then you don't need to specify --with-pngdriver at all. Any of those packages which are not in standard locations must then be installed under the same directory tree and --with-pngdriver used to point to that location. For example, if zlib and libpng are under /usr but gd is under /sw/packages then you can specify --with-pngdriver=/sw/packages and that should be fine. HTH Alan > -----Original Message----- > From: emboss-bounces at lists.open-bio.org > [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of Hong, Xin > Sent: Tuesday, May 01, 2007 1:28 PM > To: emboss at lists.open-bio.org > Subject: [EMBOSS] A question about configure of pnddriver > > > Hello there, > > I am responsible to install the EMBOSS-4.1.0 on our supurcomputers in > Indiana University, I am not the administrator. I email them to ask for > where the png, z and gd librarys are installed on and found out there are > on > the same directory. For the instruction file online, it states that "add > the > new directory to your confiture line for EMBOSS --with-pngdriver=my_dir > where the z,png, and gd libraries where eachinstalled using > --prefix=my_dir". > > I would like to know do they have to be together in my_dir, or I can state > seperately, for instance > > ./configure --prefix=/miscapps/EMBOSS --with-pngdriver=my_d1 > --with-pngdriver=my_d2 --with-pngdriver=my_d3 > > My second question is about Web interface of EMBOSS. As the policy of > using > supurcomputer, I have to put the web interface and database on another two > seperate supurcomputers. I would like to know are there anyone sampled the > difference of the webinterface and know which one is better. Or I would > appreciate any suggestion for what I should pay attention to in this > situation. > > Thanks a lots. > > Xin > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From xinhong at indiana.edu Thu May 3 16:20:18 2007 From: xinhong at indiana.edu (Hong, Xin) Date: Thu, 3 May 2007 12:20:18 -0400 Subject: [EMBOSS] A question about configure of pnddriver References: <89F32E6A19D3B34283EA3C105E33F11DC1D332@iu-mssg-mbx105.ads.iu.edu><002301c78d72$fe216ca0$f6028a0a@PICO> <54963.81.98.241.17.1178196378.squirrel@webmail.ebi.ac.uk> Message-ID: <89F32E6A19D3B34283EA3C105E33F11DC1D338@iu-mssg-mbx105.ads.iu.edu> Dear Alan, Thank you for the suggestions I get. I ask the administrator to install the updated version of z, png and gd in /usr/local/lib . The old version is still in /usr/local/lib for other use. However, I still could not get configure go through by ./configure --prefix=/miscapps/EMBOSS-4.1.0 --with-pngdriver=/usr/local/lib 2>&1 | tee configureembossmiscapps The following msg still show need to upgrade gd. I belive we use gd-2.0.4, the lastest one. checking if png driver is wanted... yes checking for inflateEnd in -lz... yes checking for png_destroy_read_struct in -lpng... yes checking for gdImageCreateFromPng in -lgd... no need to upgrade gd for png driver for plplot No png driver will be made due to librarys missing/old. checking if any authorisation type is given... no checking for gdome2... no Any one have any idea? Thanks, Xin -----Original Message----- From: emboss-bounces at lists.open-bio.org on behalf of ajb at ebi.ac.uk Sent: Thu 5/3/2007 8:46 To: emboss at emboss.open-bio.org Subject: Re: [EMBOSS] A question about configure of pnddriver Dear Xin, The configuration is only meant for one use of --with-pngdriver and only one location should be specified. If zlib, gd and libpng are all in standard system locations (e.g. under /usr/include & /usr/lib) then you don't need to specify --with-pngdriver at all. Any of those packages which are not in