From kvddrift at earthlink.net Fri Apr 6 09:14:08 2007 From: kvddrift at earthlink.net (Koen van der Drift) Date: Fri, 6 Apr 2007 09:14:08 -0400 Subject: [EMBOSS] Fwd: emboss-4.1.0-1 on a (new) intel iMac References: Message-ID: <16CD73A3-FB61-45BC-A3BA-403DEE2954E8@earthlink.net> Hi, I am the maintainer of the fink package for emboss. A user reported the following error on an Intel iMac because crypt.h is missing. On a Mac most of the the functions in crypt.h are in unistd.h. So I could replace the #include crypt.h with #include unistd.h. Another reader was wondering why crypt.h is needed, is there a situation when emboss needs a password? In that case I could just comment out the #include. BTW, on a PPC iMac, there is no error because of: #if !defined(__ppc__) && !defined(__FreeBSD__) #include #endif thanks, - Koen. Begin forwarded message: > gcc -DPACKAGE_NAME=\"\" -DPACKAGE_TARNAME=\"\" -DPACKAGE_VERSION= > \"\" -DPACKAGE_STRING=\"\" -DPACKAGE_BUGREPORT=\"\" -DPACKAGE= > \"EMBOSS\" -DVERSION=\"4.1.0\" -DSTDC_HEADERS=1 - > DHAVE_SYS_TYPES_H=1 -DHAVE_SYS_STAT_H=1 -DHAVE_STDLIB_H=1 - > DHAVE_STRING_H=1 -DHAVE_MEMORY_H=1 -DHAVE_STRINGS_H=1 - > DHAVE_INTTYPES_H=1 -DHAVE_STDINT_H=1 -DHAVE_UNISTD_H=1 - > DHAVE_DLFCN_H=1 -DHAVE_DIRENT_H=1 -DSTDC_HEADERS=1 - > DHAVE_UNISTD_H=1 -DGETPGRP_VOID=1 -DHAVE_STRFTIME=1 - > DHAVE_UNISTD_H=1 -DHAVE_FORK=1 -DHAVE_VFORK=1 - > DHAVE_WORKING_VFORK=1 -DHAVE_WORKING_FORK=1 -DHAVE_VPRINTF=1 - > DHAVE_MEMMOVE=1 -DHAVE_LIBM=1 -DPLD_png=1 -I. -I. -DAJAX_FIXED_ROOT= > \"/sw/src/fink.build/emboss-4.1.0-1/EMBOSS-4.1.0/emboss\" -DPREFIX= > \"/sw\" -I../plplot -DPOSIX_MALLOC_THRESHOLD=10 -DAJ_MACOSXLF - > Dstat64=stat -I/sw/include -DLENDIAN -I/System/Library/Frameworks/ > JavaVM.framework/Versions/1.4.2/Home -DHAVE_JAVA -I/System/Library/ > Frameworks/JavaVM.framework/Versions/1.4.2/Home/include -DNO_AUTH - > O1 -c ajjava.c -fno-common -DPIC -o .libs/ajjava.o > ajjava.c:93:19: error: crypt.h: No such file or directory > ajjava.c: In function > 'Java_org_emboss_jemboss_parser_Ajax_seqsetType': > ajjava.c:335: warning: 'ajSeqsetLen' is deprecated (declared at > ajseq.h:240) > ajjava.c:337: warning: 'ajSeqsetTotweight' is deprecated (declared > at ajseq.h:259) > ajjava.c: In function 'Java_org_emboss_jemboss_parser_Ajax_fork': > ajjava.c:1251: warning: passing argument 1 of 'ajSysStrtokR' > discards qualifiers from pointer target type > ajjava.c: In function 'make_array': > ajjava.c:1525: warning: passing argument 1 of 'ajSysStrtokR' > discards qualifiers from pointer target type > make[1]: *** [ajjava.lo] Error 1 > make: *** [all-recursive] Error 1 > ### execution of make failed, exit code 2 > Removing runtime build-lock... > Removing build-lock package... > /sw/bin/dpkg-lockwait -r fink-buildlock-emboss-4.1.0-1 > (Reading database ... 144792 files and directories currently > installed.) > Removing fink-buildlock-emboss-4.1.0-1 ... > Failed: phase compiling: emboss-4.1.0-1 failed > From ajb at ebi.ac.uk Fri Apr 6 14:25:25 2007 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 6 Apr 2007 19:25:25 +0100 (BST) Subject: [EMBOSS] Fwd: emboss-4.1.0-1 on a (new) intel iMac In-Reply-To: <16CD73A3-FB61-45BC-A3BA-403DEE2954E8@earthlink.net> References: <16CD73A3-FB61-45BC-A3BA-403DEE2954E8@earthlink.net> Message-ID: <39547.81.98.244.247.1175883925.squirrel@webmail.ebi.ac.uk> Hello Koen, Emboss itself does not need a password but Jemboss can be configured to require usernames/passwords. That's why crypt.h is there for some OSs. I'll put a test for intel Macs in there after I get back from holiday. If you don't require Jemboss then make sure that the -DHAVE_JAVA definition doesn't appear (i.e. don't use the --with-java and --with-javaos switches when configuring). The contents of ajjava.c and jembossctl.c (which also includes crypt.h) will then be ignored during compilation. HTH Alan From vivek.menon79 at gmail.com Thu Apr 12 14:53:12 2007 From: vivek.menon79 at gmail.com (Vivek Menon) Date: Thu, 12 Apr 2007 14:53:12 -0400 Subject: [EMBOSS] Problem in profiling water and needle programs in the EMBOSS package Message-ID: Hello all, I am having issues compiling the water and needle programs from the EMBOSS package. 1. I configured the package with --with-gccprofiling option which ensured that all the CFLAGS and LDFLAGS are set with -pg option. -bash-3.00$ ./water Smith-Waterman local alignment. Input sequence: ../../ncbi/build/myquery.txt Second sequence(s): ../../ncbi/build/ecoli.nt Gap opening penalty [10.0]: Gap extension penalty [0.5]: Output alignment [test1.water]: 2. the gmon.out file is created, however I get the foll. message -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt gprof: water: not in a.out format has anyone had this problem?? Thanks in advance, Vivek From ajb at ebi.ac.uk Thu Apr 12 16:42:35 2007 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 12 Apr 2007 21:42:35 +0100 (BST) Subject: [EMBOSS] Problem in profiling water and needle programs in the EMBOSS package In-Reply-To: References: Message-ID: <56453.81.98.244.247.1176410555.squirrel@webmail.ebi.ac.uk> That is likely to be because, unless you do a 'make install' the files in the 'emboss' directory are libtool scripts that call the true executables (which are held in the 'emboss/.libs' subdirectory after compilation). You may get away with typing: gprof .libs/water gmon.out > gprof_water_ecoli01.txt on some systems/configurations. However, the recommended way is to use --prefix when you configure emboss (e.g. --prefix=/usr/local/emboss) and do a 'make install'. Then use the true executable in (e.g.) /usr/local/emboss/bin HTH Alan > Hello all, > I am having issues compiling the water and needle programs from the > EMBOSS package. > 1. I configured the package with --with-gccprofiling option which > ensured that all the CFLAGS and LDFLAGS are set with -pg option. > -bash-3.00$ ./water > Smith-Waterman local alignment. > Input sequence: ../../ncbi/build/myquery.txt > Second sequence(s): ../../ncbi/build/ecoli.nt > Gap opening penalty [10.0]: > Gap extension penalty [0.5]: > Output alignment [test1.water]: > 2. the gmon.out file is created, however I get the foll. message > -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt > gprof: water: not in a.out format > > has anyone had this problem?? > Thanks in advance, > Vivek > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From vivek.menon79 at gmail.com Thu Apr 12 18:27:13 2007 From: vivek.menon79 at gmail.com (Vivek Menon) Date: Thu, 12 Apr 2007 18:27:13 -0400 Subject: [EMBOSS] Problem in profiling water and needle programs in the EMBOSS package In-Reply-To: <56453.81.98.244.247.1176410555.squirrel@webmail.ebi.ac.uk> References: <56453.81.98.244.247.1176410555.squirrel@webmail.ebi.ac.uk> Message-ID: Thanks for the info. I reconfigured the package with options --prefix=$HOME and --with-gccprofiling. I executed the water program from the bin directory and this is what I got: -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt BFD: water(.rela.plt): relocation 0 has invalid symbol index 0 BFD: water(.rela.plt): relocation 1 has invalid symbol index 0 BFD: water(.rela.plt): relocation 2 has invalid symbol index 0 BFD: water(.rela.plt): relocation 3 has invalid symbol index 0 BFD: water(.rela.plt): relocation 4 has invalid symbol index 0 BFD: water(.rela.plt): relocation 5 has invalid symbol index 0 BFD: water(.rela.plt): relocation 6 has invalid symbol index 0 BFD: water(.rela.plt): relocation 7 has invalid symbol index 0 BFD: water(.rela.plt): relocation 8 has invalid symbol index 0 BFD: water(.rela.plt): relocation 9 has invalid symbol index 0 BFD: water(.rela.plt): relocation 10 has invalid symbol index 0 BFD: water(.rela.plt): relocation 11 has invalid symbol index 0 BFD: water(.rela.plt): relocation 12 has invalid symbol index 0 BFD: water(.rela.plt): relocation 13 has invalid symbol index 0 BFD: water(.rela.plt): relocation 14 has invalid symbol index 0 BFD: water(.rela.plt): relocation 15 has invalid symbol index 0 BFD: water(.rela.plt): relocation 16 has invalid symbol index 0 BFD: water(.rela.plt): relocation 17 has invalid symbol index 0 BFD: water(.rela.plt): relocation 18 has invalid symbol index 0 BFD: water(.rela.plt): relocation 19 has invalid symbol index 0 BFD: water(.rela.plt): relocation 20 has invalid symbol index 0 BFD: water(.rela.plt): relocation 21 has invalid symbol index 0 BFD: water(.rela.plt): relocation 22 has invalid symbol index 0 BFD: water(.rela.plt): relocation 23 has invalid symbol index 0 BFD: water(.rela.plt): relocation 24 has invalid symbol index 0 BFD: water(.rela.plt): relocation 25 has invalid symbol index 0 BFD: water(.rela.plt): relocation 26 has invalid symbol index 0 BFD: water(.rela.plt): relocation 27 has invalid symbol index 0 BFD: water(.rela.plt): relocation 28 has invalid symbol index 0 BFD: water(.rela.plt): relocation 29 has invalid symbol index 0 BFD: water(.rela.plt): relocation 30 has invalid symbol index 0 BFD: water(.rela.plt): relocation 31 has invalid symbol index 0 BFD: water(.rela.plt): relocation 32 has invalid symbol index 0 BFD: water(.rela.plt): relocation 33 has invalid symbol index 0 BFD: water(.rela.plt): relocation 34 has invalid symbol index 0 BFD: water(.rela.plt): relocation 35 has invalid symbol index 0 BFD: water(.rela.plt): relocation 36 has invalid symbol index 0 BFD: water(.rela.plt): relocation 37 has invalid symbol index 0 BFD: water(.rela.plt): relocation 38 has invalid symbol index 0 BFD: water(.rela.plt): relocation 39 has invalid symbol index 0 BFD: water(.rela.plt): relocation 40 has invalid symbol index 0 BFD: water(.rela.plt): relocation 41 has invalid symbol index 0 BFD: water(.rela.plt): relocation 42 has invalid symbol index 0 BFD: water(.rela.plt): relocation 43 has invalid symbol index 0 -------------------------- what's going wrong now?? BTW I am using a linux-powerpc ppc64 machine. Thanks, Vivek On 4/12/07, ajb at ebi.ac.uk wrote: > That is likely to be because, unless you do a 'make install' the files > in the 'emboss' directory are libtool scripts that call the true > executables (which are held in the 'emboss/.libs' subdirectory after > compilation). > > You may get away with typing: > gprof .libs/water gmon.out > gprof_water_ecoli01.txt > > on some systems/configurations. However, the recommended way is > to use --prefix when you configure emboss (e.g. --prefix=/usr/local/emboss) > and do a 'make install'. Then use the true executable in (e.g.) > /usr/local/emboss/bin > > HTH > > Alan > > > > Hello all, > > I am having issues compiling the water and needle programs from the > > EMBOSS package. > > 1. I configured the package with --with-gccprofiling option which > > ensured that all the CFLAGS and LDFLAGS are set with -pg option. > > -bash-3.00$ ./water > > Smith-Waterman local alignment. > > Input sequence: ../../ncbi/build/myquery.txt > > Second sequence(s): ../../ncbi/build/ecoli.nt > > Gap opening penalty [10.0]: > > Gap extension penalty [0.5]: > > Output alignment [test1.water]: > > 2. the gmon.out file is created, however I get the foll. message > > -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt > > gprof: water: not in a.out format > > > > has anyone had this problem?? > > Thanks in advance, > > Vivek > > _______________________________________________ > > EMBOSS mailing list > > EMBOSS at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/emboss > > > > > From ajb at ebi.ac.uk Thu Apr 12 19:27:19 2007 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 13 Apr 2007 00:27:19 +0100 (BST) Subject: [EMBOSS] Problem in profiling water and needle programs in the EMBOSS package In-Reply-To: References: <56453.81.98.244.247.1176410555.squirrel@webmail.ebi.ac.uk> Message-ID: <60149.81.98.244.247.1176420439.squirrel@webmail.ebi.ac.uk> You probably also need to 'make clean' and then configure again, this time also adding '--disable-shared' on the configuration line. That will cause static libraries to be used. HTH Alan > Thanks for the info. > I reconfigured the package with options --prefix=$HOME and > --with-gccprofiling. > I executed the water program from the bin directory and this is what I > got: > -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt > BFD: water(.rela.plt): relocation 0 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 1 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 2 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 3 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 4 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 5 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 6 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 7 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 8 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 9 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 10 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 11 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 12 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 13 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 14 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 15 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 16 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 17 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 18 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 19 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 20 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 21 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 22 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 23 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 24 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 25 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 26 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 27 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 28 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 29 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 30 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 31 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 32 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 33 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 34 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 35 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 36 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 37 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 38 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 39 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 40 