From olivier.friard at unito.it Tue Jul 4 12:45:44 2006 From: olivier.friard at unito.it (Olivier Friard) Date: Tue, 04 Jul 2006 18:45:44 +0200 Subject: [EMBOSS] new format EMBL flat files index Message-ID: <44AA9B38.9070502@unito.it> Hi, I try to make indexes for the release 87 of EMBL with new first line format: * I downloaded EMBOSS-3.0.0 * gunzip, tar xvf ... * I replaced the files with the files in the fixes directory * ./configure --prefix= .... ,make, make install * I indexed my rel_std_*.dat files (db name: embl) with dbiflat * I wrote a emboss.default file for embl db (showdb works) but when I try the seqret application I obtained this output: >.1; .1; Human cytomegalovirus strain AD169 complete genome gggccgcgtggtgggtcctcgaggggcgggggggtgtttttagcgggggggtgaaacttg gagttgcgtgtgtggacggcgactagttgcgtgtggtgcggaggacggcgacggcgaata aaagcgacgtgcggcgcgcacggcgaaaagaagacgcgtgtctgtgtctgtgtgattccc ... I tried to index these new files with EMBLNEW format (in place of EMBL) as specified in the README file in the fixes directory but it is not a valid format. Does anyone index the new format EMBL flat file successfully? Thank you for the help Olivier -- Olivier Friard Laboratorio di Biologia Computazionale - Facolt? di Scienze MFN Universit? di Torino via Accademia Albertina 13, 10124 TORINO (Italy) tel. +39 011 6704689 http://www.personalweb.unito.it/olivier.friard/ From pmr at ebi.ac.uk Tue Jul 4 18:41:46 2006 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Tue, 4 Jul 2006 23:41:46 +0100 (BST) Subject: [EMBOSS] new format EMBL flat files index In-Reply-To: <44AA9B38.9070502@unito.it> References: <44AA9B38.9070502@unito.it> Message-ID: <1119.86.132.216.178.1152052906.squirrel@webmail.ebi.ac.uk> Dear Olivier, > I try to make indexes for the release 87 of EMBL with new first line > format: > > * I downloaded EMBOSS-3.0.0 > > * gunzip, tar xvf ... > > * I replaced the files with the files in the fixes directory There was a new fix last week for the embl87 format. As you see the "emblnew" format, I assume you are using the latest fix. > but when I try the seqret application I obtained this output: > > >.1; .1; Human cytomegalovirus strain AD169 complete genome > gggccgcgtggtgggtcctcgaggggcgggggggtgtttttagcgggggggtgaaacttg > gagttgcgtgtgtggacggcgactagttgcgtgtggtgcggaggacggcgacggcgaata > aaagcgacgtgcggcgcgcacggcgaaaagaagacgcgtgtctgtgtctgtgtgattccc > ... That is what you see without the fixes. Can you check all the fix files were copied, including ajax/ajseqread.c which seqret uses to read the new format. > I tried to index these new files with EMBLNEW format (in place of EMBL) > as specified in the README file in the fixes directory but it is not a > valid format. emblnew is a sequence format, not an indexing format (dbiflat, dbxflat, and anything reading embl files should read both formats with the new fixes. > Does anyone index the new format EMBL flat file successfully? Yes, I did ... but if anyone else has problems please let me know. I will try tomorrow to set up a simple test for everyone to check on a short embl database. regards, Peter From haruosuz at yahoo.co.jp Tue Jul 11 13:16:06 2006 From: haruosuz at yahoo.co.jp (haruosuz at yahoo.co.jp) Date: Tue, 11 Jul 2006 10:16:06 -0700 Subject: [EMBOSS] "entret", "seqret", & "whichdb" don't work Message-ID: <038E5E31-16A0-47E7-82D8-4F84F8C3E708@yahoo.co.jp> Dear Sir, The commands "entret", "seqret", and "whichdb" don't work on my intel Mac. http://www.csc.fi/molbio/progs/emboss/doc/programs/html/entret.html $entret tembl:hsfau Reads and writes (returns) flatfile entries Error: failed to open filename 'tembl' Error: Unable to read sequence 'tembl:hsfau' Died: entret terminated: Bad value for '-sequence' and no prompt http://www.csc.fi/molbio/progs/emboss/doc/programs/html/seqret.html $seqret Reads and writes (returns) sequences Input sequence(s): tembl:hsfau Error: failed to open filename 'tembl' Error: Unable to read sequence 'tembl:hsfau' http://www.csc.fi/molbio/progs/emboss/doc/programs/html/whichdb.html $whichdb -showall Search all databases for an entry ID or Accession number: hsfau1 Output file [outfile.whichdb]: stdout [About my Mac] Mac OS X 10.4.6 Darwin 8.6.1 MacBookPro1,1 Intel Core Duo I am looking forward to hearing from you. Sincerely yours, Haruo Suzuki -------------------------------------- Let's start Yahoo! Auction - Free Campaign Now! http://pr.mail.yahoo.co.jp/auction/ From David.Bauer at SCHERING.DE Wed Jul 12 01:47:34 2006 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Wed, 12 Jul 2006 07:47:34 +0200 Subject: [EMBOSS] Antwort: "entret", "seqret", & "whichdb" don't work In-Reply-To: <038E5E31-16A0-47E7-82D8-4F84F8C3E708@yahoo.co.jp> Message-ID: Hi, the emboss.default file, which comes with the distribution, contains some example definitions for databases. But they don't work out of the box. In principle there are two ways for database access from emboss: You can either have the data on a local file system and index them with the emboss utilities (dbxflat, dbxfasta etc.) or you can configure emboss to access remote databases via http. There is a chapter about database configuration in the documentation http://emboss.sourceforge.net/docs/themes/Databases.html which explains in detail how to configure database access. Hope this helps, David. emboss-bounces at lists.open-bio.org schrieb am 11/07/2006 19:16:06: > Dear Sir, > > The commands "entret", "seqret", and "whichdb" don't work on my intel > Mac. > > http://www.csc.fi/molbio/progs/emboss/doc/programs/html/entret.html > $entret tembl:hsfau > Reads and writes (returns) flatfile entries > Error: failed to open filename 'tembl' > Error: Unable to read sequence 'tembl:hsfau' > Died: entret terminated: Bad value for '-sequence' and no prompt > > http://www.csc.fi/molbio/progs/emboss/doc/programs/html/seqret.html > $seqret > Reads and writes (returns) sequences > Input sequence(s): tembl:hsfau > Error: failed to open filename 'tembl' > Error: Unable to read sequence 'tembl:hsfau' > > http://www.csc.fi/molbio/progs/emboss/doc/programs/html/whichdb.html > $whichdb -showall > Search all databases for an entry > ID or Accession number: hsfau1 > Output file [outfile.whichdb]: stdout > > > [About my Mac] > Mac OS X 10.4.6 > Darwin 8.6.1 > MacBookPro1,1 > Intel Core Duo > > I am looking forward to hearing from you. > > Sincerely yours, > > Haruo Suzuki > > -------------------------------------- > Let's start Yahoo! Auction - Free Campaign Now! > http://pr.mail.yahoo.co.jp/auction/ > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From loungechimp at gmail.com Thu Jul 13 12:18:05 2006 From: loungechimp at gmail.com (Andy Fant) Date: Thu, 13 Jul 2006 12:18:05 -0400 Subject: [EMBOSS] Web Interfaces to Emboss Tools Message-ID: <21c02dfe0607130918l7757810rd020330c76e50864@mail.gmail.com> Afternoon all, After a particularly bad run of defective data DVDs from Accelrys, I have decided that I want to make a full-court press to convince the decision makers that we could spend the money we are spending on that subscription and license on other priorities and migrate our core bioinformatics service to Emboss. I have two primary questions related to this. First, much of our user community is using SeqWeb as their interface to GCG. I know that there are a few Emboss web interfaces out there, and I would like to get feedback from people that have deployed them to wide-ranging production about their experiences. The ability to store sequence data and results on the server side is considered to be an essential feature, which appears to rule out some of the leading contenders. Also, does anyone have any experience/scripts/warnings for pulling the corpus of data stored in SeqWeb out into a format easily accessible by Emboss and it's various web interfaces? I'd rather not go in and manually try to extract it if there is a better way. Thanks in advance. If there is demand, I'll summarize for the list. (My apologies for the nom de plume. I don't want to telegraph my plans to managers or vendors until I have all my ducks in a row) From golharam at umdnj.edu Thu Jul 13 13:11:23 2006 From: golharam at umdnj.edu (Ryan Golhar) Date: Thu, 13 Jul 2006 13:11:23 -0400 Subject: [EMBOSS] Web Interfaces to Emboss Tools In-Reply-To: <21c02dfe0607130918l7757810rd020330c76e50864@mail.gmail.com> Message-ID: <007d01c6a69f$5f4b2950$e6028a0a@GOLHARMOBILE1> Hi Andy, Congratulations on your decisions to migrate from GCG to EMBOSS. We did it about a 2 yrs ago because of SeqWeb issues with different web browsers. We haven't looked back since. If you would like to see our installation, go to http://emboss.umdnj.edu/emboss. We were using GCG for at least 5+ years (before I started working here). I discovered EMBOSS about 3 yrs ago and prefer it over GCG for many reasons. We didn't make the transition until we found a suitable web interface as the majority of our users prefer the web interface. In the end, we chose EMBOSS-Explorer - it's a simple, clean interface compatible with a wide range of browsers (a severely lacking feature with SeqWeb). I noticed you require server-side storge, EMBOSS-Explorer requires nothing on the server side not even user accounts, the users store everything locally on their machines. This reduced our maintainence needs for backups. We find it to be a better solution than maintaining central storage for this type of data. I would recommend you tell your users to get their data out of SeqWeb. You can hold onto the storage in case anyone doesn't. There is a hidden file called .gcgwebprojects in /seqweb/config or something like that, that associates users with projects, so if you have to, you can go back at a later date to retrieve data for users. We've only had to do this a handful of times. The files are stored in text format, FASTA format I think. Good luck! -- Ryan Golhar - golharam at umdnj.edu The Informatics Institute of UMDNJ -----Original Message----- From: emboss-bounces at lists.open-bio.org [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of Andy Fant Sent: Thursday, July 13, 2006 12:18 PM To: emboss at lists.open-bio.org Subject: [EMBOSS] Web Interfaces to Emboss Tools Afternoon all, After a particularly bad run of defective data DVDs from Accelrys, I have decided that I want to make a full-court press to convince the decision makers that we could spend the money we are spending on that subscription and license on other priorities and migrate our core bioinformatics service to Emboss. I have two primary questions related to this. First, much of our user community is using SeqWeb as their interface to GCG. I know that there are a few Emboss web interfaces out there, and I would like to get feedback from people that have deployed them to wide-ranging production about their experiences. The ability to store sequence data and results on the server side is considered to be an essential feature, which appears to rule out some of the leading contenders. Also, does anyone have any experience/scripts/warnings for pulling the corpus of data stored in SeqWeb out into a format easily accessible by Emboss and it's various web interfaces? I'd rather not go in and manually try to extract it if there is a better way. Thanks in advance. If there is demand, I'll summarize for the list. (My apologies for the nom de plume. I don't want to telegraph my plans to managers or vendors until I have all my ducks in a row) _______________________________________________ EMBOSS mailing list EMBOSS at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/emboss From haruosuz at yahoo.co.jp Thu Jul 13 14:55:34 2006 From: haruosuz at yahoo.co.jp (haruosuz at yahoo.co.jp) Date: Thu, 13 Jul 2006 11:55:34 -0700 Subject: [EMBOSS] Antwort: "entret", "seqret", & "whichdb" don't work Message-ID: <456C448E-A291-4E90-95C3-4E7F937D1C9B@yahoo.co.jp> Thank you very much for your advises. http://emboss.sourceforge.net/docs/themes/Databases.html I made the two configuration files (emboss.default & .embossrc) and "showdb" showed the database, but the commands (entret, seqret, & whichdb) don't work. The details are described below. ------------------------------------------- http://emboss.sourceforge.net/docs/themes/Databases.html#default The emboss.default file (1) emboss.default (share/EMBOSS) $ cd /usr/local/share/EMBOSS $ su # cp emboss.default.template emboss.default (2) .embossrc (personal home directory) .embossrc set emboss_acdroot /usr/local/share/EMBOSS/acd http://emboss.sourceforge.net/docs/themes/Databases.html#test Testing the database definitions (run showdb) $showdb Displays information on the currently available databases # Name Type ID Qry All Comment # ==== ==== == === === ======= tpir P OK OK OK PIR using NBRF access for 4 files tsw P OK OK OK Swissprot native format with EMBL CD- ROM index tswnew P OK OK OK Swissnew as 3 files in native format with EMBL CD-ROM index twp P OK OK OK EMBL new in native format with EMBL CD- ROM index tembl N OK OK OK EMBL in native format with EMBL CD-ROM index tgb N OK - - Genbank IDs tgenbank N OK OK OK GenBank in native format with EMBL CD- ROM index http://www.csc.fi/molbio/progs/emboss/doc/programs/html/entret.html $entret tembl:hsfau Reads and writes (returns) flatfile entries Warning: Cannot open division file '' for database 'tembl' Warning: seqCdQry failed Error: Unable to read sequence 'tembl:hsfau' Died: entret terminated: Bad value for '-sequence' and no prompt http://www.csc.fi/molbio/progs/emboss/doc/programs/html/seqret.html $seqret Reads and writes (returns) sequences Input sequence(s): tembl:hsfau Warning: Cannot open