standard locations must then be installed under the same directory tree and --with-pngdriver used to point to that location. For example, if zlib and libpng are under /usr but gd is under /sw/packages then you can specify --with-pngdriver=/sw/packages and that should be fine. HTH Alan > -----Original Message----- > From: emboss-bounces at lists.open-bio.org > [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of Hong, Xin > Sent: Tuesday, May 01, 2007 1:28 PM > To: emboss at lists.open-bio.org > Subject: [EMBOSS] A question about configure of pnddriver > > > Hello there, > > I am responsible to install the EMBOSS-4.1.0 on our supurcomputers in > Indiana University, I am not the administrator. I email them to ask for > where the png, z and gd librarys are installed on and found out there are > on > the same directory. For the instruction file online, it states that "add > the > new directory to your confiture line for EMBOSS --with-pngdriver=my_dir > where the z,png, and gd libraries where eachinstalled using > --prefix=my_dir". > > I would like to know do they have to be together in my_dir, or I can state > seperately, for instance > > ./configure --prefix=/miscapps/EMBOSS --with-pngdriver=my_d1 > --with-pngdriver=my_d2 --with-pngdriver=my_d3 > > My second question is about Web interface of EMBOSS. As the policy of > using > supurcomputer, I have to put the web interface and database on another two > seperate supurcomputers. I would like to know are there anyone sampled the > difference of the webinterface and know which one is better. Or I would > appreciate any suggestion for what I should pay attention to in this > situation. > > Thanks a lots. > > Xin > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > _______________________________________________ EMBOSS mailing list EMBOSS at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/emboss From openlinuxsource at gmail.com Sun May 6 10:37:26 2007 From: openlinuxsource at gmail.com (Amy Lee) Date: Sun, 06 May 2007 18:37:26 +0800 Subject: [EMBOSS] Help: About EMBOSS Message-ID: <463DAFE6.7030800@gmail.com> Hello, I'm a Chinese student in an agricultural university. And I built a Linux Beowulf cluster for Bioinformatics Department. According to plan, we should use EMBOSS in this cluster. I'd like to know, whether I can use EMBOSS to do a big problem on these nodes? I mean the whole nodes can solve one problem together at the same time, not arrange different jobs to nodes. And how about Sun Grid Engine? Is it useful in this plan? Thanks in advance! Amy Lee From charles-listes-emboss at plessy.org Sun May 6 11:09:37 2007 From: charles-listes-emboss at plessy.org (Charles Plessy) Date: Sun, 6 May 2007 20:09:37 +0900 Subject: [EMBOSS] edialign does not take [Start:End] notation into account Message-ID: <20070506110937.GH29903@kunpuu.plessy.org> Dear EMBOSS developpers, I am using edialign with a listfile storing sequences in USA format, such as: SeqA.fasta[1:150] SeqB.fasta[1:150] However, edialign uses the full sequence, ignoring the [start:end] range. I think that this is a bug, since emma is able to correctly run clustalw with listfiles using [start:end] ranges. Have a nice day, -- Charles Plessy http://charles.plessy.org Wako, Saitama, Japan From tao.song at calibrant.com Wed May 9 19:57:01 2007 From: tao.song at calibrant.com (Tao Song) Date: Wed, 9 May 2007 15:57:01 -0400 Subject: [EMBOSS] A question about pepstats In-Reply-To: <54963.81.98.241.17.1178196378.squirrel@webmail.ebi.ac.uk> Message-ID: <000001c79274$380baf60$2d02a8c0@TAOLAPTOP> Hi, I have a quick question about pepstats. I got an error to use the following command: Pepstats AAAAAAAAGAGAGAK -filter I think it can take sequence as input but I got an "unable to read sequence" error. Thanks for help! Regards, Tao From pmr at ebi.ac.uk Wed May 9 22:06:07 2007 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Wed, 9 May 2007 23:06:07 +0100 (BST) Subject: [EMBOSS] A question about pepstats In-Reply-To: <000001c79274$380baf60$2d02a8c0@TAOLAPTOP> References: <54963.81.98.241.17.1178196378.squirrel@webmail.ebi.ac.uk> <000001c79274$380baf60$2d02a8c0@TAOLAPTOP> Message-ID: <52048.86.134.65.29.1178748367.squirrel@webmail.ebi.ac.uk> Dear Tao, > I have a quick question about pepstats. I got an error to use > the following command: > > Pepstats AAAAAAAAGAGAGAK -filter > > I think it can take sequence as input but I got an "unable to read > sequence" error. It assumes AAAAAAAAGAGAGAK is the name of a file. To put the sequence on the command line the syntax is pepstats asis::AAAAAAAAGAGAGAK -filter regards, Peter Rice From Veronique.Martin at jouy.inra.fr Wed May 16 15:31:36 2007 From: Veronique.Martin at jouy.inra.fr (Veronique.Martin at jouy.inra.fr) Date: Wed, 16 May 2007 17:31:36 +0200 (CEST) Subject: [EMBOSS] extractalign.html Message-ID: Hi, I run EMBOSS 4.1.0 release, every thing is ok but I don't have the extracalign.html file in the directory : /emboss-4.1.0/share/EMBOSS/doc/html/emboss/apps/ When I use command line it is the same : >tfm extractalign Displays a program's help documentation manual Only this command line is possbile : extractalign -h Do you know why? THanks VEronique ------------------------------------------------- V?ronique MARTIN INRA - Unit? Math?matique, Informatique et G?nome 78352 Jouy-en Josas cedex tel.: 01 34 65 29 74 ------------------------------------------------- From bernd.web at gmail.com Thu May 17 10:32:38 2007 From: bernd.web at gmail.com (Bernd Web) Date: Thu, 17 May 2007 12:32:38 +0200 Subject: [EMBOSS] Compseq DNA/Protein sequence problem In-Reply-To: <716af09c0704231428s101d5f5dnc2cbc7f572a60183@mail.gmail.com> References: <716af09c0704231428s101d5f5dnc2cbc7f572a60183@mail.gmail.com> Message-ID: <716af09c0705170332obf81f57xe58d8b564a41d934@mail.gmail.com> Hi, Regarding compseq I wonder how to count words in reading frame 0 only. The frame values can be 0,1,2 for words of length 2. I use "AGAGAG" as sequence and 1 as frame. This results in 2 times GA. Using frame 2 results in two times AG. But how to get a count of 3 times AG only? Frame zero returns a count of 3 for AG, but also a count of 2 for GA. I used emboss version 4.1.0 over the web with EMBOSS explorer. regards, bernd On 4/23/07, Bernd Web wrote: > Hi Annette, > > Your seq1 is incorrectly guessed to be a nucleotide sequence, since > you state it's protein. EMBOSS provides a boolean to state nucleotide > or protein nature of your sequence, see EMBOSS help: > > "-sequence" associated qualifiers > -snucleotide1 boolean Sequence is nucleotide > -sprotein1 boolean Sequence is protein > > regards, > bernd > > On 4/23/07, Becher, Anette wrote: > > Hi all, > > > > I believe I *may* have found a bug in compseq. > > > > I have been using compseq to calculate the frequency of amino acids in > > translated DNA sequences. I find that frequently compseq takes the amino > > acid sequence to be DNA (they are sequences with an unusual composition, > > but then I am looking for odd proteins). So instead of the expected > > output for all amino acids with most being zero, I often get output for > > A,C,G,T and 'other'. I cannot see an obvious pattern that would explain > > this behaviour, but maybe you can help. > > > > Command line: > > > > compseq -seq compseq_bug.in -word 1 -frame 