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 41 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 42 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 43 has invalid symbol index 0 > -------------------------- > > what's going wrong now?? BTW I am using a linux-powerpc ppc64 machine. > Thanks, > Vivek > > On 4/12/07, ajb at ebi.ac.uk wrote: >> That is likely to be because, unless you do a 'make install' the files >> in the 'emboss' directory are libtool scripts that call the true >> executables (which are held in the 'emboss/.libs' subdirectory after >> compilation). >> >> You may get away with typing: >> gprof .libs/water gmon.out > gprof_water_ecoli01.txt >> >> on some systems/configurations. However, the recommended way is >> to use --prefix when you configure emboss (e.g. >> --prefix=/usr/local/emboss) >> and do a 'make install'. Then use the true executable in (e.g.) >> /usr/local/emboss/bin >> >> HTH >> >> Alan >> >> >> > Hello all, >> > I am having issues compiling the water and needle programs from the >> > EMBOSS package. >> > 1. I configured the package with --with-gccprofiling option which >> > ensured that all the CFLAGS and LDFLAGS are set with -pg option. >> > -bash-3.00$ ./water >> > Smith-Waterman local alignment. >> > Input sequence: ../../ncbi/build/myquery.txt >> > Second sequence(s): ../../ncbi/build/ecoli.nt >> > Gap opening penalty [10.0]: >> > Gap extension penalty [0.5]: >> > Output alignment [test1.water]: >> > 2. the gmon.out file is created, however I get the foll. message >> > -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt >> > gprof: water: not in a.out format >> > >> > has anyone had this problem?? >> > Thanks in advance, >> > Vivek >> > _______________________________________________ >> > EMBOSS mailing list >> > EMBOSS at lists.open-bio.org >> > http://lists.open-bio.org/mailman/listinfo/emboss >> > >> >> >> > From jjplawnewera at yahoo.co.uk Thu Apr 12 21:28:03 2007 From: jjplawnewera at yahoo.co.uk (john p) Date: Fri, 13 Apr 2007 01:28:03 +0000 (GMT) Subject: [EMBOSS] How to compile water.c Message-ID: <268222.98460.qm@web27001.mail.ukl.yahoo.com> Greeting wise ones,, My name is Justin from Malaysia. I've just started a postgrad research on accelerating bioinformatics applications. My current task is to analyze and profile the smith-waterman algorithm. I dont have much experience on C programming and am just picking up. I need to compile water.c in Win XP. I'm currently using Visual Studio C++ Express and Dev-C++. When trying to compile water.c, i encountered many problems... they were a lot of linking errors and stuff... Plus i need to enable profiling info (gmon.out) so that i can profile it using gprof. Maybe i got off to a bad start.. so i want to try again properly. Could you give me some guide/intructions on how to compile water.c? and where do i find the complete list of header and function files needed to compile with water.c? Please advise. Justin ___________________________________________________________ Yahoo! Answers - Got a question? Someone out there knows the answer. Try it now. http://uk.answers.yahoo.com/ From Nick at alekta.ru Thu Apr 12 23:20:47 2007 From: Nick at alekta.ru (=?koi8-r?B?98/Sz8LDz9cg7snLz8zByiD3wcTJzc/Xyd4=?=) Date: Fri, 13 Apr 2007 10:20:47 +0700 Subject: [EMBOSS] How to compile water.c Message-ID: <39C84EE794985249993243D376DEBFA5C5287B@MAIL2.alekta.ru> Justin, 3 days ago I have been try in struggling with this problem. If you have MSDN installed on your computer see in it contents explorer: * Win32 and COM Development o Development Guides * UNIX Application Migration Guide * Chapter 9: Win32 Code Conversion Or go on link: http://search.microsoft.com/results.aspx?mkt=en-US&setlang=en-US&q=Overview+o f+the+UNIX+Application+Migration+Guide If you make a decision to port header files, you must be convert all UNIX scecifics: - UNIX creates a new process by using fork - converting UNIX code to Win32 requires the use of new techniques replacing the use of some UNIX signals - specific in working with threads - synchronization issues - specific in users, groups and security management - specific in file and data access management - an so on. Also, you must come to know the particulars of some header files, absent in Win32, i.e.: - dirent.h - dirent_w32.h - win32.h - - - and some else Regards, Nick. -----Original Message----- From: emboss-bounces at lists.open-bio.org [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of john p Sent: Friday, April 13, 2007 8:28 AM To: emboss at lists.open-bio.org Subject: [EMBOSS] How to compile water.c Greeting wise ones,, My name is Justin from Malaysia. I've just started a postgrad research on accelerating bioinformatics applications. My current task is to analyze and profile the smith-waterman algorithm. I dont have much experience on C programming and am just picking up. I need to compile water.c in Win XP. I'm currently using Visual Studio C++ Express and Dev-C++. When trying to compile water.c, i encountered many problems... they were a lot of linking errors and stuff... Plus i need to enable profiling info (gmon.out) so that i can profile it using gprof. Maybe i got off to a bad start.. so i want to try again properly. Could you give me some guide/intructions on how to compile water.c? and where do i find the complete list of header and function files needed to compile with water.c? Please advise. Justin ___________________________________________________________ Yahoo! Answers - Got a question? Someone out there knows the answer. Try it now. http://uk.answers.yahoo.com/ _______________________________________________ EMBOSS mailing list EMBOSS at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Fri Apr 13 06:09:52 2007 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 13 Apr 2007 11:09:52 +0100 Subject: [EMBOSS] Profiling and testing water In-Reply-To: References: Message-ID: <461F56F0.3000707@ebi.ac.uk> Vivek Menon wrote: > Hello all, I am having issues compiling the water and needle programs from > the EMBOSS package. That makes 3 related requests in the past week! It seems profiling and looking at the code for water is becoming popular. For those who want to play with the code, it may be helpful to describe how the EMBOSS QA testing works. So far this has just been run internally to check that code changes have not broken anything. Firstly, edit file test/.embossrc to set the locations of the source test directory (emboss_qadata) and the installed test directory (emboss_testdata). The install directory is used for the test databases tsw, tembl (etc.) provided with the EMBOSS distribution. The source test directory is used so that the results of one test can be used in another. cd to the source test directory. cd to the qa subdirectory. Run all the QA tests using: ../../scripts/qatest.pl -without=srs (the command line option turns off tests that require SRS installed locally) Run one selected QA test: ../../scripts/qatest.pl water-ex Tests run in a subdirectory with the name of the test (test/qa/water-ex) If the test succeeds, the directory is removed (the command line option -kk keeps the directory). New tests are easy to define - add them to test/qatest.dat Each test has to have a unique name. Descriptions of the definition line types are in the top of the file. Tests assume files stderr and stdout are created and empty. All other output files must be included in the test definition (getting a surprise new file is an error). The .embossrc file defines the date to be 15-jul-2006 so do not be surprised if you see that date in your output - we use it to keep the results constant when updating the documentation. All the *-ex tests are examples for the manuals. Have fun!!! Peter From vivek.menon79 at gmail.com Fri Apr 13 10:10:15 2007 From: vivek.menon79 at gmail.com (Vivek Menon) Date: Fri, 13 Apr 2007 10:10:15 -0400 Subject: [EMBOSS] Problem in profiling water and needle programs in the EMBOSS package In-Reply-To: <60149.81.98.244.247.1176420439.squirrel@webmail.ebi.ac.uk> References: <56453.81.98.244.247.1176410555.squirrel@webmail.ebi.ac.uk> <60149.81.98.244.247.1176420439.squirrel@webmail.ebi.ac.uk> Message-ID: I still get these error messages. BFD: needle(.rela.plt): relocation 101 has invalid symbol index 0 BFD: needle(.rela.plt): relocation 102 has invalid symbol index 0 BFD: needle(.rela.plt): relocation 103 has invalid symbol index 0 BFD: needle(.rela.plt): relocation 104 has invalid symbol index 0 BFD: needle(.rela.plt): relocation 105 has invalid symbol index 0 Based on your previous message, I deleted the directory and did a fresh install with ./configure --prefix=$HOME --with-gccprofilling --disable-shared make install -bash-3.00$ ls bin include lib share cd bin ./water gprof water gmon.out >gprof_water_ecoli1.txt .......Error messages... The gprof file is created now and I see these error messages. The whoe point in my profiling water is to determine the functions utilizing max. CPU time and function calls. is this information affected by the error messages or by creating static libraries? Thanks once again. Vivek On 4/12/07, ajb at ebi.ac.uk wrote: > You probably also need to 'make clean' and then configure again, > this time also adding '--disable-shared' on the configuration > line. That will cause static libraries to be used. > > HTH > > Alan > > > > Thanks for the info. > > I reconfigured the package with options --prefix=$HOME and > > --with-gccprofiling. > > I executed the water program from the bin directory and this is what I > > got: > > -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt > > BFD: water(.rela.plt): relocation 0 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 1 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 2 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 3 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 4 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 5 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 6 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 7 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 8 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 9 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 10 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 11 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 12 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 13 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 14 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 15 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 16 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 17 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 18 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 19 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 20 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 21 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 22 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 23 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 24 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 25 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 26 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 27 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 28 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 29 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 30 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 31 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 32 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 33 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 34 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 35 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 36 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 37 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 38 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 39 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 40 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 41 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 42 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 43 has invalid symbol index 0 > > -------------------------- > > > > what's going wrong now?? BTW I am using a linux-powerpc ppc64 machine. > > Thanks, > > Vivek > > > > On 4/12/07, ajb at ebi.ac.uk wrote: > >> That is likely to be because, unless you do a 'make install' the files > >> in the 'emboss' directory are libtool scripts that call the true > >> executables (which are held in the 'emboss/.libs' subdirectory after > >> compilation). > >> > >> You may get away with typing: > >> gprof .libs/water gmon.out > gprof_water_ecoli01.txt > >> > >> on some systems/configurations. However, the recommended way is > >> to use --prefix when you configure emboss (e.g. > >> --prefix=/usr/local/emboss) > >> and do a 'make install'. Then use the true executable in (e.g.) > >> /usr/local/emboss/bin > >> > >> HTH > >> > >> Alan > >> > >> > >> > Hello all, > >> > I am having issues compiling the water and needle programs from the > >> > EMBOSS package. > >> > 1. I configured the package with --with-gccprofiling option which > >> > ensured that all the CFLAGS and LDFLAGS are set with -pg option. > >> > -bash-3.00$ ./water > >> > Smith-Waterman local alignment. > >> > Input sequence: ../../ncbi/build/myquery.txt > >> > Second sequence(s): ../../ncbi/build/ecoli.nt > >> > Gap opening penalty [10.0]: > >> > Gap extension penalty [0.5]: > >> > Output alignment [test1.water]: > >> > 2. the gmon.out file is created, however I get the foll. message > >> > -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt > >> > gprof: water: not in a.out format > >> > > >> > has anyone had this problem?? > >> > Thanks in advance, > >> > Vivek > >> > _______________________________________________ > >> > EMBOSS mailing list > >> > EMBOSS at lists.open-bio.org > >> > http://lists.open-bio.org/mailman/listinfo/emboss > >> > > >> > >> > >> > > > > > From ajb at ebi.ac.uk Fri Apr 13 12:23:01 2007 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 13 Apr 2007 17:23:01 +0100 (BST) Subject: [EMBOSS] Problem in profiling water and needle programs in the EMBOSS package In-Reply-To: References: <56453.81.98.244.247.1176410555.squirrel@webmail.ebi.ac.uk> <60149.81.98.244.247.1176420439.squirrel@webmail.ebi.ac.uk> Message-ID: <53807.81.98.244.247.1176481381.squirrel@webmail.ebi.ac.uk> Hello Vivek, > I still get these error messages. > BFD: needle(.rela.plt): relocation 101 has invalid symbol index 0 > BFD: needle(.rela.plt): relocation 102 has invalid symbol index 0 > BFD: needle(.rela.plt): relocation 103 has invalid symbol index 0 > BFD: needle(.rela.plt): relocation 104 has invalid symbol index 0 > BFD: needle(.rela.plt): relocation 105 has invalid symbol index 0 Then I'd guess that there are some ppc64 ELF problems on your linux ppc64 system. I can now only suggest that any available updates are applied to your linux ppc64 distribution - there were some ppc64 binutils package ELF problems with symbol tables last year I see. If that isn't possible then try to gain access to a linux x86 or x86_64 system. > Based on your previous message, I deleted the directory and did a > fresh install with > ./configure --prefix=$HOME --with-gccprofilling --disable-shared I think you meant --with-gccprofile > make install > -bash-3.00$ ls > bin include lib share > > cd bin > ./water > gprof water gmon.out >gprof_water_ecoli1.txt > .......Error messages... > The gprof file is created now and I see these error messages. The whoe > point in my profiling water is to determine the functions utilizing > max. CPU time and function calls. What you are doing is correct, and indeed works without error on Linux x86 and x86_64 systems (I have just tried it on Fedora 32bit and 64bit distros). > is this information affected by the error messages or by creating > static libraries? If sensible-looking profiling information is being produced in gprof_water_ecoli1.txt then it is not going to be affected by using static libraries (and likely not by relocation errors - but I'd be happier if the errors weren't there). HTH Alan From openlinuxsource at gmail.com Sat Apr 14 09:20:42 2007 From: openlinuxsource at gmail.com (Lee Amy) Date: Sat, 14 Apr 2007 21:20:42 +0800 Subject: [EMBOSS] Help: About cluster In-Reply-To: <289665360704140612t27f126c5v93ef996286566ba6@mail.gmail.com> References: <289665360704140612t27f126c5v93ef996286566ba6@mail.gmail.com> Message-ID: <289665360704140620q222303a5if5f6162861970b10@mail.gmail.com> 2007/4/14, Lee Amy : > > Hello, > > I'm a Chinese student. I build a bioinformatics Linux cluster for my > school. I've installed MpiBlast and some other parallel software package. > > Furthermore, in order to make my cluster more excellent and power, I wanna > use EMBOSS to do with it. But I meet a problem. I just know how to run > EMBOSS in local computer system, not in Linux cluster. So I really wanna > learn that how to use EMBOSS in my cluster, and what kinds of cluster manage > software I should use. > > Thanks in advance! > > Amy Lee in NEAU > > From nyachy at yahoo.co.jp Sat Apr 14 20:15:36 2007 From: nyachy at yahoo.co.jp (=?ISO-2022-JP?B?GyRCPi5MbkRNGyhCIBskQkNSSH4bKEI=?=) Date: Sun, 15 Apr 2007 09:15:36 +0900 (JST) Subject: [EMBOSS] pepstat algorythm Message-ID: <20070415001536.44835.qmail@web3711.mail.tnz.yahoo.co.jp> Dear friends I would like to know how the extinction coefficients for proteins at 280 nm in pepstat. I read the source code and reference paper but still I could not understand. could somebody tell me the more informative reference paper or the formula of the algorithm. Thank you in advance nyachy From molatwork at yahoo.es Sun Apr 15 02:47:54 2007 From: molatwork at yahoo.es (Miguel Ortiz-Lombardia) Date: Sun, 15 Apr 2007 08:47:54 +0200 Subject: [EMBOSS] pepstat algorythm In-Reply-To: <20070415001536.44835.qmail@web3711.mail.tnz.yahoo.co.jp> References: <20070415001536.44835.qmail@web3711.mail.tnz.yahoo.co.jp> Message-ID: <4621CA9A.8030504@yahoo.es> -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 Dear Nyachy, I don't know about the formula used in pepstat. But there are several ways of calculating the extintion coefficient of a protein at 280 nm, using its sequence. Have a look at the ProtParam (at Expasy) documentation: http://www.expasy.ch/tools/protparam-doc.html There, they explain several possible choices and give references about them. Cheers, Miguel En/na ??? ?? ha escrit: > Dear friends > > I would like to know how the extinction coefficients for > proteins at 280 nm in pepstat. > > I read the source code and reference paper but still I > could not understand. > > could somebody tell me the more informative reference > paper or the formula of the algorithm. > > Thank you in advance > > nyachy > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > - -- Miguel Ortiz Lombard?a Centro de Investigaciones Oncol?gicas C/ Melchor Fern?ndez Almagro, 3 28029 Madrid, Spain Tel. +34 912 246 900 Fax. +34 912 246 976 e-mail: molatwork at yahoo.es - ---------------------------------------------------------------------- Et ainsi ne pouvant faire que ce qui est juste f?t fort, on a fait que ce qui est fort f?t juste. Blaise Pascal, Pens?es -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.4.5 (Darwin) iD8DBQFGIcqZF6oOrDvhbQIRAozcAJ9Z9lKr9HyB0QshtBX5FpR3CDGoZQCaA5X/ x5+6L5u6deCU0xTE2aHdRnA= =cAIb -----END PGP SIGNATURE----- From ajb at ebi.ac.uk Sun Apr 15 03:40:30 2007 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Sun, 15 Apr 2007 08:40:30 +0100 (BST) Subject: [EMBOSS] pepstat algorythm In-Reply-To: <20070415001536.44835.qmail@web3711.mail.tnz.yahoo.co.jp> References: <20070415001536.44835.qmail@web3711.mail.tnz.yahoo.co.jp> Message-ID: <36808.81.98.244.247.1176622830.squirrel@webmail.ebi.ac.uk> >From looking at the source code: The program uses per amino acid values for the extinction coefficient. It gets them from the Eamino.dat data file in the EMBOSS distribution. Extinction coefficients are based on the values of Gill and von Hippel (1989) Anal Biochem 182 319-326. It sums the values over the sequence and reports that. It then calculates the 1mg/ml value by taking the above value and dividing it by the molecular weight. HTH Alan > Dear friends > > I would like to know how the extinction coefficients for > proteins at 280 nm in pepstat. > > I read the source code and reference paper but still I > could not understand. > > could somebody tell me the more informative reference > paper or the formula of the algorithm. > > Thank you in advance > > nyachy > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From jison at ebi.ac.uk Mon Apr 16 11:41:59 2007 From: jison at ebi.ac.uk (Jon Ison) Date: Mon, 16 Apr 2007 16:41:59 +0100 (BST) Subject: [EMBOSS] How to compile water.c In-Reply-To: <39C84EE794985249993243D376DEBFA5C5287B@MAIL2.alekta.ru> References: <39C84EE794985249993243D376DEBFA5C5287B@MAIL2.alekta.ru> Message-ID: <35484.84.92.187.247.1176738119.squirrel@webmail.ebi.ac.uk> Hi Justin You might be better off using the native windows code for EMBOSS developed by Alan Bleasby - which I don't think is available via our website yet but Alan can provide. Feel free to email emboss-bug about it. Cheers Jon > Justin, 3 days ago I have been try in struggling with this problem. > > If you have MSDN installed on your computer see in it contents explorer: > > * Win32 and COM Development > o Development Guides > * UNIX Application Migration Guide > * Chapter 9: Win32 Code Conversion > > Or go on link: > http://search.microsoft.com/results.aspx?mkt=en-US&setlang=en-US&q=Overview+o > f+the+UNIX+Application+Migration+Guide > > If you make a decision to port header files, you must be convert all UNIX > scecifics: > - UNIX creates a new process by using fork > - converting UNIX code to Win32 requires the use of new techniques replacing > the use of some UNIX signals > - specific in working with threads > - synchronization issues > - specific in users, groups and security management > - specific in file and data access management > - an so on. > > Also, you must come to know the particulars of some header files, absent in > Win32, i.e.: > - dirent.h > - dirent_w32.h > - win32.h > - > - > - and some else > > > Regards, Nick. > > -----Original Message----- > From: emboss-bounces at lists.open-bio.org > [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of john p > Sent: Friday, April 13, 2007 8:28 AM > To: emboss at lists.open-bio.org > Subject: [EMBOSS] How to compile water.c > > Greeting wise ones,, > > My name is Justin from Malaysia. I've just started a postgrad research on > accelerating bioinformatics applications. > > My current task is to analyze and profile the smith-waterman algorithm. I > dont have much experience on C programming and am just picking up. I need to > compile water.c in Win XP. I'm currently using Visual Studio C++ Express and > Dev-C++. > > When trying to compile water.c, i encountered many problems... they were a > lot of linking errors and stuff... Plus i need to enable profiling info > (gmon.out) so that i can profile it using gprof. > Maybe i got off to a bad start.. so i want to try again properly. > > Could you give me some guide/intructions on how to compile water.c? and where > do i find the complete list of header and function files needed to compile > with water.c? > > Please advise. > > Justin > > > ___________________________________________________________ > Yahoo! Answers - Got a question? Someone out there knows the answer. Try it > now. > http://uk.answers.yahoo.com/ > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From openlinuxsource at gmail.com Wed Apr 18 06:42:00 2007 From: openlinuxsource at gmail.com (Lee Amy) Date: Wed, 18 Apr 2007 18:42:00 +0800 Subject: [EMBOSS] Help: About cluster Message-ID: <289665360704180342v68bde7cfg1bc5839527fb4770@mail.gmail.com> Hi, At first, I shoud say thanks very much to some one who helped me last time. And I got a new problem about my task Linux Beowulf cluster. I have 4 workstation as my nodes, and a server as a master. I wanna know about the Emboss package that how many task should I start? Thanks in advance! Amy Lee From anette.becher at agresearch.co.nz Mon Apr 23 16:54:09 2007 From: anette.becher at agresearch.co.nz (Becher, Anette) Date: Tue, 24 Apr 2007 08:54:09 +1200 Subject: [EMBOSS] Compseq DNA/Protein sequence problem Message-ID: Hi all, I believe I *may* have found a bug in compseq. I have been using compseq to calculate the frequency of amino acids in translated DNA sequences. I find that frequently compseq takes the amino acid sequence to be DNA (they are sequences with an unusual composition, but then I am looking for odd proteins). So instead of the expected output for all amino acids with most being zero, I often get output for A,C,G,T and 'other'. I cannot see an obvious pattern that would explain this behaviour, but maybe you can help. Command line: compseq -seq compseq_bug.in -word 1 -frame 1 -out compseq_bug.out An example input and output file are pasted in below - I can provide many more. It might help if the user could specify whether the input sequence is DNA or protein, rather than the program working it out somehow? Best wishes Anette Here is an example of the problem: >Seq1 GSGGGGGSGGRGMGGWGGGRGSGVGGRGWGVG # # Output from 'compseq' # # Only words in frame 1 will be counted. # The Expected frequencies are calculated on the (false) assumption that every # word has equal frequency. # # The input sequences are: # Seq1 Word size 1 Total count 31 # # Word Obs Count Obs Frequency Exp Frequency Obs/Exp Frequency # A 0 0.0000000 0.2500000 0.0000000 C 0 0.0000000 0.2500000 0.0000000 G 20 0.6451613 0.2500000 2.5806452 T 0 0.0000000 0.2500000 0.0000000 Other 11 0.3548387 0.0000000 10000000000.0000000 Here is a similar sequence that works fine: >Seq2 VGSEGGGGGRRGEGGGGGGRGGGGGRWEEGAG # # Output from 'compseq' # # Only words in frame 1 will be counted. # The Expected frequencies are calculated on the (false) assumption that every # word has equal frequency. # # The input sequences are: # Seq2 Word size 1 Total count 31 # # Word Obs Count Obs Frequency Exp Frequency Obs/Exp Frequency # A 1 0.0322581 0.0476190 0.6774194 C 0 0.0000000 0.0476190 0.0000000 D 0 0.0000000 0.0476190 0.0000000 E 4 0.1290323 0.0476190 2.7096774 F 0 0.0000000 0.0476190 0.0000000 G 20 0.6451613 0.0476190 13.5483871 H 0 0.0000000 0.0476190 0.0000000 I 0 0.0000000 0.0476190 0.0000000 K 0 0.0000000 0.0476190 0.0000000 L 0 0.0000000 0.0476190 0.0000000 M 0 0.0000000 0.0476190 0.0000000 N 0 0.0000000 0.0476190 0.0000000 P 0 0.0000000 0.0476190 0.0000000 Q 0 0.0000000 0.0476190 0.0000000 R 4 0.1290323 0.0476190 2.7096774 S 1 0.0322581 0.0476190 0.6774194 T 0 0.0000000 0.0476190 0.0000000 U 0 0.0000000 0.0476190 0.0000000 V 0 0.0000000 0.0476190 0.0000000 W 1 0.0322581 0.0476190 0.6774194 Y 0 0.0000000 0.0476190 0.0000000 ======================================================================= Attention: The information contained in this message and/or attachments from AgResearch Limited is intended only for the persons or entities to which it is addressed and may contain confidential and/or privileged material. Any review, retransmission, dissemination or other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipients is prohibited by AgResearch Limited. If you have received this message in error, please notify the sender immediately. ======================================================================= From bernd.web at gmail.com Mon Apr 23 17:28:15 2007 From: bernd.web at gmail.com (Bernd Web) Date: Mon, 23 Apr 2007 23:28:15 +0200 Subject: [EMBOSS] Compseq DNA/Protein sequence problem In-Reply-To: References: Message-ID: <716af09c0704231428s101d5f5dnc2cbc7f572a60183@mail.gmail.com> Hi Annette, Your seq1 is incorrectly guessed to be a nucleotide sequence, since you state it's protein. EMBOSS provides a boolean to state nucleotide or protein nature of your sequence, see EMBOSS help: "-sequence" associated qualifiers -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein regards, bernd On 4/23/07, Becher, Anette wrote: > Hi all, > > I believe I *may* have found a bug in compseq. > > I have been using compseq to calculate the frequency of amino acids in > translated DNA sequences. I find that frequently compseq takes the amino > acid sequence to be DNA (they are sequences with an unusual composition, > but then I am looking for odd proteins). So instead of the expected > output for all amino acids with most being zero, I often get output for > A,C,G,T and 'other'. I cannot see an obvious pattern that would explain > this behaviour, but maybe you can help. > > Command line: > > compseq -seq compseq_bug.in -word 1 -frame 1 -out compseq_bug.out > > An example input and output file are pasted in below - I can provide > many more. > > It might help if the user could specify whether the input sequence is > DNA or protein, rather than the program working it out somehow? > > > Best wishes > > > Anette > > > > Here is an example of the problem: > > > >Seq1 > GSGGGGGSGGRGMGGWGGGRGSGVGGRGWGVG > > > # > # Output from 'compseq' > # > # Only words in frame 1 will be counted. > # The Expected frequencies are calculated on the (false) assumption that > every > # word has equal frequency. > # > # The input sequences are: > # Seq1 > > > Word size 1 > Total count 31 > > # > # Word Obs Count Obs Frequency Exp Frequency Obs/Exp > Frequency > # > A 0 0.0000000 0.2500000 0.0000000 > C 0 0.0000000 0.2500000 0.0000000 > G 20 0.6451613 0.2500000 2.5806452 > T 0 0.0000000 0.2500000 0.0000000 > > Other 11 0.3548387 0.0000000 > 10000000000.0000000 > > > > > Here is a similar sequence that works fine: > > > >Seq2 > VGSEGGGGGRRGEGGGGGGRGGGGGRWEEGAG > > > > # > # Output from 'compseq' > # > # Only words in frame 1 will be counted. > # The Expected frequencies are calculated on the (false) assumption that > every > # word has equal frequency. > # > # The input sequences are: > # Seq2 > > > Word size 1 > Total count 31 > > # > # Word Obs Count Obs Frequency Exp Frequency Obs/Exp > Frequency > # > A 1 0.0322581 0.0476190 0.6774194 > C 0 0.0000000 0.0476190 0.0000000 > D 0 0.0000000 0.0476190 0.0000000 > E 4 0.1290323 0.0476190 2.7096774 > F 0 0.0000000 0.0476190 0.0000000 > G 20 0.6451613 0.0476190 13.5483871 > H 0 0.0000000 0.0476190 0.0000000 > I 0 0.0000000 0.0476190 0.0000000 > K 0 0.0000000 0.0476190 0.0000000 > L 0 0.0000000 0.0476190 0.0000000 > M 0 0.0000000 0.0476190 0.0000000 > N 0 0.0000000 0.0476190 0.0000000 > P 0 0.0000000 0.0476190 0.0000000 > Q 0 0.0000000 0.0476190 0.0000000 > R 4 0.1290323 0.0476190 2.7096774 > S 1 0.0322581 0.0476190 0.6774194 > T 0 0.0000000 0.0476190 0.0000000 > U 0 0.0000000 0.0476190 0.0000000 > V 0 0.0000000 0.0476190 0.0000000 > W 1 0.0322581 0.0476190 0.6774194 > Y 0 0.0000000 0.0476190 0.0000000 > ======================================================================= > Attention: The information contained in this message and/or attachments > from AgResearch Limited is intended only for the persons or entities > to which it is addressed and may contain confidential and/or privileged > material. Any review, retransmission, dissemination or other use of, or > taking of any action in reliance upon, this information by persons or > entities other than the intended recipients is prohibited by AgResearch > Limited. If you have received this message in error, please notify the > sender immediately. > ======================================================================= > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From charles-listes-emboss at plessy.org Wed Apr 25 21:01:37 2007 From: charles-listes-emboss at plessy.org (Charles Plessy) Date: Thu, 26 Apr 2007 10:01:37 +0900 Subject: [EMBOSS] Does not manage to use .embossrc from the current directory. Message-ID: <20070426010137.GA6977@kunpuu.plessy.org> Dear EMBOSS programmers, I am using EMBOSS in a context where I can not expect $HOME to be set. Therefore, I created a .embossrc from a template and attempted to use it in the current directory. However, EMBOSS does not seem to read it, despite what is written in the documentation: http://emboss.sourceforge.net/docs/adminguide/node4.html Here is an example: # The template: sorbet?tmp?$ cat mirbase.embossrc DB mirbase [ type: N format: embl method: emblcd directory: /usr/share/mirbase/emboss file: *.dat ] # Creation of the .embossrc: sorbet?tmp?$ PWD=`pwd` perl -pe "s(/usr/share/mirbase/emboss)($PWD)" < mirbase.embossrc | tee .embossrc DB mirbase [ type: N format: embl method: emblcd directory: /home/charles/tmp file: *.dat ] # It does not work, but the .embossrc is functional in $HOME sorbet?tmp?$ seqret mirbase:MI0000007 stdout Reads and writes (returns) sequences Error: Failed to open filename 'mirbase' Error: Unable to read sequence 'mirbase:MI0000007' Died: seqret terminated: Bad value for '-sequence' and no prompt sorbet?tmp?$ cp .embossrc $HOME sorbet?tmp?$ seqret mirbase:MI0000007 stdout Reads and writes (returns) sequences >cel-mir-36 MI0000007 Caenorhabditis elegans miR-36 stem-loop caccgcugucggggaaccgcgccaauuuucgcuucagugcuagaccauccaaagugucua ucaccgggugaaaauucgcauggguccccgacgcgga # Strace confirms that the current dir is not searched for .embossrc sorbet?tmp?$ rm $HOME/.embossrc sorbet?tmp?$ strace seqret mirbase:MI0000007 stdout 2>&1 | grep embossrc open("/home/charles/.embossrc", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory) sorbet?tmp?$ strace seqret mirbase:MI0000007 stdout 2>&1 | grep emboss.default open("/usr/share/EMBOSS/emboss.default", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory) open("/home/charles/debian/EMBOSS-4.1.0/emboss/emboss.default", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory) Interestingly, it searches also emboss.default in a place which is not expected: where I compiled EMBOSS... Can I have made a mistake at compilation time which would prevent `pwd`/.embossrc to be parsed? Have a nice day, -- Charles Plessy Debian-Med packaging team http://www.debian.org/devel/debian-med/ Wako, Saitama, Japan From pmr at ebi.ac.uk Thu Apr 26 06:44:44 2007 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 26 Apr 2007 11:44:44 +0100 Subject: [EMBOSS] Does not manage to use .embossrc from the current directory. In-Reply-To: <20070426010137.GA6977@kunpuu.plessy.org> References: <20070426010137.GA6977@kunpuu.plessy.org> Message-ID: <4630829C.9090709@ebi.ac.uk> Charles Plessy wrote: > Dear EMBOSS programmers, > > I am using EMBOSS in a context where I can not expect $HOME to be set. > Therefore, I created a .embossrc from a template and attempted to use it in > the current directory. However, EMBOSS does not seem to read it, despite what > is written in the documentation: > > # It does not work, but the .embossrc is functional in $HOME > > sorbet?tmp?$ seqret mirbase:MI0000007 stdout Reads and writes (returns) > sequences Error: Failed to open filename 'mirbase' Error: Unable to read > sequence 'mirbase:MI0000007' Died: seqret terminated: Bad value for > '-sequence' and no prompt > > sorbet?tmp?$ cp .embossrc $HOME > > sorbet?tmp?$ seqret mirbase:MI0000007 stdout Reads and writes (returns) > sequences >> cel-mir-36 MI0000007 Caenorhabditis elegans miR-36 stem-loop > caccgcugucggggaaccgcgccaauuuucgcuucagugcuagaccauccaaagugucua > ucaccgggugaaaauucgcauggguccccgacgcgga > > # Strace confirms that the current dir is not searched for .embossrc > > sorbet?tmp?$ rm $HOME/.embossrc > > sorbet?tmp?$ strace seqret mirbase:MI0000007 stdout 2>&1 | grep embossrc > open("/home/charles/.embossrc", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such > file or directory) Ah, that is a documentation error. EMBOSS no longer looks in the current directory. We are writing a new admin guide. But another suggestion in the same part of the admin guide is what you need. EMBOSS has a way to redirect $HOME (we use it to redirect $HOME/.embossrc when running QA tests. Define EMBOSSRC to be the current directory (you can use ".") Interesting ... I had not tried strace. Looks useful. Running seqret with -debug will also report where it is trying to open files. A good way to check whether your emboss.defaults and .embossrc files were used is to run showdb -full to list all the databases you have defined. Databases in $HOME/embossrc appear as "user". Databases in $EMBOSSRC/.embossrc appear as "special" > Interestingly, it searches also emboss.default in a place which is not > expected: where I compiled EMBOSS... Can I have made a mistake at compilation > time which would prevent `pwd`/.embossrc to be parsed? This is intentional. EMBOSS looks for data files in the install directories and also in the source directory - in case users are testing EMBOSS and have not run "make install". The source directory is only searched if the installed file is not found. regards, Peter From charles-listes-emboss at plessy.org Sat Apr 28 04:23:56 2007 From: charles-listes-emboss at plessy.org (Charles Plessy) Date: Sat, 28 Apr 2007 17:23:56 +0900 Subject: [EMBOSS] Experimental packages available for EMBOSS on Debian. Message-ID: <20070428082356.GA6603@kunpuu.plessy.org> Dear all, The Debian-Med project is preparing Debian packages for EMBOSS. While our current packages are not ready for official release in Debian unstable or testing, they seem to be functionnal from a bioinformatical point of view. The issues are more about QA of the packaging - for instance there are conflicts between some EMBOSS binary names and other programs from other packages. We made our packages available in the experimental section of Debian, and would be glad to hear feedback from interested users. http://packages.debian.org/experimental/science/emboss Debian offers an increasing range of programs for bioinformatics, and using packages management tools such as apt-get, aptitude or synaptic, one can automagically install programms for which EMBOSS has a wrapper: such as dialign, primer3 and clustalw. When the EMBOSS packages will be ready, we plan to further increase our support to EMBASSY and to helper databases such as REBASE. Have a nice day, -- Charles Plessy Debian-Med pacakging team, http://www.debian.org/devel/debian-med/ From charles-listes-emboss at plessy.org Sat Apr 28 04:32:09 2007 From: charles-listes-emboss at plessy.org (Charles Plessy) Date: Sat, 28 Apr 2007 17:32:09 +0900 Subject: [EMBOSS] Does not manage to use .embossrc from the current directory. In-Reply-To: <4630829C.9090709@ebi.ac.uk> References: <20070426010137.GA6977@kunpuu.plessy.org> <4630829C.9090709@ebi.ac.uk> Message-ID: <20070428083209.GJ32455@kunpuu.plessy.org> Le Thu, Apr 26, 2007 at 11:44:44AM +0100, Peter Rice a ?crit : > > Ah, that is a documentation error. EMBOSS no longer looks in the current > directory. We are writing a new admin guide. > But another suggestion in the same part of the admin guide is what you need. > > EMBOSS has a way to redirect $HOME (we use it to redirect $HOME/.embossrc when > running QA tests. Define EMBOSSRC to be the current directory (you can use ".") Many thanks, it works well. (By the way, I get no extra information when running seqret -debug). I would like to take the opportunity of this thread for a feature request: In the Debian-Med project, we are planning to distribute some small databases as debian packages. In order to make them easily available to users, I would like that each package would deposit a small configuration file in a directory such as /etc/emboss/embossrc.d, and it would be great if embossrc files could be instructed to "INCLUDE" a whole directory. Have a nice day, -- Charles Plessy Wako, Saitama, Japan. From openlinuxsource at gmail.com Sun Apr 29 02:35:54 2007 From: openlinuxsource at gmail.com (Lee Amy) Date: Sun, 29 Apr 2007 14:35:54 +0800 Subject: [EMBOSS] Help: About Jemboss Message-ID: <289665360704282335p110cbfeau4df0c8348f64d13e@mail.gmail.com> Hi, I've installed EMBOSS-4.0.0-5, and download the Jemboss GUI. To do in my local machine, I change the runJemboss.sh in Installation Guide. When I run the Jemboss, the screen shows [root at localhost jemboss]# RunEmbossApplication2 Error executing: /usr/local/bin/wossname -colon -gui -auto Exception in thread "Thread-1" java.lang.NullPointerException at org.emboss.jemboss.programs.RunEmbossApplication2.waitFor( RunEmbossApplication2.java:338) at org.emboss.jemboss.gui.BuildProgramMenu$1.construct( BuildProgramMenu.java:256) at org.emboss.jemboss.gui.SwingWorker$2.run(SwingWorker.java:127) at java.lang.Thread.run(Thread.java:595) Java Env is JRE1.5.0_09 Can someone tell me how to solve the problem? Thanks in advance! Amy Lee From tjc at sanger.ac.uk Mon Apr 30 03:30:49 2007 From: tjc at sanger.ac.uk (Tim Carver) Date: Mon, 30 Apr 2007 08:30:49 +0100 Subject: [EMBOSS] Help: About Jemboss In-Reply-To: <289665360704282335p110cbfeau4df0c8348f64d13e@mail.gmail.com> Message-ID: Hi Amy You need to install them together with the script: EMBOSS-4.0.0-5/jemboss/utils/install-jemboss-server.sh As described at: http://emboss.sourceforge.net/Jemboss/install/setup.html Regards Tim On 29/4/07 07:35, "Lee Amy" wrote: > Hi, > > I've installed EMBOSS-4.0.0-5, and download the Jemboss GUI. To do in my > local machine, I change the runJemboss.sh in Installation Guide. When I run > the Jemboss, the screen shows > > [root at localhost jemboss]# RunEmbossApplication2 Error executing: > /usr/local/bin/wossname -colon -gui -auto > Exception in thread "Thread-1" java.lang.NullPointerException > at org.emboss.jemboss.programs.RunEmbossApplication2.waitFor( > RunEmbossApplication2.java:338) > at org.emboss.jemboss.gui.BuildProgramMenu$1.construct( > BuildProgramMenu.java:256) > at org.emboss.jemboss.gui.SwingWorker$2.run(SwingWorker.java:127) > at java.lang.Thread.run(Thread.java:595) > > Java Env is JRE1.5.0_09 > > Can someone tell me how to solve the problem? > > Thanks in advance! > > Amy Lee > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From tjc at sanger.ac.uk Mon Apr 30 06:13:00 2007 From: tjc at sanger.ac.uk (Tim Carver) Date: Mon, 30 Apr 2007 11:13:00 +0100 Subject: [EMBOSS] Help: About Jemboss In-Reply-To: Message-ID: Hi Amy It has been pointed out to me that EMBOSS-4.0.0-5 may have been supplied by someone else as an RPM. In which case it may not support Jemboss and you may need to contact the supplier. Regards Tim On 30/4/07 08:30, "Tim Carver" wrote: > Hi Amy > > You need to install them together with the script: > > EMBOSS-4.0.0-5/jemboss/utils/install-jemboss-server.sh > > As described at: > > http://emboss.sourceforge.net/Jemboss/install/setup.html > > Regards > Tim > > > On 29/4/07 07:35, "Lee Amy" wrote: > >> Hi, >> >> I've installed EMBOSS-4.0.0-5, and download the Jemboss GUI. To do in my >> local machine, I change the runJemboss.sh in Installation Guide. When I run >> the Jemboss, the screen shows >> >> [root at localhost jemboss]# RunEmbossApplication2 Error executing: >> /usr/local/bin/wossname -colon -gui -auto >> Exception in thread "Thread-1" java.lang.NullPointerException >> at org.emboss.jemboss.programs.RunEmbossApplication2.waitFor( >> RunEmbossApplication2.java:338) >> at org.emboss.jemboss.gui.BuildProgramMenu$1.construct( >> BuildProgramMenu.java:256) >> at org.emboss.jemboss.gui.SwingWorker$2.run(SwingWorker.java:127) >> at java.lang.Thread.run(Thread.java:595) >> >> Java Env is JRE1.5.0_09 >> >> Can someone tell me how to solve the problem? >> >> Thanks in advance! >> >> Amy Lee >> _______________________________________________ >> EMBOSS mailing list >> EMBOSS at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/emboss > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From kvddrift