division file '' for database 'tembl' Warning: seqCdQry failed Error: Unable to read sequence 'tembl:hsfau' Input sequence(s): http://www.csc.fi/molbio/progs/emboss/doc/programs/html/whichdb.html $whichdb -showall Search all databases for an entry ID or Accession number: hsfau1 Output file [outfile.whichdb]: stdout # Trying 'twp:hsfau1' Warning: Cannot open division file '' for database 'twp' Warning: seqCdQry failed # Failed 'twp:hsfau1' # Trying 'tsw:hsfau1' Warning: Cannot open division file '' for database 'tsw' Warning: seqCdQry failed # Failed 'tsw:hsfau1' # Trying 'tgenbank:hsfau1' Warning: Cannot open division file '' for database 'tgenbank' Warning: seqCdQry failed # Failed 'tgenbank:hsfau1' # Trying 'tpir:hsfau1' Warning: Cannot open division file '' for database 'tpir' EMBOSS An error in ajseqdb.c at line 5141: seqCdQryOpen failed ------------------------------------------- Haruo Suzuki http://emboss.open-bio.org/pipermail/emboss/2006-July/002561.html -------------------------------------- Let's start Yahoo! Auction - Free Campaign Now! http://pr.mail.yahoo.co.jp/auction/ From ajb at ebi.ac.uk Thu Jul 13 16:14:16 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 13 Jul 2006 21:14:16 +0100 (BST) Subject: [EMBOSS] Antwort: "entret", "seqret", & "whichdb" don't work In-Reply-To: <456C448E-A291-4E90-95C3-4E7F937D1C9B@yahoo.co.jp> References: <456C448E-A291-4E90-95C3-4E7F937D1C9B@yahoo.co.jp> Message-ID: <41726.81.98.244.247.1152821656.squirrel@webmail.ebi.ac.uk> If you look at the top of your .embossrc file you'll see the line: # SET emboss_tempdata path_to_directory_$EMBOSS/test Uncomment that line and edit in the location of the test databases. >From your description of your installation the line should look like: SET emboss_tempdata /usr/local/share/EMBOSS/test HTH Alan Bleasby EBI From haruosuz at yahoo.co.jp Thu Jul 13 20:18:37 2006 From: haruosuz at yahoo.co.jp (haruosuz at yahoo.co.jp) Date: Thu, 13 Jul 2006 17:18:37 -0700 Subject: [EMBOSS] Antwort: "entret", "seqret", & "whichdb" don't work In-Reply-To: <41726.81.98.244.247.1152821656.squirrel@webmail.ebi.ac.uk> References: <456C448E-A291-4E90-95C3-4E7F937D1C9B@yahoo.co.jp> <41726.81.98.244.247.1152821656.squirrel@webmail.ebi.ac.uk> Message-ID: <8E5FCDC1-5421-47B5-BBF9-BFEEE1D629D7@yahoo.co.jp> Thank you very much. The commands successfully work after I edited .embossrc as follows: set emboss_acdroot /usr/local/share/EMBOSS/acd were replaced by set emboss_tempdata /usr/local/share/EMBOSS/test (example) $whichdb -showall Search all databases for an entry ID or Accession number: hsfau1 Output file [outfile.whichdb]: stdout # Trying 'twp:hsfau1' # Failed 'twp:hsfau1' # Trying 'tsw:hsfau1' # Failed 'tsw:hsfau1' # Trying 'tgenbank:hsfau1' tgenbank:hsfau1 # Trying 'tpir:hsfau1' # Failed 'tpir:hsfau1' # Trying 'tswnew:hsfau1' # Failed 'tswnew:hsfau1' # Trying 'tembl:hsfau1' tembl:hsfau1 # Trying 'tgb:hsfau1' # Failed 'tgb:hsfau1' -------------------------------------- Let's start Yahoo! Auction - Free Campaign Now! http://pr.mail.yahoo.co.jp/auction/ From gbottu at ben.vub.ac.be Fri Jul 14 04:32:24 2006 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Fri, 14 Jul 2006 10:32:24 +0200 Subject: [EMBOSS] Web Interfaces to Emboss Tools - Checked by AntiVir DEMO v In-Reply-To: <21c02dfe0607130918l7757810rd020330c76e50864@mail.gmail.com> References: <21c02dfe0607130918l7757810rd020330c76e50864@mail.gmail.com> Message-ID: <20060714083224.GB15333@bigben.ulb.ac.be> Dear Andy, Well, you might consider using wEMBOSS, developed by the Belgian and Argentinian EMBnet Nodes (http://wemboss.sourceforge.net/). It works with data stored on the server. The data are in a classic UNIX directory, so that you can easily let software run on these data in a terminal session or use ftp for bulk data transfers, in case you might want to do that. wEMBOSS has facilities to upload/download data and manage them in different "projects". On the same site you will also find wrappers4EMBOSS, that allows to integrate under the EMBOSS/wEMBOSS interface a number of programs that are very useful but lacking in EMBOSS (BLAST, fastA, MUSCLE, a program to search the complete PROSITE rather than just the patterns, ...). As for the recovery of data from SeqWeb, I have no experience with that. The related problem of how to use data generated by GCG under EMBOSS is simpler : EMBOSS does accept GCG sequence and GCG MSF files, as well as GCG codon usage tables. wEMBOSS does include a facility to convert GCG List Files into EMBOSS List Files. Sincerely, Guy Bottu, Belgian EMBnet Node From yasser at iastate.edu Fri Jul 14 10:29:19 2006 From: yasser at iastate.edu (Yasser El-Manzalawy) Date: Fri, 14 Jul 2006 09:29:19 -0500 (CDT) Subject: [EMBOSS] Nucleotide profiles with prophecy Message-ID: <1929914610651941@webmail.iastate.edu> Hi, I am trying to build a nucleotide profile for the following multiple sequence alignment: !!NA_MULTIPLE_ALIGNMENT 30 MSF: 8 Type: N Jul 14, 2006 01:37 Check: 0 .. Name: 1 Len: 8 Check: 2489 Weight: 1.00 Name: 2 Len: 8 Check: 2489 Weight: 1.00 Name: 3 Len: 8 Check: 2489 Weight: 1.00 Name: 4 Len: 8 Check: 2489 Weight: 1.00 Name: 5 Len: 8 Check: 2525 Weight: 1.00 Name: 6 Len: 8 Check: 2608 Weight: 1.00 Name: 7 Len: 8 Check: 2608 Weight: 1.00 Name: 8 Len: 8 Check: 2725 Weight: 1.00 Name: 9 Len: 8 Check: 2714 Weight: 1.00 Name: 10 Len: 8 Check: 2616 Weight: 1.00 Name: 11 Len: 8 Check: 2494 Weight: 1.00 Name: 12 Len: 8 Check: 2733 Weight: 1.00 Name: 13 Len: 8 Check: 2436 Weight: 1.00 Name: 14 Len: 8 Check: 2615 Weight: 1.00 Name: 15 Len: 8 Check: 2589 Weight: 1.00 Name: 16 Len: 8 Check: 2705 Weight: 1.00 Name: 17 Len: 8 Check: 2742 Weight: 1.00 Name: 18 Len: 8 Check: 2591 Weight: 1.00 Name: 19 Len: 8 Check: 2640 Weight: 1.00 Name: 20 Len: 8 Check: 2761 Weight: 1.00 Name: 21 Len: 8 Check: 2471 Weight: 1.00 Name: 22 Len: 8 Check: 2744 Weight: 1.00 Name: 23 Len: 8 Check: 2569 Weight: 1.00 Name: 24 Len: 8 Check: 2605 Weight: 1.00 Name: 25 Len: 8 Check: 2593 Weight: 1.00 Name: 26 Len: 8 Check: 2675 Weight: 1.00 Name: 27 Len: 8 Check: 2481 Weight: 1.00 Name: 28 Len: 8 Check: 2658 Weight: 1.00 Name: 29 Len: 8 Check: 2736 Weight: 1.00 Name: 30 Len: 8 Check: 2641 Weight: 1.00 // 1 CGTCACGC 2 CGTCACGC 3 CGTCACGC 4 CGTCACGC 5 GGTCACGG 6 TGTCATGC 7 TGTCATGC 8 AGTCATGT 9 AGTCACTT 10 GGTCACTG 11 TATCACGC 12 TGTCACTT 13 AGCCACGC 14 GATCATGG 15 CGTTACGG 16 AGTCTCTG 17 AGTCGTTG 18 TGCCACGT 19 GGTCAGTG 20 TGTCGTTG 21 ATTCACAC 22 GTTCATTG 23 CATCATAG 24 TATCAATG 25 AATGATGC 26 TAACATGT 27 AGTCCCGA 28 CAACATGT 29 ACTCGCTT 30 TGATAAGT I used the following command line: prophecy -sequence data.msf -type G -datafile Epprofile -name temp -outfile profile.prophecy -snucleotide1 Although both the input file and the command line indicate that this is nucleotide sequences, the obtained profile is for protein sequences. Could you please, point my to the source of the error? Is it in the data file or the command line that I used? Thanks Yasser EL-Manzalawy From ajb at ebi.ac.uk Sat Jul 15 05:33:48 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Sat, 15 Jul 2006 10:33:48 +0100 (BST) Subject: [EMBOSS] EMBOSS 4.0.0 released Message-ID: <51409.81.98.244.247.1152956028.squirrel@webmail.ebi.ac.uk> EMBOSS-4.0.0.tar.gz is now available. It can be downloaded from the directory: ftp://emboss.open-bio.org/pub/EMBOSS/ or via anonymous ftp to emboss.open-bio.org in the pub/EMBOSS directory. As usual, more complete information is in the ChangeLog file: here are some highlights. - new prompt style generated from 'knowntypes' - new -help format provides more information - new sequence access method 'dbfetch' uses the EBI's REST services - new sequence access method 'mrs' uses CMBI's "Maarten's Retrieval System." - new program backtranambig - new program makenucseq - new program makeprotseq - 'embl' format will read both the old EMBL format and the new one. A new output format 'emblnew' can be used to write the new format. - new 'swissnew' database format - lists of prosite patterns can now be used by fuzznuc, fuzzpro & fuzztran. Pattern lists can be specified using the @filename syntax. New options added specifically for pattern lists. Pattern lists have a new ACD definition type. - lists of regular expressions can now be used by dreg & preg - Use of GFF for proteins now allowed - prophet now uses an 'align' output type - iep allows the specification of the number of uncharged lysines and intra-chain disulphide bridges - splitter/union allow nucleotide deatues to be preserved - digest has a ragging capability - coderet writes any permutation of cds, mrna & protein to separate files - mincount option added to wordcount - biosed modified to allow the specification of sequence mutation position - wossname can now search for phrases - new sequence type 'gapstopprotein' - sequence reading from website URLs now defaults to HTTP 1.1 - new 'keywords' attribute in ACD files - many minor additions, bugfixes and placeholders for future capabilities EMBASSY packages VIENNA has been added. This is a port of the Vienna RNA package by Ivo Hofacker. It is to be regarded as an alpha test. We are investigating the incorporation of the Vienna sequence format into the main libraries. This would lead to simplification of the interface for future releases. HMMER: this package is now a wrapper written around HMMER 2.3.2 You must therefore install HMMER 2.3.2 from the http://hmmer.wustl.edu/ site and add it to your PATH. MEMENEW: this package is now a wrapper. You must therefore install MEME/MAST from the http://meme.sdsc.edu/meme/meme-download.html site and add it to your PATH. MYEMBOSS: This package enable developers to write their own applications using the standard EMBOSS distribution. PHYLIPNEW: This is now out of EMBOSS beta testing. It is PHYLIP version 3.6b Microsoft Windows An alpha test version of EMBOSS for Microsoft Windows is available from the 'windows' directory of the ftp server above. This port was done using Andre Blavier's EMBOSSWIN package as a starting point and we thank him for his work. The EMBOSS programs can be run from a DOS Command window. There is currently no GUI though we hope that some may spring up from the community. If, when trying to run applications, you get "DLL missing" errors then you will need to install the vcredist_x86.exe package for Visual C++ 2005 from the Microsoft web site. This small executable does not install a compiler, only the required runtime DLLs. Developers Developers should note that we are in the process of standardising library function names. Old function names will still work but will print out a 'deprecated' message when compiled using the GCC compiler. We therefore recommend use of this compiler for developers as an aid to updating their source code. Happy St Swithun's (Swithin's) Day. Alan EBI 15th July 2006 From ajb at ebi.ac.uk Mon Jul 17 14:17:47 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Mon, 17 Jul 2006 19:17:47 +0100 (BST) Subject: [EMBOSS] problem with EMBASSY program VIENNA In-Reply-To: References: Message-ID: <44816.81.98.244.247.1153160267.squirrel@webmail.ebi.ac.uk> Hi Bela, It's emboss at emboss.open-bio.org for the main list and emboss-bug at emboss.open-bio.org for bug reports Thanks for pointing out the VIENNA error. I've put a replacement VIENNA-1.6.tar.gz on the ftp server. That should fix the problem. ATB Alan From nycademon at spiralrealm.com Mon Jul 17 14:55:58 2006 From: nycademon at spiralrealm.com (Guido Vacano) Date: Mon, 17 Jul 2006 12:55:58 -0600 Subject: [EMBOSS] Jemboss Display Problem? Message-ID: <44BBDD3E.9070208@spiralrealm.com> Hello-- I recently installed EMBOSS (and Jemboss) on a Fedora Core 5 machine, running Tomcat 5.5 and Axis 1.4 (both downloaded binaries). Using Jemboss, everything seems to work fine, except there's a problem displaying results from restrict (and possibly other programs). The output is fine for maybe 100 or so lines, but then it turns into gibberish (as if I were trying to read a binary executable). If I download the results from the server via Jemboss, the downloaded file contains the same correct output, followed by gibberish. However, if I look at the output file on the server via a terminal connection, the entire file is correct, so it appears to be an error in transferring information from server to client. I have no idea if this is a Jemboss or Tomcat or Axis problem. Any ideas? Thanks, Guido Vacano From ajb at ebi.ac.uk Mon Jul 17 16:17:26 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Mon, 17 Jul 2006 21:17:26 +0100 (BST) Subject: [EMBOSS] Jemboss Display Problem? In-Reply-To: <44BBDD3E.9070208@spiralrealm.com> References: <44BBDD3E.9070208@spiralrealm.com> Message-ID: <39063.81.98.244.247.1153167446.squirrel@webmail.ebi.ac.uk> Dear Guido, Which version of EMBOSS did you install (typing 'embossversion' will show it)? This was a known problem in 3.0.0 but should be fixed in the latest EMBOSS release (4.0.0) Alan From nycademon at spiralrealm.com Mon Jul 17 16:52:38 2006 From: nycademon at spiralrealm.com (Guido Vacano) Date: Mon, 17 Jul 2006 14:52:38 -0600 Subject: [EMBOSS] Jemboss Display Problem? In-Reply-To: <39063.81.98.244.247.1153167446.squirrel@webmail.ebi.ac.uk> References: <44BBDD3E.9070208@spiralrealm.com> <39063.81.98.244.247.1153167446.squirrel@webmail.ebi.ac.uk> Message-ID: <44BBF896.3080008@spiralrealm.com> Sorry Alan, it was version 3. I guess it's time to upgrade. :-) Thanks, Guido ajb at ebi.ac.uk wrote: > Dear Guido, > > Which version of EMBOSS did you install (typing 'embossversion' > will show it)? > > This was a known problem in 3.0.0 but should be fixed in the > latest EMBOSS release (4.0.0) > > Alan > > > From jison at ebi.ac.uk Tue Jul 18 07:41:49 2006 From: jison at ebi.ac.uk (Jon Ison) Date: Tue, 18 Jul 2006 12:41:49 +0100 (BST) Subject: [EMBOSS] Nucleotide profiles with prophecy In-Reply-To: <1929914610651941@webmail.iastate.edu> References: <1929914610651941@webmail.iastate.edu> Message-ID: <37175.172.31.100.168.1153222909.squirrel@webmail.ebi.ac.uk> Dear Yasser The prophecy program is for use with protein sequences only and always interprets its input as protein. I don't think the underlying Gribskov or Henikoff profiles we're ever intended for use with nucleotide sequences. You could try the new EMBASSY HMMER package, which contains applications that wrap (call) applications for HMM analysis from the latest version of the hmmer suite by Sean Eddy. These too are not recommended for use with nucletotide sequences but would almost certainly work better than the older style profiles. Cheers Jon > Hi, > > I am trying to build a nucleotide profile for the following multiple sequence > alignment: > > !!NA_MULTIPLE_ALIGNMENT > > 30 MSF: 8 Type: N Jul 14, 2006 01:37 Check: 0 .. > > Name: 1 Len: 8 Check: 2489 Weight: 1.00 > Name: 2 Len: 8 Check: 2489 Weight: 1.00 > Name: 3 Len: 8 Check: 2489 Weight: 1.00 > Name: 4 Len: 8 Check: 2489 Weight: 1.00 > Name: 5 Len: 8 Check: 2525 Weight: 1.00 > Name: 6 Len: 8 Check: 2608 Weight: 1.00 > Name: 7 Len: 8 Check: 2608 Weight: 1.00 > Name: 8 Len: 8 Check: 2725 Weight: 1.00 > Name: 9 Len: 8 Check: 2714 Weight: 1.00 > Name: 10 Len: 8 Check: 2616 Weight: 1.00 > Name: 11 Len: 8 Check: 2494 Weight: 1.00 > Name: 12 Len: 8 Check: 2733 Weight: 1.00 > Name: 13 Len: 8 Check: 2436 Weight: 1.00 > Name: 14 Len: 8 Check: 2615 Weight: 1.00 > Name: 15 Len: 8 Check: 2589 Weight: 1.00 > Name: 16 Len: 8 Check: 2705 Weight: 1.00 > Name: 17 Len: 8 Check: 2742 Weight: 1.00 > Name: 18 Len: 8 Check: 2591 Weight: 1.00 > Name: 19 Len: 8 Check: 2640 Weight: 1.00 > Name: 20 Len: 8 Check: 2761 Weight: 1.00 > Name: 21 Len: 8 Check: 2471 Weight: 1.00 > Name: 22 Len: 8 Check: 2744 Weight: 1.00 > Name: 23 Len: 8 Check: 2569 Weight: 1.00 > Name: 24 Len: 8 Check: 2605 Weight: 1.00 > Name: 25 Len: 8 Check: 2593 Weight: 1.00 > Name: 26 Len: 8 Check: 2675 Weight: 1.00 > Name: 27 Len: 8 Check: 2481 Weight: 1.00 > Name: 28 Len: 8 Check: 2658 Weight: 1.00 > Name: 29 Len: 8 Check: 2736 Weight: 1.00 > Name: 30 Len: 8 Check: 2641 Weight: 1.00 > // > > 1 CGTCACGC > 2 CGTCACGC > 3 CGTCACGC > 4 CGTCACGC > 5 GGTCACGG > 6 TGTCATGC > 7 TGTCATGC > 8 AGTCATGT > 9 AGTCACTT > 10 GGTCACTG > 11 TATCACGC > 12 TGTCACTT > 13 AGCCACGC > 14 GATCATGG > 15 CGTTACGG > 16 AGTCTCTG > 17 AGTCGTTG > 18 TGCCACGT > 19 GGTCAGTG > 20 TGTCGTTG > 21 ATTCACAC > 22 GTTCATTG > 23 CATCATAG > 24 TATCAATG > 25 AATGATGC > 26 TAACATGT > 27 AGTCCCGA > 28 CAACATGT > 29 ACTCGCTT > 30 TGATAAGT > > I used the following command line: > prophecy -sequence data.msf -type G -datafile Epprofile -name temp -outfile > profile.prophecy -snucleotide1 > > Although both the input file and the command line indicate that this is > nucleotide sequences, the obtained profile is for protein sequences. > > Could you please, point my to the source of the error? Is it in the data file or > the command line that I used? > > > Thanks > Yasser EL-Manzalawy > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From Suraj.Mukatira at STJUDE.ORG Fri Jul 21 08:41:32 2006 From: Suraj.Mukatira at STJUDE.ORG (Mukatira, Suraj) Date: Fri, 21 Jul 2006 07:41:32 -0500 Subject: [EMBOSS] notseq limits Message-ID: Hello, I am writing to get an idea about the limits of 'notseq'(Windows EMBOSS). I noticed that it is unable to read-in more than 250 sequence ID's to be removed from a large file (fasta). Any thoughts/solutions will be greatly appreciated Thanks in anticipation Sincerely, Suraj Mukatira From ajb at ebi.ac.uk Fri Jul 21 11:03:13 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 21 Jul 2006 16:03:13 +0100 (BST) Subject: [EMBOSS] notseq limits In-Reply-To: References: Message-ID: <44434.81.98.244.247.1153494193.squirrel@webmail.ebi.ac.uk> Hello Suraj, > I am writing to get an idea about the limits of 'notseq'(Windows > EMBOSS). I noticed that it is unable to read-in more than 250 sequence > ID's to be removed from a large file (fasta). We're in somewhat unknown territory here but this is just the sort of feedback we need. I would suspect that the above is related to the standard heap size built into the executable. The heap size is determined at the program linking stage. If you are willing to test it out then I could produce a version with increased heap size. Is there anyone else on the list who has run into such memory limit problems with the Windows version? Alan From javierluiso at yahoo.com Fri Jul 21 11:10:35 2006 From: javierluiso at yahoo.com (Javier Luiso) Date: Fri, 21 Jul 2006 15:10:35 +0000 (GMT) Subject: [EMBOSS] New EMBOSS application : dottie Message-ID: <20060721151035.39538.qmail@web53415.mail.yahoo.com> Hi, I read the table of "suggested new applications for EMBOSS" ( http://emboss.sourceforge.net/apps/proposed.html) and I'm interesting in the app. dottie. I work in Computer Graphics and Visualization area, not in biology, so I need more specific information about the features dottie must include. Thanks. Javier Luiso __________________________________________________ Pregunt?. Respond?. Descubr?. Todo lo que quer?as saber, y lo que ni imaginabas, est? en Yahoo! Respuestas (Beta). ?Probalo ya! http://www.yahoo.com.ar/respuestas From dvorah at agri.huji.ac.il Tue Jul 25 11:12:13 2006 From: dvorah at agri.huji.ac.il (Deborah Weisman) Date: Tue, 25 Jul 2006 17:12:13 +0200 Subject: [EMBOSS] compiling embassy programs Message-ID: <44C634CD.3040105@agri.huji.ac.il> I have successfully compiled, installed and tested emboss 4 on a new Redhat ES 4 machine. I am trying to install the embassy programs, and am having trouble with many of them. The ones that installed without problems are: EMNU-1.05 ESIM4-1.0.0 HMMER-2.3.2 MEME-2.3.1 MSE-1.0.0 TOPO-1.0.0 Most of the others are giving problems. Starting with Phylip, since the docs claim that Phylip also should install without problems: Since emboss is installed into /usr/local , I did: ./configure --prefix=/usr/local --enable-localforce and then make gives: clique.c: In function `emboss_getoptions': clique.c:160: error: void value not ignored as it ought to be make: *** [all-recursive] Error 1 I downloaded the current version of phylip, without emboss additions, from : ftp://evolution.genetics.washington.edu/pub/phylip/phylip-3.65.tar.gz and it compiles and runs with no problems. Do you have any suggestions as to what I should be looking at? Thank you, Deborah Weisman From fernan at iib.unsam.edu.ar Tue Jul 25 12:09:11 2006 From: fernan at iib.unsam.edu.ar (Fernan Aguero) Date: Tue, 25 Jul 2006 13:09:11 -0300 Subject: [EMBOSS] compiling embassy programs In-Reply-To: <44C634CD.3040105@agri.huji.ac.il> References: <44C634CD.3040105@agri.huji.ac.il> Message-ID: <20060725160911.GC17788@iib.unsam.edu.ar> +----[ Deborah Weisman (25.Jul.2006 12:53): | | Starting with Phylip, since the docs claim that Phylip also should | install without problems: | Since emboss is installed into /usr/local , I did: | | ./configure --prefix=/usr/local --enable-localforce | | and then make gives: | | clique.c: In function `emboss_getoptions': | clique.c:160: error: void value not ignored as it ought to be | make: *** [all-recursive] Error 1 | | I downloaded the current version of phylip, without emboss additions, | from : | ftp://evolution.genetics.washington.edu/pub/phylip/phylip-3.65.tar.gz | and it compiles and runs with no problems. | | Do you have any suggestions as to what I should be looking at? | +----] Deborah, I've had the same problem building the old phylip against emboss-4.0.0, however the one that's called PHYLIPNEW (3.6b) compiles fine. I've compiled all embassy apps without problem against emboss 4.0.0 on FreeBSD-6.1. Following is the list of embassy apps with the versions I've used. If in doubt re-download the distfile, as sometimes they are re-rolled with a new version of emboss without changing their version ... below is the MD5 checksum and size of the files that are working for me. Cheers, fernan MD5 (emboss/DOMAINATRIX-0.1.0.tar.gz) = 5893d3e5f101783050cbbc44766fe7d8 SIZE (emboss/DOMAINATRIX-0.1.0.tar.gz) = 405474 MD5 (emboss/EMNU-1.05.tar.gz) = 3ef6e2ac28f55b167b7f2f3614015618 SIZE (emboss/EMNU-1.05.tar.gz) = 377734 MD5 (emboss/ESIM4-1.0.0.tar.gz) = 35b0f661043bd9c03aaba22f7bffc321 SIZE (emboss/ESIM4-1.0.0.tar.gz) = 417724 MD5 (emboss/HMMER-2.3.2.tar.gz) = 967454c708ecaa0cbd47deda66b78e65 SIZE (emboss/HMMER-2.3.2.tar.gz) = 546870 MD5 (emboss/MEMENEW-0.1.0.tar.gz) = 46b6ca9eeba6c63bd08ebe1b661434dc SIZE (emboss/MEMENEW-0.1.0.tar.gz) = 423254 MD5 (emboss/MSE-1.0.0.tar.gz) = b5f3f4ed1e74c6cf7a7d57d398a7634b SIZE (emboss/MSE-1.0.0.tar.gz) = 428940 MD5 (emboss/PHYLIPNEW-3.6b.tar.gz) = 3a12ee43c48562092f4f2add0e8f2978 SIZE (emboss/PHYLIPNEW-3.6b.tar.gz) = 1532866 MD5 (emboss/TOPO-1.0.0.tar.gz) = 538c5205fc65ff3b0f3b83dde466200f SIZE (emboss/TOPO-1.0.0.tar.gz) = 367882 MD5 (emboss/DOMALIGN-0.1.0.tar.gz) = 38ab9e0a0158cf923668d0e863606b54 SIZE (emboss/DOMALIGN-0.1.0.tar.gz) = 440714 MD5 (emboss/DOMSEARCH-0.1.0.tar.gz) = d214f124dd2806aa2eb163682dc7be7f SIZE (emboss/DOMSEARCH-0.1.0.tar.gz) = 452839 MD5 (emboss/SIGNATURE-0.1.0.tar.gz) = 64eae2537e7c887f5af2275ac3f1d2fa SIZE (emboss/SIGNATURE-0.1.0.tar.gz) = 549405 MD5 (emboss/STRUCTURE-0.1.0.tar.gz) = 93e7bb7fbd53d8aa2e1ab0d1af4f44c4 SIZE (emboss/STRUCTURE-0.1.0.tar.gz) = 514336 MD5 (emboss/MYEMBOSS-3.0.0.tar.gz) = 7536331836127104c3dac6941118cbac SIZE (emboss/MYEMBOSS-3.0.0.tar.gz) = 343762 MD5 (emboss/VIENNA-1.6.tar.gz) = 66087ecae4775e9c9928980f7976deee SIZE (emboss/VIENNA-1.6.tar.gz) = 590827 From gbottu at ben.vub.ac.be Wed Jul 26 06:13:46 2006 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Wed, 26 Jul 2006 12:13:46 +0200 Subject: [EMBOSS] the dbfetch and mrs access methods - Checked by AntiVir DEMO version - Message-ID: <20060726101346.GA11071@bigben.ulb.ac.be> Dear colleagues, EMBOSS version 4 has two new database access methods : "mrs" and "dbfetch". Unfortunately, there seems to be nowhere a documentation that tells how to configure it in emboss.defaults and I did not succeed. Has anyone already successfully intstalled EMBOSS 4 and used these mthods ? Sincerely, Guy Bottu, BEN From David.Bauer at schering.de Wed Jul 26 08:47:12 2006 From: David.Bauer at schering.de (David.Bauer at schering.de) Date: Wed, 26 Jul 2006 14:47:12 +0200 Subject: [EMBOSS] Emboss Win Message-ID: The Windows version is a bit dangerous because it does not append the installation directory to the system path variable but it overvrites this variable. Cheers, David. From ajb at ebi.ac.uk Wed Jul 26 15:41:56 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Wed, 26 Jul 2006 20:41:56 +0100 (BST) Subject: [EMBOSS] Emboss Win In-Reply-To: References: Message-ID: <40572.81.98.244.247.1153942916.squirrel@webmail.ebi.ac.uk> Hello David, > The Windows version is a bit dangerous because it does not append the > installation directory to the system path variable but it overvrites this > variable. On XP systems here it doesn't overwrite, rather it adds it to the PATH. On which Windows systems do you experience overwriting? Alan From andrespinzon at gmail.com Wed Jul 26 19:37:25 2006 From: andrespinzon at gmail.com (Andres Pinzon) Date: Wed, 26 Jul 2006 18:37:25 -0500 Subject: [EMBOSS] emboss explorer installation Message-ID: <8968fc7e0607261637k2fc29f57j79a0beb4309ebc9a@mail.gmail.com> Hi all, I just installed emboss 4.0 and wemboss 1.6.0, everythings fine ;-) Now im trying to install emboss-explorer (it used to be a straightforward install) but some things went wrong, for instance, it never finds the emboss manuals, as far as i can see from the install file it tries to find'em in: $EMBOSS_PREFIX/share/EMBOSS/doc/programs/html But actually they are in: $EMBOSS_PREFIX/share/EMBOSS/doc/html/emboss/apps So I changed that line. But it didn't work. Im also trying to change the .css file but changes are not reflected on the webpage. Applications run fine (emma etc.) Any help? Thanks. -- Andr?s Pinz?n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From David.Bauer at SCHERING.DE Thu Jul 27 01:55:18 2006 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Thu, 27 Jul 2006 07:55:18 +0200 Subject: [EMBOSS] Emboss Win In-Reply-To: <40572.81.98.244.247.1153942916.squirrel@webmail.ebi.ac.uk> Message-ID: Hello Alan, it was on "a kind of" XP Pro. This is not a generic XP but a special core build designed for company use. I will test the Emboss setup on my XP Home and some other XP Pro to see what happens to the PATH. David. ajb at ebi.ac.uk schrieb am 26/07/2006 21:41:56: > Hello David, > > > The Windows version is a bit dangerous because it does not append the > > installation directory to the system path variable but it overvrites this > > variable. > > On XP systems here it doesn't overwrite, rather it adds it to the PATH. > > On which Windows systems do you experience overwriting? > > Alan > > From gbottu at ben.vub.ac.be Thu Jul 27 04:20:04 2006 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Thu, 27 Jul 2006 10:20:04 +0200 Subject: [EMBOSS] emboss explorer installation - Checked by AntiVir DEMO ver In-Reply-To: <8968fc7e0607261637k2fc29f57j79a0beb4309ebc9a@mail.gmail.com> References: <8968fc7e0607261637k2fc29f57j79a0beb4309ebc9a@mail.gmail.com> Message-ID: <20060727082004.GA22324@bigben.ulb.ac.be> On Wed, Jul 26, 2006 at 06:37:25PM -0500, Andres Pinzon wrote: > I just installed emboss 4.0 and wemboss 1.6.0, everythings fine ;-) I'm afraid you did not take a good look, because wEMBOSS 1.6.0 does not handle a few things that changed between EMBOSS 3.0 and 4.0 : - the program pages cannot display the length of the sequence, because the output format of infoseq changed - the "fuzzies" do not work because of the new object "pattern" - wEMBOSS cannot find the on-line manuals because their location changed (see also below) This will be fixed in wEMBOSS 1.7.0, which will be out end August or begin September. > Now im trying to install emboss-explorer (it used to be a > straightforward install) but some things went wrong, for instance, it > never finds the emboss manuals, as far as i can see from the install > file it tries to find'em in: > $EMBOSS_PREFIX/share/EMBOSS/doc/programs/html > But actually they are in: > $EMBOSS_PREFIX/share/EMBOSS/doc/html/emboss/apps Try the following : cd $EMBOSS_PREFIX/share/EMBOSS/doc/programs ln -s $EMBOSS_PREFIX/share/EMBOSS/doc/html/emboss/apps html (or make a directory html and just copy the files) Under wEMBOSS it works and I see no reason why it should not work under emboss explorer. The only problem is that if you have also "Embassadirs" there are troubles in navigating from one manual page to another because the Embassadirs are supposed to have their pages in different directories. Guy Bottu, Belgian EMBnet Node From ajb at ebi.ac.uk Thu Jul 27 06:45:15 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 27 Jul 2006 11:45:15 +0100 (BST) Subject: [EMBOSS] Emboss Win In-Reply-To: References: <40572.81.98.244.247.1153942916.squirrel@webmail.ebi.ac.uk> Message-ID: <48865.81.98.244.247.1153997115.squirrel@webmail.ebi.ac.uk> Hello David, Thanks, it would be interesting to know what triggers it. It ought to be safe under all circumstances that I've been able to think of but I may have missed one. A program is supplied in the distribution called setenv.exe which is called by the installer. That program does the obvious sort of things and has a switch to specify appending. That switch is, of course, set. As you probably know, environment variables are handled differently in XP/2K compared to 98/ME. In the former it's a registry thing, for the others it's an autoexec.bat alteration job. setenv.exe should be able to deal with both. The uninstaller will call setenv.exe with a different switch + the installation path so that that specific part of the PATH will be deleted. Specifically, setenv -a envvarname value creates and overwrites setenv -a envvarname %value adds value to envvar (used for PATH) setenv -d envvarname deletes an envvar setenv -d envvarname %value removes value from envvar The above ought to help you with your investigation. ATB Alan > > Hello Alan, > > it was on "a kind of" XP Pro. This is not a generic XP but a special core > build designed for company use. > I will test the Emboss setup on my XP Home and some other XP Pro to see > what happens to the PATH. > > David. > > ajb at ebi.ac.uk schrieb am 26/07/2006 21:41:56: > >> Hello David, >> >> > The Windows version is a bit dangerous because it does not append the >> > installation directory to the system path variable but it overvrites > this >> > variable. >> >> On XP systems here it doesn't overwrite, rather it adds it to the PATH. >> >> On which Windows systems do you experience overwriting? >> >> Alan >> >> > > From ajb at ebi.ac.uk Thu Jul 27 08:06:09 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 27 Jul 2006 13:06:09 +0100 (BST) Subject: [EMBOSS] the dbfetch and mrs access methods - Checked by AntiVir DEMO version - In-Reply-To: <20060726101346.GA11071@bigben.ulb.ac.be> References: <20060726101346.GA11071@bigben.ulb.ac.be> Message-ID: <57140.81.98.244.247.1154001969.squirrel@webmail.ebi.ac.uk> Hello Guy, Posted this yesterday but their were problems with our mailer. Reposting as it hasn't appeared in the list archives. > EMBOSS version 4 has two new database access methods : "mrs" and > "dbfetch". Unfortunately, there seems to be nowhere a documentation that > tells how to configure it in emboss.defaults and I did not succeed. Has > anyone already successfully intstalled EMBOSS 4 and used these mthods ? A quick look shows that it does seem to be an oversight in the release. The code is there but it appears not to have been activated in ajnam.c (easy to fix). However, once that's done there does appear to be another minor issue with mrs retrieval. More on this and any necessary fix, probably next week, when the rest of the development team get back from their holidays (we do at least try to maintain demarcation within the code.) Alan From andrespinzon at gmail.com Fri Jul 28 15:40:29 2006 From: andrespinzon at gmail.com (Andres Pinzon) Date: Fri, 28 Jul 2006 14:40:29 -0500 Subject: [EMBOSS] cutg database Message-ID: <8968fc7e0607281240y67a1d506lfce523e3889869f8@mail.gmail.com> Is it necessary to dowwnload all gb* archives from ftp://ftp.kazusa.or.jp/pub/codon/current/ in order to have the cutg database running? -- Andr?s Pinz?n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From andrespinzon at gmail.com Fri Jul 28 15:47:11 2006 From: andrespinzon at gmail.com (Andres Pinzon) Date: Fri, 28 Jul 2006 14:47:11 -0500 Subject: [EMBOSS] cutg database In-Reply-To: <8968fc7e0607281240y67a1d506lfce523e3889869f8@mail.gmail.com> References: <8968fc7e0607281240y67a1d506lfce523e3889869f8@mail.gmail.com> Message-ID: <8968fc7e0607281247t97598cet89256f8afe21b79d@mail.gmail.com> On 7/28/06, Andres Pinzon wrote: > Is it necessary to dowwnload all gb* archives from > ftp://ftp.kazusa.or.jp/pub/codon/current/ in order to have the cutg > database running? I answer myself! It seems that one only need the CUTG.151.tar.gz (158Mb) file under the compressed/ directory. ;-) I have not ran the "cutgextract" command yet, i'll see. -- Andr?s Pinz?n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From fkosuke at yahoo.co.jp Mon Jul 31 03:22:32 2006 From: fkosuke at yahoo.co.jp (=?ISO-2022-JP?B?GyRCQSU4TRsoQiAbJEJeK00kGyhC?=) Date: Mon, 31 Jul 2006 16:22:32 +0900 (JST) Subject: [EMBOSS] Installation Problem Message-ID: <20060731072232.78255.qmail@web3314.mail.bbt.yahoo.co.jp> Hi there, I'm trying to install EMBOSS to my linux machine, however I've got an error message. My OS is Suse-linux-3.3.4, and the version of EMBOSS is 4.0.0. I didn't get error message during configuration. The mailing list archives don't seem to help me. Could anyone tell me how to get through this problem? Thanks, Kosuke === Here is the error message === ... gcc -O2 -o .libs/aaindexextract aaindexextract.o ../nucleus/.libs/libnucleus.so ../ajax/.libs/libajaxg.so ../ajax/.libs/libajax.so ../plplot/.libs/libplplot.so /usr/lib/libgd.so -L/usr/lib -L/usr/X11R6/lib -lXpm -lX11 /usr/lib/libjpeg.so /usr/local/lib/libfreetype.so -lpng12 -lpng -lz -lm -Wl,--rpath -Wl,/usr/local/emboss/lib /usr/lib/gcc-lib/i586-suse-linux/3.3.4/../../../../i586-suse-linux/bin/ld: cannot find -lXpm collect2: ld returned 1 exit status make[2]: *** [aaindexextract] Error 1 ... ******************************** Kosuke Funato Dept. of Mol. and Gen. Info IMCB, Univ. of Tokyo, Japan Tel: +81-3-5841-7869 Fax: 8482 fkosuke at yahoo.co.jp ss66333 at mail.ecc.u-tokyo.ac.jp ******************************** --------------------------------- Let's start Yahoo! Auction - Free Campaign Now! From gbottu at ben.vub.ac.be Mon Jul 31 04:09:02 2006 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Mon, 31 Jul 2006 10:09:02 +0200 Subject: [EMBOSS] cutg database - Checked by AntiVir DEMO version - In-Reply-To: <8968fc7e0607281247t97598cet89256f8afe21b79d@mail.gmail.com> References: <8968fc7e0607281240y67a1d506lfce523e3889869f8@mail.gmail.com> <8968fc7e0607281247t97598cet89256f8afe21b79d@mail.gmail.com> Message-ID: <20060731080902.GA3996@bigben.ulb.ac.be> On Fri, Jul 28, 2006 at 02:47:11PM -0500, Andres Pinzon wrote: > On 7/28/06, Andres Pinzon wrote: > > Is it necessary to dowwnload all gb* archives from > > ftp://ftp.kazusa.or.jp/pub/codon/current/ in order to have the cutg > > database running? > It seems that one only need the CUTG.151.tar.gz (158Mb) file under the > compressed/ directory. ;-) > I have not ran the "cutgextract" command yet, i'll see. Dear Andres, It are actually the files *.codon that are needed for EMBOSS ; downloading and extracting CUTG.151.tar.gz will do the job. There is however a problem : cutgextract puts the files with codons in .../share/EMBOSS/data/CODON. Under wEMBOSS this produces a selector with thenthousands of entries, which causes delays in the transfer of the Web page and is though to use. I do not know how EMBOSS explorer behaves. The EMBOSS development team is considering putting the CUTG files in a separate directory CUTG, but they have not yet done so. At the BEN site I have modified cutgextract, so that it creates files with extension .cutg instead of .cut ; wEMBOSS only displays the *.cut files in the selector and the .cutg files can still be accessed by typing in their name or by retrieving them with embossdata. Hope this information helps, Guy Bottu, Belgian EMBnet Node From ajb at ebi.ac.uk Mon Jul 31 04:24:18 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Mon, 31 Jul 2006 09:24:18 +0100 (BST) Subject: [EMBOSS] Installation Problem In-Reply-To: <20060731072232.78255.qmail@web3314.mail.bbt.yahoo.co.jp> References: <20060731072232.78255.qmail@web3314.mail.bbt.yahoo.co.jp> Message-ID: <53502.81.98.244.247.1154334258.squirrel@webmail.ebi.ac.uk> Hello Kosuke, > My OS is Suse-linux-3.3.4, I'm unfamiliar with that particular release of SuSE (unless that's a compiler version :-) > > gcc -O2 -o .libs/aaindexextract aaindexextract.o > ../nucleus/.libs/libnucleus.so ../ajax/.libs/libajaxg.so > ../ajax/.libs/libajax.so ../plplot/.libs/libplplot.so /usr/lib/libgd.so > -L/usr/lib -L/usr/X11R6/lib -lXpm -lX11 /usr/lib/libjpeg.so > /usr/local/lib/libfreetype.so -lpng12 -lpng -lz -lm -Wl,--rpath > -Wl,/usr/local/emboss/lib > /usr/lib/gcc-lib/i586-suse-linux/3.3.4/../../../../i586-suse-linux/bin/ld: > cannot find -lXpm > collect2: ld returned 1 exit status > make[2]: *** [aaindexextract] Error 1 As the error suggests, it can't find the file libXpm.so. Under later SuSE releases you will need to: a) Install the xorg-x11-devel RPM b) "make clean" in EMBOSS c) configure EMBOSS again HTH Alan EBI From andrespinzon at gmail.com Mon Jul 31 10:56:26 2006 From: andrespinzon at gmail.com (Andres Pinzon) Date: Mon, 31 Jul 2006 09:56:26 -0500 Subject: [EMBOSS] Fwd: Installation Problem In-Reply-To: <8968fc7e0607310756s36c988ccva8817f0f7588ad76@mail.gmail.com> References: <20060731072232.78255.qmail@web3314.mail.bbt.yahoo.co.jp> <8968fc7e0607310756s36c988ccva8817f0f7588ad76@mail.gmail.com> Message-ID: <8968fc7e0607310756y7e4ab1ffl3366eb649ecf61f9@mail.gmail.com> ---------- Forwarded message ---------- From: Andres Pinzon Date: Jul 31, 2006 9:56 AM Subject: Re: [EMBOSS] Installation Problem To: ???? ???? On 7/31/06, ???? ???? wrote: > === Here is the error message === > > ... > gcc -O2 -o .libs/aaindexextract aaindexextract.o ../nucleus/.libs/libnucleus.so ../ajax/.libs/libajaxg.so ../ajax/.libs/libajax.so ../plplot/.libs/libplplot.so /usr/lib/libgd.so -L/usr/lib -L/usr/X11R6/lib -lXpm -lX11 /usr/lib/libjpeg.so /usr/local/lib/libfreetype.so -lpng12 -lpng -lz -lm -Wl,--rpath -Wl,/usr/local/emboss/lib > /usr/lib/gcc-lib/i586-suse-linux/3.3.4/../../../../i586-suse-linux/bin/ld: cannot find -lXpm > collect2: ld returned 1 exit status > make[2]: *** [aaindexextract] Error 1 On suse libpng is under /usr/lib, so you have to run the installation with the following option: ./configure --with-pngdriver=/usr/lib This is the way I ran it in a SuSE 9.1 machine (after installing X11 devel package): ./configure --with-pngdriver=/usr/lib --prefix=/usr/local/emboss You can also install it without X support: ./configure --with-pngdriver=/usr/lib --prefix=/usr/local/emboss --without-x Hope this help ;-) -- Andr??s Pinz??n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- -- Andr??s Pinz??n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From ajb at ebi.ac.uk Mon Jul 31 11:57:43 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Mon, 31 Jul 2006 16:57:43 +0100 (BST) Subject: [EMBOSS] Fwd: Installation Problem In-Reply-To: <8968fc7e0607310756y7e4ab1ffl3366eb649ecf61f9@mail.gmail.com> References: <20060731072232.78255.qmail@web3314.mail.bbt.yahoo.co.jp> <8968fc7e0607310756s36c988ccva8817f0f7588ad76@mail.gmail.com> <8968fc7e0607310756y7e4ab1ffl3366eb649ecf61f9@mail.gmail.com> Message-ID: <51441.81.98.244.247.1154361463.squirrel@webmail.ebi.ac.uk> > On suse libpng is under /usr/lib, so you have to run the installation > with the following option: > > ./configure --with-pngdriver=/usr/lib Just two points to add there: a) You don't have to use PNG graphics if you don't want to. b) If the libpng library is under /usr/lib then the configure option would be: --with-pngdriver=/usr [if you specify /usr/lib then it will search for /usr/lib/lib and /usr/lib/include - neither of which is likely to exist] The configure script will, however, look for the libraries and include- files under /usr/lib and /usr/include anyway. In short, as long as you've got any zlib-devel, libpng-devel and gd-devel RPMs installed, you should not need to specify the --with-pngdriver switch under SuSE to be able to use PNG graphiics. The same applies to most Linux distributions. At least, that's the theory. Alan EBI From olivier.friard at unito.it Tue Jul 4 16:45:44 2006 From: olivier.friard at unito.it (Olivier Friard) Date: Tue, 04 Jul 2006 18:45:44 +0200 Subject: [EMBOSS] new format EMBL flat files index Message-ID: <44AA9B38.9070502@unito.it> Hi, I try to make indexes for the release 87 of EMBL with new first line format: * I downloaded EMBOSS-3.0.0 * gunzip, tar xvf ... * I replaced the files with the files in the fixes directory * ./configure --prefix= .... ,make, make install * I indexed my rel_std_*.dat files (db name: embl) with dbiflat * I wrote a emboss.default file for embl db (showdb works) but when I try the seqret application I obtained this output: >.1; .1; Human cytomegalovirus strain AD169 complete genome gggccgcgtggtgggtcctcgaggggcgggggggtgtttttagcgggggggtgaaacttg gagttgcgtgtgtggacggcgactagttgcgtgtggtgcggaggacggcgacggcgaata aaagcgacgtgcggcgcgcacggcgaaaagaagacgcgtgtctgtgtctgtgtgattccc ... I tried to index these new files with EMBLNEW format (in place of EMBL) as specified in the README file in the fixes directory but it is not a valid format. Does anyone index the new format EMBL flat file successfully? Thank you for the help Olivier -- Olivier Friard Laboratorio di Biologia Computazionale - Facolt? di Scienze MFN Universit? di Torino via Accademia Albertina 13, 10124 TORINO (Italy) tel. +39 011 6704689 http://www.personalweb.unito.it/olivier.friard/ From pmr at ebi.ac.uk Tue Jul 4 22:41:46 2006 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Tue, 4 Jul 2006 23:41:46 +0100 (BST) Subject: [EMBOSS] new format EMBL flat files index In-Reply-To: <44AA9B38.9070502@unito.it> References: <44AA9B38.9070502@unito.it> Message-ID: <1119.86.132.216.178.1152052906.squirrel@webmail.ebi.ac.uk> Dear Olivier, > I try to make indexes for the release 87 of EMBL with new first line > format: > > * I downloaded EMBOSS-3.0.0 > > * gunzip, tar xvf ... > > * I replaced the files with the files in the fixes directory There was a new fix last week for the embl87 format. As you see the "emblnew" format, I assume you are using the latest fix. > but when I try the seqret application I obtained this output: > > >.1; .1; Human cytomegalovirus strain AD169 complete genome > gggccgcgtggtgggtcctcgaggggcgggggggtgtttttagcgggggggtgaaacttg > gagttgcgtgtgtggacggcgactagttgcgtgtggtgcggaggacggcgacggcgaata > aaagcgacgtgcggcgcgcacggcgaaaagaagacgcgtgtctgtgtctgtgtgattccc > ... That is what you see without the fixes. Can you check all the fix files were copied, including ajax/ajseqread.c which seqret uses to read the new format. > I tried to index these new files with EMBLNEW format (in place of EMBL) > as specified in the README file in the fixes directory but it is not a > valid format. emblnew is a sequence format, not an indexing format (dbiflat, dbxflat, and anything reading embl files should read both formats with the new fixes. > Does anyone index the new format EMBL flat file successfully? Yes, I did ... but if anyone else has problems please let me know. I will try tomorrow to set up a simple test for everyone to check on a short embl database. regards, Peter From haruosuz at yahoo.co.jp Tue Jul 11 17:16:06 2006 From: haruosuz at yahoo.co.jp (haruosuz at yahoo.co.jp) Date: Tue, 11 Jul 2006 10:16:06 -0700 Subject: [EMBOSS] "entret", "seqret", & "whichdb" don't work Message-ID: <038E5E31-16A0-47E7-82D8-4F84F8C3E708@yahoo.co.jp> Dear Sir, The commands "entret", "seqret", and "whichdb" don't work on my intel Mac. http://www.csc.fi/molbio/progs/emboss/doc/programs/html/entret.html $entret tembl:hsfau Reads and writes (returns) flatfile entries Error: failed to open filename 'tembl' Error: Unable to read sequence 'tembl:hsfau' Died: entret terminated: Bad value for '-sequence' and no prompt http://www.csc.fi/molbio/progs/emboss/doc/programs/html/seqret.html $seqret Reads and writes (returns) sequences Input sequence(s): tembl:hsfau Error: failed to open filename 'tembl' Error: Unable to read sequence 'tembl:hsfau' http://www.csc.fi/molbio/progs/emboss/doc/programs/html/whichdb.html $whichdb -showall Search all databases for an entry ID or Accession number: hsfau1 Output file [outfile.whichdb]: stdout [About my Mac] Mac OS X 10.4.6 Darwin 8.6.1 MacBookPro1,1 Intel Core Duo I am looking forward to hearing from you. Sincerely yours, Haruo Suzuki -------------------------------------- Let's start Yahoo! Auction - Free Campaign Now! http://pr.mail.yahoo.co.jp/auction/ From David.Bauer at SCHERING.DE Wed Jul 12 05:47:34 2006 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Wed, 12 Jul 2006 07:47:34 +0200 Subject: [EMBOSS] Antwort: "entret", "seqret", & "whichdb" don't work In-Reply-To: <038E5E31-16A0-47E7-82D8-4F84F8C3E708@yahoo.co.jp> Message-ID: Hi, the emboss.default file, which comes with the distribution, contains some example definitions for databases. But they don't work out of the box. In principle there are two ways for database access from emboss: You can either have the data on a local file system and index them with the emboss utilities (dbxflat, dbxfasta etc.) or you can configure emboss to access remote databases via http. There is a chapter about database configuration in the documentation http://emboss.sourceforge.net/docs/themes/Databases.html which explains in detail how to configure database access. Hope this helps, David. emboss-bounces at lists.open-bio.org schrieb am 11/07/2006 19:16:06: > Dear Sir, > > The commands "entret", "seqret", and "whichdb" don't work on my intel > Mac. > > http://www.csc.fi/molbio/progs/emboss/doc/programs/html/entret.html > $entret tembl:hsfau > Reads and writes (returns) flatfile entries > Error: failed to open filename 'tembl' > Error: Unable to read sequence 'tembl:hsfau' > Died: entret terminated: Bad value for '-sequence' and no prompt > > http://www.csc.fi/molbio/progs/emboss/doc/programs/html/seqret.html > $seqret > Reads and writes (returns) sequences > Input sequence(s): tembl:hsfau > Error: failed to open filename 'tembl' > Error: Unable to read sequence 'tembl:hsfau' > > http://www.csc.fi/molbio/progs/emboss/doc/programs/html/whichdb.html > $whichdb -showall > Search all databases for an entry > ID or Accession number: hsfau1 > Output file [outfile.whichdb]: stdout > > > [About my Mac] > Mac OS X 10.4.6 > Darwin 8.6.1 > MacBookPro1,1 > Intel Core Duo > > I am looking forward to hearing from you. > > Sincerely yours, > > Haruo Suzuki > > -------------------------------------- > Let's start Yahoo! Auction - Free Campaign Now! > http://pr.mail.yahoo.co.jp/auction/ > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From loungechimp at gmail.com Thu Jul 13 16:18:05 2006 From: loungechimp at gmail.com (Andy Fant) Date: Thu, 13 Jul 2006 12:18:05 -0400 Subject: [EMBOSS] Web Interfaces to Emboss Tools Message-ID: <21c02dfe0607130918l7757810rd020330c76e50864@mail.gmail.com> Afternoon all, After a particularly bad run of defective data DVDs from Accelrys, I have decided that I want to make a full-court press to convince the decision makers that we could spend the money we are spending on that subscription and license on other priorities and migrate our core bioinformatics service to Emboss. I have two primary questions related to this. First, much of our user community is using SeqWeb as their interface to GCG. I know that there are a few Emboss web interfaces out there, and I would like to get feedback from people that have deployed them to wide-ranging production about their experiences. The ability to store sequence data and results on the server side is considered to be an essential feature, which appears to rule out some of the leading contenders. Also, does anyone have any experience/scripts/warnings for pulling the corpus of data stored in SeqWeb out into a format easily accessible by Emboss and it's various web interfaces? I'd rather not go in and manually try to extract it if there is a better way. Thanks in advance. If there is demand, I'll summarize for the list. (My apologies for the nom de plume. I don't want to telegraph my plans to managers or vendors until I have all my ducks in a row) From golharam at umdnj.edu Thu Jul 13 17:11:23 2006 From: golharam at umdnj.edu (Ryan Golhar) Date: Thu, 13 Jul 2006 13:11:23 -0400 Subject: [EMBOSS] Web Interfaces to Emboss Tools In-Reply-To: <21c02dfe0607130918l7757810rd020330c76e50864@mail.gmail.com> Message-ID: <007d01c6a69f$5f4b2950$e6028a0a@GOLHARMOBILE1> Hi Andy, Congratulations on your decisions to migrate from GCG to EMBOSS. We did it about a 2 yrs ago because of SeqWeb issues with different web browsers. We haven't looked back since. If you would like to see our installation, go to http://emboss.umdnj.edu/emboss. We were using GCG for at least 5+ years (before I started working here). I discovered EMBOSS about 3 yrs ago and prefer it over GCG for many reasons. We didn't make the transition until we found a suitable web interface as the majority of our users prefer the web interface. In the end, we chose EMBOSS-Explorer - it's a simple, clean interface compatible with a wide range of browsers (a severely lacking feature with SeqWeb). I noticed you require server-side storge, EMBOSS-Explorer requires nothing on the server side not even user accounts, the users store everything locally on their machines. This reduced our maintainence needs for backups. We find it to be a better solution than maintaining central storage for this type of data. I would recommend you tell your users to get their data out of SeqWeb. You can hold onto the storage in case anyone doesn't. There is a hidden file called .gcgwebprojects in /seqweb/config or something like that, that associates users with projects, so if you have to, you can go back at a later date to retrieve data for users. We've only had to do this a handful of times. The files are stored in text format, FASTA format I think. Good luck! -- Ryan Golhar - golharam at umdnj.edu The Informatics Institute of UMDNJ -----Original Message----- From: emboss-bounces at lists.open-bio.org [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of Andy Fant Sent: Thursday, July 13, 2006 12:18 PM To: emboss at lists.open-bio.org Subject: [EMBOSS] Web Interfaces to Emboss Tools Afternoon all, After a particularly bad run of defective data DVDs from Accelrys, I have decided that I want to make a full-court press to convince the decision makers that we could spend the money we are spending on that subscription and license on other priorities and migrate our core bioinformatics service to Emboss. I have two primary questions related to this. First, much of our user community is using SeqWeb as their interface to GCG. I know that there are a few Emboss web interfaces out there, and I would like to get feedback from people that have deployed them to wide-ranging production about their experiences. The ability to store sequence data and results on the server side is considered to be an essential feature, which appears to rule out some of the leading contenders. Also, does anyone have any experience/scripts/warnings for pulling the corpus of data stored in SeqWeb out into a format easily accessible by Emboss and it's various web interfaces? I'd rather not go in and manually try to extract it if there is a better way. Thanks in advance. If there is demand, I'll summarize for the list. (My apologies for the nom de plume. I don't want to telegraph my plans to managers or vendors until I have all my ducks in a row) _______________________________________________ EMBOSS mailing list EMBOSS at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/emboss From haruosuz at yahoo.co.jp Thu Jul 13 18:55:34 2006 From: haruosuz at yahoo.co.jp (haruosuz at yahoo.co.jp) Date: Thu, 13 Jul 2006 11:55:34 -0700 Subject: [EMBOSS] Antwort: "entret", "seqret", & "whichdb" don't work Message-ID: <456C448E-A291-4E90-95C3-4E7F937D1C9B@yahoo.co.jp> Thank you very much for your advises. http://emboss.sourceforge.net/docs/themes/Databases.html I made the two configuration files (emboss.default & .embossrc) and "showdb" showed the database, but the commands (entret, seqret, & whichdb) don't work. The details are described below. ------------------------------------------- http://emboss.sourceforge.net/docs/themes/Databases.html#default The emboss.default file (1) emboss.default (share/EMBOSS) $ cd /usr/local/share/EMBOSS $ su # cp emboss.default.template emboss.default (2) .embossrc (personal home directory) .embossrc set emboss_acdroot /usr/local/share/EMBOSS/acd http://emboss.sourceforge.net/docs/themes/Databases.html#test Testing the database definitions (run showdb) $showdb Displays information on the currently available databases # Name Type ID Qry All Comment # ==== ==== == === === ======= tpir P OK OK OK PIR using NBRF access for 4 files tsw P OK OK OK Swissprot native format with EMBL CD- ROM index tswnew P OK OK OK Swissnew as 3 files in native format with EMBL CD-ROM index twp P OK OK OK EMBL new in native format with EMBL CD- ROM index tembl N OK OK OK EMBL in native format with EMBL CD-ROM index tgb N OK - - Genbank IDs tgenbank N OK OK OK GenBank in native format with EMBL CD- ROM index http://www.csc.fi/molbio/progs/emboss/doc/programs/html/entret.html $entret tembl:hsfau Reads and writes (returns) flatfile entries Warning: Cannot open division file '' for database 'tembl' Warning: seqCdQry failed Error: Unable to read sequence 'tembl:hsfau' Died: entret terminated: Bad value for '-sequence' and no prompt http://www.csc.fi/molbio/progs/emboss/doc/programs/html/seqret.html $seqret Reads and writes (returns) sequences Input sequence(s): tembl:hsfau Warning: Cannot open division file '' for database 'tembl' Warning: seqCdQry failed Error: Unable to read sequence 'tembl:hsfau' Input sequence(s): http://www.csc.fi/molbio/progs/emboss/doc/programs/html/whichdb.html $whichdb -showall Search all databases for an entry ID or Accession number: hsfau1 Output file [outfile.whichdb]: stdout # Trying 'twp:hsfau1' Warning: Cannot open division file '' for database 'twp' Warning: seqCdQry failed # Failed 'twp:hsfau1' # Trying 'tsw:hsfau1' Warning: Cannot open division file '' for database 'tsw' Warning: seqCdQry failed # Failed 'tsw:hsfau1' # Trying 'tgenbank:hsfau1' Warning: Cannot open division file '' for database 'tgenbank' Warning: seqCdQry failed # Failed 'tgenbank:hsfau1' # Trying 'tpir:hsfau1' Warning: Cannot open division file '' for database 'tpir' EMBOSS An error in ajseqdb.c at line 5141: seqCdQryOpen failed ------------------------------------------- Haruo Suzuki http://emboss.open-bio.org/pipermail/emboss/2006-July/002561.html -------------------------------------- Let's start Yahoo! Auction - Free Campaign Now! http://pr.mail.yahoo.co.jp/auction/ From ajb at ebi.ac.uk Thu Jul 13 20:14:16 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 13 Jul 2006 21:14:16 +0100 (BST) Subject: [EMBOSS] Antwort: "entret", "seqret", & "whichdb" don't work In-Reply-To: <456C448E-A291-4E90-95C3-4E7F937D1C9B@yahoo.co.jp> References: <456C448E-A291-4E90-95C3-4E7F937D1C9B@yahoo.co.jp> Message-ID: <41726.81.98.244.247.1152821656.squirrel@webmail.ebi.ac.uk> If you look at the top of your .embossrc file you'll see the line: # SET emboss_tempdata path_to_directory_$EMBOSS/test Uncomment that line and edit in the location of the test databases. >From your description of your installation the line should look like: SET emboss_tempdata /usr/local/share/EMBOSS/test HTH Alan Bleasby EBI From haruosuz at yahoo.co.jp Fri Jul 14 00:18:37 2006 From: haruosuz at yahoo.co.jp (haruosuz at yahoo.co.jp) Date: Thu, 13 Jul 2006 17:18:37 -0700 Subject: [EMBOSS] Antwort: "entret", "seqret", & "whichdb" don't work In-Reply-To: <41726.81.98.244.247.1152821656.squirrel@webmail.ebi.ac.uk> References: <456C448E-A291-4E90-95C3-4E7F937D1C9B@yahoo.co.jp> <41726.81.98.244.247.1152821656.squirrel@webmail.ebi.ac.uk> Message-ID: <8E5FCDC1-5421-47B5-BBF9-BFEEE1D629D7@yahoo.co.jp> Thank you very much. The commands successfully work after I edited .embossrc as follows: set emboss_acdroot /usr/local/share/EMBOSS/acd were replaced by set emboss_tempdata /usr/local/share/EMBOSS/test (example) $whichdb -showall Search all databases for an entry ID or Accession number: hsfau1 Output file [outfile.whichdb]: stdout # Trying 'twp:hsfau1' # Failed 'twp:hsfau1' # Trying 'tsw:hsfau1' # Failed 'tsw:hsfau1' # Trying 'tgenbank:hsfau1' tgenbank:hsfau1 # Trying 'tpir:hsfau1' # Failed 'tpir:hsfau1' # Trying 'tswnew:hsfau1' # Failed 'tswnew:hsfau1' # Trying 'tembl:hsfau1' tembl:hsfau1 # Trying 'tgb:hsfau1' # Failed 'tgb:hsfau1' -------------------------------------- Let's start Yahoo! Auction - Free Campaign Now! http://pr.mail.yahoo.co.jp/auction/ From gbottu at ben.vub.ac.be Fri Jul 14 08:32:24 2006 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Fri, 14 Jul 2006 10:32:24 +0200 Subject: [EMBOSS] Web Interfaces to Emboss Tools - Checked by AntiVir DEMO v In-Reply-To: <21c02dfe0607130918l7757810rd020330c76e50864@mail.gmail.com> References: <21c02dfe0607130918l7757810rd020330c76e50864@mail.gmail.com> Message-ID: <20060714083224.GB15333@bigben.ulb.ac.be> Dear Andy, Well, you might consider using wEMBOSS, developed by the Belgian and Argentinian EMBnet Nodes (http://wemboss.sourceforge.net/). It works with data stored on the server. The data are in a classic UNIX directory, so that you can easily let software run on these data in a terminal session or use ftp for bulk data transfers, in case you might want to do that. wEMBOSS has facilities to upload/download data and manage them in different "projects". On the same site you will also find wrappers4EMBOSS, that allows to integrate under the EMBOSS/wEMBOSS interface a number of programs that are very useful but lacking in EMBOSS (BLAST, fastA, MUSCLE, a program to search the complete PROSITE rather than just the patterns, ...). As for the recovery of data from SeqWeb, I have no experience with that. The related problem of how to use data generated by GCG under EMBOSS is simpler : EMBOSS does accept GCG sequence and GCG MSF files, as well as GCG codon usage tables. wEMBOSS does include a facility to convert GCG List Files into EMBOSS List Files. Sincerely, Guy Bottu, Belgian EMBnet Node From yasser at iastate.edu Fri Jul 14 14:29:19 2006 From: yasser at iastate.edu (Yasser El-Manzalawy) Date: Fri, 14 Jul 2006 09:29:19 -0500 (CDT) Subject: [EMBOSS] Nucleotide profiles with prophecy Message-ID: <1929914610651941@webmail.iastate.edu> Hi, I am trying to build a nucleotide profile for the following multiple sequence alignment: !!NA_MULTIPLE_ALIGNMENT 30 MSF: 8 Type: N Jul 14, 2006 01:37 Check: 0 .. Name: 1 Len: 8 Check: 2489 Weight: 1.00 Name: 2 Len: 8 Check: 2489 Weight: 1.00 Name: 3 Len: 8 Check: 2489 Weight: 1.00 Name: 4 Len: 8 Check: 2489 Weight: 1.00 Name: 5 Len: 8 Check: 2525 Weight: 1.00 Name: 6 Len: 8 Check: 2608 Weight: 1.00 Name: 7 Len: 8 Check: 2608 Weight: 1.00 Name: 8 Len: 8 Check: 2725 Weight: 1.00 Name: 9 Len: 8 Check: 2714 Weight: 1.00 Name: 10 Len: 8 Check: 2616 Weight: 1.00 Name: 11 Len: 8 Check: 2494 Weight: 1.00 Name: 12 Len: 8 Check: 2733 Weight: 1.00 Name: 13 Len: 8 Check: 2436 Weight: 1.00 Name: 14 Len: 8 Check: 2615 Weight: 1.00 Name: 15 Len: 8 Check: 2589 Weight: 1.00 Name: 16 Len: 8 Check: 2705 Weight: 1.00 Name: 17 Len: 8 Check: 2742 Weight: 1.00 Name: 18 Len: 8 Check: 2591 Weight: 1.00 Name: 19 Len: 8 Check: 2640 Weight: 1.00 Name: 20 Len: 8 Check: 2761 Weight: 1.00 Name: 21 Len: 8 Check: 2471 Weight: 1.00 Name: 22 Len: 8 Check: 2744 Weight: 1.00 Name: 23 Len: 8 Check: 2569 Weight: 1.00 Name: 24 Len: 8 Check: 2605 Weight: 1.00 Name: 25 Len: 8 Check: 2593 Weight: 1.00 Name: 26 Len: 8 Check: 2675 Weight: 1.00 Name: 27 Len: 8 Check: 2481 Weight: 1.00 Name: 28 Len: 8 Check: 2658 Weight: 1.00 Name: 29 Len: 8 Check: 2736 Weight: 1.00 Name: 30 Len: 8 Check: 2641 Weight: 1.00 // 1 CGTCACGC 2 CGTCACGC 3 CGTCACGC 4 CGTCACGC 5 GGTCACGG 6 TGTCATGC 7 TGTCATGC 8 AGTCATGT 9 AGTCACTT 10 GGTCACTG 11 TATCACGC 12 TGTCACTT 13 AGCCACGC 14 GATCATGG 15 CGTTACGG 16 AGTCTCTG 17 AGTCGTTG 18 TGCCACGT 19 GGTCAGTG 20 TGTCGTTG 21 ATTCACAC 22 GTTCATTG 23 CATCATAG 24 TATCAATG 25 AATGATGC 26 TAACATGT 27 AGTCCCGA 28 CAACATGT 29 ACTCGCTT 30 TGATAAGT I used the following command line: prophecy -sequence data.msf -type G -datafile Epprofile -name temp -outfile profile.prophecy -snucleotide1 Although both the input file and the command line indicate that this is nucleotide sequences, the obtained profile is for protein sequences. Could you please, point my to the source of the error? Is it in the data file or the command line that I used? Thanks Yasser EL-Manzalawy From ajb at ebi.ac.uk Sat Jul 15 09:33:48 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Sat, 15 Jul 2006 10:33:48 +0100 (BST) Subject: [EMBOSS] EMBOSS 4.0.0 released Message-ID: <51409.81.98.244.247.1152956028.squirrel@webmail.ebi.ac.uk> EMBOSS-4.0.0.tar.gz is now available. It can be downloaded from the directory: ftp://emboss.open-bio.org/pub/EMBOSS/ or via anonymous ftp to emboss.open-bio.org in the pub/EMBOSS directory. As usual, more complete information is in the ChangeLog file: here are some highlights. - new prompt style generated from 'knowntypes' - new -help format provides more information - new sequence access method 'dbfetch' uses the EBI's REST services - new sequence access method 'mrs' uses CMBI's "Maarten's Retrieval System." - new program backtranambig - new program makenucseq - new program makeprotseq - 'embl' format will read both the old EMBL format and the new one. A new output format 'emblnew' can be used to write the new format. - new 'swissnew' database format - lists of prosite patterns can now be used by fuzznuc, fuzzpro & fuzztran. Pattern lists can be specified using the @filename syntax. New options added specifically for pattern lists. Pattern lists have a new ACD definition type. - lists of regular expressions can now be used by dreg & preg - Use of GFF for proteins now allowed - prophet now uses an 'align' output type - iep allows the specification of the number of uncharged lysines and intra-chain disulphide bridges - splitter/union allow nucleotide deatues to be preserved - digest has a ragging capability - coderet writes any permutation of cds, mrna & protein to separate files - mincount option added to wordcount - biosed modified to allow the specification of sequence mutation position - wossname can now search for phrases - new sequence type 'gapstopprotein' - sequence reading from website URLs now defaults to HTTP 1.1 - new 'keywords' attribute in ACD files - many minor additions, bugfixes and placeholders for future capabilities EMBASSY packages VIENNA has been added. This is a port of the Vienna RNA package by Ivo Hofacker. It is to be regarded as an alpha test. We are investigating the incorporation of the Vienna sequence format into the main libraries. This would lead to simplification of the interface for future releases. HMMER: this package is now a wrapper written around HMMER 2.3.2 You must therefore install HMMER 2.3.2 from the http://hmmer.wustl.edu/ site and add it to your PATH. MEMENEW: this package is now a wrapper. You must therefore install MEME/MAST from the http://meme.sdsc.edu/meme/meme-download.html site and add it to your PATH. MYEMBOSS: This package enable developers to write their own applications using the standard EMBOSS distribution. PHYLIPNEW: This is now out of EMBOSS beta testing. It is PHYLIP version 3.6b Microsoft Windows An alpha test version of EMBOSS for Microsoft Windows is available from the 'windows' directory of the ftp server above. This port was done using Andre Blavier's EMBOSSWIN package as a starting point and we thank him for his work. The EMBOSS programs can be run from a DOS Command window. There is currently no GUI though we hope that some may spring up from the community. If, when trying to run applications, you get "DLL missing" errors then you will need to install the vcredist_x86.exe package for Visual C++ 2005 from the Microsoft web site. This small executable does not install a compiler, only the required runtime DLLs. Developers Developers should note that we are in the process of standardising library function names. Old function names will still work but will print out a 'deprecated' message when compiled using the GCC compiler. We therefore recommend use of this compiler for developers as an aid to updating their source code. Happy St Swithun's (Swithin's) Day. Alan EBI 15th July 2006 From ajb at ebi.ac.uk Mon Jul 17 18:17:47 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Mon, 17 Jul 2006 19:17:47 +0100 (BST) Subject: [EMBOSS] problem with EMBASSY program VIENNA In-Reply-To: References: Message-ID: <44816.81.98.244.247.1153160267.squirrel@webmail.ebi.ac.uk> Hi Bela, It's emboss at emboss.open-bio.org for the main list and emboss-bug at emboss.open-bio.org for bug reports Thanks for pointing out the VIENNA error. I've put a replacement VIENNA-1.6.tar.gz on the ftp server. That should fix the problem. ATB Alan From nycademon at spiralrealm.com Mon Jul 17 18:55:58 2006 From: nycademon at spiralrealm.com (Guido Vacano) Date: Mon, 17 Jul 2006 12:55:58 -0600 Subject: [EMBOSS] Jemboss Display Problem? Message-ID: <44BBDD3E.9070208@spiralrealm.com> Hello-- I recently installed EMBOSS (and Jemboss) on a Fedora Core 5 machine, running Tomcat 5.5 and Axis 1.4 (both downloaded binaries). Using Jemboss, everything seems to work fine, except there's a problem displaying results from restrict (and possibly other programs). The output is fine for maybe 100 or so lines, but then it turns into gibberish (as if I were trying to read a binary executable). If I download the results from the server via Jemboss, the downloaded file contains the same correct output, followed by gibberish. However, if I look at the output file on the server via a terminal connection, the entire file is correct, so it appears to be an error in transferring information from server to client. I have no idea if this is a Jemboss or Tomcat or Axis problem. Any ideas? Thanks, Guido Vacano From ajb at ebi.ac.uk Mon Jul 17 20:17:26 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Mon, 17 Jul 2006 21:17:26 +0100 (BST) Subject: [EMBOSS] Jemboss Display Problem? In-Reply-To: <44BBDD3E.9070208@spiralrealm.com> References: <44BBDD3E.9070208@spiralrealm.com> Message-ID: <39063.81.98.244.247.1153167446.squirrel@webmail.ebi.ac.uk> Dear Guido, Which version of EMBOSS did you install (typing 'embossversion' will show it)? This was a known problem in 3.0.0 but should be fixed in the latest EMBOSS release (4.0.0) Alan From nycademon at spiralrealm.com Mon Jul 17 20:52:38 2006 From: nycademon at spiralrealm.com (Guido Vacano) Date: Mon, 17 Jul 2006 14:52:38 -0600 Subject: [EMBOSS] Jemboss Display Problem? In-Reply-To: <39063.81.98.244.247.1153167446.squirrel@webmail.ebi.ac.uk> References: <44BBDD3E.9070208@spiralrealm.com> <39063.81.98.244.247.1153167446.squirrel@webmail.ebi.ac.uk> Message-ID: <44BBF896.3080008@spiralrealm.com> Sorry Alan, it was version 3. I guess it's time to upgrade. :-) Thanks, Guido ajb at ebi.ac.uk wrote: > Dear Guido, > > Which version of EMBOSS did you install (typing 'embossversion' > will show it)? > > This was a known problem in 3.0.0 but should be fixed in the > latest EMBOSS release (4.0.0) > > Alan > > > From jison at ebi.ac.uk Tue Jul 18 11:41:49 2006 From: jison at ebi.ac.uk (Jon Ison) Date: Tue, 18 Jul 2006 12:41:49 +0100 (BST) Subject: [EMBOSS] Nucleotide profiles with prophecy In-Reply-To: <1929914610651941@webmail.iastate.edu> References: <1929914610651941@webmail.iastate.edu> Message-ID: <37175.172.31.100.168.1153222909.squirrel@webmail.ebi.ac.uk> Dear Yasser The prophecy program is for use with protein sequences only and always interprets its input as protein. I don't think the underlying Gribskov or Henikoff profiles we're ever intended for use with nucleotide sequences. You could try the new EMBASSY HMMER package, which contains applications that wrap (call) applications for HMM analysis from the latest version of the hmmer suite by Sean Eddy. These too are not recommended for use with nucletotide sequences but would almost certainly work better than the older style profiles. Cheers Jon > Hi, > > I am trying to build a nucleotide profile for the following multiple sequence > alignment: > > !!NA_MULTIPLE_ALIGNMENT > > 30 MSF: 8 Type: N Jul 14, 2006 01:37 Check: 0 .. > > Name: 1 Len: 8 Check: 2489 Weight: 1.00 > Name: 2 Len: 8 Check: 2489 Weight: 1.00 > Name: 3 Len: 8 Check: 2489 Weight: 1.00 > Name: 4 Len: 8 Check: 2489 Weight: 1.00 > Name: 5 Len: 8 Check: 2525 Weight: 1.00 > Name: 6 Len: 8 Check: 2608 Weight: 1.00 > Name: 7 Len: 8 Check: 2608 Weight: 1.00 > Name: 8 Len: 8 Check: 2725 Weight: 1.00 > Name: 9 Len: 8 Check: 2714 Weight: 1.00 > Name: 10 Len: 8 Check: 2616 Weight: 1.00 > Name: 11 Len: 8 Check: 2494 Weight: 1.00 > Name: 12 Len: 8 Check: 2733 Weight: 1.00 > Name: 13 Len: 8 Check: 2436 Weight: 1.00 > Name: 14 Len: 8 Check: 2615 Weight: 1.00 > Name: 15 Len: 8 Check: 2589 Weight: 1.00 > Name: 16 Len: 8 Check: 2705 Weight: 1.00 > Name: 17 Len: 8 Check: 2742 Weight: 1.00 > Name: 18 Len: 8 Check: 2591 Weight: 1.00 > Name: 19 Len: 8 Check: 2640 Weight: 1.00 > Name: 20 Len: 8 Check: 2761 Weight: 1.00 > Name: 21 Len: 8 Check: 2471 Weight: 1.00 > Name: 22 Len: 8 Check: 2744 Weight: 1.00 > Name: 23 Len: 8 Check: 2569 Weight: 1.00 > Name: 24 Len: 8 Check: 2605 Weight: 1.00 > Name: 25 Len: 8 Check: 2593 Weight: 1.00 > Name: 26 Len: 8 Check: 2675 Weight: 1.00 > Name: 27 Len: 8 Check: 2481 Weight: 1.00 > Name: 28 Len: 8 Check: 2658 Weight: 1.00 > Name: 29 Len: 8 Check: 2736 Weight: 1.00 > Name: 30 Len: 8 Check: 2641 Weight: 1.00 > // > > 1 CGTCACGC > 2 CGTCACGC > 3 CGTCACGC > 4 CGTCACGC > 5 GGTCACGG > 6 TGTCATGC > 7 TGTCATGC > 8 AGTCATGT > 9 AGTCACTT > 10 GGTCACTG > 11 TATCACGC > 12 TGTCACTT > 13 AGCCACGC > 14 GATCATGG > 15 CGTTACGG > 16 AGTCTCTG > 17 AGTCGTTG > 18 TGCCACGT > 19 GGTCAGTG > 20 TGTCGTTG > 21 ATTCACAC > 22 GTTCATTG > 23 CATCATAG > 24 TATCAATG > 25 AATGATGC > 26 TAACATGT > 27 AGTCCCGA > 28 CAACATGT > 29 ACTCGCTT > 30 TGATAAGT > > I used the following command line: > prophecy -sequence data.msf -type G -datafile Epprofile -name temp -outfile > profile.prophecy -snucleotide1 > > Although both the input file and the command line indicate that this is > nucleotide sequences, the obtained profile is for protein sequences. > > Could you please, point my to the source of the error? Is it in the data file or > the command line that I used? > > > Thanks > Yasser EL-Manzalawy > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From Suraj.Mukatira at STJUDE.ORG Fri Jul 21 12:41:32 2006 From: Suraj.Mukatira at STJUDE.ORG (Mukatira, Suraj) Date: Fri, 21 Jul 2006 07:41:32 -0500 Subject: [EMBOSS] notseq limits Message-ID: Hello, I am writing to get an idea about the limits of 'notseq'(Windows EMBOSS). I noticed that it is unable to read-in more than 250 sequence ID's to be removed from a large file (fasta). Any thoughts/solutions will be greatly appreciated Thanks in anticipation Sincerely, Suraj Mukatira From ajb at ebi.ac.uk Fri Jul 21 15:03:13 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 21 Jul 2006 16:03:13 +0100 (BST) Subject: [EMBOSS] notseq limits In-Reply-To: References: Message-ID: <44434.81.98.244.247.1153494193.squirrel@webmail.ebi.ac.uk> Hello Suraj, > I am writing to get an idea about the limits of 'notseq'(Windows > EMBOSS). I noticed that it is unable to read-in more than 250 sequence > ID's to be removed from a large file (fasta). We're in somewhat unknown territory here but this is just the sort of feedback we need. I would suspect that the above is related to the standard heap size built into the executable. The heap size is determined at the program linking stage. If you are willing to test it out then I could produce a version with increased heap size. Is there anyone else on the list who has run into such memory limit problems with the Windows version? Alan From javierluiso at yahoo.com Fri Jul 21 15:10:35 2006 From: javierluiso at yahoo.com (Javier Luiso) Date: Fri, 21 Jul 2006 15:10:35 +0000 (GMT) Subject: [EMBOSS] New EMBOSS application : dottie Message-ID: <20060721151035.39538.qmail@web53415.mail.yahoo.com> Hi, I read the table of "suggested new applications for EMBOSS" ( http://emboss.sourceforge.net/apps/proposed.html) and I'm interesting in the app. dottie. I work in Computer Graphics and Visualization area, not in biology, so I need more specific information about the features dottie must include. Thanks. Javier Luiso __________________________________________________ Pregunt?. Respond?. Descubr?. Todo lo que quer?as saber, y lo que ni imaginabas, est? en Yahoo! Respuestas (Beta). ?Probalo ya! http://www.yahoo.com.ar/respuestas From dvorah at agri.huji.ac.il Tue Jul 25 15:12:13 2006 From: dvorah at agri.huji.ac.il (Deborah Weisman) Date: Tue, 25 Jul 2006 17:12:13 +0200 Subject: [EMBOSS] compiling embassy programs Message-ID: <44C634CD.3040105@agri.huji.ac.il> I have successfully compiled, installed and tested emboss 4 on a new Redhat ES 4 machine. I am trying to install the embassy programs, and am having trouble with many of them. The ones that installed without problems are: EMNU-1.05 ESIM4-1.0.0 HMMER-2.3.2 MEME-2.3.1 MSE-1.0.0 TOPO-1.0.0 Most of the others are giving problems. Starting with Phylip, since the docs claim that Phylip also should install without problems: Since emboss is installed into /usr/local , I did: ./configure --prefix=/usr/local --enable-localforce and then make gives: clique.c: In function `emboss_getoptions': clique.c:160: error: void value not ignored as it ought to be make: *** [all-recursive] Error 1 I downloaded the current version of phylip, without emboss additions, from : ftp://evolution.genetics.washington.edu/pub/phylip/phylip-3.65.tar.gz and it compiles and runs with no problems. Do you have any suggestions as to what I should be looking at? Thank you, Deborah Weisman From fernan at iib.unsam.edu.ar Tue Jul 25 16:09:11 2006 From: fernan at iib.unsam.edu.ar (Fernan Aguero) Date: Tue, 25 Jul 2006 13:09:11 -0300 Subject: [EMBOSS] compiling embassy programs In-Reply-To: <44C634CD.3040105@agri.huji.ac.il> References: <44C634CD.3040105@agri.huji.ac.il> Message-ID: <20060725160911.GC17788@iib.unsam.edu.ar> +----[ Deborah Weisman (25.Jul.2006 12:53): | | Starting with Phylip, since the docs claim that Phylip also should | install without problems: | Since emboss is installed into /usr/local , I did: | | ./configure --prefix=/usr/local --enable-localforce | | and then make gives: | | clique.c: In function `emboss_getoptions': | clique.c:160: error: void value not ignored as it ought to be | make: *** [all-recursive] Error 1 | | I downloaded the current version of phylip, without emboss additions, | from : | ftp://evolution.genetics.washington.edu/pub/phylip/phylip-3.65.tar.gz | and it compiles and runs with no problems. | | Do you have any suggestions as to what I should be looking at? | +----] Deborah, I've had the same problem building the old phylip against emboss-4.0.0, however the one that's called PHYLIPNEW (3.6b) compiles fine. I've compiled all embassy apps without problem against emboss 4.0.0 on FreeBSD-6.1. Following is the list of embassy apps with the versions I've used. If in doubt re-download the distfile, as sometimes they are re-rolled with a new version of emboss without changing their version ... below is the MD5 checksum and size of the files that are working for me. Cheers, fernan MD5 (emboss/DOMAINATRIX-0.1.0.tar.gz) = 5893d3e5f101783050cbbc44766fe7d8 SIZE (emboss/DOMAINATRIX-0.1.0.tar.gz) = 405474 MD5 (emboss/EMNU-1.05.tar.gz) = 3ef6e2ac28f55b167b7f2f3614015618 SIZE (emboss/EMNU-1.05.tar.gz) = 377734 MD5 (emboss/ESIM4-1.0.0.tar.gz) = 35b0f661043bd9c03aaba22f7bffc321 SIZE (emboss/ESIM4-1.0.0.tar.gz) = 417724 MD5 (emboss/HMMER-2.3.2.tar.gz) = 967454c708ecaa0cbd47deda66b78e65 SIZE (emboss/HMMER-2.3.2.tar.gz) = 546870 MD5 (emboss/MEMENEW-0.1.0.tar.gz) = 46b6ca9eeba6c63bd08ebe1b661434dc SIZE (emboss/MEMENEW-0.1.0.tar.gz) = 423254 MD5 (emboss/MSE-1.0.0.tar.gz) = b5f3f4ed1e74c6cf7a7d57d398a7634b SIZE (emboss/MSE-1.0.0.tar.gz) = 428940 MD5 (emboss/PHYLIPNEW-3.6b.tar.gz) = 3a12ee43c48562092f4f2add0e8f2978 SIZE (emboss/PHYLIPNEW-3.6b.tar.gz) = 1532866 MD5 (emboss/TOPO-1.0.0.tar.gz) = 538c5205fc65ff3b0f3b83dde466200f SIZE (emboss/TOPO-1.0.0.tar.gz) = 367882 MD5 (emboss/DOMALIGN-0.1.0.tar.gz) = 38ab9e0a0158cf923668d0e863606b54 SIZE (emboss/DOMALIGN-0.1.0.tar.gz) = 440714 MD5 (emboss/DOMSEARCH-0.1.0.tar.gz) = d214f124dd2806aa2eb163682dc7be7f SIZE (emboss/DOMSEARCH-0.1.0.tar.gz) = 452839 MD5 (emboss/SIGNATURE-0.1.0.tar.gz) = 64eae2537e7c887f5af2275ac3f1d2fa SIZE (emboss/SIGNATURE-0.1.0.tar.gz) = 549405 MD5 (emboss/STRUCTURE-0.1.0.tar.gz) = 93e7bb7fbd53d8aa2e1ab0d1af4f44c4 SIZE (emboss/STRUCTURE-0.1.0.tar.gz) = 514336 MD5 (emboss/MYEMBOSS-3.0.0.tar.gz) = 7536331836127104c3dac6941118cbac SIZE (emboss/MYEMBOSS-3.0.0.tar.gz) = 343762 MD5 (emboss/VIENNA-1.6.tar.gz) = 66087ecae4775e9c9928980f7976deee SIZE (emboss/VIENNA-1.6.tar.gz) = 590827 From gbottu at ben.vub.ac.be Wed Jul 26 10:13:46 2006 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Wed, 26 Jul 2006 12:13:46 +0200 Subject: [EMBOSS] the dbfetch and mrs access methods - Checked by AntiVir DEMO version - Message-ID: <20060726101346.GA11071@bigben.ulb.ac.be> Dear colleagues, EMBOSS version 4 has two new database access methods : "mrs" and "dbfetch". Unfortunately, there seems to be nowhere a documentation that tells how to configure it in emboss.defaults and I did not succeed. Has anyone already successfully intstalled EMBOSS 4 and used these mthods ? Sincerely, Guy Bottu, BEN From David.Bauer at schering.de Wed Jul 26 12:47:12 2006 From: David.Bauer at schering.de (David.Bauer at schering.de) Date: Wed, 26 Jul 2006 14:47:12 +0200 Subject: [EMBOSS] Emboss Win Message-ID: The Windows version is a bit dangerous because it does not append the installation directory to the system path variable but it overvrites this variable. Cheers, David. From ajb at ebi.ac.uk Wed Jul 26 19:41:56 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Wed, 26 Jul 2006 20:41:56 +0100 (BST) Subject: [EMBOSS] Emboss Win In-Reply-To: References: Message-ID: <40572.81.98.244.247.1153942916.squirrel@webmail.ebi.ac.uk> Hello David, > The Windows version is a bit dangerous because it does not append the > installation directory to the system path variable but it overvrites this > variable. On XP systems here it doesn't overwrite, rather it adds it to the PATH. On which Windows systems do you experience overwriting? Alan From andrespinzon at gmail.com Wed Jul 26 23:37:25 2006 From: andrespinzon at gmail.com (Andres Pinzon) Date: Wed, 26 Jul 2006 18:37:25 -0500 Subject: [EMBOSS] emboss explorer installation Message-ID: <8968fc7e0607261637k2fc29f57j79a0beb4309ebc9a@mail.gmail.com> Hi all, I just installed emboss 4.0 and wemboss 1.6.0, everythings fine ;-) Now im trying to install emboss-explorer (it used to be a straightforward install) but some things went wrong, for instance, it never finds the emboss manuals, as far as i can see from the install file it tries to find'em in: $EMBOSS_PREFIX/share/EMBOSS/doc/programs/html But actually they are in: $EMBOSS_PREFIX/share/EMBOSS/doc/html/emboss/apps So I changed that line. But it didn't work. Im also trying to change the .css file but changes are not reflected on the webpage. Applications run fine (emma etc.) Any help? Thanks. -- Andr?s Pinz?n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From David.Bauer at SCHERING.DE Thu Jul 27 05:55:18 2006 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Thu, 27 Jul 2006 07:55:18 +0200 Subject: [EMBOSS] Emboss Win In-Reply-To: <40572.81.98.244.247.1153942916.squirrel@webmail.ebi.ac.uk> Message-ID: Hello Alan, it was on "a kind of" XP Pro. This is not a generic XP but a special core build designed for company use. I will test the Emboss setup on my XP Home and some other XP Pro to see what happens to the PATH. David. ajb at ebi.ac.uk schrieb am 26/07/2006 21:41:56: > Hello David, > > > The Windows version is a bit dangerous because it does not append the > > installation directory to the system path variable but it overvrites this > > variable. > > On XP systems here it doesn't overwrite, rather it adds it to the PATH. > > On which Windows systems do you experience overwriting? > > Alan > > From gbottu at ben.vub.ac.be Thu Jul 27 08:20:04 2006 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Thu, 27 Jul 2006 10:20:04 +0200 Subject: [EMBOSS] emboss explorer installation - Checked by AntiVir DEMO ver In-Reply-To: <8968fc7e0607261637k2fc29f57j79a0beb4309ebc9a@mail.gmail.com> References: <8968fc7e0607261637k2fc29f57j79a0beb4309ebc9a@mail.gmail.com> Message-ID: <20060727082004.GA22324@bigben.ulb.ac.be> On Wed, Jul 26, 2006 at 06:37:25PM -0500, Andres Pinzon wrote: > I just installed emboss 4.0 and wemboss 1.6.0, everythings fine ;-) I'm afraid you did not take a good look, because wEMBOSS 1.6.0 does not handle a few things that changed between EMBOSS 3.0 and 4.0 : - the program pages cannot display the length of the sequence, because the output format of infoseq changed - the "fuzzies" do not work because of the new object "pattern" - wEMBOSS cannot find the on-line manuals because their location changed (see also below) This will be fixed in wEMBOSS 1.7.0, which will be out end August or begin September. > Now im trying to install emboss-explorer (it used to be a > straightforward install) but some things went wrong, for instance, it > never finds the emboss manuals, as far as i can see from the install > file it tries to find'em in: > $EMBOSS_PREFIX/share/EMBOSS/doc/programs/html > But actually they are in: > $EMBOSS_PREFIX/share/EMBOSS/doc/html/emboss/apps Try the following : cd $EMBOSS_PREFIX/share/EMBOSS/doc/programs ln -s $EMBOSS_PREFIX/share/EMBOSS/doc/html/emboss/apps html (or make a directory html and just copy the files) Under wEMBOSS it works and I see no reason why it should not work under emboss explorer. The only problem is that if you have also "Embassadirs" there are troubles in navigating from one manual page to another because the Embassadirs are supposed to have their pages in different directories. Guy Bottu, Belgian EMBnet Node From ajb at ebi.ac.uk Thu Jul 27 10:45:15 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 27 Jul 2006 11:45:15 +0100 (BST) Subject: [EMBOSS] Emboss Win In-Reply-To: References: <40572.81.98.244.247.1153942916.squirrel@webmail.ebi.ac.uk> Message-ID: <48865.81.98.244.247.1153997115.squirrel@webmail.ebi.ac.uk> Hello David, Thanks, it would be interesting to know what triggers it. It ought to be safe under all circumstances that I've been able to think of but I may have missed one. A program is supplied in the distribution called setenv.exe which is called by the installer. That program does the obvious sort of things and has a switch to specify appending. That switch is, of course, set. As you probably know, environment variables are handled differently in XP/2K compared to 98/ME. In the former it's a registry thing, for the others it's an autoexec.bat alteration job. setenv.exe should be able to deal with both. The uninstaller will call setenv.exe with a different switch + the installation path so that that specific part of the PATH will be deleted. Specifically, setenv -a envvarname value creates and overwrites setenv -a envvarname %value adds value to envvar (used for PATH) setenv -d envvarname deletes an envvar setenv -d envvarname %value removes value from envvar The above ought to help you with your investigation. ATB Alan > > Hello Alan, > > it was on "a kind of" XP Pro. This is not a generic XP but a special core > build designed for company use. > I will test the Emboss setup on my XP Home and some other XP Pro to see > what happens to the PATH. > > David. > > ajb at ebi.ac.uk schrieb am 26/07/2006 21:41:56: > >> Hello David, >> >> > The Windows version is a bit dangerous because it does not append the >> > installation directory to the system path variable but it overvrites > this >> > variable. >> >> On XP systems here it doesn't overwrite, rather it adds it to the PATH. >> >> On which Windows systems do you experience overwriting? >> >> Alan >> >> > > From ajb at ebi.ac.uk Thu Jul 27 12:06:09 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 27 Jul 2006 13:06:09 +0100 (BST) Subject: [EMBOSS] the dbfetch and mrs access methods - Checked by AntiVir DEMO version - In-Reply-To: <20060726101346.GA11071@bigben.ulb.ac.be> References: <20060726101346.GA11071@bigben.ulb.ac.be> Message-ID: <57140.81.98.244.247.1154001969.squirrel@webmail.ebi.ac.uk> Hello Guy, Posted this yesterday but their were problems with our mailer. Reposting as it hasn't appeared in the list archives. > EMBOSS version 4 has two new database access methods : "mrs" and > "dbfetch". Unfortunately, there seems to be nowhere a documentation that > tells how to configure it in emboss.defaults and I did not succeed. Has > anyone already successfully intstalled EMBOSS 4 and used these mthods ? A quick look shows that it does seem to be an oversight in the release. The code is there but it appears not to have been activated in ajnam.c (easy to fix). However, once that's done there does appear to be another minor issue with mrs retrieval. More on this and any necessary fix, probably next week, when the rest of the development team get back from their holidays (we do at least try to maintain demarcation within the code.) Alan From andrespinzon at gmail.com Fri Jul 28 19:40:29 2006 From: andrespinzon at gmail.com (Andres Pinzon) Date: Fri, 28 Jul 2006 14:40:29 -0500 Subject: [EMBOSS] cutg database Message-ID: <8968fc7e0607281240y67a1d506lfce523e3889869f8@mail.gmail.com> Is it necessary to dowwnload all gb* archives from ftp://ftp.kazusa.or.jp/pub/codon/current/ in order to have the cutg database running? -- Andr?s Pinz?n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From andrespinzon at gmail.com Fri Jul 28 19:47:11 2006 From: andrespinzon at gmail.com (Andres Pinzon) Date: Fri, 28 Jul 2006 14:47:11 -0500 Subject: [EMBOSS] cutg database In-Reply-To: <8968fc7e0607281240y67a1d506lfce523e3889869f8@mail.gmail.com> References: <8968fc7e0607281240y67a1d506lfce523e3889869f8@mail.gmail.com> Message-ID: <8968fc7e0607281247t97598cet89256f8afe21b79d@mail.gmail.com> On 7/28/06, Andres Pinzon wrote: > Is it necessary to dowwnload all gb* archives from > ftp://ftp.kazusa.or.jp/pub/codon/current/ in order to have the cutg > database running? I answer myself! It seems that one only need the CUTG.151.tar.gz (158Mb) file under the compressed/ directory. ;-) I have not ran the "cutgextract" command yet, i'll see. -- Andr?s Pinz?n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From fkosuke at yahoo.co.jp Mon Jul 31 07:22:32 2006 From: fkosuke at yahoo.co.jp (=?ISO-2022-JP?B?GyRCQSU4TRsoQiAbJEJeK00kGyhC?=) Date: Mon, 31 Jul 2006 16:22:32 +0900 (JST) Subject: [EMBOSS] Installation Problem Message-ID: <20060731072232.78255.qmail@web3314.mail.bbt.yahoo.co.jp> Hi there, I'm trying to install EMBOSS to my linux machine, however I've got an error message. My OS is Suse-linux-3.3.4, and the version of EMBOSS is 4.0.0. I didn't get error message during configuration. The mailing list archives don't seem to help me. Could anyone tell me how to get through this problem? Thanks, Kosuke === Here is the error message === ... gcc -O2 -o .libs/aaindexextract aaindexextract.o ../nucleus/.libs/libnucleus.so ../ajax/.libs/libajaxg.so ../ajax/.libs/libajax.so ../plplot/.libs/libplplot.so /usr/lib/libgd.so -L/usr/lib -L/usr/X11R6/lib -lXpm -lX11 /usr/lib/libjpeg.so /usr/local/lib/libfreetype.so -lpng12 -lpng -lz -lm -Wl,--rpath -Wl,/usr/local/emboss/lib /usr/lib/gcc-lib/i586-suse-linux/3.3.4/../../../../i586-suse-linux/bin/ld: cannot find -lXpm collect2: ld returned 1 exit status make[2]: *** [aaindexextract] Error 1 ... ******************************** Kosuke Funato Dept. of Mol. and Gen. Info IMCB, Univ. of Tokyo, Japan Tel: +81-3-5841-7869 Fax: 8482 fkosuke at yahoo.co.jp ss66333 at mail.ecc.u-tokyo.ac.jp ******************************** --------------------------------- Let's start Yahoo! Auction - Free Campaign Now! From gbottu at ben.vub.ac.be Mon Jul 31 08:09:02 2006 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Mon, 31 Jul 2006 10:09:02 +0200 Subject: [EMBOSS] cutg database - Checked by AntiVir DEMO version - In-Reply-To: <8968fc7e0607281247t97598cet89256f8afe21b79d@mail.gmail.com> References: <8968fc7e0607281240y67a1d506lfce523e3889869f8@mail.gmail.com> <8968fc7e0607281247t97598cet89256f8afe21b79d@mail.gmail.com> Message-ID: <20060731080902.GA3996@bigben.ulb.ac.be> On Fri, Jul 28, 2006 at 02:47:11PM -0500, Andres Pinzon wrote: > On 7/28/06, Andres Pinzon wrote: > > Is it necessary to dowwnload all gb* archives from > > ftp://ftp.kazusa.or.jp/pub/codon/current/ in order to have the cutg > > database running? > It seems that one only need the CUTG.151.tar.gz (158Mb) file under the > compressed/ directory. ;-) > I have not ran the "cutgextract" command yet, i'll see. Dear Andres, It are actually the files *.codon that are needed for EMBOSS ; downloading and extracting CUTG.151.tar.gz will do the job. There is however a problem : cutgextract puts the files with codons in .../share/EMBOSS/data/CODON. Under wEMBOSS this produces a selector with thenthousands of entries, which causes delays in the transfer of the Web page and is though to use. I do not know how EMBOSS explorer behaves. The EMBOSS development team is considering putting the CUTG files in a separate directory CUTG, but they have not yet done so. At the BEN site I have modified cutgextract, so that it creates files with extension .cutg instead of .cut ; wEMBOSS only displays the *.cut files in the selector and the .cutg files can still be accessed by typing in their name or by retrieving them with embossdata. Hope this information helps, Guy Bottu, Belgian EMBnet Node From ajb at ebi.ac.uk Mon Jul 31 08:24:18 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Mon, 31 Jul 2006 09:24:18 +0100 (BST) Subject: [EMBOSS] Installation Problem In-Reply-To: <20060731072232.78255.qmail@web3314.mail.bbt.yahoo.co.jp> References: <20060731072232.78255.qmail@web3314.mail.bbt.yahoo.co.jp> Message-ID: <53502.81.98.244.247.1154334258.squirrel@webmail.ebi.ac.uk> Hello Kosuke, > My OS is Suse-linux-3.3.4, I'm unfamiliar with that particular release of SuSE (unless that's a compiler version :-) > > gcc -O2 -o .libs/aaindexextract aaindexextract.o > ../nucleus/.libs/libnucleus.so ../ajax/.libs/libajaxg.so > ../ajax/.libs/libajax.so ../plplot/.libs/libplplot.so /usr/lib/libgd.so > -L/usr/lib -L/usr/X11R6/lib -lXpm -lX11 /usr/lib/libjpeg.so > /usr/local/lib/libfreetype.so -lpng12 -lpng -lz -lm -Wl,--rpath > -Wl,/usr/local/emboss/lib > /usr/lib/gcc-lib/i586-suse-linux/3.3.4/../../../../i586-suse-linux/bin/ld: > cannot find -lXpm > collect2: ld returned 1 exit status > make[2]: *** [aaindexextract] Error 1 As the error suggests, it can't find the file libXpm.so. Under later SuSE releases you will need to: a) Install the xorg-x11-devel RPM b) "make clean" in EMBOSS c) configure EMBOSS again HTH Alan EBI From andrespinzon at gmail.com Mon Jul 31 14:56:26 2006 From: andrespinzon at gmail.com (Andres Pinzon) Date: Mon, 31 Jul 2006 09:56:26 -0500 Subject: [EMBOSS] Fwd: Installation Problem In-Reply-To: <8968fc7e0607310756s36c988ccva8817f0f7588ad76@mail.gmail.com> References: <20060731072232.78255.qmail@web3314.mail.bbt.yahoo.co.jp> <8968fc7e0607310756s36c988ccva8817f0f7588ad76@mail.gmail.com> Message-ID: <8968fc7e0607310756y7e4ab1ffl3366eb649ecf61f9@mail.gmail.com> ---------- Forwarded message ---------- From: Andres Pinzon Date: Jul 31, 2006 9:56 AM Subject: Re: [EMBOSS] Installation Problem To: ???? ???? On 7/31/06, ???? ???? wrote: > === Here is the error message === > > ... > gcc -O2 -o .libs/aaindexextract aaindexextract.o ../nucleus/.libs/libnucleus.so ../ajax/.libs/libajaxg.so ../ajax/.libs/libajax.so ../plplot/.libs/libplplot.so /usr/lib/libgd.so -L/usr/lib -L/usr/X11R6/lib -lXpm -lX11 /usr/lib/libjpeg.so /usr/local/lib/libfreetype.so -lpng12 -lpng -lz -lm -Wl,--rpath -Wl,/usr/local/emboss/lib > /usr/lib/gcc-lib/i586-suse-linux/3.3.4/../../../../i586-suse-linux/bin/ld: cannot find -lXpm > collect2: ld returned 1 exit status > make[2]: *** [aaindexextract] Error 1 On suse libpng is under /usr/lib, so you have to run the installation with the following option: ./configure --with-pngdriver=/usr/lib This is the way I ran it in a SuSE 9.1 machine (after installing X11 devel package): ./configure --with-pngdriver=/usr/lib --prefix=/usr/local/emboss You can also install it without X support: ./configure --with-pngdriver=/usr/lib --prefix=/usr/local/emboss --without-x Hope this help ;-) -- Andr??s Pinz??n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- -- Andr??s Pinz??n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From ajb at ebi.ac.uk Mon Jul 31 15:57:43 2006 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Mon, 31 Jul 2006 16:57:43 +0100 (BST) Subject: [EMBOSS] Fwd: Installation Problem In-Reply-To: <8968fc7e0607310756y7e4ab1ffl3366eb649ecf61f9@mail.gmail.com> References: <20060731072232.78255.qmail@web3314.mail.bbt.yahoo.co.jp> <8968fc7e0607310756s36c988ccva8817f0f7588ad76@mail.gmail.com> <8968fc7e0607310756y7e4ab1ffl3366eb649ecf61f9@mail.gmail.com> Message-ID: <51441.81.98.244.247.1154361463.squirrel@webmail.ebi.ac.uk> > On suse libpng is under /usr/lib, so you have to run the installation > with the following option: > > ./configure --with-pngdriver=/usr/lib Just two points to add there: a) You don't have to use PNG graphics if you don't want to. b) If the libpng library is under /usr/lib then the configure option would be: --with-pngdriver=/usr [if you specify /usr/lib then it will search for /usr/lib/lib and /usr/lib/include - neither of which is likely to exist] The configure script will, however, look for the libraries and include- files under /usr/lib and /usr/include anyway. In short, as long as you've got any zlib-devel, libpng-devel and gd-devel RPMs installed, you should not need to specify the --with-pngdriver switch under SuSE to be able to use PNG graphiics. The same applies to most Linux distributions. At least, that's the theory. Alan EBI