1 -out compseq_bug.out > > > > An example input and output file are pasted in below - I can provide > > many more. > > > > It might help if the user could specify whether the input sequence is > > DNA or protein, rather than the program working it out somehow? > > > > > > Best wishes > > > > > > Anette > > > > > > > > Here is an example of the problem: > > > > > > >Seq1 > > GSGGGGGSGGRGMGGWGGGRGSGVGGRGWGVG > > > > > > # > > # Output from 'compseq' > > # > > # Only words in frame 1 will be counted. > > # The Expected frequencies are calculated on the (false) assumption that > > every > > # word has equal frequency. > > # > > # The input sequences are: > > # Seq1 > > > > > > Word size 1 > > Total count 31 > > > > # > > # Word Obs Count Obs Frequency Exp Frequency Obs/Exp > > Frequency > > # > > A 0 0.0000000 0.2500000 0.0000000 > > C 0 0.0000000 0.2500000 0.0000000 > > G 20 0.6451613 0.2500000 2.5806452 > > T 0 0.0000000 0.2500000 0.0000000 > > > > Other 11 0.3548387 0.0000000 > > 10000000000.0000000 > > > > > > > > > > Here is a similar sequence that works fine: > > > > > > >Seq2 > > VGSEGGGGGRRGEGGGGGGRGGGGGRWEEGAG > > > > > > > > # > > # Output from 'compseq' > > # > > # Only words in frame 1 will be counted. > > # The Expected frequencies are calculated on the (false) assumption that > > every > > # word has equal frequency. > > # > > # The input sequences are: > > # Seq2 > > > > > > Word size 1 > > Total count 31 > > > > # > > # Word Obs Count Obs Frequency Exp Frequency Obs/Exp > > Frequency > > # > > A 1 0.0322581 0.0476190 0.6774194 > > C 0 0.0000000 0.0476190 0.0000000 > > D 0 0.0000000 0.0476190 0.0000000 > > E 4 0.1290323 0.0476190 2.7096774 > > F 0 0.0000000 0.0476190 0.0000000 > > G 20 0.6451613 0.0476190 13.5483871 > > H 0 0.0000000 0.0476190 0.0000000 > > I 0 0.0000000 0.0476190 0.0000000 > > K 0 0.0000000 0.0476190 0.0000000 > > L 0 0.0000000 0.0476190 0.0000000 > > M 0 0.0000000 0.0476190 0.0000000 > > N 0 0.0000000 0.0476190 0.0000000 > > P 0 0.0000000 0.0476190 0.0000000 > > Q 0 0.0000000 0.0476190 0.0000000 > > R 4 0.1290323 0.0476190 2.7096774 > > S 1 0.0322581 0.0476190 0.6774194 > > T 0 0.0000000 0.0476190 0.0000000 > > U 0 0.0000000 0.0476190 0.0000000 > > V 0 0.0000000 0.0476190 0.0000000 > > W 1 0.0322581 0.0476190 0.6774194 > > Y 0 0.0000000 0.0476190 0.0000000 > > ======================================================================= > > Attention: The information contained in this message and/or attachments > > from AgResearch Limited is intended only for the persons or entities > > to which it is addressed and may contain confidential and/or privileged > > material. Any review, retransmission, dissemination or other use of, or > > taking of any action in reliance upon, this information by persons or > > entities other than the intended recipients is prohibited by AgResearch > > Limited. If you have received this message in error, please notify the > > sender immediately. > > ======================================================================= > > > > _______________________________________________ > > EMBOSS mailing list > > EMBOSS at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/emboss > > > From charles-listes-emboss at plessy.org Tue May 29 08:37:10 2007 From: charles-listes-emboss at plessy.org (Charles Plessy) Date: Tue, 29 May 2007 17:37:10 +0900 Subject: [EMBOSS] Indexing the ID field of EMBL-formatted databases. Message-ID: <20070529083710.GH2487@kunpuu.plessy.org> Dear list, I have tried to index mirbase, the miRNA database, with dbiflat, but in that case I can only retrieve the seqences by their accession numbers, and not by their IDs: gslc12?mirbase3?