at earthlink.net Fri Apr 6 13:14:08 2007 From: kvddrift at earthlink.net (Koen van der Drift) Date: Fri, 6 Apr 2007 09:14:08 -0400 Subject: [EMBOSS] Fwd: emboss-4.1.0-1 on a (new) intel iMac References: Message-ID: <16CD73A3-FB61-45BC-A3BA-403DEE2954E8@earthlink.net> Hi, I am the maintainer of the fink package for emboss. A user reported the following error on an Intel iMac because crypt.h is missing. On a Mac most of the the functions in crypt.h are in unistd.h. So I could replace the #include crypt.h with #include unistd.h. Another reader was wondering why crypt.h is needed, is there a situation when emboss needs a password? In that case I could just comment out the #include. BTW, on a PPC iMac, there is no error because of: #if !defined(__ppc__) && !defined(__FreeBSD__) #include #endif thanks, - Koen. Begin forwarded message: > gcc -DPACKAGE_NAME=\"\" -DPACKAGE_TARNAME=\"\" -DPACKAGE_VERSION= > \"\" -DPACKAGE_STRING=\"\" -DPACKAGE_BUGREPORT=\"\" -DPACKAGE= > \"EMBOSS\" -DVERSION=\"4.1.0\" -DSTDC_HEADERS=1 - > DHAVE_SYS_TYPES_H=1 -DHAVE_SYS_STAT_H=1 -DHAVE_STDLIB_H=1 - > DHAVE_STRING_H=1 -DHAVE_MEMORY_H=1 -DHAVE_STRINGS_H=1 - > DHAVE_INTTYPES_H=1 -DHAVE_STDINT_H=1 -DHAVE_UNISTD_H=1 - > DHAVE_DLFCN_H=1 -DHAVE_DIRENT_H=1 -DSTDC_HEADERS=1 - > DHAVE_UNISTD_H=1 -DGETPGRP_VOID=1 -DHAVE_STRFTIME=1 - > DHAVE_UNISTD_H=1 -DHAVE_FORK=1 -DHAVE_VFORK=1 - > DHAVE_WORKING_VFORK=1 -DHAVE_WORKING_FORK=1 -DHAVE_VPRINTF=1 - > DHAVE_MEMMOVE=1 -DHAVE_LIBM=1 -DPLD_png=1 -I. -I. -DAJAX_FIXED_ROOT= > \"/sw/src/fink.build/emboss-4.1.0-1/EMBOSS-4.1.0/emboss\" -DPREFIX= > \"/sw\" -I../plplot -DPOSIX_MALLOC_THRESHOLD=10 -DAJ_MACOSXLF - > Dstat64=stat -I/sw/include -DLENDIAN -I/System/Library/Frameworks/ > JavaVM.framework/Versions/1.4.2/Home -DHAVE_JAVA -I/System/Library/ > Frameworks/JavaVM.framework/Versions/1.4.2/Home/include -DNO_AUTH - > O1 -c ajjava.c -fno-common -DPIC -o .libs/ajjava.o > ajjava.c:93:19: error: crypt.h: No such file or directory > ajjava.c: In function > 'Java_org_emboss_jemboss_parser_Ajax_seqsetType': > ajjava.c:335: warning: 'ajSeqsetLen' is deprecated (declared at > ajseq.h:240) > ajjava.c:337: warning: 'ajSeqsetTotweight' is deprecated (declared > at ajseq.h:259) > ajjava.c: In function 'Java_org_emboss_jemboss_parser_Ajax_fork': > ajjava.c:1251: warning: passing argument 1 of 'ajSysStrtokR' > discards qualifiers from pointer target type > ajjava.c: In function 'make_array': > ajjava.c:1525: warning: passing argument 1 of 'ajSysStrtokR' > discards qualifiers from pointer target type > make[1]: *** [ajjava.lo] Error 1 > make: *** [all-recursive] Error 1 > ### execution of make failed, exit code 2 > Removing runtime build-lock... > Removing build-lock package... > /sw/bin/dpkg-lockwait -r fink-buildlock-emboss-4.1.0-1 > (Reading database ... 144792 files and directories currently > installed.) > Removing fink-buildlock-emboss-4.1.0-1 ... > Failed: phase compiling: emboss-4.1.0-1 failed > From ajb at ebi.ac.uk Fri Apr 6 18:25:25 2007 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 6 Apr 2007 19:25:25 +0100 (BST) Subject: [EMBOSS] Fwd: emboss-4.1.0-1 on a (new) intel iMac In-Reply-To: <16CD73A3-FB61-45BC-A3BA-403DEE2954E8@earthlink.net> References: <16CD73A3-FB61-45BC-A3BA-403DEE2954E8@earthlink.net> Message-ID: <39547.81.98.244.247.1175883925.squirrel@webmail.ebi.ac.uk> Hello Koen, Emboss itself does not need a password but Jemboss can be configured to require usernames/passwords. That's why crypt.h is there for some OSs. I'll put a test for intel Macs in there after I get back from holiday. If you don't require Jemboss then make sure that the -DHAVE_JAVA definition doesn't appear (i.e. don't use the --with-java and --with-javaos switches when configuring). The contents of ajjava.c and jembossctl.c (which also includes crypt.h) will then be ignored during compilation. HTH Alan From vivek.menon79 at gmail.com Thu Apr 12 18:53:12 2007 From: vivek.menon79 at gmail.com (Vivek Menon) Date: Thu, 12 Apr 2007 14:53:12 -0400 Subject: [EMBOSS] Problem in profiling water and needle programs in the EMBOSS package Message-ID: Hello all, I am having issues compiling the water and needle programs from the EMBOSS package. 1. I configured the package with --with-gccprofiling option which ensured that all the CFLAGS and LDFLAGS are set with -pg option. -bash-3.00$ ./water Smith-Waterman local alignment. Input sequence: ../../ncbi/build/myquery.txt Second sequence(s): ../../ncbi/build/ecoli.nt Gap opening penalty [10.0]: Gap extension penalty [0.5]: Output alignment [test1.water]: 2. the gmon.out file is created, however I get the foll. message -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt gprof: water: not in a.out format has anyone had this problem?? Thanks in advance, Vivek From ajb at ebi.ac.uk Thu Apr 12 20:42:35 2007 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 12 Apr 2007 21:42:35 +0100 (BST) Subject: [EMBOSS] Problem in profiling water and needle programs in the EMBOSS package In-Reply-To: References: Message-ID: <56453.81.98.244.247.1176410555.squirrel@webmail.ebi.ac.uk> That is likely to be because, unless you do a 'make install' the files in the 'emboss' directory are libtool scripts that call the true executables (which are held in the 'emboss/.libs' subdirectory after compilation). You may get away with typing: gprof .libs/water gmon.out > gprof_water_ecoli01.txt on some systems/configurations. However, the recommended way is to use --prefix when you configure emboss (e.g. --prefix=/usr/local/emboss) and do a 'make install'. Then use the true executable in (e.g.) /usr/local/emboss/bin HTH Alan > Hello all, > I am having issues compiling the water and needle programs from the > EMBOSS package. > 1. I configured the package with --with-gccprofiling option which > ensured that all the CFLAGS and LDFLAGS are set with -pg option. > -bash-3.00$ ./water > Smith-Waterman local alignment. > Input sequence: ../../ncbi/build/myquery.txt > Second sequence(s): ../../ncbi/build/ecoli.nt > Gap opening penalty [10.0]: > Gap extension penalty [0.5]: > Output alignment [test1.water]: > 2. the gmon.out file is created, however I get the foll. message > -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt > gprof: water: not in a.out format > > has anyone had this problem?? > Thanks in advance, > Vivek > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From vivek.menon79 at gmail.com Thu Apr 12 22:27:13 2007 From: vivek.menon79 at gmail.com (Vivek Menon) Date: Thu, 12 Apr 2007 18:27:13 -0400 Subject: [EMBOSS] Problem in profiling water and needle programs in the EMBOSS package In-Reply-To: <56453.81.98.244.247.1176410555.squirrel@webmail.ebi.ac.uk> References: <56453.81.98.244.247.1176410555.squirrel@webmail.ebi.ac.uk> Message-ID: Thanks for the info. I reconfigured the package with options --prefix=$HOME and --with-gccprofiling. I executed the water program from the bin directory and this is what I got: -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt BFD: water(.rela.plt): relocation 0 has invalid symbol index 0 BFD: water(.rela.plt): relocation 1 has invalid symbol index 0 BFD: water(.rela.plt): relocation 2 has invalid symbol index 0 BFD: water(.rela.plt): relocation 3 has invalid symbol index 0 BFD: water(.rela.plt): relocation 4 has invalid symbol index 0 BFD: water(.rela.plt): relocation 5 has invalid symbol index 0 BFD: water(.rela.plt): relocation 6 has invalid symbol index 0 BFD: water(.rela.plt): relocation 7 has invalid symbol index 0 BFD: water(.rela.plt): relocation 8 has invalid symbol index 0 BFD: water(.rela.plt): relocation 9 has invalid symbol index 0 BFD: water(.rela.plt): relocation 10 has invalid symbol index 0 BFD: water(.rela.plt): relocation 11 has invalid symbol index 0 BFD: water(.rela.plt): relocation 12 has invalid symbol index 0 BFD: water(.rela.plt): relocation 13 has invalid symbol index 0 BFD: water(.rela.plt): relocation 14 has invalid symbol index 0 BFD: water(.rela.plt): relocation 15 has invalid symbol index 0 BFD: water(.rela.plt): relocation 16 has invalid symbol index 0 BFD: water(.rela.plt): relocation 17 has invalid symbol index 0 BFD: water(.rela.plt): relocation 18 has invalid symbol index 0 BFD: water(.rela.plt): relocation 19 has invalid symbol index 0 BFD: water(.rela.plt): relocation 20 has invalid symbol index 0 BFD: water(.rela.plt): relocation 21 has invalid symbol index 0 BFD: water(.rela.plt): relocation 22 has invalid symbol index 0 BFD: water(.rela.plt): relocation 23 has invalid symbol index 0 BFD: water(.rela.plt): relocation 24 has invalid symbol index 0 BFD: water(.rela.plt): relocation 25 has invalid symbol index 0 BFD: water(.rela.plt): relocation 26 has invalid symbol index 0 BFD: water(.rela.plt): relocation 27 has invalid symbol index 0 BFD: water(.rela.plt): relocation 28 has invalid symbol index 0 BFD: water(.rela.plt): relocation 29 has invalid symbol index 0 BFD: water(.rela.plt): relocation 30 has invalid symbol index 0 BFD: water(.rela.plt): relocation 31 has invalid symbol index 0 BFD: water(.rela.plt): relocation 32 has invalid symbol index 0 BFD: water(.rela.plt): relocation 33 has invalid symbol index 0 BFD: water(.rela.plt): relocation 34 has invalid symbol index 0 BFD: water(.rela.plt): relocation 35 has invalid symbol index 0 BFD: water(.rela.plt): relocation 36 has invalid symbol index 0 BFD: water(.rela.plt): relocation 37 has invalid symbol index 0 BFD: water(.rela.plt): relocation 38 has invalid symbol index 0 BFD: water(.rela.plt): relocation 39 has invalid symbol index 0 BFD: water(.rela.plt): relocation 40 has invalid symbol index 0 BFD: water(.rela.plt): relocation 41 has invalid symbol index 0 BFD: water(.rela.plt): relocation 42 has invalid symbol index 0 BFD: water(.rela.plt): relocation 43 has invalid symbol index 0 -------------------------- what's going wrong now?? BTW I am using a linux-powerpc ppc64 machine. Thanks, Vivek On 4/12/07, ajb at ebi.ac.uk wrote: > That is likely to be because, unless you do a 'make install' the files > in the 'emboss' directory are libtool scripts that call the true > executables (which are held in the 'emboss/.libs' subdirectory after > compilation). > > You may get away with typing: > gprof .libs/water gmon.out > gprof_water_ecoli01.txt > > on some systems/configurations. However, the recommended way is > to use --prefix when you configure emboss (e.g. --prefix=/usr/local/emboss) > and do a 'make install'. Then use the true executable in (e.g.) > /usr/local/emboss/bin > > HTH > > Alan > > > > Hello all, > > I am having issues compiling the water and needle programs from the > > EMBOSS package. > > 1. I configured the package with --with-gccprofiling option which > > ensured that all the CFLAGS and LDFLAGS are set with -pg option. > > -bash-3.00$ ./water > > Smith-Waterman local alignment. > > Input sequence: ../../ncbi/build/myquery.txt > > Second sequence(s): ../../ncbi/build/ecoli.nt > > Gap opening penalty [10.0]: > > Gap extension penalty [0.5]: > > Output alignment [test1.water]: > > 2. the gmon.out file is created, however I get the foll. message > > -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt > > gprof: water: not in a.out format > > > > has anyone had this problem?? > > Thanks in advance, > > Vivek > > _______________________________________________ > > EMBOSS mailing list > > EMBOSS at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/emboss > > > > > From ajb at ebi.ac.uk Thu Apr 12 23:27:19 2007 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 13 Apr 2007 00:27:19 +0100 (BST) Subject: [EMBOSS] Problem in profiling water and needle programs in the EMBOSS package In-Reply-To: References: <56453.81.98.244.247.1176410555.squirrel@webmail.ebi.ac.uk> Message-ID: <60149.81.98.244.247.1176420439.squirrel@webmail.ebi.ac.uk> You probably also need to 'make clean' and then configure again, this time also adding '--disable-shared' on the configuration line. That will cause static libraries to be used. HTH Alan > Thanks for the info. > I reconfigured the package with options --prefix=$HOME and > --with-gccprofiling. > I executed the water program from the bin directory and this is what I > got: > -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt > BFD: water(.rela.plt): relocation 0 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 1 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 2 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 3 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 4 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 5 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 6 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 7 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 8 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 9 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 10 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 11 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 12 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 13 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 14 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 15 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 16 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 17 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 18 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 19 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 20 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 21 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 22 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 23 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 24 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 25 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 26 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 27 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 28 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 29 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 30 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 31 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 32 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 33 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 34 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 35 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 36 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 37 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 38 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 39 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 40 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 41 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 42 has invalid symbol index 0 > BFD: water(.rela.plt): relocation 43 has invalid symbol index 0 > -------------------------- > > what's going wrong now?? BTW I am using a linux-powerpc ppc64 machine. > Thanks, > Vivek > > On 4/12/07, ajb at ebi.ac.uk wrote: >> That is likely to be because, unless you do a 'make install' the files >> in the 'emboss' directory are libtool scripts that call the true >> executables (which are held in the 'emboss/.libs' subdirectory after >> compilation). >> >> You may get away with typing: >> gprof .libs/water gmon.out > gprof_water_ecoli01.txt >> >> on some systems/configurations. However, the recommended way is >> to use --prefix when you configure emboss (e.g. >> --prefix=/usr/local/emboss) >> and do a 'make install'. Then use the true executable in (e.g.) >> /usr/local/emboss/bin >> >> HTH >> >> Alan >> >> >> > Hello all, >> > I am having issues compiling the water and needle programs from the >> > EMBOSS package. >> > 1. I configured the package with --with-gccprofiling option which >> > ensured that all the CFLAGS and LDFLAGS are set with -pg option. >> > -bash-3.00$ ./water >> > Smith-Waterman local alignment. >> > Input sequence: ../../ncbi/build/myquery.txt >> > Second sequence(s): ../../ncbi/build/ecoli.nt >> > Gap opening penalty [10.0]: >> > Gap extension penalty [0.5]: >> > Output alignment [test1.water]: >> > 2. the gmon.out file is created, however I get the foll. message >> > -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt >> > gprof: water: not in a.out format >> > >> > has anyone had this problem?? >> > Thanks in advance, >> > Vivek >> > _______________________________________________ >> > EMBOSS mailing list >> > EMBOSS at lists.open-bio.org >> > http://lists.open-bio.org/mailman/listinfo/emboss >> > >> >> >> > From jjplawnewera at yahoo.co.uk Fri Apr 13 01:28:03 2007 From: jjplawnewera at yahoo.co.uk (john p) Date: Fri, 13 Apr 2007 01:28:03 +0000 (GMT) Subject: [EMBOSS] How to compile water.c Message-ID: <268222.98460.qm@web27001.mail.ukl.yahoo.com> Greeting wise ones,, My name is Justin from Malaysia. I've just started a postgrad research on accelerating bioinformatics applications. My current task is to analyze and profile the smith-waterman algorithm. I dont have much experience on C programming and am just picking up. I need to compile water.c in Win XP. I'm currently using Visual Studio C++ Express and Dev-C++. When trying to compile water.c, i encountered many problems... they were a lot of linking errors and stuff... Plus i need to enable profiling info (gmon.out) so that i can profile it using gprof. Maybe i got off to a bad start.. so i want to try again properly. Could you give me some guide/intructions on how to compile water.c? and where do i find the complete list of header and function files needed to compile with water.c? Please advise. Justin ___________________________________________________________ Yahoo! Answers - Got a question? Someone out there knows the answer. Try it now. http://uk.answers.yahoo.com/ From Nick at alekta.ru Fri Apr 13 03:20:47 2007 From: Nick at alekta.ru (=?koi8-r?B?98/Sz8LDz9cg7snLz8zByiD3wcTJzc/Xyd4=?=) Date: Fri, 13 Apr 2007 10:20:47 +0700 Subject: [EMBOSS] How to compile water.c Message-ID: <39C84EE794985249993243D376DEBFA5C5287B@MAIL2.alekta.ru> Justin, 3 days ago I have been try in struggling with this problem. If you have MSDN installed on your computer see in it contents explorer: * Win32 and COM Development o Development Guides * UNIX Application Migration Guide * Chapter 9: Win32 Code Conversion Or go on link: http://search.microsoft.com/results.aspx?mkt=en-US&setlang=en-US&q=Overview+o f+the+UNIX+Application+Migration+Guide If you make a decision to port header files, you must be convert all UNIX scecifics: - UNIX creates a new process by using fork - converting UNIX code to Win32 requires the use of new techniques replacing the use of some UNIX signals - specific in working with threads - synchronization issues - specific in users, groups and security management - specific in file and data access management - an so on. Also, you must come to know the particulars of some header files, absent in Win32, i.e.: - dirent.h - dirent_w32.h - win32.h - - - and some else Regards, Nick. -----Original Message----- From: emboss-bounces at lists.open-bio.org [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of john p Sent: Friday, April 13, 2007 8:28 AM To: emboss at lists.open-bio.org Subject: [EMBOSS] How to compile water.c Greeting wise ones,, My name is Justin from Malaysia. I've just started a postgrad research on accelerating bioinformatics applications. My current task is to analyze and profile the smith-waterman algorithm. I dont have much experience on C programming and am just picking up. I need to compile water.c in Win XP. I'm currently using Visual Studio C++ Express and Dev-C++. When trying to compile water.c, i encountered many problems... they were a lot of linking errors and stuff... Plus i need to enable profiling info (gmon.out) so that i can profile it using gprof. Maybe i got off to a bad start.. so i want to try again properly. Could you give me some guide/intructions on how to compile water.c? and where do i find the complete list of header and function files needed to compile with water.c? Please advise. Justin ___________________________________________________________ Yahoo! Answers - Got a question? Someone out there knows the answer. Try it now. http://uk.answers.yahoo.com/ _______________________________________________ EMBOSS mailing list EMBOSS at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Fri Apr 13 10:09:52 2007 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 13 Apr 2007 11:09:52 +0100 Subject: [EMBOSS] Profiling and testing water In-Reply-To: References: Message-ID: <461F56F0.3000707@ebi.ac.uk> Vivek Menon wrote: > Hello all, I am having issues compiling the water and needle programs from > the EMBOSS package. That makes 3 related requests in the past week! It seems profiling and looking at the code for water is becoming popular. For those who want to play with the code, it may be helpful to describe how the EMBOSS QA testing works. So far this has just been run internally to check that code changes have not broken anything. Firstly, edit file test/.embossrc to set the locations of the source test directory (emboss_qadata) and the installed test directory (emboss_testdata). The install directory is used for the test databases tsw, tembl (etc.) provided with the EMBOSS distribution. The source test directory is used so that the results of one test can be used in another. cd to the source test directory. cd to the qa subdirectory. Run all the QA tests using: ../../scripts/qatest.pl -without=srs (the command line option turns off tests that require SRS installed locally) Run one selected QA test: ../../scripts/qatest.pl water-ex Tests run in a subdirectory with the name of the test (test/qa/water-ex) If the test succeeds, the directory is removed (the command line option -kk keeps the directory). New tests are easy to define - add them to test/qatest.dat Each test has to have a unique name. Descriptions of the definition line types are in the top of the file. Tests assume files stderr and stdout are created and empty. All other output files must be included in the test definition (getting a surprise new file is an error). The .embossrc file defines the date to be 15-jul-2006 so do not be surprised if you see that date in your output - we use it to keep the results constant when updating the documentation. All the *-ex tests are examples for the manuals. Have fun!!! Peter From vivek.menon79 at gmail.com Fri Apr 13 14:10:15 2007 From: vivek.menon79 at gmail.com (Vivek Menon) Date: Fri, 13 Apr 2007 10:10:15 -0400 Subject: [EMBOSS] Problem in profiling water and needle programs in the EMBOSS package In-Reply-To: <60149.81.98.244.247.1176420439.squirrel@webmail.ebi.ac.uk> References: <56453.81.98.244.247.1176410555.squirrel@webmail.ebi.ac.uk> <60149.81.98.244.247.1176420439.squirrel@webmail.ebi.ac.uk> Message-ID: I still get these error messages. BFD: needle(.rela.plt): relocation 101 has invalid symbol index 0 BFD: needle(.rela.plt): relocation 102 has invalid symbol index 0 BFD: needle(.rela.plt): relocation 103 has invalid symbol index 0 BFD: needle(.rela.plt): relocation 104 has invalid symbol index 0 BFD: needle(.rela.plt): relocation 105 has invalid symbol index 0 Based on your previous message, I deleted the directory and did a fresh install with ./configure --prefix=$HOME --with-gccprofilling --disable-shared make install -bash-3.00$ ls bin include lib share cd bin ./water gprof water gmon.out >gprof_water_ecoli1.txt .......Error messages... The gprof file is created now and I see these error messages. The whoe point in my profiling water is to determine the functions utilizing max. CPU time and function calls. is this information affected by the error messages or by creating static libraries? Thanks once again. Vivek On 4/12/07, ajb at ebi.ac.uk wrote: > You probably also need to 'make clean' and then configure again, > this time also adding '--disable-shared' on the configuration > line. That will cause static libraries to be used. > > HTH > > Alan > > > > Thanks for the info. > > I reconfigured the package with options --prefix=$HOME and > > --with-gccprofiling. > > I executed the water program from the bin directory and this is what I > > got: > > -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt > > BFD: water(.rela.plt): relocation 0 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 1 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 2 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 3 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 4 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 5 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 6 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 7 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 8 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 9 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 10 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 11 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 12 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 13 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 14 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 15 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 16 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 17 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 18 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 19 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 20 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 21 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 22 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 23 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 24 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 25 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 26 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 27 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 28 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 29 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 30 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 31 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 32 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 33 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 34 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 35 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 36 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 37 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 38 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 39 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 40 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 41 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 42 has invalid symbol index 0 > > BFD: water(.rela.plt): relocation 43 has invalid symbol index 0 > > -------------------------- > > > > what's going wrong now?? BTW I am using a linux-powerpc ppc64 machine. > > Thanks, > > Vivek > > > > On 4/12/07, ajb at ebi.ac.uk wrote: > >> That is likely to be because, unless you do a 'make install' the files > >> in the 'emboss' directory are libtool scripts that call the true > >> executables (which are held in the 'emboss/.libs' subdirectory after > >> compilation). > >> > >> You may get away with typing: > >> gprof .libs/water gmon.out > gprof_water_ecoli01.txt > >> > >> on some systems/configurations. However, the recommended way is > >> to use --prefix when you configure emboss (e.g. > >> --prefix=/usr/local/emboss) > >> and do a 'make install'. Then use the true executable in (e.g.) > >> /usr/local/emboss/bin > >> > >> HTH > >> > >> Alan > >> > >> > >> > Hello all, > >> > I am having issues compiling the water and needle programs from the > >> > EMBOSS package. > >> > 1. I configured the package with --with-gccprofiling option which > >> > ensured that all the CFLAGS and LDFLAGS are set with -pg option. > >> > -bash-3.00$ ./water > >> > Smith-Waterman local alignment. > >> > Input sequence: ../../ncbi/build/myquery.txt > >> > Second sequence(s): ../../ncbi/build/ecoli.nt > >> > Gap opening penalty [10.0]: > >> > Gap extension penalty [0.5]: > >> > Output alignment [test1.water]: > >> > 2. the gmon.out file is created, however I get the foll. message > >> > -bash-3.00$ gprof water gmon.out > gprof_water_ecoli01.txt > >> > gprof: water: not in a.out format > >> > > >> > has anyone had this problem?? > >> > Thanks in advance, > >> > Vivek > >> > _______________________________________________ > >> > EMBOSS mailing list > >> > EMBOSS at lists.open-bio.org > >> > http://lists.open-bio.org/mailman/listinfo/emboss > >> > > >> > >> > >> > > > > > From ajb at ebi.ac.uk Fri Apr 13 16:23:01 2007 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 13 Apr 2007 17:23:01 +0100 (BST) Subject: [EMBOSS] Problem in profiling water and needle programs in the EMBOSS package In-Reply-To: References: <56453.81.98.244.247.1176410555.squirrel@webmail.ebi.ac.uk> <60149.81.98.244.247.1176420439.squirrel@webmail.ebi.ac.uk> Message-ID: <53807.81.98.244.247.1176481381.squirrel@webmail.ebi.ac.uk> Hello Vivek, > I still get these error messages. > BFD: needle(.rela.plt): relocation 101 has invalid symbol index 0 > BFD: needle(.rela.plt): relocation 102 has invalid symbol index 