$ seqret mirbase:MI0004658 stdout Reads and writes (returns) sequences >mmu-mir-690 MI0004658 Mus musculus miR-690 stem-loop uguguuuuuguggagcuaauuggcuguauuaaagugcuaguaagaaacauucuccuccag cuggagagauggcucagcuguuaaaggcuaggcucacaaccaaaauaua gslc12?mirbase3?$ seqret mirbase:mmu-mir-690 stdout Reads and writes (returns) sequences Error: Unable to read sequence 'mirbase:mmu-mir-690' Died: seqret terminated: Bad value for '-sequence' and no prompt gslc12?mirbase3?$ seqret mirbase-ID:mmu-mir-690 stdout Reads and writes (returns) sequences Error: Unable to read sequence 'mirbase-ID:mmu-mir-690' Died: seqret terminated: Bad value for '-sequence' and no prompt gslc12?mirbase3?$ seqret mirbase-id:mmu-mir-690 stdout Reads and writes (returns) sequences Error: Unable to read sequence 'mirbase-id:mmu-mir-690' Died: seqret terminated: Bad value for '-sequence' and no prompt Here is the command line I used: dbiflat -dbname mirbase\ -idformat EMBL\ -directory .\ -filenames miRNA.dat\ -release 9.1\ -date `date +%d/%m/%y`\ -outfile /dev/stdout And here is the embossrc I use: DB mirbase [ type: N format: embl method: emblcd directory: /usr/share/mirbase/emboss file: *.dat ] Is it a bug, or did I miss something ? Have a nice day, -- Charles Plessy http://charles.plessy.org Wako, Saitama, Japan From hjenkins at uvic.ca Tue May 29 23:14:25 2007 From: hjenkins at uvic.ca (Hazel Hartman Jenkins) Date: Tue, 29 May 2007 17:14:25 -0600 Subject: [EMBOSS] Segmentation fault with multiple similarity matricies in fdnadist Message-ID: <200705291714.25677.hjenkins@uvic.ca> Hello, all, I have a replicable segmentation fault problem. If I run the following command; fneighbor -datafile tinytest.dat -replicates y -outfile filefrom.fnb using a tinytest.dat file containing; 3 1187Aquife 0.000000 0.368385 0.404489 BB213b06 0.368385 0.000000 0.151182 BB269b06 0.404489 0.151182 0.000000 then everything works. If, however, my tinytest.phy contains two similarity matricies (or, for that matter, the one hundred bootstrap replicates written by fdnadist by default), like this; 3 1187Aquife 0.000000 0.368385 0.404489 BB213b06 0.368385 0.000000 0.151182 BB269b06 0.404489 0.151182 0.000000 3 1187Aquife 0.000000 0.368385 0.404489 BB213b06 0.368385 0.000000 0.151182 BB269b06 0.404489 0.151182 0.000000 then fdnadist returns; Phylogenies from distance matrix by N-J or UPGMA method Segmentation fault The fault remains regardless of the "-replicates" setting. I am not familiar with the Emboss program; I am attempting to translate a Phylip algorhythm. It is possible that I am simply misusing fdnadist. I downloaded this through the Gentoo Linux distribution, so I've cross-posted the query on the Gentoo forums at http://forums.gentoo.org/viewtopic-p-4080556.html#4080556. I'll also cross-post the fix. Thank you for your time. Regards, H. Jenkins From david.bauer at bayerhealthcare.com Wed May 30 12:12:55 2007 From: david.bauer at bayerhealthcare.com (david.bauer at bayerhealthcare.com) Date: Wed, 30 May 2007 14:12:55 +0200 Subject: [EMBOSS] Antwort: Indexing the ID field of EMBL-formatted databases. In-Reply-To: <20070529083710.GH2487@kunpuu.plessy.org> Message-ID: Hi Charles, you should try the new indexing program dbxflat. I have miRNA.dat indexed with this and retrieval with ID and ACC work fine on my system (EMBOSS 4.1.0). HTH, David. emboss-bounces at lists.open-bio.org schrieb am 29/05/2007 10:37:10: > Dear list, > > I have tried to index mirbase, the miRNA database, with dbiflat, but in that > case I can only retrieve the seqences by their accession numbers, and not by > their IDs: > > gslc12?mirbase3?$ seqret mirbase:MI0004658 stdout > Reads and writes (returns) sequences > >mmu-mir-690 MI0004658 Mus musculus miR-690 stem-loop > uguguuuuuguggagcuaauuggcuguauuaaagugcuaguaagaaacauucuccuccag > cuggagagauggcucagcuguuaaaggcuaggcucacaaccaaaauaua > > gslc12?mirbase3?$ seqret mirbase:mmu-mir-690 stdout > Reads and writes (returns) sequences > Error: Unable to read sequence 'mirbase:mmu-mir-690' > Died: seqret terminated: Bad value for '-sequence' and no prompt > > gslc12?mirbase3?$ seqret mirbase-ID:mmu-mir-690 stdout > Reads and writes (returns) sequences > Error: Unable to read sequence 'mirbase-ID:mmu-mir-690' > Died: seqret terminated: Bad value for '-sequence' and no prompt > > gslc12?mirbase3?$ seqret mirbase-id:mmu-mir-690 stdout > Reads and writes (returns) sequences > Error: Unable to read sequence 'mirbase-id:mmu-mir-690' > Died: seqret terminated: Bad value for '-sequence' and no prompt > > Here is the command line I used: > > dbiflat -dbname mirbase\ > -idformat EMBL\ > -directory .\ > -filenames miRNA.dat\ > -release 9.1\ > -date `date +%d/%m/%y`\ > -outfile /dev/stdout > > And here is the embossrc I use: > > DB mirbase [ > type: N > format: embl > method: emblcd > directory: /usr/share/mirbase/emboss > file: *.dat > ] > > Is it a bug, or did I miss something ? > > Have a nice day, > > -- > Charles Plessy > http://charles.plessy.org > Wako, Saitama, Japan > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Wed May 30 13:33:11 2007 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 30 May 2007 14:33:11 +0100 Subject: [EMBOSS] Indexing the ID field of EMBL-formatted databases. In-Reply-To: <20070529083710.GH2487@kunpuu.plessy.org> References: <20070529083710.GH2487@kunpuu.plessy.org> Message-ID: <465D7D17.3020006@ebi.ac.uk> Charles Plessy wrote: > I have tried to index mirbase, the miRNA database, with dbiflat, but in that > case I can only retrieve the seqences by their accession numbers, and not by > their IDs: > > gslc12.mirbase3.$ seqret mirbase:mmu-mir-690 stdout > Reads and writes (returns) sequences > Error: Unable to read sequence 'mirbase:mmu-mir-690' > Died: seqret terminated: Bad value for '-sequence' and no prompt Aha ... mirbase is in EMBL format .. except the IDs are in lower case. All other EMBL/UniProt databases are in upper case. in emboss/dbiflat.c function dbiflat_ParseEmbl, add a conversion to upper case: if(lineType == FLATTYPE_ID) { ajRegExec(regEmblId, rline); ajRegSubI(regEmblId, 1, myid); ajStrFmtUpper(&myid); ajDebug("++id '%S'\n", *myid); ajRegSubI(regEmblId, 3, &tmpfd); (the ajStrFmtUpper line). Will be included in the July release. regards, Peter From charles-listes-emboss at plessy.org Thu May 31 01:13:04 2007 From: charles-listes-emboss at plessy.org (charles-listes-emboss at plessy.org) Date: Thu, 31 May 2007 10:13:04 +0900 Subject: [EMBOSS] Indexing the ID field of EMBL-formatted databases. In-Reply-To: <465D7D17.3020006@ebi.ac.uk> References: <20070529083710.GH2487@kunpuu.plessy.org> <465D7D17.3020006@ebi.ac.uk> Message-ID: <20070531011304.GD24131@kunpuu.plessy.org> Le Wed, May 30, 2007 at 02:33:11PM +0100, Peter Rice a ?crit : > > Aha ... mirbase is in EMBL format .. except the IDs are in lower case. All other > EMBL/UniProt databases are in upper case. > > in emboss/dbiflat.c function dbiflat_ParseEmbl, add a conversion to upper case: > > Will be included in the July release. Thanks to you and David for the answers ! By the way, where can I have informations about upcoming releases ? I am part of the team that makes Debian packages for EMBOSS, and it would help us to organise our work... Have a nice day, -- Charles Plessy http://charles.plessy.org Wako, Saitama, Japan