0 > BFD: needle(.rela.plt): relocation 103 has invalid symbol index 0 > BFD: needle(.rela.plt): relocation 104 has invalid symbol index 0 > BFD: needle(.rela.plt): relocation 105 has invalid symbol index 0 Then I'd guess that there are some ppc64 ELF problems on your linux ppc64 system. I can now only suggest that any available updates are applied to your linux ppc64 distribution - there were some ppc64 binutils package ELF problems with symbol tables last year I see. If that isn't possible then try to gain access to a linux x86 or x86_64 system. > Based on your previous message, I deleted the directory and did a > fresh install with > ./configure --prefix=$HOME --with-gccprofilling --disable-shared I think you meant --with-gccprofile > make install > -bash-3.00$ ls > bin include lib share > > cd bin > ./water > gprof water gmon.out >gprof_water_ecoli1.txt > .......Error messages... > The gprof file is created now and I see these error messages. The whoe > point in my profiling water is to determine the functions utilizing > max. CPU time and function calls. What you are doing is correct, and indeed works without error on Linux x86 and x86_64 systems (I have just tried it on Fedora 32bit and 64bit distros). > is this information affected by the error messages or by creating > static libraries? If sensible-looking profiling information is being produced in gprof_water_ecoli1.txt then it is not going to be affected by using static libraries (and likely not by relocation errors - but I'd be happier if the errors weren't there). HTH Alan From openlinuxsource at gmail.com Sat Apr 14 13:20:42 2007 From: openlinuxsource at gmail.com (Lee Amy) Date: Sat, 14 Apr 2007 21:20:42 +0800 Subject: [EMBOSS] Help: About cluster In-Reply-To: <289665360704140612t27f126c5v93ef996286566ba6@mail.gmail.com> References: <289665360704140612t27f126c5v93ef996286566ba6@mail.gmail.com> Message-ID: <289665360704140620q222303a5if5f6162861970b10@mail.gmail.com> 2007/4/14, Lee Amy : > > Hello, > > I'm a Chinese student. I build a bioinformatics Linux cluster for my > school. I've installed MpiBlast and some other parallel software package. > > Furthermore, in order to make my cluster more excellent and power, I wanna > use EMBOSS to do with it. But I meet a problem. I just know how to run > EMBOSS in local computer system, not in Linux cluster. So I really wanna > learn that how to use EMBOSS in my cluster, and what kinds of cluster manage > software I should use. > > Thanks in advance! > > Amy Lee in NEAU > > From nyachy at yahoo.co.jp Sun Apr 15 00:15:36 2007 From: nyachy at yahoo.co.jp (=?ISO-2022-JP?B?GyRCPi5MbkRNGyhCIBskQkNSSH4bKEI=?=) Date: Sun, 15 Apr 2007 09:15:36 +0900 (JST) Subject: [EMBOSS] pepstat algorythm Message-ID: <20070415001536.44835.qmail@web3711.mail.tnz.yahoo.co.jp> Dear friends I would like to know how the extinction coefficients for proteins at 280 nm in pepstat. I read the source code and reference paper but still I could not understand. could somebody tell me the more informative reference paper or the formula of the algorithm. Thank you in advance nyachy From molatwork at yahoo.es Sun Apr 15 06:47:54 2007 From: molatwork at yahoo.es (Miguel Ortiz-Lombardia) Date: Sun, 15 Apr 2007 08:47:54 +0200 Subject: [EMBOSS] pepstat algorythm In-Reply-To: <20070415001536.44835.qmail@web3711.mail.tnz.yahoo.co.jp> References: <20070415001536.44835.qmail@web3711.mail.tnz.yahoo.co.jp> Message-ID: <4621CA9A.8030504@yahoo.es> -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 Dear Nyachy, I don't know about the formula used in pepstat. But there are several ways of calculating the extintion coefficient of a protein at 280 nm, using its sequence. Have a look at the ProtParam (at Expasy) documentation: http://www.expasy.ch/tools/protparam-doc.html There, they explain several possible choices and give references about them. Cheers, Miguel En/na ??? ?? ha escrit: > Dear friends > > I would like to know how the extinction coefficients for > proteins at 280 nm in pepstat. > > I read the source code and reference paper but still I > could not understand. > > could somebody tell me the more informative reference > paper or the formula of the algorithm. > > Thank you in advance > > nyachy > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > - -- Miguel Ortiz Lombard?a Centro de Investigaciones Oncol?gicas C/ Melchor Fern?ndez Almagro, 3 28029 Madrid, Spain Tel. +34 912 246 900 Fax. +34 912 246 976 e-mail: molatwork at yahoo.es - ---------------------------------------------------------------------- Et ainsi ne pouvant faire que ce qui est juste f?t fort, on a fait que ce qui est fort f?t juste. Blaise Pascal, Pens?es -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.4.5 (Darwin) iD8DBQFGIcqZF6oOrDvhbQIRAozcAJ9Z9lKr9HyB0QshtBX5FpR3CDGoZQCaA5X/ x5+6L5u6deCU0xTE2aHdRnA= =cAIb -----END PGP SIGNATURE----- From ajb at ebi.ac.uk Sun Apr 15 07:40:30 2007 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Sun, 15 Apr 2007 08:40:30 +0100 (BST) Subject: [EMBOSS] pepstat algorythm In-Reply-To: <20070415001536.44835.qmail@web3711.mail.tnz.yahoo.co.jp> References: <20070415001536.44835.qmail@web3711.mail.tnz.yahoo.co.jp> Message-ID: <36808.81.98.244.247.1176622830.squirrel@webmail.ebi.ac.uk> >From looking at the source code: The program uses per amino acid values for the extinction coefficient. It gets them from the Eamino.dat data file in the EMBOSS distribution. Extinction coefficients are based on the values of Gill and von Hippel (1989) Anal Biochem 182 319-326. It sums the values over the sequence and reports that. It then calculates the 1mg/ml value by taking the above value and dividing it by the molecular weight. HTH Alan > Dear friends > > I would like to know how the extinction coefficients for > proteins at 280 nm in pepstat. > > I read the source code and reference paper but still I > could not understand. > > could somebody tell me the more informative reference > paper or the formula of the algorithm. > > Thank you in advance > > nyachy > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From jison at ebi.ac.uk Mon Apr 16 15:41:59 2007 From: jison at ebi.ac.uk (Jon Ison) Date: Mon, 16 Apr 2007 16:41:59 +0100 (BST) Subject: [EMBOSS] How to compile water.c In-Reply-To: <39C84EE794985249993243D376DEBFA5C5287B@MAIL2.alekta.ru> References: <39C84EE794985249993243D376DEBFA5C5287B@MAIL2.alekta.ru> Message-ID: <35484.84.92.187.247.1176738119.squirrel@webmail.ebi.ac.uk> Hi Justin You might be better off using the native windows code for EMBOSS developed by Alan Bleasby - which I don't think is available via our website yet but Alan can provide. Feel free to email emboss-bug about it. Cheers Jon > Justin, 3 days ago I have been try in struggling with this problem. > > If you have MSDN installed on your computer see in it contents explorer: > > * Win32 and COM Development > o Development Guides > * UNIX Application Migration Guide > * Chapter 9: Win32 Code Conversion > > Or go on link: > http://search.microsoft.com/results.aspx?mkt=en-US&setlang=en-US&q=Overview+o > f+the+UNIX+Application+Migration+Guide > > If you make a decision to port header files, you must be convert all UNIX > scecifics: > - UNIX creates a new process by using fork > - converting UNIX code to Win32 requires the use of new techniques replacing > the use of some UNIX signals > - specific in working with threads > - synchronization issues > - specific in users, groups and security management > - specific in file and data access management > - an so on. > > Also, you must come to know the particulars of some header files, absent in > Win32, i.e.: > - dirent.h > - dirent_w32.h > - win32.h > - > - > - and some else > > > Regards, Nick. > > -----Original Message----- > From: emboss-bounces at lists.open-bio.org > [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of john p > Sent: Friday, April 13, 2007 8:28 AM > To: emboss at lists.open-bio.org > Subject: [EMBOSS] How to compile water.c > > Greeting wise ones,, > > My name is Justin from Malaysia. I've just started a postgrad research on > accelerating bioinformatics applications. > > My current task is to analyze and profile the smith-waterman algorithm. I > dont have much experience on C programming and am just picking up. I need to > compile water.c in Win XP. I'm currently using Visual Studio C++ Express and > Dev-C++. > > When trying to compile water.c, i encountered many problems... they were a > lot of linking errors and stuff... Plus i need to enable profiling info > (gmon.out) so that i can profile it using gprof. > Maybe i got off to a bad start.. so i want to try again properly. > > Could you give me some guide/intructions on how to compile water.c? and where > do i find the complete list of header and function files needed to compile > with water.c? > > Please advise. > > Justin > > > ___________________________________________________________ > Yahoo! Answers - Got a question? Someone out there knows the answer. Try it > now. > http://uk.answers.yahoo.com/ > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From openlinuxsource at gmail.com Wed Apr 18 10:42:00 2007 From: openlinuxsource at gmail.com (Lee Amy) Date: Wed, 18 Apr 2007 18:42:00 +0800 Subject: [EMBOSS] Help: About cluster Message-ID: <289665360704180342v68bde7cfg1bc5839527fb4770@mail.gmail.com> Hi, At first, I shoud say thanks very much to some one who helped me last time. And I got a new problem about my task Linux Beowulf cluster. I have 4 workstation as my nodes, and a server as a master. I wanna know about the Emboss package that how many task should I start? Thanks in advance! Amy Lee From anette.becher at agresearch.co.nz Mon Apr 23 20:54:09 2007 From: anette.becher at agresearch.co.nz (Becher, Anette) Date: Tue, 24 Apr 2007 08:54:09 +1200 Subject: [EMBOSS] Compseq DNA/Protein sequence problem Message-ID: Hi all, I believe I *may* have found a bug in compseq. I have been using compseq to calculate the frequency of amino acids in translated DNA sequences. I find that frequently compseq takes the amino acid sequence to be DNA (they are sequences with an unusual composition, but then I am looking for odd proteins). So instead of the expected output for all amino acids with most being zero, I often get output for A,C,G,T and 'other'. I cannot see an obvious pattern that would explain this behaviour, but maybe you can help. Command line: compseq -seq compseq_bug.in -word 1 -frame 1 -out compseq_bug.out An example input and output file are pasted in below - I can provide many more. It might help if the user could specify whether the input sequence is DNA or protein, rather than the program working it out somehow? Best wishes Anette Here is an example of the problem: >Seq1 GSGGGGGSGGRGMGGWGGGRGSGVGGRGWGVG # # Output from 'compseq' # # Only words in frame 1 will be counted. # The Expected frequencies are calculated on the (false) assumption that every # word has equal frequency. # # The input sequences are: # Seq1 Word size 1 Total count 31 # # Word Obs Count Obs Frequency Exp Frequency Obs/Exp Frequency # A 0 0.0000000 0.2500000 0.0000000 C 0 0.0000000 0.2500000 0.0000000 G 20 0.6451613 0.2500000 2.5806452 T 0 0.0000000 0.2500000 0.0000000 Other 11 0.3548387 0.0000000 10000000000.0000000 Here is a similar sequence that works fine: >Seq2 VGSEGGGGGRRGEGGGGGGRGGGGGRWEEGAG # # Output from 'compseq' # # Only words in frame 1 will be counted. # The Expected frequencies are calculated on the (false) assumption that every # word has equal frequency. # # The input sequences are: # Seq2 Word size 1 Total count 31 # # Word Obs Count Obs Frequency Exp Frequency Obs/Exp Frequency # A 1 0.0322581 0.0476190 0.6774194 C 0 0.0000000 0.0476190 0.0000000 D 0 0.0000000 0.0476190 0.0000000 E 4 0.1290323 0.0476190 2.7096774 F 0 0.0000000 0.0476190 0.0000000 G 20 0.6451613 0.0476190 13.5483871 H 0 0.0000000 0.0476190 0.0000000 I 0 0.0000000 0.0476190 0.0000000 K 0 0.0000000 0.0476190 0.0000000 L 0 0.0000000 0.0476190 0.0000000 M 0 0.0000000 0.0476190 0.0000000 N 0 0.0000000 0.0476190 0.0000000 P 0 0.0000000 0.0476190 0.0000000 Q 0 0.0000000 0.0476190 0.0000000 R 4 0.1290323 0.0476190 2.7096774 S 1 0.0322581 0.0476190 0.6774194 T 0 0.0000000 0.0476190 0.0000000 U 0 0.0000000 0.0476190 0.0000000 V 0 0.0000000 0.0476190 0.0000000 W 1 0.0322581 0.0476190 0.6774194 Y 0 0.0000000 0.0476190 0.0000000 ======================================================================= Attention: The information contained in this message and/or attachments from AgResearch Limited is intended only for the persons or entities to which it is addressed and may contain confidential and/or privileged material. Any review, retransmission, dissemination or other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipients is prohibited by AgResearch Limited. If you have received this message in error, please notify the sender immediately. ======================================================================= From bernd.web at gmail.com Mon Apr 23 21:28:15 2007 From: bernd.web at gmail.com (Bernd Web) Date: Mon, 23 Apr 2007 23:28:15 +0200 Subject: [EMBOSS] Compseq DNA/Protein sequence problem In-Reply-To: References: Message-ID: <716af09c0704231428s101d5f5dnc2cbc7f572a60183@mail.gmail.com> Hi Annette, Your seq1 is incorrectly guessed to be a nucleotide sequence, since you state it's protein. EMBOSS provides a boolean to state nucleotide or protein nature of your sequence, see EMBOSS help: "-sequence" associated qualifiers -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein regards, bernd On 4/23/07, Becher, Anette wrote: > Hi all, > > I believe I *may* have found a bug in compseq. > > I have been using compseq to calculate the frequency of amino acids in > translated DNA sequences. I find that frequently compseq takes the amino > acid sequence to be DNA (they are sequences with an unusual composition, > but then I am looking for odd proteins). So instead of the expected > output for all amino acids with most being zero, I often get output for > A,C,G,T and 'other'. I cannot see an obvious pattern that would explain > this behaviour, but maybe you can help. > > Command line: > > compseq -seq compseq_bug.in -word 1 -frame 1 -out compseq_bug.out > > An example input and output file are pasted in below - I can provide > many more. > > It might help if the user could specify whether the input sequence is > DNA or protein, rather than the program working it out somehow? > > > Best wishes > > > Anette > > > > Here is an example of the problem: > > > >Seq1 > GSGGGGGSGGRGMGGWGGGRGSGVGGRGWGVG > > > # > # Output from 'compseq' > # > # Only words in frame 1 will be counted. > # The Expected frequencies are calculated on the (false) assumption that > every > # word has equal frequency. > # > # The input sequences are: > # Seq1 > > > Word size 1 > Total count 31 > > # > # Word Obs Count Obs Frequency Exp Frequency Obs/Exp > Frequency > # > A 0 0.0000000 0.2500000 0.0000000 > C 0 0.0000000 0.2500000 0.0000000 > G 20 0.6451613 0.2500000 2.5806452 > T 0 0.0000000 0.2500000 0.0000000 > > Other 11 0.3548387 0.0000000 > 10000000000.0000000 > > > > > Here is a similar sequence that works fine: > > > >Seq2 > VGSEGGGGGRRGEGGGGGGRGGGGGRWEEGAG > > > > # > # Output from 'compseq' > # > # Only words in frame 1 will be counted. > # The Expected frequencies are calculated on the (false) assumption that > every > # word has equal frequency. > # > # The input sequences are: > # Seq2 > > > Word size 1 > Total count 31 > > # > # Word Obs Count Obs Frequency Exp Frequency Obs/Exp > Frequency > # > A 1 0.0322581 0.0476190 0.6774194 > C 0 0.0000000 0.0476190 0.0000000 > D 0 0.0000000 0.0476190 0.0000000 > E 4 0.1290323 0.0476190 2.7096774 > F 0 0.0000000 0.0476190 0.0000000 > G 20 0.6451613 0.0476190 13.5483871 > H 0 0.0000000 0.0476190 0.0000000 > I 0 0.0000000 0.0476190 0.0000000 > K 0 0.0000000 0.0476190 0.0000000 > L 0 0.0000000 0.0476190 0.0000000 > M 0 0.0000000 0.0476190 0.0000000 > N 0 0.0000000 0.0476190 0.0000000 > P 0 0.0000000 0.0476190 0.0000000 > Q 0 0.0000000 0.0476190 0.0000000 > R 4 0.1290323 0.0476190 2.7096774 > S 1 0.0322581 0.0476190 0.6774194 > T 0 0.0000000 0.0476190 0.0000000 > U 0 0.0000000 0.0476190 0.0000000 > V 0 0.0000000 0.0476190 0.0000000 > W 1 0.0322581 0.0476190 0.6774194 > Y 0 0.0000000 0.0476190 0.0000000 > ======================================================================= > Attention: The information contained in this message and/or attachments > from AgResearch Limited is intended only for the persons or entities > to which it is addressed and may contain confidential and/or privileged > material. Any review, retransmission, dissemination or other use of, or > taking of any action in reliance upon, this information by persons or > entities other than the intended recipients is prohibited by AgResearch > Limited. If you have received this message in error, please notify the > sender immediately. > ======================================================================= > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From charles-listes-emboss at plessy.org Thu Apr 26 01:01:37 2007 From: charles-listes-emboss at plessy.org (Charles Plessy) Date: Thu, 26 Apr 2007 10:01:37 +0900 Subject: [EMBOSS] Does not manage to use .embossrc from the current directory. Message-ID: <20070426010137.GA6977@kunpuu.plessy.org> Dear EMBOSS programmers, I am using EMBOSS in a context where I can not expect $HOME to be set. Therefore, I created a .embossrc from a template and attempted to use it in the current directory. However, EMBOSS does not seem to read it, despite what is written in the documentation: http://emboss.sourceforge.net/docs/adminguide/node4.html Here is an example: # The template: sorbet?tmp?$ cat mirbase.embossrc DB mirbase [ type: N format: embl method: emblcd directory: /usr/share/mirbase/emboss file: *.dat ] # Creation of the .embossrc: sorbet?tmp?$ PWD=`pwd` perl -pe "s(/usr/share/mirbase/emboss)($PWD)" < mirbase.embossrc | tee .embossrc DB mirbase [ type: N format: embl method: emblcd directory: /home/charles/tmp file: *.dat ] # It does not work, but the .embossrc is functional in $HOME sorbet?tmp?$ seqret mirbase:MI0000007 stdout Reads and writes (returns) sequences Error: Failed to open filename 'mirbase' Error: Unable to read sequence 'mirbase:MI0000007' Died: seqret terminated: Bad value for '-sequence' and no prompt sorbet?tmp?$ cp .embossrc $HOME sorbet?tmp?$ seqret mirbase:MI0000007 stdout Reads and writes (returns) sequences >cel-mir-36 MI0000007 Caenorhabditis elegans miR-36 stem-loop caccgcugucggggaaccgcgccaauuuucgcuucagugcuagaccauccaaagugucua ucaccgggugaaaauucgcauggguccccgacgcgga # Strace confirms that the current dir is not searched for .embossrc sorbet?tmp?$ rm $HOME/.embossrc sorbet?tmp?$ strace seqret mirbase:MI0000007 stdout 2>&1 | grep embossrc open("/home/charles/.embossrc", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory) sorbet?tmp?$ strace seqret mirbase:MI0000007 stdout 2>&1 | grep emboss.default open("/usr/share/EMBOSS/emboss.default", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory) open("/home/charles/debian/EMBOSS-4.1.0/emboss/emboss.default", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory) Interestingly, it searches also emboss.default in a place which is not expected: where I compiled EMBOSS... Can I have made a mistake at compilation time which would prevent `pwd`/.embossrc to be parsed? Have a nice day, -- Charles Plessy Debian-Med packaging team http://www.debian.org/devel/debian-med/ Wako, Saitama, Japan From pmr at ebi.ac.uk Thu Apr 26 10:44:44 2007 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 26 Apr 2007 11:44:44 +0100 Subject: [EMBOSS] Does not manage to use .embossrc from the current directory. In-Reply-To: <20070426010137.GA6977@kunpuu.plessy.org> References: <20070426010137.GA6977@kunpuu.plessy.org> Message-ID: <4630829C.9090709@ebi.ac.uk> Charles Plessy wrote: > Dear EMBOSS programmers, > > I am using EMBOSS in a context where I can not expect $HOME to be set. > Therefore, I created a .embossrc from a template and attempted to use it in > the current directory. However, EMBOSS does not seem to read it, despite what > is written in the documentation: > > # It does not work, but the .embossrc is functional in $HOME > > sorbet?tmp?$ seqret mirbase:MI0000007 stdout Reads and writes (returns) > sequences Error: Failed to open filename 'mirbase' Error: Unable to read > sequence 'mirbase:MI0000007' Died: seqret terminated: Bad value for > '-sequence' and no prompt > > sorbet?tmp?$ cp .embossrc $HOME > > sorbet?tmp?$ seqret mirbase:MI0000007 stdout Reads and writes (returns) > sequences >> cel-mir-36 MI0000007 Caenorhabditis elegans miR-36 stem-loop > caccgcugucggggaaccgcgccaauuuucgcuucagugcuagaccauccaaagugucua > ucaccgggugaaaauucgcauggguccccgacgcgga > > # Strace confirms that the current dir is not searched for .embossrc > > sorbet?tmp?$ rm $HOME/.embossrc > > sorbet?tmp?$ strace seqret mirbase:MI0000007 stdout 2>&1 | grep embossrc > open("/home/charles/.embossrc", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such > file or directory) Ah, that is a documentation error. EMBOSS no longer looks in the current directory. We are writing a new admin guide. But another suggestion in the same part of the admin guide is what you need. EMBOSS has a way to redirect $HOME (we use it to redirect $HOME/.embossrc when running QA tests. Define EMBOSSRC to be the current directory (you can use ".") Interesting ... I had not tried strace. Looks useful. Running seqret with -debug will also report where it is trying to open files. A good way to check whether your emboss.defaults and .embossrc files were used is to run showdb -full to list all the databases you have defined. Databases in $HOME/embossrc appear as "user". Databases in $EMBOSSRC/.embossrc appear as "special" > Interestingly, it searches also emboss.default in a place which is not > expected: where I compiled EMBOSS... Can I have made a mistake at compilation > time which would prevent `pwd`/.embossrc to be parsed? This is intentional. EMBOSS looks for data files in the install directories and also in the source directory - in case users are testing EMBOSS and have not run "make install". The source directory is only searched if the installed file is not found. regards, Peter From charles-listes-emboss at plessy.org Sat Apr 28 08:23:56 2007 From: charles-listes-emboss at plessy.org (Charles Plessy) Date: Sat, 28 Apr 2007 17:23:56 +0900 Subject: [EMBOSS] Experimental packages available for EMBOSS on Debian. Message-ID: <20070428082356.GA6603@kunpuu.plessy.org> Dear all, The Debian-Med project is preparing Debian packages for EMBOSS. While our current packages are not ready for official release in Debian unstable or testing, they seem to be functionnal from a bioinformatical point of view. The issues are more about QA of the packaging - for instance there are conflicts between some EMBOSS binary names and other programs from other packages. We made our packages available in the experimental section of Debian, and would be glad to hear feedback from interested users. http://packages.debian.org/experimental/science/emboss Debian offers an increasing range of programs for bioinformatics, and using packages management tools such as apt-get, aptitude or synaptic, one can automagically install programms for which EMBOSS has a wrapper: such as dialign, primer3 and clustalw. When the EMBOSS packages will be ready, we plan to further increase our support to EMBASSY and to helper databases such as REBASE. Have a nice day, -- Charles Plessy Debian-Med pacakging team, http://www.debian.org/devel/debian-med/ From charles-listes-emboss at plessy.org Sat Apr 28 08:32:09 2007 From: charles-listes-emboss at plessy.org (Charles Plessy) Date: Sat, 28 Apr 2007 17:32:09 +0900 Subject: [EMBOSS] Does not manage to use .embossrc from the current directory. In-Reply-To: <4630829C.9090709@ebi.ac.uk> References: <20070426010137.GA6977@kunpuu.plessy.org> <4630829C.9090709@ebi.ac.uk> Message-ID: <20070428083209.GJ32455@kunpuu.plessy.org> Le Thu, Apr 26, 2007 at 11:44:44AM +0100, Peter Rice a ?crit : > > Ah, that is a documentation error. EMBOSS no longer looks in the current > directory. We are writing a new admin guide. > But another suggestion in the same part of the admin guide is what you need. > > EMBOSS has a way to redirect $HOME (we use it to redirect $HOME/.embossrc when > running QA tests. Define EMBOSSRC to be the current directory (you can use ".") Many thanks, it works well. (By the way, I get no extra information when running seqret -debug). I would like to take the opportunity of this thread for a feature request: In the Debian-Med project, we are planning to distribute some small databases as debian packages. In order to make them easily available to users, I would like that each package would deposit a small configuration file in a directory such as /etc/emboss/embossrc.d, and it would be great if embossrc files could be instructed to "INCLUDE" a whole directory. Have a nice day, -- Charles Plessy Wako, Saitama, Japan. From openlinuxsource at gmail.com Sun Apr 29 06:35:54 2007 From: openlinuxsource at gmail.com (Lee Amy) Date: Sun, 29 Apr 2007 14:35:54 +0800 Subject: [EMBOSS] Help: About Jemboss Message-ID: <289665360704282335p110cbfeau4df0c8348f64d13e@mail.gmail.com> Hi, I've installed EMBOSS-4.0.0-5, and download the Jemboss GUI. To do in my local machine, I change the runJemboss.sh in Installation Guide. When I run the Jemboss, the screen shows [root at localhost jemboss]# RunEmbossApplication2 Error executing: /usr/local/bin/wossname -colon -gui -auto Exception in thread "Thread-1" java.lang.NullPointerException at org.emboss.jemboss.programs.RunEmbossApplication2.waitFor( RunEmbossApplication2.java:338) at org.emboss.jemboss.gui.BuildProgramMenu$1.construct( BuildProgramMenu.java:256) at org.emboss.jemboss.gui.SwingWorker$2.run(SwingWorker.java:127) at java.lang.Thread.run(Thread.java:595) Java Env is JRE1.5.0_09 Can someone tell me how to solve the problem? Thanks in advance! Amy Lee From tjc at sanger.ac.uk Mon Apr 30 07:30:49 2007 From: tjc at sanger.ac.uk (Tim Carver) Date: Mon, 30 Apr 2007 08:30:49 +0100 Subject: [EMBOSS] Help: About Jemboss In-Reply-To: <289665360704282335p110cbfeau4df0c8348f64d13e@mail.gmail.com> Message-ID: Hi Amy You need to install them together with the script: EMBOSS-4.0.0-5/jemboss/utils/install-jemboss-server.sh As described at: http://emboss.sourceforge.net/Jemboss/install/setup.html Regards Tim On 29/4/07 07:35, "Lee Amy" wrote: > Hi, > > I've installed EMBOSS-4.0.0-5, and download the Jemboss GUI. To do in my > local machine, I change the runJemboss.sh in Installation Guide. When I run > the Jemboss, the screen shows > > [root at localhost jemboss]# RunEmbossApplication2 Error executing: > /usr/local/bin/wossname -colon -gui -auto > Exception in thread "Thread-1" java.lang.NullPointerException > at org.emboss.jemboss.programs.RunEmbossApplication2.waitFor( > RunEmbossApplication2.java:338) > at org.emboss.jemboss.gui.BuildProgramMenu$1.construct( > BuildProgramMenu.java:256) > at org.emboss.jemboss.gui.SwingWorker$2.run(SwingWorker.java:127) > at java.lang.Thread.run(Thread.java:595) > > Java Env is JRE1.5.0_09 > > Can someone tell me how to solve the problem? > > Thanks in advance! > > Amy Lee > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From tjc at sanger.ac.uk Mon Apr 30 10:13:00 2007 From: tjc at sanger.ac.uk (Tim Carver) Date: Mon, 30 Apr 2007 11:13:00 +0100 Subject: [EMBOSS] Help: About Jemboss In-Reply-To: Message-ID: Hi Amy It has been pointed out to me that EMBOSS-4.0.0-5 may have been supplied by someone else as an RPM. In which case it may not support Jemboss and you may need to contact the supplier. Regards Tim On 30/4/07 08:30, "Tim Carver" wrote: > Hi Amy > > You need to install them together with the script: > > EMBOSS-4.0.0-5/jemboss/utils/install-jemboss-server.sh > > As described at: > > http://emboss.sourceforge.net/Jemboss/install/setup.html > > Regards > Tim > > > On 29/4/07 07:35, "Lee Amy" wrote: > >> Hi, >> >> I've installed EMBOSS-4.0.0-5, and download the Jemboss GUI. To do in my >> local machine, I change the runJemboss.sh in Installation Guide. When I run >> the Jemboss, the screen shows >> >> [root at localhost jemboss]# RunEmbossApplication2 Error executing: >> /usr/local/bin/wossname -colon -gui -auto >> Exception in thread "Thread-1" java.lang.NullPointerException >> at org.emboss.jemboss.programs.RunEmbossApplication2.waitFor( >> RunEmbossApplication2.java:338) >> at org.emboss.jemboss.gui.BuildProgramMenu$1.construct( >> BuildProgramMenu.java:256) >> at org.emboss.jemboss.gui.SwingWorker$2.run(SwingWorker.java:127) >> at java.lang.Thread.run(Thread.java:595) >> >> Java Env is JRE1.5.0_09 >> >> Can someone tell me how to solve the problem? >> >> Thanks in advance! >> >> Amy Lee >> _______________________________________________ >> EMBOSS mailing list >> EMBOSS at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/emboss > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss