From stefan.rensing at biologie.uni-freiburg.de  Fri Feb  3 10:16:14 2006
From: stefan.rensing at biologie.uni-freiburg.de (Stefan Rensing)
Date: Fri, 03 Feb 2006 16:16:14 +0100
Subject: [EMBOSS] patmatdb
Message-ID: <43E373BE.10202@biologie.uni-freiburg.de>

Dear all,

what exactly does the flag -snucleotide1 toggle in patmatdb?

>From the doc I was thinking it would enable searching against nucleotide
acid sequences instead of proteins. However, execution aborts with an
error message saying that the sequence is not protein.

Cheers, Stefan

-- 
Dr. Stefan Rensing, Group Leader Computational Biology
Plant Biotechnology, Faculty of Biology, University of Freiburg
Schaenzlestr. 1, D-79104 Freiburg, Fon: +49 761 203-6974, Fax: -6945
http://www.plant-biotech.net/  http://www.cosmoss.org/
stefan.rensing at biologie.uni-freiburg.de

"An old man dies. A young girl lives. A fair trade. I love you, Nancy."



From pmr at ebi.ac.uk  Fri Feb  3 12:31:39 2006
From: pmr at ebi.ac.uk (Peter Rice)
Date: Fri, 03 Feb 2006 17:31:39 +0000
Subject: [EMBOSS] patmatdb
In-Reply-To: <43E373BE.10202@biologie.uni-freiburg.de>
References: <43E373BE.10202@biologie.uni-freiburg.de>
Message-ID: <43E3937B.607@ebi.ac.uk>

Hi Stefan,

> what exactly does the flag -snucleotide1 toggle in patmatdb?

-snucleotide (and -sprotein) are available for all sequence inputs. They are 
used for programs that can read DNA of rpotein sequences, where you have a 
sequence that can be both types (a short sequence ni FASTA format for example)

>>From the doc I was thinking it would enable searching against nucleotide
> acid sequences instead of proteins. However, execution aborts with an
> error message saying that the sequence is not protein.

The sequence type tells patmatdb to only accept protein.

Thinking about this ... we can change the -help output (and the program 
documentation) to describe the sequence type much better than the current 
"sequence database USA". We can, for example, say whether the sequence can be 
DNA or protein and whether gaps, stops, and other characters are used. All we 
need is a short description (which we have) for each sequence type. This is 
something we should have added long ago :-)

The pattern syntax was defined for the PROSITE database ... but we can also 
allow it to search nucleotide data. It is only a small change to the program. 
Does anyone neet to search a nucleotide database with patmatdb?

I suspect patmatdb is rather redundant ... you can get the same results from 
fuzzpro (for protein) or fuzznuc (for nucleotide) ... -rformat dbmotif will 
give you the same output format as patmatdb.

Any preferences?

Peter



From andrespinzon at gmail.com  Mon Feb  6 14:18:50 2006
From: andrespinzon at gmail.com (Andres Pinzon)
Date: Mon, 6 Feb 2006 14:18:50 -0500
Subject: [EMBOSS] seqretsplit in batch mode
In-Reply-To: <8968fc7e0602061015r551ce5dcn@mail.gmail.com>
References: <8968fc7e0602061015r551ce5dcn@mail.gmail.com>
Message-ID: <8968fc7e0602061118s2bf6fdc4l@mail.gmail.com>

2006/2/6, Andres Pinzon <andrespinzon at gmail.com>:

> [...]
> Anybody knows how can i tell seqretsplit not to prompt for the Output sequence?
> Best regards,

Ok, I answer my own question, just in case ;-)
============
seqretsplit -sequence mysequence.fasta -auto
============

--
---------
Andr?s Pinz?n [http://www.andrespinzon.com]
Bioinformatics Center, Colombia EMBnet node
Biotechnology Institute - National University of Colombia
http://bioinf.ibun.unal.edu.co
Tel +57 3165000 ext 16961 Fax +571 3165415
----------



From andrespinzon at gmail.com  Mon Feb  6 13:15:15 2006
From: andrespinzon at gmail.com (Andres Pinzon)
Date: Mon, 6 Feb 2006 13:15:15 -0500
Subject: [EMBOSS] seqretsplit in batch mode
Message-ID: <8968fc7e0602061015r551ce5dcn@mail.gmail.com>

Hi all,
Im trying to use seqretsplit in thousands of fasta files in a
directory at once. But it fails (I think) because for each fasta file
one is supoussed to hit <ENTER>, for instance:

andipin at linux:~/BYB/byDir> seqretsplit 11150.fasta
Reads and writes (returns) sequences in individual files
Output sequence [q3ybd3.fasta]:   <--- HIT ENTER!!!!

Anybody knows how can i tell seqretsplit not to prompt for the Output sequence?
Best regards,

--
---------
Andr?s Pinz?n [http://www.andrespinzon.com]
Bioinformatics Center, Colombia EMBnet node
Biotechnology Institute - National University of Colombia
http://bioinf.ibun.unal.edu.co
Tel +57 3165000 ext 16961 Fax +571 3165415
----------



From David.Bauer at schering.de  Tue Feb  7 01:46:16 2006
From: David.Bauer at schering.de (David.Bauer at schering.de)
Date: Tue, 7 Feb 2006 07:46:16 +0100
Subject: [EMBOSS] seqretsplit in batch mode
In-Reply-To: <8968fc7e0602061118s2bf6fdc4l@mail.gmail.com>
Message-ID: <OF1B745080.81A8AC07-ONC125710E.0024ECE6-C125710E.0025351D@schering.de>



And if you become more familiar with emboss you can set the environment
variable
EMBOSS_AUTO=1
which causes alle emboss programs to run like if -auto has been specified
on the command line.

Cheers,
David.
emboss-bounces at emboss.open-bio.org schrieb am 06/02/2006 20:18:50:

> 2006/2/6, Andres Pinzon <andrespinzon at gmail.com>:
>
> > [...]
> > Anybody knows how can i tell seqretsplit not to prompt for the
> Output sequence?
> > Best regards,
>
> Ok, I answer my own question, just in case ;-)
> ============
> seqretsplit -sequence mysequence.fasta -auto
> ============



From golharam at umdnj.edu  Wed Feb  8 23:46:43 2006
From: golharam at umdnj.edu (Ryan Golhar)
Date: Wed, 08 Feb 2006 23:46:43 -0500
Subject: [EMBOSS] Tool to mutate DNA sequence
Message-ID: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>

Does anyone know of tool to mutate a DNA sequence by a specified amount?
For instance, say I have a DNA sequence 1000 bases long, and I want to
simulate mutations to make it 75% (or 80%, etc) similar to the original.


Ryan



From pmr at ebi.ac.uk  Thu Feb  9 03:25:24 2006
From: pmr at ebi.ac.uk (pmr at ebi.ac.uk)
Date: Thu, 9 Feb 2006 08:25:24 -0000 (GMT)
Subject: [EMBOSS] [BiO BB] Tool to mutate DNA sequence
In-Reply-To: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
Message-ID: <2714.86.132.216.50.1139473524.squirrel@webmail.ebi.ac.uk>

Ryan Golhar writes:

> Does anyone know of tool to mutate a DNA sequence by a specified amount?
> For instance, say I have a DNA sequence 1000 bases long, and I want to
> simulate mutations to make it 75% (or 80%, etc) similar to the original.

EMBOSS has the msbar program ("mutate sequence beyond all recognition")
which allows you to select the number and type of changes.

With some tuning of options to match the sequence length you should be
able to get results that match whatever your definition of 75% similar
might be (amazing how much more similarity you can get by adding gaps in
an alignment :-)

If you can specify a clear and generally useful way to define what you
need we could of course add a "percent change" option to the msbar program
for a future release.

Hope that helps,

Peter



From torsten.seemann at infotech.monash.edu.au  Thu Feb  9 06:15:28 2006
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Thu, 09 Feb 2006 22:15:28 +1100
Subject: [EMBOSS] [Bioperl-l] Tool to mutate DNA sequence
In-Reply-To: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
Message-ID: <43EB2450.6000606@infotech.monash.edu.au>

Ryan,

> Does anyone know of tool to mutate a DNA sequence by a specified amount?
> For instance, say I have a DNA sequence 1000 bases long, and I want to
> simulate mutations to make it 75% (or 80%, etc) similar to the original.

The EMBOSS suite comes with a tool called "msbar" which can controllably 
mutate sequences:

http://emboss.sourceforge.net/apps/msbar.html

-- 
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/


From jason.stajich at duke.edu  Thu Feb  9 14:10:54 2006
From: jason.stajich at duke.edu (Jason Stajich)
Date: Thu, 9 Feb 2006 14:10:54 -0500
Subject: [EMBOSS] [Bioperl-l] Tool to mutate DNA sequence
In-Reply-To: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
Message-ID: <0B84EE38-0BA5-4E56-B35F-C8CBAA342AC4@duke.edu>

Depending on whether or not you want to use evolutionary realistic  
models...
* evolver which comes with PAML lets you evolve sequences on a tree
* SeqGen from Andrew Rambaut http://evolve.zoo.ox.ac.uk/software.html? 
id=seqgen
also lets you do this
I believe there are PISE interfaces to both of these at the pasteur  
bioweb site - http://bioweb.pasteur.fr/

-jason
On Feb 8, 2006, at 11:46 PM, Ryan Golhar wrote:

> Does anyone know of tool to mutate a DNA sequence by a specified  
> amount?
> For instance, say I have a DNA sequence 1000 bases long, and I want to
> simulate mutations to make it 75% (or 80%, etc) similar to the  
> original.
>
>
> Ryan
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12




From heikki at sanbi.ac.za  Thu Feb  9 06:31:20 2006
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Thu, 9 Feb 2006 13:31:20 +0200
Subject: [EMBOSS] [Bioperl-l] Tool to mutate DNA sequence
In-Reply-To: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
Message-ID: <200602091331.21690.heikki@sanbi.ac.za>

Ryan,

Instructions in pseudo code:

take the sequence string out of the object
use a hash to store changed locations
repeat 
    pick a location in the string randomly
    if the location is not in a hash , i.e. changed already, 
        change it into something else
    add the changed location into the hash
    if enough locations have been changed (scalar keys hash), exit loop
put the sequence string back into the seq object

   -Heikki   

On Thursday 09 February 2006 06:46, Ryan Golhar wrote:
> Does anyone know of tool to mutate a DNA sequence by a specified amount?
> For instance, say I have a DNA sequence 1000 bases long, and I want to
> simulate mutations to make it 75% (or 80%, etc) similar to the original.
>
>
> Ryan
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________


From heikki at sanbi.ac.za  Thu Feb  9 09:54:30 2006
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Thu, 9 Feb 2006 16:54:30 +0200
Subject: [EMBOSS] [Bioperl-l] Tool to mutate DNA sequence
In-Reply-To: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
Message-ID: <200602091654.30890.heikki@sanbi.ac.za>

Ryan,

I should have made this very clear in my first reply:

You have to plan very carefully what rules you use when you mutate your 
sequence because it will affect directly the resulting sequences. Of course,  
all that depends on what you will be using the sequences for. If you are 
going to draw evolutionary conclusions from those sequences, you must mutate 
them in a way that simulates evolutionary principles.

My earlier pseudocode example, for example, should allow mutations in every 
location. Mutations do occur multiple times in same places as sequences get 
saturated by mutations. Also, you should decide the relative occurrence of 
transversions versus transitions. Then there are indels; do you want to take 
those into account?

Also, check the EMBOSS program 'msbar'.

You did not ask this, but... I remember that during the early days of Celera, 
one of the tools that enabled them to estimate the feasibility of the whole 
genome shotgun sequence assembly, was a very complete program to 'synthesize' 
in-silico the whole complexity of the human genome. I have no idea of that 
program is generally available now.

Yours,

    -Heikki

On Thursday 09 February 2006 06:46, Ryan Golhar wrote:
> Does anyone know of tool to mutate a DNA sequence by a specified amount?
> For instance, say I have a DNA sequence 1000 bases long, and I want to
> simulate mutations to make it 75% (or 80%, etc) similar to the original.
>
>
> Ryan
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________


From golharam at umdnj.edu  Thu Feb  9 16:19:46 2006
From: golharam at umdnj.edu (Ryan Golhar)
Date: Thu, 09 Feb 2006 16:19:46 -0500
Subject: [EMBOSS] [Bioperl-l] Tool to mutate DNA sequence
In-Reply-To: <200602091654.30890.heikki@sanbi.ac.za>
Message-ID: <002801c62dbe$8d4d7e20$e6028a0a@GOLHARMOBILE1>

Thanks all.  The responses I got were definitely more than helpful.  FYI
- I did initially look at msbar.  I glanced over the "Number of times to
perform mutation operations", which is what I was looking for.  

I'm looking to statistically test some simply scoring matrices.  I think
msbar will do.

Ryan

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Heikki
Lehvaslaiho
Sent: Thursday, February 09, 2006 9:55 AM
To: bioperl-l at lists.open-bio.org; golharam at umdnj.edu
Cc: 'The general forum at Bioinformatics.Org'; 'bioperl-l';
emboss at emboss.open-bio.org
Subject: Re: [Bioperl-l] Tool to mutate DNA sequence


Ryan,

I should have made this very clear in my first reply:

You have to plan very carefully what rules you use when you mutate your 
sequence because it will affect directly the resulting sequences. Of
course,  
all that depends on what you will be using the sequences for. If you are

going to draw evolutionary conclusions from those sequences, you must
mutate 
them in a way that simulates evolutionary principles.

My earlier pseudocode example, for example, should allow mutations in
every 
location. Mutations do occur multiple times in same places as sequences
get 
saturated by mutations. Also, you should decide the relative occurrence
of 
transversions versus transitions. Then there are indels; do you want to
take 
those into account?

Also, check the EMBOSS program 'msbar'.

You did not ask this, but... I remember that during the early days of
Celera, 
one of the tools that enabled them to estimate the feasibility of the
whole 
genome shotgun sequence assembly, was a very complete program to
'synthesize' 
in-silico the whole complexity of the human genome. I have no idea of
that 
program is generally available now.

Yours,

    -Heikki

On Thursday 09 February 2006 06:46, Ryan Golhar wrote:
> Does anyone know of tool to mutate a DNA sequence by a specified 
> amount? For instance, say I have a DNA sequence 1000 bases long, and I

> want to simulate mutations to make it 75% (or 80%, etc) similar to the

> original.
>
>
> Ryan
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org 
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



From Marc.Logghe at DEVGEN.com  Fri Feb 10 06:06:35 2006
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Fri, 10 Feb 2006 12:06:35 +0100
Subject: [EMBOSS] infoseq table format issues
Message-ID: <0C528E3670D8CE4B8E013F6749231AA6746B04@ANTARESIA.be.devgen.com>

Hi all,
I have noticed that the output table format of infoseq is not
consistent. In the sense that the whitespace field separator is
sometimes two spaces and sometimes a tab followed by a space. This makes
it impossible (at least, if you don't want an extra processing step) to
properly import the infoseq output into a spreadsheet. Is there a way to
force infoseq to use tabs only as field separator ?
Regards,
Marc



From Marc.Logghe at DEVGEN.com  Fri Feb 10 06:39:26 2006
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Fri, 10 Feb 2006 12:39:26 +0100
Subject: [EMBOSS] infoseq table format issues
Message-ID: <0C528E3670D8CE4B8E013F6749231AA6746B07@ANTARESIA.be.devgen.com>

Never mind.
Just found out that in Excel you have the option to define multiple
delimiters AND treat consecutive delimiters as one ...
Guess I don't use spreadsheets regularly enough ;-)
On the other hand, I think it would be 'cleaner' if infoseq would stick
to a single type of delimiter.
Cheers,
Marc

> -----Original Message-----
> From: emboss-bounces at emboss.open-bio.org 
> [mailto:emboss-bounces at emboss.open-bio.org] On Behalf Of Marc Logghe
> Sent: Friday, February 10, 2006 12:07 PM
> To: emboss at emboss.open-bio.org
> Subject: [EMBOSS] infoseq table format issues
> 
> Hi all,
> I have noticed that the output table format of infoseq is not 
> consistent. In the sense that the whitespace field separator 
> is sometimes two spaces and sometimes a tab followed by a 
> space. This makes it impossible (at least, if you don't want 
> an extra processing step) to properly import the infoseq 
> output into a spreadsheet. Is there a way to force infoseq to 
> use tabs only as field separator ?
> Regards,
> Marc
> 
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at emboss.open-bio.org
> http://newportal.open-bio.org/mailman/listinfo/emboss
> 



From pmr at ebi.ac.uk  Fri Feb 10 06:45:41 2006
From: pmr at ebi.ac.uk (Peter Rice)
Date: Fri, 10 Feb 2006 11:45:41 +0000
Subject: [EMBOSS] infoseq table format issues
In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA6746B04@ANTARESIA.be.devgen.com>
References: <0C528E3670D8CE4B8E013F6749231AA6746B04@ANTARESIA.be.devgen.com>
Message-ID: <43EC7CE5.8020101@ebi.ac.uk>

Marc Logghe wrote:

> Hi all,
> I have noticed that the output table format of infoseq is not
> consistent. In the sense that the whitespace field separator is
> sometimes two spaces and sometimes a tab followed by a space. This makes
> it impossible (at least, if you don't want an extra processing step) to
> properly import the infoseq output into a spreadsheet. Is there a way to
> force infoseq to use tabs only as field separator ?

Yes .... but ...

infoseq produces a report or HTML.

Is the HTML useful?

Is the text output useful (and is it better to use spaces as text)

Is tab-delimited output useful (also for other programs)?

Do we need some kind of XML output to replace the HTML?

Meanwhile, I will look at cleaning up the current infoseq

regards,

Peter



From Marc.Logghe at DEVGEN.com  Fri Feb 10 08:18:13 2006
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Fri, 10 Feb 2006 14:18:13 +0100
Subject: [EMBOSS] infoseq table format issues
Message-ID: <0C528E3670D8CE4B8E013F6749231AA6746B0A@ANTARESIA.be.devgen.com>

Hi Peter,

> > step) to properly import the infoseq output into a spreadsheet. Is 
> > there a way to force infoseq to use tabs only as field separator ?
> 
> Yes .... but ...
> 
> infoseq produces a report or HTML.
> 
> Is the HTML useful?

Yes, just found out that you can perfectly import this format into Excel
...

> 
> Is the text output useful (and is it better to use spaces as text)
> 
> Is tab-delimited output useful (also for other programs)?
I think tab delimited is better (compared to spaces as delimiter). That
way you can easily process the table with cut or sort and that kind of
things.

> 
> Do we need some kind of XML output to replace the HTML?
> 
> Meanwhile, I will look at cleaning up the current infoseq

Thanks and regards,
Marc



From fnovo at unav.es  Mon Feb 13 07:29:29 2006
From: fnovo at unav.es (F.J. Novo)
Date: Mon, 13 Feb 2006 13:29:29 +0100
Subject: [EMBOSS] dottup and dotmatcher in 3.0.0
Message-ID: <43F07BA9.6020606@unav.es>

Hi all. There seems to be something wrong  with dottup and dotmatcher in 
3.0.0 (under Fedora Core 4). I consistently get an error:

[fnovo at localhost ~]$ dotmatcher
Displays a thresholded dotplot of two sequences
Input sequence: p53mRNA.seq
Second sequence: p53mRNA.seq
Graph type [x11]: png
Devices allowed are:-
postscript
ps
hpgl
hp7470
hp7580
meta
colourps
cps
tektronics
tekt
tek4107t
tek
none
null
text
data
png
Error: Invalid XY graph value 'x11'
Died: dotmatcher terminated: Bad value for '-xygraph' and no prompt

and the same for dottup.

Needless to say, png is properly installed and works fine with other 
applications (including dotpath and polydot), so it seems something 
specific to these two programs. Has anyone else seen this? Any suggestions?

Thanks,




From maximilianh at gmail.com  Tue Feb 14 05:11:42 2006
From: maximilianh at gmail.com (Maximilian Haeussler)
Date: Tue, 14 Feb 2006 11:11:42 +0100
Subject: [EMBOSS] [BiO BB] Re: [Bioperl-l] Tool to mutate DNA sequence
In-Reply-To: <0B84EE38-0BA5-4E56-B35F-C8CBAA342AC4@duke.edu>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
	<0B84EE38-0BA5-4E56-B35F-C8CBAA342AC4@duke.edu>
Message-ID: <76f031ae0602140211n2a0bbf4fl@mail.gmail.com>

The tool ROSE also evolves sequences on a tree. There is a web
interface and downloadable source at
http://bibiserv.techfak.uni-bielefeld.de/rose/

Max

On 09/02/06, Jason Stajich <jason.stajich at duke.edu> wrote:
> Depending on whether or not you want to use evolutionary realistic
> models...
> * evolver which comes with PAML lets you evolve sequences on a tree
> * SeqGen from Andrew Rambaut http://evolve.zoo.ox.ac.uk/software.html?
> id=seqgen
> also lets you do this
> I believe there are PISE interfaces to both of these at the pasteur
> bioweb site - http://bioweb.pasteur.fr/
>
> -jason
> On Feb 8, 2006, at 11:46 PM, Ryan Golhar wrote:
>
> > Does anyone know of tool to mutate a DNA sequence by a specified
> > amount?
> > For instance, say I have a DNA sequence 1000 bases long, and I want to
> > simulate mutations to make it 75% (or 80%, etc) similar to the
> > original.
> >
> >
> > Ryan
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12
>
>
> _______________________________________________
> Bioinformatics.Org general forum  -  BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>


--
Maximilian Haeussler,
CNRS Gif-sur-Yvette, Paris
tel: +33 6 12 82 76 16
icq: 3825815  -- msn: maximilian.haeussler at hpi.uni-potsdam.de
skype: maximilianhaeussler



From scott at cs.wits.ac.za  Wed Feb 15 13:41:02 2006
From: scott at cs.wits.ac.za (Scott Hazelhurst)
Date: Wed, 15 Feb 2006 20:41:02 +0200 (SAST)
Subject: [EMBOSS] Emma options
Message-ID: <20060215184102.6176F40F54B@midi.cs.wits.ac.za>


Dear all,

I am not sure if this is a question for this list or the wemboss forum
-- but their site seems down so I'll ask it here.

I have users who want to specify their own penalty matrices. For
example, for nucleotide sequences the options are clustalw, iub or
own. However, if you pick "own" nothing changes: the option to 
specify your own file doesn't appear. I had a look at the acd file --
not that I properly understand it, and it seems 


I had a look at the acd file -- not that I understand acd syntax
properly so it's a like my trying to fix a broken Jumbo engine.
This seems to be the relevant 

    list: dnamatrix  [
      additional: "@(!$(acdprotein))"
      default: "i"
      minimum: "1"
      maximum: "1"
      header: "Nucleotide multiple alignment matrix options"
      values: "i:iub, c:clustalw, o:own"
      delimiter: ","
      codedelimiter: ":"
      information: "Select matrix"
      button: "Y"
      help: "This gives a menu where you are offered amenu where a
             single matrix (not a series) can be selected."
    ]

    variable: umamatrix "@($(dnamatrix) == own)"

    infile: mamatrix  [
      additional: "@($(usermamatrix)?True:$(umamatrix))"
      default: ""
      nullok: "@($(usermamatrix)?@(!$(umamatrix)):True)"
      information: "Filename of user multiple alignment matrix"
      knowntype: "comparison matrix"
    ]

I  changed the "additional" field in mamatrix to be

      additional: "@($(umamatrix))"

and it seems to work in that the file input box now appears when the
"own" option is seleced.



As an aside, does anyone know the format of what the matrix file
should look like. I did some web searching and looked at the clustalw
source code but it's not so easy to re-engineer..

Can anyone help with either of these queries.

Thanks 

Scott





From gbottu at ben.vub.ac.be  Fri Feb 17 06:27:11 2006
From: gbottu at ben.vub.ac.be (Guy Bottu)
Date: Fri, 17 Feb 2006 12:27:11 +0100
Subject: [EMBOSS] Emma options - Checked by AntiVir DEMO version -
In-Reply-To: <20060215184102.6176F40F54B@midi.cs.wits.ac.za>
References: <20060215184102.6176F40F54B@midi.cs.wits.ac.za>
Message-ID: <20060217112711.GA23686@bigben.ulb.ac.be>

On Wed, Feb 15, 2006 at 08:41:02PM +0200, Scott Hazelhurst wrote:
> As an aside, does anyone know the format of what the matrix file
> should look like. I did some web searching and looked at the clustalw
> source code but it's not so easy to re-engineer..

In case you did not already found it by yourself, here's the answer 
(copied from a user manaul I composed some time ago) :

-------------------------------------------------------------
Data files

   clustal uses symbol comparison matrices for scoring bases or amino acids.
   CLUSTAL has built-in symbol comparison matrices, but allows you to provide
   your own matrix. For proteins, but not for nucleic acids, you can give a
   series of matrices as input. You can choose different matrices for pairwise
   alignment and for multiple alignment.

  Single matrix input file

   The format used for a single matrix is the same as that used by the BLAST
   program. The scores in the new weight matrix should be similarities. You can
   use negative as well as positive values if you wish, although for proteins
   the matrix will be automatically adjusted to all positive scores, unless the
   -norescale option is selected. Any lines beginning with a # character are
   assumed to be comments. The first non-comment line should contain a list of
   bases or amino acids in any order, using the 1 letter code, followed by a *
   character. This should be followed by a square matrix of scores, with one
   row and one column for each base or amino acid. The last row and column of
   the matrix (corresponding to the * character) contain the minimum score over
   the whole matrix.

#  Matrix made by matblas from blosum62.iij
#  * column uses minimum score
#  BLOSUM Clustered Scoring Matrix in 1/2 Bit Units
#  Blocks Database = /data/blocks_5.0/blocks.dat
#  Cluster Percentage: >= 62
#  Entropy =   0.6979, Expected =  -0.5209
   A  R  N  D  C  Q  E  G  H  I  L  K  M  F  P  S  T  W  Y  V  B  Z  X  *
A  4 -1 -2 -2  0 -1 -1  0 -2 -1 -1 -1 -1 -2 -1  1  0 -3 -2  0 -2 -1  0 -4
R -1  5  0 -2 -3  1  0 -2  0 -3 -2  2 -1 -3 -2 -1 -1 -3 -2 -3 -1  0 -1 -4
N -2  0  6  1 -3  0  0  0  1 -3 -3  0 -2 -3 -2  1  0 -4 -2 -3  3  0 -1 -4
D -2 -2  1  6 -3  0  2 -1 -1 -3 -4 -1 -3 -3 -1  0 -1 -4 -3 -3  4  1 -1 -4
C  0 -3 -3 -3  9 -3 -4 -3 -3 -1 -1 -3 -1 -2 -3 -1 -1 -2 -2 -1 -3 -3 -2 -4
Q -1  1  0  0 -3  5  2 -2  0 -3 -2  1  0 -3 -1  0 -1 -2 -1 -2  0  3 -1 -4
E -1  0  0  2 -4  2  5 -2  0 -3 -3  1 -2 -3 -1  0 -1 -3 -2 -2  1  4 -1 -4
G  0 -2  0 -1 -3 -2 -2  6 -2 -4 -4 -2 -3 -3 -2  0 -2 -2 -3 -3 -1 -2 -1 -4
H -2  0  1 -1 -3  0  0 -2  8 -3 -3 -1 -2 -1 -2 -1 -2 -2  2 -3  0  0 -1 -4
I -1 -3 -3 -3 -1 -3 -3 -4 -3  4  2 -3  1  0 -3 -2 -1 -3 -1  3 -3 -3 -1 -4
L -1 -2 -3 -4 -1 -2 -3 -4 -3  2  4 -2  2  0 -3 -2 -1 -2 -1  1 -4 -3 -1 -4
K -1  2  0 -1 -3  1  1 -2 -1 -3 -2  5 -1 -3 -1  0 -1 -3 -2 -2  0  1 -1 -4
M -1 -1 -2 -3 -1  0 -2 -3 -2  1  2 -1  5  0 -2 -1 -1 -1 -1  1 -3 -1 -1 -4
F -2 -3 -3 -3 -2 -3 -3 -3 -1  0  0 -3  0  6 -4 -2 -2  1  3 -1 -3 -3 -1 -4
P -1 -2 -2 -1 -3 -1 -1 -2 -2 -3 -3 -1 -2 -4  7 -1 -1 -4 -3 -2 -2 -1 -2 -4
S  1 -1  1  0 -1  0  0  0 -1 -2 -2  0 -1 -2 -1  4  1 -3 -2 -2  0  0  0 -4
T  0 -1  0 -1 -1 -1 -1 -2 -2 -1 -1 -1 -1 -2 -1  1  5 -2 -2  0 -1 -1  0 -4
W -3 -3 -4 -4 -2 -2 -3 -2 -2 -3 -2 -3 -1  1 -4 -3 -2 11  2 -3 -4 -3 -2 -4
Y -2 -2 -2 -3 -2 -1 -2 -3  2 -1 -1 -2 -1  3 -3 -2 -2  2  7 -1 -3 -2 -1 -4
V  0 -3 -3 -3 -1 -2 -2 -3 -3  3  1 -2  1 -1 -2 -2  0 -3 -1  4 -3 -2 -1 -4
B -2 -1  3  4 -3  0  1 -1  0 -3 -4  0 -3 -3 -2  0 -1 -4 -3 -3  4  1 -1 -4
Z -1  0  0  1 -3  3  4 -2  0 -3 -3  1 -1 -3 -1  0 -1 -3 -2 -2  1  4 -1 -4
X  0 -1 -1 -1 -2 -1 -1 -1 -1 -1 -1 -1 -1 -1 -2  0  0 -2 -1 -1 -1 -1 -1 -4
* -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4  1

  Matrix series input format

   For proteins, CLUSTAL uses by default different matrices depending on the
   mean percent identity of the sequences to be aligned. For proteins, but not
   for nucleic acids, you can specify yourself a series of matrices and the
   range of the percent identity for each matrix in a matrix series file. The
   file is automatically recognised by the word CLUSTAL_SERIES at the beginning
   of the file. Each matrix in the series is then specified on one line which
   should start with the word MATRIX. This is followed by the lower and upper
   limits of the sequence percent identities for which you want to apply the
   matrix. The final entry on the matrix line is the filename of a BLAST format
   matrix file (see above for details of the single matrix file format).

CLUSTAL_SERIES

MATRIX 81 100 blosum80
MATRIX 61  80 blosum62
MATRIX 31  60 blosum45
MATRIX  0  30 blosum30

----------------------------------------------------------------------

	Regards,
	Guy Bottu,
	Belgian EMBnet Node



From biopyte at yahoo.de  Fri Feb 17 20:03:19 2006
From: biopyte at yahoo.de (Hans Meier)
Date: Sat, 18 Feb 2006 02:03:19 +0100 (CET)
Subject: [EMBOSS] 'octanol' - output to stdout not possible?
Message-ID: <20060218010319.77871.qmail@web26314.mail.ukl.yahoo.com>

Dear friends,
 
 with the general qualifiers "-filter" and "-stdout"
 I tried to make 'octanol -graph png' write to stdout 
 and not to a file (for certain reasons).
 Anyway, a file is written and I can't catch the output 
 directly from stdout.
 
 Is there a solution for this problem or
 is writing a file hardcoded?
 
 Regards, Harald
 
 
		
---------------------------------
Telefonieren Sie ohne weitere Kosten mit Ihren Freunden von PC zu PC!
Jetzt Yahoo! Messenger installieren!


From dstates at bioinformatics.med.umich.edu  Fri Feb 17 16:00:19 2006
From: dstates at bioinformatics.med.umich.edu (David States)
Date: Fri, 17 Feb 2006 16:00:19 -0500
Subject: [EMBOSS] Building EMBOSS in cygwin - undefined reference to _c_pl...
Message-ID: <46949FAC535B4245B58BB9A1262F5EC40824@mail.bicc.med.umich.edu>

I am trying to build EMBOSS-3.0.0 under cygwin (recent install) and follow the directions in http://emboss.sourceforge.net/download/cygwin.html, but when I get to ./libs/ajgraph.o, the build fails with a large number of error messages of the form

.libs/ajgraph.o:ajgraph.c:(.text+0xc4): undefined reference to `_c_plxsfnam'
.libs/ajgraph.o:ajgraph.c:(.text+0x15d): undefined reference to `_c_pladv'
.libs/ajgraph.o:ajgraph.c:(.text+0x195): undefined reference to `_c_plssub'
...

Any suggestions?

David

David J. States, M.D., Ph.D.
Professor of Human Genetics
University of Michigan School of Medicine?
Palmer Commons,??2035B
100 Washtenaw Rd.
Ann Arbor, MI 48109 USA
email: dstates at umich.edu
tel: (734) 615-5510
fax: (734) 615-6553
URL: http://stateslab.bioinformatics.med.umich.edu





From maximilianh at gmail.com  Sun Feb 19 08:52:37 2006
From: maximilianh at gmail.com (Maximilian Haeussler)
Date: Sun, 19 Feb 2006 14:52:37 +0100
Subject: [EMBOSS] [BiO BB] Tool to mutate DNA sequence
In-Reply-To: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
Message-ID: <76f031ae0602190552v5f2542dbv@mail.gmail.com>

Hi bio-mailinglists,

does anyone here know of a tool or a library to display two (or more)
sequences at the same time with coloured features? Possibly with lines,
connecting some features from one sequence to the other (synteny-plot) ?
Or to display two multiple alignments, one on top of each other, with
colored features added?

It's not that it would be difficult to write, but programming visualisation
usually takes a lot of time.
Bio::Graphics seems mainly concerned with one main sequence and features on
it. Well, I could copy together two of these gif-images, but then there
would be no connecting lines. Same applies for the graphics in Biojava or
the gff2ps tool or all the multiple alignment viewers that I know (Bioedit,
ClustalX). There is something called Toucan in Java, which displays at least
several lines of gff-style-features, but no visible sequences and more
importantly, no connecting lines. A recent software, Djinn lite, is using a
similar kind of visualization to compare different spliced genes from
various species, but it's mainly aimed at splicing and written in Visual
Basic.
I guess a good compromise might be the 3D viewer Sockeye, but I haven't seen
any synteny-lines in sockeye yet.

I guess I must have missed something here. I cannot be the first one that
would like to compare, say, two gff files, or two multiple alignments?

Thanks a lot for any idea,
Max



From gbottu at ben.vub.ac.be  Mon Feb 20 03:04:11 2006
From: gbottu at ben.vub.ac.be (Guy Bottu)
Date: Mon, 20 Feb 2006 09:04:11 +0100
Subject: [EMBOSS] [BiO BB] Tool to mutate DNA sequence - Checked by
	AntiVir
In-Reply-To: <76f031ae0602190552v5f2542dbv@mail.gmail.com>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
	<76f031ae0602190552v5f2542dbv@mail.gmail.com>
Message-ID: <20060220080411.GB26540@bigben.ulb.ac.be>

On Sun, Feb 19, 2006 at 02:52:37PM +0100, Maximilian Haeussler wrote:
> does anyone here know of a tool or a library to display two (or more)
> sequences at the same time with coloured features? Possibly with lines,
> connecting some features from one sequence to the other (synteny-plot) ?
> Or to display two multiple alignments, one on top of each other, with
> colored features added?

Well, there is Alfresco
http://www.sanger.ac.uk/Software/Alfresco/

	Guy Bottu,
	Belgian EMBnet Node



From pmr at ebi.ac.uk  Mon Feb 20 03:19:07 2006
From: pmr at ebi.ac.uk (pmr at ebi.ac.uk)
Date: Mon, 20 Feb 2006 08:19:07 -0000 (GMT)
Subject: [EMBOSS] 'octanol' - output to stdout not possible?
In-Reply-To: <20060218010319.77871.qmail@web26314.mail.ukl.yahoo.com>
References: <20060218010319.77871.qmail@web26314.mail.ukl.yahoo.com>
Message-ID: <1256.86.137.129.90.1140423547.squirrel@webmail.ebi.ac.uk>

Dear Harald,

>  with the general qualifiers "-filter" and "-stdout"
>  I tried to make 'octanol -graph png' write to stdout
>  and not to a file (for certain reasons).
>  Anyway, a file is written and I can't catch the output
>  directly from stdout.

For graphs output must go to a file because many programs will write more
than one PNG file.

>  Is there a solution for this problem or
>  is writing a file hardcoded?

Unfortunately the -goutfile stdout option will not work - the graphics
library writes the message "Created octanol.1.png" to stdout.

But for octanol there is a single image file produces, so you can use the
command line option:

 -goutfile x.png

and than cat x.png to stdout.

For programs that write more than one PNG file (prettyplot for example)
you will get x.png.1.png x.png.2.png and so on. I do not see an easy way
around this for PNG files.

Hope that helps,

Peter



From shameer at ncbs.res.in  Mon Feb 20 01:21:01 2006
From: shameer at ncbs.res.in (Shameer Khadar)
Date: Mon, 20 Feb 2006 11:51:01 +0530 (IST)
Subject: [EMBOSS] Matrix Average Code / Module ?
In-Reply-To: <76f031ae0602190552v5f2542dbv@mail.gmail.com>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
	<76f031ae0602190552v5f2542dbv@mail.gmail.com>
Message-ID: <59825.192.168.1.176.1140416461.squirrel@192.168.1.176>

Hi all,
Is there any program/module to calculate the average of a blosum/pam any
matrix ?

I have a matrix and I need to see the average

for example

11 22 43 54 50
27 87 74 32 10
66 58 98 78 20
22 23 44 16 34

I have gone through Bio::Matrix::MatrixI and Bio::Matrix::GenericMatrix
and other perl modules like Math::Matrix
http://search.cpan.org/~ulpfr/Math-Matrix-0.4/Matrix.pm
and Math::Cephes::Matrix - but none of them have a provison to do matrix 
average calculation.

Any help ???
thanks in advance,
Happy biocomputing !!!


-- 
Shameer Khadar
National Centre for Biological Sciences (TIFR)
UAS - GKVK Campus - Bellary Road Bangalore - 65 - Karnataka - India
T - 91-080-23636420-32 EXT 4241
F - 91-080-23636662/23636675
W - http://www.ncbs.res.in
--------------------------------------------------
"Refrain from illusions, insist on work and not words,
 patiently seek divine and scientific truth."
MM




From d.gatherer at vir.gla.ac.uk  Wed Feb 22 07:03:11 2006
From: d.gatherer at vir.gla.ac.uk (Derek Gatherer)
Date: Wed, 22 Feb 2006 12:03:11 +0000
Subject: [EMBOSS] showseq and overlapping ORFs
Message-ID: <6.2.3.4.1.20060222114454.02b36000@lenzie.gla.ac.uk>

Hi EMBOSSers

I'm using showseq as follows:

[gath01d at gamma ebv]$ showseq hhv8.fa -format 4 -trans 
105-944,1112-2764,3179-6577,6594-8681,8665-11202,11329-14367,14485-15741,15756-16979,28774-29154,30242-30769 
-out test.showseq -auto

    EMBOSS An error in showseq.c at line 198:
Translation ranges are not in ascending, non-overlapping order.

As can be seen, the failure originates with the subsequence 6594-8681 
slightly overlapping with the next one 8665-11202.

Is there a way round this on the command line or would it require a 
code tweak?  It would be good if there was, since often in viral 
genomes (this is HHV8, as it happens) ORFs are not cleanly "in 
ascending, non-overlapping order" as the program would seem to require.

A related question: all the above are top-strand ORFs, but further 
down there are a few complementary strand ones.  What combination of 
parameters would I use to indicate that I want some translated on the 
top and some on the bottom?  I could of course use format -6 and get 
all six frames, but that is a bit messy for the output I want.  I was 
thinking that maybe it would need to be something like:

showseq hhv8.fa -things B,N,T,S,B,1,A,F -trans 
105-944,1112-2764,3179-6577,6594-8681,8665-11202,11329-14367  -things 
B,N,T,S,B,-1,A,F -trans 
14485-15741,15756-16979,28774-29154,30242-30769 -out test.showseq -auto

ie, using things to specify that for some ORFs I want the translation 
on -1 instead of 1, but the above command just outputs DNA sequence 
with no translation.

Any ideas gratefully appreciated

Derek



From d.gatherer at vir.gla.ac.uk  Wed Feb 22 10:19:58 2006
From: d.gatherer at vir.gla.ac.uk (Derek Gatherer)
Date: Wed, 22 Feb 2006 15:19:58 +0000
Subject: [EMBOSS] showseq and overlapping ORFs
In-Reply-To: <6.2.3.4.1.20060222114454.02b36000@lenzie.gla.ac.uk>
References: <6.2.3.4.1.20060222114454.02b36000@lenzie.gla.ac.uk>
Message-ID: <6.2.3.4.1.20060222151212.02bb2328@lenzie.gla.ac.uk>

Hello again

I wonder if showseq is bugged.  Look at the following:

[gath01d at gamma ebv]$ showseq hhv8.fa -format 0 -trans 100-200 -out test.showseq
Display a sequence with features, translation etc..
Specify your own things to display
          S : Sequence
          B : Blank line
          1 : Frame1 translation
          2 : Frame2 translation
          3 : Frame3 translation
         -1 : CompFrame1 translation
         -2 : CompFrame2 translation
         -3 : CompFrame3 translation
          T : Ticks line
          N : Number ticks line
          C : Complement sequence
          F : Features
          R : Restriction enzyme cut sites in forward sense
         -R : Restriction enzyme cut sites in reverse sense
          A : Annotation
Enter a list of things to display [B,N,T,S,A,F]: b,s,1

Choosing b,s,1 here gives:


AF148805.2
Human herpesvirus 8 isolate GK18, complete genome

           TACTAATTTTGAAAGGCGGGGTTCTGCCAGGCATAGTCTTTTTTTGTGGCGGCCCTTGTG


           TAAACCTGTCTTTCAGACCTTGTTGGACATCCCGTACAATCAAGATGTTCCTGTATGTTG
                                                  S  R  C  S  C  M  L

           TTTGCAGTCTGGCGGTTTGCTTTCGAGGACTATTAAGCCTTTCTCTGCAATCGTCTCCAA
           F  A  V  W  R  F  A  F  E  D  Y  *  A  F  L  C  N  R  L  Q

           ATCTCTGCCCTGGAGTGATTTCAACGCCTTACACGTTGACCTGTCCGTCTAATACATCCT
           I  S  A  L  E  *  X

           TGCCAACATCCTGGTATTGCAACGATACTCGGCTTTTACGAGTGACGCAGGGAACATTGA


ie. a nice frame 1 translation in the frame requested.

but if I choose b,s,-1, I get:

AF148805.2
Human herpesvirus 8 isolate GK18, complete genome

           TACTAATTTTGAAAGGCGGGGTTCTGCCAGGCATAGTCTTTTTTTGTGGCGGCCCTTGTG
             V  L  K  S  L  R  P  E  A  L  C  L  R  K  K  H  R  G  K  H

           TAAACCTGTCTTTCAGACCTTGTTGGACATCCCGTACAATCAAGATGTTCCTGTATGTTG
             L  G  T  K  *  V  K  N  S  M  G  Y  L  *  S  T  G  T  H  Q

           TTTGCAGTCTGGCGGTTTGCTTTCGAGGACTATTAAGCCTTTCTCTGCAATCGTCTCCAA
             K  C  D  P  P  K  S  E  L  V  I  L  G  K  E  A  I  T  E  L

           ATCTCTGCCCTGGAGTGATTTCAACGCCTTACACGTTGACCTGTCCGTCTAATACATCCT
             D  R  G  Q  L  S  K  L  A  K  C  T  S  R  D  T  *  Y  M  R

           TGCCAACATCCTGGTATTGCAACGATACTCGGCTTTTACGAGTGACGCAGGGAACATTGA
             A  L  M  R  T  N  C  R  Y  E  A  K  V  L  S  A  P  F  M  S

ie the frame -1 translation over the whole thing.

So is -trans only really supposed to work with frame 1?? or is this a 
bug?  I notice that transeq has in its "known bugs":

"When using the '-regions' option, you should always leave the 
'-frames' option at the default of frame '1'."

Has this been carried over into showseq?


Cheers
Derek



From golharam at umdnj.edu  Thu Feb 23 15:25:39 2006
From: golharam at umdnj.edu (Ryan Golhar)
Date: Thu, 23 Feb 2006 15:25:39 -0500
Subject: [EMBOSS] MEME for EMBOSS
Message-ID: <001901c638b7$4f8625c0$e6028a0a@GOLHARMOBILE1>

I downloaded and installed MEME for EMBOSS.  When I run 'tfm' and enter
meme I get the output.  The description and algorithm information is
missing....



Function

   Motif detection

Description

   **************** EDIT HERE ****************

Algorithm

   **************** EDIT HERE ****************

Usage

   Here is a sample session with meme



--
Ryan Golhar  -  golharam at umdnj.edu
The Informatics Institute of UMDNJ



From ajb at ebi.ac.uk  Thu Feb 23 16:32:16 2006
From: ajb at ebi.ac.uk (ajb at ebi.ac.uk)
Date: Thu, 23 Feb 2006 21:32:16 -0000 (GMT)
Subject: [EMBOSS] MEME for EMBOSS
In-Reply-To: <001901c638b7$4f8625c0$e6028a0a@GOLHARMOBILE1>
References: <001901c638b7$4f8625c0$e6028a0a@GOLHARMOBILE1>
Message-ID: <55463.81.96.70.96.1140730336.squirrel@webmail.ebi.ac.uk>

Hello Ryan,

Yes, it is rather sparse. We hope to update meme to version 3.5.1 in the
near future.
However, the authors supply no documentation with their releases other
than that gleaned from using the -help flag. The meme homepage gives
similarly sparse information, although you can download a 1994 paper
as a PDF. See http://meme.sdsc.edu/meme/papers.html

In the meantime,   meme -help   will give some information.

We will try to write more material for tfm in the next release. Thanks
for reminding us.

Alan




From Ahmad.N.Abou.Tayoun at Dartmouth.EDU  Fri Feb 24 21:50:28 2006
From: Ahmad.N.Abou.Tayoun at Dartmouth.EDU (Ahmad N. Abou Tayoun)
Date: 24 Feb 2006 21:50:28 EST
Subject: [EMBOSS] Accessing Applications
Message-ID: <51444772@comet.Dartmouth.EDU>

Hello,

I am a graduate student at Dartmouth Medical School.  I was trying to use some of EMBOSS applications but it always gave me the error shown below.  Can you please help me figure that out ?


An error has been encountered in accessing this page. 

1. Server: emboss.sourceforge.net
2. URL path: /apps/groups/diffseq.html
3. Error notes: File does not exist: /home/groups/e/em/emboss/htdocs/apps/groups/diffseq.html
4. Error type: 404
5. Request method: GET
6. Request query string: 
7. Time: 2006-02-24 18:48:16 PST (1140835696)



Thank you alot,
username: Ahmadtayoun

Ahmad



From pmr at ebi.ac.uk  Tue Feb 28 04:44:12 2006
From: pmr at ebi.ac.uk (Peter Rice)
Date: Tue, 28 Feb 2006 09:44:12 +0000
Subject: [EMBOSS] Accessing Applications
In-Reply-To: <51444772@comet.Dartmouth.EDU>
References: <51444772@comet.Dartmouth.EDU>
Message-ID: <44041B6C.6030600@ebi.ac.uk>

Ahmad N. Abou Tayoun wrote:

> Hello,
> 
> I am a graduate student at Dartmouth Medical School.  I was trying to use some of EMBOSS applications but it always gave me the error shown below.  Can you please help me figure that out ?
> 
> 
> An error has been encountered in accessing this page. 
> 
> 1. Server: emboss.sourceforge.net
> 2. URL path: /apps/groups/diffseq.html
> 3. Error notes: File does not exist: /home/groups/e/em/emboss/htdocs/apps/groups/diffseq.html

Oops ... we are making changes to the documentation on the website. We appear 
to have broken some links.

What we are doing is to make separate documentation for the latest release 
and for the current development code. This has broken the links if you go via 
the application groups pages.

You will still be able to use your local EMBOSS installation (which includes 
full documentation on the programs).

 From your message it could be you are looking for a site where you can run 
EMBOSS through a web interface ... if so, there are many to choose from. We do 
not advertise any in particular, but perhaps we should.

Meanwhile, we will fix the broken links.

Hope that helps,

Peter




From Marc.Logghe at DEVGEN.com  Tue Feb 28 04:56:12 2006
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Tue, 28 Feb 2006 10:56:12 +0100
Subject: [EMBOSS] Accessing Applications
Message-ID: <0C528E3670D8CE4B8E013F6749231AA6746B65@ANTARESIA.be.devgen.com>

Hi Ahmad,

> Hello,
> 
> I am a graduate student at Dartmouth Medical School.  I was 
> trying to use some of EMBOSS applications but it always gave 
> me the error shown below.  Can you please help me figure that out ?

I have noticed some changes at the EMBOSS web site as well. The docs for
the individual applications can be found at this url:
http://emboss.sourceforge.net/apps/cvs/index.html
A direct link to the docs of diffseq is
http://emboss.sourceforge.net/apps/cvs/diffseq.html.

Beware that at the sourceforge web site you can not actually run the
applications !
You have to install it yourself and run applications at the command line
or check out some sites that publish an EMBOSS web interface.
I wanted to point you to some wEMBOSS implementations at various EMBL
nodes but ... in order to use that you need to register, unfortunately.
I don't know their policies  (http://bigben.vub.ac.be:6080/wEMBOSS,
https://emb1.bcc.univie.ac.at/component/option,com_wrapper/Itemid,104/).
Anyhow, the EMBL policies seem to differ from those used by the NCBI or
EBI for instance, cos there everybody can make use of the tools. Even if
you don't pay taxes ;-) 
HTH,
Marc 



From pmr at ebi.ac.uk  Tue Feb 28 06:06:25 2006
From: pmr at ebi.ac.uk (Peter Rice)
Date: Tue, 28 Feb 2006 11:06:25 +0000
Subject: [EMBOSS] Accessing Applications
In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA6746B65@ANTARESIA.be.devgen.com>
References: <0C528E3670D8CE4B8E013F6749231AA6746B65@ANTARESIA.be.devgen.com>
Message-ID: <44042EB1.8000204@ebi.ac.uk>

Marc Logghe wrote:

> I have noticed some changes at the EMBOSS web site as well. The docs for
> the individual applications can be found at this url:
> http://emboss.sourceforge.net/apps/cvs/index.html
> A direct link to the docs of diffseq is
> http://emboss.sourceforge.net/apps/cvs/diffseq.html.

These URLs will change as we update the website (we will change the apps/cvs 
part). A new path will appear for the docs for release 3.0.0. Thsi wil be the 
first time we have documented the latest release on the website - although few 
users noticed we were always documenting the latest CVS developers release :-)

EMBOSS does include full documentation for all programs which is installed 
into the share/EMBOSS/doc/programs/html/ directory. This will change in 
release 4.0.0 (July 2006). In release 3.0.0 the EMBASSY packages are still 
documented in the same directory as the EMBOSS main programs.

> I wanted to point you to some wEMBOSS implementations at various EMBL
> nodes but ... in order to use that you need to register, unfortunately.
> I don't know their policies  (http://bigben.vub.ac.be:6080/wEMBOSS,
> https://emb1.bcc.univie.ac.at/component/option,com_wrapper/Itemid,104/).
> Anyhow, the EMBL policies seem to differ from those used by the NCBI or
> EBI for instance, cos there everybody can make use of the tools. Even if
> you don't pay taxes ;-) 

I think you mean "EMBnet" ... I have to be picky as EBI is part of EMBL 
(European Molecular Biology Laboratory in Heidelberg, Germany) ... and also a 
member of EMBnet :-) National EMBnet servers provide access to their 
registered scientists, - that is what they are funded for - and may also allow 
access to those outside. If you are in the UK, you no longer have a national 
EMBnet server as that was the HGMP/RFCGR where EMBOSS was developed until it 
closed in July 2005. The Austrian server machine (univie.ac.at) is about to 
move so may be down for a while.

EBI does provide access to EMBOSS, but not a simple web interface to all the 
programs by name. You can also use many of EMBOSS programs through the EBI 
"Toolbox", but not diffseq which was the that started this thread. EBI also 
provides simple web service access through WSEmboss frok our External Services 
Group http://www.ebi.ac.uk/Tools/webservices/WSEmboss.html and fully featured 
web wervice access through SoapLab http://www.ebi.ac.uk/soaplab/ developed by 
Martin Senger in my group as part of the myGrid project (and now part of the 
EMBRACE project).

I still plan to survey all the EMBOSS interfaces in the near future ... once 
funding is sorted out ...

Hope that helps,

Peter




From stefan.rensing at biologie.uni-freiburg.de  Fri Feb  3 15:16:14 2006
From: stefan.rensing at biologie.uni-freiburg.de (Stefan Rensing)
Date: Fri, 03 Feb 2006 16:16:14 +0100
Subject: [EMBOSS] patmatdb
Message-ID: <43E373BE.10202@biologie.uni-freiburg.de>

Dear all,

what exactly does the flag -snucleotide1 toggle in patmatdb?

>From the doc I was thinking it would enable searching against nucleotide
acid sequences instead of proteins. However, execution aborts with an
error message saying that the sequence is not protein.

Cheers, Stefan

-- 
Dr. Stefan Rensing, Group Leader Computational Biology
Plant Biotechnology, Faculty of Biology, University of Freiburg
Schaenzlestr. 1, D-79104 Freiburg, Fon: +49 761 203-6974, Fax: -6945
http://www.plant-biotech.net/  http://www.cosmoss.org/
stefan.rensing at biologie.uni-freiburg.de

"An old man dies. A young girl lives. A fair trade. I love you, Nancy."



From pmr at ebi.ac.uk  Fri Feb  3 17:31:39 2006
From: pmr at ebi.ac.uk (Peter Rice)
Date: Fri, 03 Feb 2006 17:31:39 +0000
Subject: [EMBOSS] patmatdb
In-Reply-To: <43E373BE.10202@biologie.uni-freiburg.de>
References: <43E373BE.10202@biologie.uni-freiburg.de>
Message-ID: <43E3937B.607@ebi.ac.uk>

Hi Stefan,

> what exactly does the flag -snucleotide1 toggle in patmatdb?

-snucleotide (and -sprotein) are available for all sequence inputs. They are 
used for programs that can read DNA of rpotein sequences, where you have a 
sequence that can be both types (a short sequence ni FASTA format for example)

>>From the doc I was thinking it would enable searching against nucleotide
> acid sequences instead of proteins. However, execution aborts with an
> error message saying that the sequence is not protein.

The sequence type tells patmatdb to only accept protein.

Thinking about this ... we can change the -help output (and the program 
documentation) to describe the sequence type much better than the current 
"sequence database USA". We can, for example, say whether the sequence can be 
DNA or protein and whether gaps, stops, and other characters are used. All we 
need is a short description (which we have) for each sequence type. This is 
something we should have added long ago :-)

The pattern syntax was defined for the PROSITE database ... but we can also 
allow it to search nucleotide data. It is only a small change to the program. 
Does anyone neet to search a nucleotide database with patmatdb?

I suspect patmatdb is rather redundant ... you can get the same results from 
fuzzpro (for protein) or fuzznuc (for nucleotide) ... -rformat dbmotif will 
give you the same output format as patmatdb.

Any preferences?

Peter



From andrespinzon at gmail.com  Mon Feb  6 19:18:50 2006
From: andrespinzon at gmail.com (Andres Pinzon)
Date: Mon, 6 Feb 2006 14:18:50 -0500
Subject: [EMBOSS] seqretsplit in batch mode
In-Reply-To: <8968fc7e0602061015r551ce5dcn@mail.gmail.com>
References: <8968fc7e0602061015r551ce5dcn@mail.gmail.com>
Message-ID: <8968fc7e0602061118s2bf6fdc4l@mail.gmail.com>

2006/2/6, Andres Pinzon <andrespinzon at gmail.com>:

> [...]
> Anybody knows how can i tell seqretsplit not to prompt for the Output sequence?
> Best regards,

Ok, I answer my own question, just in case ;-)
============
seqretsplit -sequence mysequence.fasta -auto
============

--
---------
Andr?s Pinz?n [http://www.andrespinzon.com]
Bioinformatics Center, Colombia EMBnet node
Biotechnology Institute - National University of Colombia
http://bioinf.ibun.unal.edu.co
Tel +57 3165000 ext 16961 Fax +571 3165415
----------



From andrespinzon at gmail.com  Mon Feb  6 18:15:15 2006
From: andrespinzon at gmail.com (Andres Pinzon)
Date: Mon, 6 Feb 2006 13:15:15 -0500
Subject: [EMBOSS] seqretsplit in batch mode
Message-ID: <8968fc7e0602061015r551ce5dcn@mail.gmail.com>

Hi all,
Im trying to use seqretsplit in thousands of fasta files in a
directory at once. But it fails (I think) because for each fasta file
one is supoussed to hit <ENTER>, for instance:

andipin at linux:~/BYB/byDir> seqretsplit 11150.fasta
Reads and writes (returns) sequences in individual files
Output sequence [q3ybd3.fasta]:   <--- HIT ENTER!!!!

Anybody knows how can i tell seqretsplit not to prompt for the Output sequence?
Best regards,

--
---------
Andr?s Pinz?n [http://www.andrespinzon.com]
Bioinformatics Center, Colombia EMBnet node
Biotechnology Institute - National University of Colombia
http://bioinf.ibun.unal.edu.co
Tel +57 3165000 ext 16961 Fax +571 3165415
----------



From David.Bauer at schering.de  Tue Feb  7 06:46:16 2006
From: David.Bauer at schering.de (David.Bauer at schering.de)
Date: Tue, 7 Feb 2006 07:46:16 +0100
Subject: [EMBOSS] seqretsplit in batch mode
In-Reply-To: <8968fc7e0602061118s2bf6fdc4l@mail.gmail.com>
Message-ID: <OF1B745080.81A8AC07-ONC125710E.0024ECE6-C125710E.0025351D@schering.de>



And if you become more familiar with emboss you can set the environment
variable
EMBOSS_AUTO=1
which causes alle emboss programs to run like if -auto has been specified
on the command line.

Cheers,
David.
emboss-bounces at emboss.open-bio.org schrieb am 06/02/2006 20:18:50:

> 2006/2/6, Andres Pinzon <andrespinzon at gmail.com>:
>
> > [...]
> > Anybody knows how can i tell seqretsplit not to prompt for the
> Output sequence?
> > Best regards,
>
> Ok, I answer my own question, just in case ;-)
> ============
> seqretsplit -sequence mysequence.fasta -auto
> ============



From golharam at umdnj.edu  Thu Feb  9 04:46:43 2006
From: golharam at umdnj.edu (Ryan Golhar)
Date: Wed, 08 Feb 2006 23:46:43 -0500
Subject: [EMBOSS] Tool to mutate DNA sequence
Message-ID: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>

Does anyone know of tool to mutate a DNA sequence by a specified amount?
For instance, say I have a DNA sequence 1000 bases long, and I want to
simulate mutations to make it 75% (or 80%, etc) similar to the original.


Ryan



From pmr at ebi.ac.uk  Thu Feb  9 08:25:24 2006
From: pmr at ebi.ac.uk (pmr at ebi.ac.uk)
Date: Thu, 9 Feb 2006 08:25:24 -0000 (GMT)
Subject: [EMBOSS] [BiO BB] Tool to mutate DNA sequence
In-Reply-To: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
Message-ID: <2714.86.132.216.50.1139473524.squirrel@webmail.ebi.ac.uk>

Ryan Golhar writes:

> Does anyone know of tool to mutate a DNA sequence by a specified amount?
> For instance, say I have a DNA sequence 1000 bases long, and I want to
> simulate mutations to make it 75% (or 80%, etc) similar to the original.

EMBOSS has the msbar program ("mutate sequence beyond all recognition")
which allows you to select the number and type of changes.

With some tuning of options to match the sequence length you should be
able to get results that match whatever your definition of 75% similar
might be (amazing how much more similarity you can get by adding gaps in
an alignment :-)

If you can specify a clear and generally useful way to define what you
need we could of course add a "percent change" option to the msbar program
for a future release.

Hope that helps,

Peter



From torsten.seemann at infotech.monash.edu.au  Thu Feb  9 11:15:28 2006
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Thu, 09 Feb 2006 22:15:28 +1100
Subject: [EMBOSS] [Bioperl-l] Tool to mutate DNA sequence
In-Reply-To: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
Message-ID: <43EB2450.6000606@infotech.monash.edu.au>

Ryan,

> Does anyone know of tool to mutate a DNA sequence by a specified amount?
> For instance, say I have a DNA sequence 1000 bases long, and I want to
> simulate mutations to make it 75% (or 80%, etc) similar to the original.

The EMBOSS suite comes with a tool called "msbar" which can controllably 
mutate sequences:

http://emboss.sourceforge.net/apps/msbar.html

-- 
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/


From jason.stajich at duke.edu  Thu Feb  9 19:10:54 2006
From: jason.stajich at duke.edu (Jason Stajich)
Date: Thu, 9 Feb 2006 14:10:54 -0500
Subject: [EMBOSS] [Bioperl-l] Tool to mutate DNA sequence
In-Reply-To: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
Message-ID: <0B84EE38-0BA5-4E56-B35F-C8CBAA342AC4@duke.edu>

Depending on whether or not you want to use evolutionary realistic  
models...
* evolver which comes with PAML lets you evolve sequences on a tree
* SeqGen from Andrew Rambaut http://evolve.zoo.ox.ac.uk/software.html? 
id=seqgen
also lets you do this
I believe there are PISE interfaces to both of these at the pasteur  
bioweb site - http://bioweb.pasteur.fr/

-jason
On Feb 8, 2006, at 11:46 PM, Ryan Golhar wrote:

> Does anyone know of tool to mutate a DNA sequence by a specified  
> amount?
> For instance, say I have a DNA sequence 1000 bases long, and I want to
> simulate mutations to make it 75% (or 80%, etc) similar to the  
> original.
>
>
> Ryan
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12




From heikki at sanbi.ac.za  Thu Feb  9 11:31:20 2006
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Thu, 9 Feb 2006 13:31:20 +0200
Subject: [EMBOSS] [Bioperl-l] Tool to mutate DNA sequence
In-Reply-To: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
Message-ID: <200602091331.21690.heikki@sanbi.ac.za>

Ryan,

Instructions in pseudo code:

take the sequence string out of the object
use a hash to store changed locations
repeat 
    pick a location in the string randomly
    if the location is not in a hash , i.e. changed already, 
        change it into something else
    add the changed location into the hash
    if enough locations have been changed (scalar keys hash), exit loop
put the sequence string back into the seq object

   -Heikki   

On Thursday 09 February 2006 06:46, Ryan Golhar wrote:
> Does anyone know of tool to mutate a DNA sequence by a specified amount?
> For instance, say I have a DNA sequence 1000 bases long, and I want to
> simulate mutations to make it 75% (or 80%, etc) similar to the original.
>
>
> Ryan
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________


From heikki at sanbi.ac.za  Thu Feb  9 14:54:30 2006
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Thu, 9 Feb 2006 16:54:30 +0200
Subject: [EMBOSS] [Bioperl-l] Tool to mutate DNA sequence
In-Reply-To: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
Message-ID: <200602091654.30890.heikki@sanbi.ac.za>

Ryan,

I should have made this very clear in my first reply:

You have to plan very carefully what rules you use when you mutate your 
sequence because it will affect directly the resulting sequences. Of course,  
all that depends on what you will be using the sequences for. If you are 
going to draw evolutionary conclusions from those sequences, you must mutate 
them in a way that simulates evolutionary principles.

My earlier pseudocode example, for example, should allow mutations in every 
location. Mutations do occur multiple times in same places as sequences get 
saturated by mutations. Also, you should decide the relative occurrence of 
transversions versus transitions. Then there are indels; do you want to take 
those into account?

Also, check the EMBOSS program 'msbar'.

You did not ask this, but... I remember that during the early days of Celera, 
one of the tools that enabled them to estimate the feasibility of the whole 
genome shotgun sequence assembly, was a very complete program to 'synthesize' 
in-silico the whole complexity of the human genome. I have no idea of that 
program is generally available now.

Yours,

    -Heikki

On Thursday 09 February 2006 06:46, Ryan Golhar wrote:
> Does anyone know of tool to mutate a DNA sequence by a specified amount?
> For instance, say I have a DNA sequence 1000 bases long, and I want to
> simulate mutations to make it 75% (or 80%, etc) similar to the original.
>
>
> Ryan
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________


From golharam at umdnj.edu  Thu Feb  9 21:19:46 2006
From: golharam at umdnj.edu (Ryan Golhar)
Date: Thu, 09 Feb 2006 16:19:46 -0500
Subject: [EMBOSS] [Bioperl-l] Tool to mutate DNA sequence
In-Reply-To: <200602091654.30890.heikki@sanbi.ac.za>
Message-ID: <002801c62dbe$8d4d7e20$e6028a0a@GOLHARMOBILE1>

Thanks all.  The responses I got were definitely more than helpful.  FYI
- I did initially look at msbar.  I glanced over the "Number of times to
perform mutation operations", which is what I was looking for.  

I'm looking to statistically test some simply scoring matrices.  I think
msbar will do.

Ryan

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Heikki
Lehvaslaiho
Sent: Thursday, February 09, 2006 9:55 AM
To: bioperl-l at lists.open-bio.org; golharam at umdnj.edu
Cc: 'The general forum at Bioinformatics.Org'; 'bioperl-l';
emboss at emboss.open-bio.org
Subject: Re: [Bioperl-l] Tool to mutate DNA sequence


Ryan,

I should have made this very clear in my first reply:

You have to plan very carefully what rules you use when you mutate your 
sequence because it will affect directly the resulting sequences. Of
course,  
all that depends on what you will be using the sequences for. If you are

going to draw evolutionary conclusions from those sequences, you must
mutate 
them in a way that simulates evolutionary principles.

My earlier pseudocode example, for example, should allow mutations in
every 
location. Mutations do occur multiple times in same places as sequences
get 
saturated by mutations. Also, you should decide the relative occurrence
of 
transversions versus transitions. Then there are indels; do you want to
take 
those into account?

Also, check the EMBOSS program 'msbar'.

You did not ask this, but... I remember that during the early days of
Celera, 
one of the tools that enabled them to estimate the feasibility of the
whole 
genome shotgun sequence assembly, was a very complete program to
'synthesize' 
in-silico the whole complexity of the human genome. I have no idea of
that 
program is generally available now.

Yours,

    -Heikki

On Thursday 09 February 2006 06:46, Ryan Golhar wrote:
> Does anyone know of tool to mutate a DNA sequence by a specified 
> amount? For instance, say I have a DNA sequence 1000 bases long, and I

> want to simulate mutations to make it 75% (or 80%, etc) similar to the

> original.
>
>
> Ryan
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org 
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



From Marc.Logghe at DEVGEN.com  Fri Feb 10 11:06:35 2006
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Fri, 10 Feb 2006 12:06:35 +0100
Subject: [EMBOSS] infoseq table format issues
Message-ID: <0C528E3670D8CE4B8E013F6749231AA6746B04@ANTARESIA.be.devgen.com>

Hi all,
I have noticed that the output table format of infoseq is not
consistent. In the sense that the whitespace field separator is
sometimes two spaces and sometimes a tab followed by a space. This makes
it impossible (at least, if you don't want an extra processing step) to
properly import the infoseq output into a spreadsheet. Is there a way to
force infoseq to use tabs only as field separator ?
Regards,
Marc



From Marc.Logghe at DEVGEN.com  Fri Feb 10 11:39:26 2006
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Fri, 10 Feb 2006 12:39:26 +0100
Subject: [EMBOSS] infoseq table format issues
Message-ID: <0C528E3670D8CE4B8E013F6749231AA6746B07@ANTARESIA.be.devgen.com>

Never mind.
Just found out that in Excel you have the option to define multiple
delimiters AND treat consecutive delimiters as one ...
Guess I don't use spreadsheets regularly enough ;-)
On the other hand, I think it would be 'cleaner' if infoseq would stick
to a single type of delimiter.
Cheers,
Marc

> -----Original Message-----
> From: emboss-bounces at emboss.open-bio.org 
> [mailto:emboss-bounces at emboss.open-bio.org] On Behalf Of Marc Logghe
> Sent: Friday, February 10, 2006 12:07 PM
> To: emboss at emboss.open-bio.org
> Subject: [EMBOSS] infoseq table format issues
> 
> Hi all,
> I have noticed that the output table format of infoseq is not 
> consistent. In the sense that the whitespace field separator 
> is sometimes two spaces and sometimes a tab followed by a 
> space. This makes it impossible (at least, if you don't want 
> an extra processing step) to properly import the infoseq 
> output into a spreadsheet. Is there a way to force infoseq to 
> use tabs only as field separator ?
> Regards,
> Marc
> 
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at emboss.open-bio.org
> http://newportal.open-bio.org/mailman/listinfo/emboss
> 



From pmr at ebi.ac.uk  Fri Feb 10 11:45:41 2006
From: pmr at ebi.ac.uk (Peter Rice)
Date: Fri, 10 Feb 2006 11:45:41 +0000
Subject: [EMBOSS] infoseq table format issues
In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA6746B04@ANTARESIA.be.devgen.com>
References: <0C528E3670D8CE4B8E013F6749231AA6746B04@ANTARESIA.be.devgen.com>
Message-ID: <43EC7CE5.8020101@ebi.ac.uk>

Marc Logghe wrote:

> Hi all,
> I have noticed that the output table format of infoseq is not
> consistent. In the sense that the whitespace field separator is
> sometimes two spaces and sometimes a tab followed by a space. This makes
> it impossible (at least, if you don't want an extra processing step) to
> properly import the infoseq output into a spreadsheet. Is there a way to
> force infoseq to use tabs only as field separator ?

Yes .... but ...

infoseq produces a report or HTML.

Is the HTML useful?

Is the text output useful (and is it better to use spaces as text)

Is tab-delimited output useful (also for other programs)?

Do we need some kind of XML output to replace the HTML?

Meanwhile, I will look at cleaning up the current infoseq

regards,

Peter



From Marc.Logghe at DEVGEN.com  Fri Feb 10 13:18:13 2006
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Fri, 10 Feb 2006 14:18:13 +0100
Subject: [EMBOSS] infoseq table format issues
Message-ID: <0C528E3670D8CE4B8E013F6749231AA6746B0A@ANTARESIA.be.devgen.com>

Hi Peter,

> > step) to properly import the infoseq output into a spreadsheet. Is 
> > there a way to force infoseq to use tabs only as field separator ?
> 
> Yes .... but ...
> 
> infoseq produces a report or HTML.
> 
> Is the HTML useful?

Yes, just found out that you can perfectly import this format into Excel
...

> 
> Is the text output useful (and is it better to use spaces as text)
> 
> Is tab-delimited output useful (also for other programs)?
I think tab delimited is better (compared to spaces as delimiter). That
way you can easily process the table with cut or sort and that kind of
things.

> 
> Do we need some kind of XML output to replace the HTML?
> 
> Meanwhile, I will look at cleaning up the current infoseq

Thanks and regards,
Marc



From fnovo at unav.es  Mon Feb 13 12:29:29 2006
From: fnovo at unav.es (F.J. Novo)
Date: Mon, 13 Feb 2006 13:29:29 +0100
Subject: [EMBOSS] dottup and dotmatcher in 3.0.0
Message-ID: <43F07BA9.6020606@unav.es>

Hi all. There seems to be something wrong  with dottup and dotmatcher in 
3.0.0 (under Fedora Core 4). I consistently get an error:

[fnovo at localhost ~]$ dotmatcher
Displays a thresholded dotplot of two sequences
Input sequence: p53mRNA.seq
Second sequence: p53mRNA.seq
Graph type [x11]: png
Devices allowed are:-
postscript
ps
hpgl
hp7470
hp7580
meta
colourps
cps
tektronics
tekt
tek4107t
tek
none
null
text
data
png
Error: Invalid XY graph value 'x11'
Died: dotmatcher terminated: Bad value for '-xygraph' and no prompt

and the same for dottup.

Needless to say, png is properly installed and works fine with other 
applications (including dotpath and polydot), so it seems something 
specific to these two programs. Has anyone else seen this? Any suggestions?

Thanks,




From maximilianh at gmail.com  Tue Feb 14 10:11:42 2006
From: maximilianh at gmail.com (Maximilian Haeussler)
Date: Tue, 14 Feb 2006 11:11:42 +0100
Subject: [EMBOSS] [BiO BB] Re: [Bioperl-l] Tool to mutate DNA sequence
In-Reply-To: <0B84EE38-0BA5-4E56-B35F-C8CBAA342AC4@duke.edu>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
	<0B84EE38-0BA5-4E56-B35F-C8CBAA342AC4@duke.edu>
Message-ID: <76f031ae0602140211n2a0bbf4fl@mail.gmail.com>

The tool ROSE also evolves sequences on a tree. There is a web
interface and downloadable source at
http://bibiserv.techfak.uni-bielefeld.de/rose/

Max

On 09/02/06, Jason Stajich <jason.stajich at duke.edu> wrote:
> Depending on whether or not you want to use evolutionary realistic
> models...
> * evolver which comes with PAML lets you evolve sequences on a tree
> * SeqGen from Andrew Rambaut http://evolve.zoo.ox.ac.uk/software.html?
> id=seqgen
> also lets you do this
> I believe there are PISE interfaces to both of these at the pasteur
> bioweb site - http://bioweb.pasteur.fr/
>
> -jason
> On Feb 8, 2006, at 11:46 PM, Ryan Golhar wrote:
>
> > Does anyone know of tool to mutate a DNA sequence by a specified
> > amount?
> > For instance, say I have a DNA sequence 1000 bases long, and I want to
> > simulate mutations to make it 75% (or 80%, etc) similar to the
> > original.
> >
> >
> > Ryan
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12
>
>
> _______________________________________________
> Bioinformatics.Org general forum  -  BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>


--
Maximilian Haeussler,
CNRS Gif-sur-Yvette, Paris
tel: +33 6 12 82 76 16
icq: 3825815  -- msn: maximilian.haeussler at hpi.uni-potsdam.de
skype: maximilianhaeussler



From scott at cs.wits.ac.za  Wed Feb 15 18:41:02 2006
From: scott at cs.wits.ac.za (Scott Hazelhurst)
Date: Wed, 15 Feb 2006 20:41:02 +0200 (SAST)
Subject: [EMBOSS] Emma options
Message-ID: <20060215184102.6176F40F54B@midi.cs.wits.ac.za>


Dear all,

I am not sure if this is a question for this list or the wemboss forum
-- but their site seems down so I'll ask it here.

I have users who want to specify their own penalty matrices. For
example, for nucleotide sequences the options are clustalw, iub or
own. However, if you pick "own" nothing changes: the option to 
specify your own file doesn't appear. I had a look at the acd file --
not that I properly understand it, and it seems 


I had a look at the acd file -- not that I understand acd syntax
properly so it's a like my trying to fix a broken Jumbo engine.
This seems to be the relevant 

    list: dnamatrix  [
      additional: "@(!$(acdprotein))"
      default: "i"
      minimum: "1"
      maximum: "1"
      header: "Nucleotide multiple alignment matrix options"
      values: "i:iub, c:clustalw, o:own"
      delimiter: ","
      codedelimiter: ":"
      information: "Select matrix"
      button: "Y"
      help: "This gives a menu where you are offered amenu where a
             single matrix (not a series) can be selected."
    ]

    variable: umamatrix "@($(dnamatrix) == own)"

    infile: mamatrix  [
      additional: "@($(usermamatrix)?True:$(umamatrix))"
      default: ""
      nullok: "@($(usermamatrix)?@(!$(umamatrix)):True)"
      information: "Filename of user multiple alignment matrix"
      knowntype: "comparison matrix"
    ]

I  changed the "additional" field in mamatrix to be

      additional: "@($(umamatrix))"

and it seems to work in that the file input box now appears when the
"own" option is seleced.



As an aside, does anyone know the format of what the matrix file
should look like. I did some web searching and looked at the clustalw
source code but it's not so easy to re-engineer..

Can anyone help with either of these queries.

Thanks 

Scott





From gbottu at ben.vub.ac.be  Fri Feb 17 11:27:11 2006
From: gbottu at ben.vub.ac.be (Guy Bottu)
Date: Fri, 17 Feb 2006 12:27:11 +0100
Subject: [EMBOSS] Emma options - Checked by AntiVir DEMO version -
In-Reply-To: <20060215184102.6176F40F54B@midi.cs.wits.ac.za>
References: <20060215184102.6176F40F54B@midi.cs.wits.ac.za>
Message-ID: <20060217112711.GA23686@bigben.ulb.ac.be>

On Wed, Feb 15, 2006 at 08:41:02PM +0200, Scott Hazelhurst wrote:
> As an aside, does anyone know the format of what the matrix file
> should look like. I did some web searching and looked at the clustalw
> source code but it's not so easy to re-engineer..

In case you did not already found it by yourself, here's the answer 
(copied from a user manaul I composed some time ago) :

-------------------------------------------------------------
Data files

   clustal uses symbol comparison matrices for scoring bases or amino acids.
   CLUSTAL has built-in symbol comparison matrices, but allows you to provide
   your own matrix. For proteins, but not for nucleic acids, you can give a
   series of matrices as input. You can choose different matrices for pairwise
   alignment and for multiple alignment.

  Single matrix input file

   The format used for a single matrix is the same as that used by the BLAST
   program. The scores in the new weight matrix should be similarities. You can
   use negative as well as positive values if you wish, although for proteins
   the matrix will be automatically adjusted to all positive scores, unless the
   -norescale option is selected. Any lines beginning with a # character are
   assumed to be comments. The first non-comment line should contain a list of
   bases or amino acids in any order, using the 1 letter code, followed by a *
   character. This should be followed by a square matrix of scores, with one
   row and one column for each base or amino acid. The last row and column of
   the matrix (corresponding to the * character) contain the minimum score over
   the whole matrix.

#  Matrix made by matblas from blosum62.iij
#  * column uses minimum score
#  BLOSUM Clustered Scoring Matrix in 1/2 Bit Units
#  Blocks Database = /data/blocks_5.0/blocks.dat
#  Cluster Percentage: >= 62
#  Entropy =   0.6979, Expected =  -0.5209
   A  R  N  D  C  Q  E  G  H  I  L  K  M  F  P  S  T  W  Y  V  B  Z  X  *
A  4 -1 -2 -2  0 -1 -1  0 -2 -1 -1 -1 -1 -2 -1  1  0 -3 -2  0 -2 -1  0 -4
R -1  5  0 -2 -3  1  0 -2  0 -3 -2  2 -1 -3 -2 -1 -1 -3 -2 -3 -1  0 -1 -4
N -2  0  6  1 -3  0  0  0  1 -3 -3  0 -2 -3 -2  1  0 -4 -2 -3  3  0 -1 -4
D -2 -2  1  6 -3  0  2 -1 -1 -3 -4 -1 -3 -3 -1  0 -1 -4 -3 -3  4  1 -1 -4
C  0 -3 -3 -3  9 -3 -4 -3 -3 -1 -1 -3 -1 -2 -3 -1 -1 -2 -2 -1 -3 -3 -2 -4
Q -1  1  0  0 -3  5  2 -2  0 -3 -2  1  0 -3 -1  0 -1 -2 -1 -2  0  3 -1 -4
E -1  0  0  2 -4  2  5 -2  0 -3 -3  1 -2 -3 -1  0 -1 -3 -2 -2  1  4 -1 -4
G  0 -2  0 -1 -3 -2 -2  6 -2 -4 -4 -2 -3 -3 -2  0 -2 -2 -3 -3 -1 -2 -1 -4
H -2  0  1 -1 -3  0  0 -2  8 -3 -3 -1 -2 -1 -2 -1 -2 -2  2 -3  0  0 -1 -4
I -1 -3 -3 -3 -1 -3 -3 -4 -3  4  2 -3  1  0 -3 -2 -1 -3 -1  3 -3 -3 -1 -4
L -1 -2 -3 -4 -1 -2 -3 -4 -3  2  4 -2  2  0 -3 -2 -1 -2 -1  1 -4 -3 -1 -4
K -1  2  0 -1 -3  1  1 -2 -1 -3 -2  5 -1 -3 -1  0 -1 -3 -2 -2  0  1 -1 -4
M -1 -1 -2 -3 -1  0 -2 -3 -2  1  2 -1  5  0 -2 -1 -1 -1 -1  1 -3 -1 -1 -4
F -2 -3 -3 -3 -2 -3 -3 -3 -1  0  0 -3  0  6 -4 -2 -2  1  3 -1 -3 -3 -1 -4
P -1 -2 -2 -1 -3 -1 -1 -2 -2 -3 -3 -1 -2 -4  7 -1 -1 -4 -3 -2 -2 -1 -2 -4
S  1 -1  1  0 -1  0  0  0 -1 -2 -2  0 -1 -2 -1  4  1 -3 -2 -2  0  0  0 -4
T  0 -1  0 -1 -1 -1 -1 -2 -2 -1 -1 -1 -1 -2 -1  1  5 -2 -2  0 -1 -1  0 -4
W -3 -3 -4 -4 -2 -2 -3 -2 -2 -3 -2 -3 -1  1 -4 -3 -2 11  2 -3 -4 -3 -2 -4
Y -2 -2 -2 -3 -2 -1 -2 -3  2 -1 -1 -2 -1  3 -3 -2 -2  2  7 -1 -3 -2 -1 -4
V  0 -3 -3 -3 -1 -2 -2 -3 -3  3  1 -2  1 -1 -2 -2  0 -3 -1  4 -3 -2 -1 -4
B -2 -1  3  4 -3  0  1 -1  0 -3 -4  0 -3 -3 -2  0 -1 -4 -3 -3  4  1 -1 -4
Z -1  0  0  1 -3  3  4 -2  0 -3 -3  1 -1 -3 -1  0 -1 -3 -2 -2  1  4 -1 -4
X  0 -1 -1 -1 -2 -1 -1 -1 -1 -1 -1 -1 -1 -1 -2  0  0 -2 -1 -1 -1 -1 -1 -4
* -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4  1

  Matrix series input format

   For proteins, CLUSTAL uses by default different matrices depending on the
   mean percent identity of the sequences to be aligned. For proteins, but not
   for nucleic acids, you can specify yourself a series of matrices and the
   range of the percent identity for each matrix in a matrix series file. The
   file is automatically recognised by the word CLUSTAL_SERIES at the beginning
   of the file. Each matrix in the series is then specified on one line which
   should start with the word MATRIX. This is followed by the lower and upper
   limits of the sequence percent identities for which you want to apply the
   matrix. The final entry on the matrix line is the filename of a BLAST format
   matrix file (see above for details of the single matrix file format).

CLUSTAL_SERIES

MATRIX 81 100 blosum80
MATRIX 61  80 blosum62
MATRIX 31  60 blosum45
MATRIX  0  30 blosum30

----------------------------------------------------------------------

	Regards,
	Guy Bottu,
	Belgian EMBnet Node



From biopyte at yahoo.de  Sat Feb 18 01:03:19 2006
From: biopyte at yahoo.de (Hans Meier)
Date: Sat, 18 Feb 2006 02:03:19 +0100 (CET)
Subject: [EMBOSS] 'octanol' - output to stdout not possible?
Message-ID: <20060218010319.77871.qmail@web26314.mail.ukl.yahoo.com>

Dear friends,
 
 with the general qualifiers "-filter" and "-stdout"
 I tried to make 'octanol -graph png' write to stdout 
 and not to a file (for certain reasons).
 Anyway, a file is written and I can't catch the output 
 directly from stdout.
 
 Is there a solution for this problem or
 is writing a file hardcoded?
 
 Regards, Harald
 
 
		
---------------------------------
Telefonieren Sie ohne weitere Kosten mit Ihren Freunden von PC zu PC!
Jetzt Yahoo! Messenger installieren!


From dstates at bioinformatics.med.umich.edu  Fri Feb 17 21:00:19 2006
From: dstates at bioinformatics.med.umich.edu (David States)
Date: Fri, 17 Feb 2006 16:00:19 -0500
Subject: [EMBOSS] Building EMBOSS in cygwin - undefined reference to _c_pl...
Message-ID: <46949FAC535B4245B58BB9A1262F5EC40824@mail.bicc.med.umich.edu>

I am trying to build EMBOSS-3.0.0 under cygwin (recent install) and follow the directions in http://emboss.sourceforge.net/download/cygwin.html, but when I get to ./libs/ajgraph.o, the build fails with a large number of error messages of the form

.libs/ajgraph.o:ajgraph.c:(.text+0xc4): undefined reference to `_c_plxsfnam'
.libs/ajgraph.o:ajgraph.c:(.text+0x15d): undefined reference to `_c_pladv'
.libs/ajgraph.o:ajgraph.c:(.text+0x195): undefined reference to `_c_plssub'
...

Any suggestions?

David

David J. States, M.D., Ph.D.
Professor of Human Genetics
University of Michigan School of Medicine?
Palmer Commons,??2035B
100 Washtenaw Rd.
Ann Arbor, MI 48109 USA
email: dstates at umich.edu
tel: (734) 615-5510
fax: (734) 615-6553
URL: http://stateslab.bioinformatics.med.umich.edu





From maximilianh at gmail.com  Sun Feb 19 13:52:37 2006
From: maximilianh at gmail.com (Maximilian Haeussler)
Date: Sun, 19 Feb 2006 14:52:37 +0100
Subject: [EMBOSS] [BiO BB] Tool to mutate DNA sequence
In-Reply-To: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
Message-ID: <76f031ae0602190552v5f2542dbv@mail.gmail.com>

Hi bio-mailinglists,

does anyone here know of a tool or a library to display two (or more)
sequences at the same time with coloured features? Possibly with lines,
connecting some features from one sequence to the other (synteny-plot) ?
Or to display two multiple alignments, one on top of each other, with
colored features added?

It's not that it would be difficult to write, but programming visualisation
usually takes a lot of time.
Bio::Graphics seems mainly concerned with one main sequence and features on
it. Well, I could copy together two of these gif-images, but then there
would be no connecting lines. Same applies for the graphics in Biojava or
the gff2ps tool or all the multiple alignment viewers that I know (Bioedit,
ClustalX). There is something called Toucan in Java, which displays at least
several lines of gff-style-features, but no visible sequences and more
importantly, no connecting lines. A recent software, Djinn lite, is using a
similar kind of visualization to compare different spliced genes from
various species, but it's mainly aimed at splicing and written in Visual
Basic.
I guess a good compromise might be the 3D viewer Sockeye, but I haven't seen
any synteny-lines in sockeye yet.

I guess I must have missed something here. I cannot be the first one that
would like to compare, say, two gff files, or two multiple alignments?

Thanks a lot for any idea,
Max



From gbottu at ben.vub.ac.be  Mon Feb 20 08:04:11 2006
From: gbottu at ben.vub.ac.be (Guy Bottu)
Date: Mon, 20 Feb 2006 09:04:11 +0100
Subject: [EMBOSS] [BiO BB] Tool to mutate DNA sequence - Checked by
	AntiVir
In-Reply-To: <76f031ae0602190552v5f2542dbv@mail.gmail.com>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
	<76f031ae0602190552v5f2542dbv@mail.gmail.com>
Message-ID: <20060220080411.GB26540@bigben.ulb.ac.be>

On Sun, Feb 19, 2006 at 02:52:37PM +0100, Maximilian Haeussler wrote:
> does anyone here know of a tool or a library to display two (or more)
> sequences at the same time with coloured features? Possibly with lines,
> connecting some features from one sequence to the other (synteny-plot) ?
> Or to display two multiple alignments, one on top of each other, with
> colored features added?

Well, there is Alfresco
http://www.sanger.ac.uk/Software/Alfresco/

	Guy Bottu,
	Belgian EMBnet Node



From pmr at ebi.ac.uk  Mon Feb 20 08:19:07 2006
From: pmr at ebi.ac.uk (pmr at ebi.ac.uk)
Date: Mon, 20 Feb 2006 08:19:07 -0000 (GMT)
Subject: [EMBOSS] 'octanol' - output to stdout not possible?
In-Reply-To: <20060218010319.77871.qmail@web26314.mail.ukl.yahoo.com>
References: <20060218010319.77871.qmail@web26314.mail.ukl.yahoo.com>
Message-ID: <1256.86.137.129.90.1140423547.squirrel@webmail.ebi.ac.uk>

Dear Harald,

>  with the general qualifiers "-filter" and "-stdout"
>  I tried to make 'octanol -graph png' write to stdout
>  and not to a file (for certain reasons).
>  Anyway, a file is written and I can't catch the output
>  directly from stdout.

For graphs output must go to a file because many programs will write more
than one PNG file.

>  Is there a solution for this problem or
>  is writing a file hardcoded?

Unfortunately the -goutfile stdout option will not work - the graphics
library writes the message "Created octanol.1.png" to stdout.

But for octanol there is a single image file produces, so you can use the
command line option:

 -goutfile x.png

and than cat x.png to stdout.

For programs that write more than one PNG file (prettyplot for example)
you will get x.png.1.png x.png.2.png and so on. I do not see an easy way
around this for PNG files.

Hope that helps,

Peter



From shameer at ncbs.res.in  Mon Feb 20 06:21:01 2006
From: shameer at ncbs.res.in (Shameer Khadar)
Date: Mon, 20 Feb 2006 11:51:01 +0530 (IST)
Subject: [EMBOSS] Matrix Average Code / Module ?
In-Reply-To: <76f031ae0602190552v5f2542dbv@mail.gmail.com>
References: <003b01c62d33$d37d15d0$e6028a0a@GOLHARMOBILE1>
	<76f031ae0602190552v5f2542dbv@mail.gmail.com>
Message-ID: <59825.192.168.1.176.1140416461.squirrel@192.168.1.176>

Hi all,
Is there any program/module to calculate the average of a blosum/pam any
matrix ?

I have a matrix and I need to see the average

for example

11 22 43 54 50
27 87 74 32 10
66 58 98 78 20
22 23 44 16 34

I have gone through Bio::Matrix::MatrixI and Bio::Matrix::GenericMatrix
and other perl modules like Math::Matrix
http://search.cpan.org/~ulpfr/Math-Matrix-0.4/Matrix.pm
and Math::Cephes::Matrix - but none of them have a provison to do matrix 
average calculation.

Any help ???
thanks in advance,
Happy biocomputing !!!


-- 
Shameer Khadar
National Centre for Biological Sciences (TIFR)
UAS - GKVK Campus - Bellary Road Bangalore - 65 - Karnataka - India
T - 91-080-23636420-32 EXT 4241
F - 91-080-23636662/23636675
W - http://www.ncbs.res.in
--------------------------------------------------
"Refrain from illusions, insist on work and not words,
 patiently seek divine and scientific truth."
MM




From d.gatherer at vir.gla.ac.uk  Wed Feb 22 12:03:11 2006
From: d.gatherer at vir.gla.ac.uk (Derek Gatherer)
Date: Wed, 22 Feb 2006 12:03:11 +0000
Subject: [EMBOSS] showseq and overlapping ORFs
Message-ID: <6.2.3.4.1.20060222114454.02b36000@lenzie.gla.ac.uk>

Hi EMBOSSers

I'm using showseq as follows:

[gath01d at gamma ebv]$ showseq hhv8.fa -format 4 -trans 
105-944,1112-2764,3179-6577,6594-8681,8665-11202,11329-14367,14485-15741,15756-16979,28774-29154,30242-30769 
-out test.showseq -auto

    EMBOSS An error in showseq.c at line 198:
Translation ranges are not in ascending, non-overlapping order.

As can be seen, the failure originates with the subsequence 6594-8681 
slightly overlapping with the next one 8665-11202.

Is there a way round this on the command line or would it require a 
code tweak?  It would be good if there was, since often in viral 
genomes (this is HHV8, as it happens) ORFs are not cleanly "in 
ascending, non-overlapping order" as the program would seem to require.

A related question: all the above are top-strand ORFs, but further 
down there are a few complementary strand ones.  What combination of 
parameters would I use to indicate that I want some translated on the 
top and some on the bottom?  I could of course use format -6 and get 
all six frames, but that is a bit messy for the output I want.  I was 
thinking that maybe it would need to be something like:

showseq hhv8.fa -things B,N,T,S,B,1,A,F -trans 
105-944,1112-2764,3179-6577,6594-8681,8665-11202,11329-14367  -things 
B,N,T,S,B,-1,A,F -trans 
14485-15741,15756-16979,28774-29154,30242-30769 -out test.showseq -auto

ie, using things to specify that for some ORFs I want the translation 
on -1 instead of 1, but the above command just outputs DNA sequence 
with no translation.

Any ideas gratefully appreciated

Derek



From d.gatherer at vir.gla.ac.uk  Wed Feb 22 15:19:58 2006
From: d.gatherer at vir.gla.ac.uk (Derek Gatherer)
Date: Wed, 22 Feb 2006 15:19:58 +0000
Subject: [EMBOSS] showseq and overlapping ORFs
In-Reply-To: <6.2.3.4.1.20060222114454.02b36000@lenzie.gla.ac.uk>
References: <6.2.3.4.1.20060222114454.02b36000@lenzie.gla.ac.uk>
Message-ID: <6.2.3.4.1.20060222151212.02bb2328@lenzie.gla.ac.uk>

Hello again

I wonder if showseq is bugged.  Look at the following:

[gath01d at gamma ebv]$ showseq hhv8.fa -format 0 -trans 100-200 -out test.showseq
Display a sequence with features, translation etc..
Specify your own things to display
          S : Sequence
          B : Blank line
          1 : Frame1 translation
          2 : Frame2 translation
          3 : Frame3 translation
         -1 : CompFrame1 translation
         -2 : CompFrame2 translation
         -3 : CompFrame3 translation
          T : Ticks line
          N : Number ticks line
          C : Complement sequence
          F : Features
          R : Restriction enzyme cut sites in forward sense
         -R : Restriction enzyme cut sites in reverse sense
          A : Annotation
Enter a list of things to display [B,N,T,S,A,F]: b,s,1

Choosing b,s,1 here gives:


AF148805.2
Human herpesvirus 8 isolate GK18, complete genome

           TACTAATTTTGAAAGGCGGGGTTCTGCCAGGCATAGTCTTTTTTTGTGGCGGCCCTTGTG


           TAAACCTGTCTTTCAGACCTTGTTGGACATCCCGTACAATCAAGATGTTCCTGTATGTTG
                                                  S  R  C  S  C  M  L

           TTTGCAGTCTGGCGGTTTGCTTTCGAGGACTATTAAGCCTTTCTCTGCAATCGTCTCCAA
           F  A  V  W  R  F  A  F  E  D  Y  *  A  F  L  C  N  R  L  Q

           ATCTCTGCCCTGGAGTGATTTCAACGCCTTACACGTTGACCTGTCCGTCTAATACATCCT
           I  S  A  L  E  *  X

           TGCCAACATCCTGGTATTGCAACGATACTCGGCTTTTACGAGTGACGCAGGGAACATTGA


ie. a nice frame 1 translation in the frame requested.

but if I choose b,s,-1, I get:

AF148805.2
Human herpesvirus 8 isolate GK18, complete genome

           TACTAATTTTGAAAGGCGGGGTTCTGCCAGGCATAGTCTTTTTTTGTGGCGGCCCTTGTG
             V  L  K  S  L  R  P  E  A  L  C  L  R  K  K  H  R  G  K  H

           TAAACCTGTCTTTCAGACCTTGTTGGACATCCCGTACAATCAAGATGTTCCTGTATGTTG
             L  G  T  K  *  V  K  N  S  M  G  Y  L  *  S  T  G  T  H  Q

           TTTGCAGTCTGGCGGTTTGCTTTCGAGGACTATTAAGCCTTTCTCTGCAATCGTCTCCAA
             K  C  D  P  P  K  S  E  L  V  I  L  G  K  E  A  I  T  E  L

           ATCTCTGCCCTGGAGTGATTTCAACGCCTTACACGTTGACCTGTCCGTCTAATACATCCT
             D  R  G  Q  L  S  K  L  A  K  C  T  S  R  D  T  *  Y  M  R

           TGCCAACATCCTGGTATTGCAACGATACTCGGCTTTTACGAGTGACGCAGGGAACATTGA
             A  L  M  R  T  N  C  R  Y  E  A  K  V  L  S  A  P  F  M  S

ie the frame -1 translation over the whole thing.

So is -trans only really supposed to work with frame 1?? or is this a 
bug?  I notice that transeq has in its "known bugs":

"When using the '-regions' option, you should always leave the 
'-frames' option at the default of frame '1'."

Has this been carried over into showseq?


Cheers
Derek



From golharam at umdnj.edu  Thu Feb 23 20:25:39 2006
From: golharam at umdnj.edu (Ryan Golhar)
Date: Thu, 23 Feb 2006 15:25:39 -0500
Subject: [EMBOSS] MEME for EMBOSS
Message-ID: <001901c638b7$4f8625c0$e6028a0a@GOLHARMOBILE1>

I downloaded and installed MEME for EMBOSS.  When I run 'tfm' and enter
meme I get the output.  The description and algorithm information is
missing....



Function

   Motif detection

Description

   **************** EDIT HERE ****************

Algorithm

   **************** EDIT HERE ****************

Usage

   Here is a sample session with meme



--
Ryan Golhar  -  golharam at umdnj.edu
The Informatics Institute of UMDNJ



From ajb at ebi.ac.uk  Thu Feb 23 21:32:16 2006
From: ajb at ebi.ac.uk (ajb at ebi.ac.uk)
Date: Thu, 23 Feb 2006 21:32:16 -0000 (GMT)
Subject: [EMBOSS] MEME for EMBOSS
In-Reply-To: <001901c638b7$4f8625c0$e6028a0a@GOLHARMOBILE1>
References: <001901c638b7$4f8625c0$e6028a0a@GOLHARMOBILE1>
Message-ID: <55463.81.96.70.96.1140730336.squirrel@webmail.ebi.ac.uk>

Hello Ryan,

Yes, it is rather sparse. We hope to update meme to version 3.5.1 in the
near future.
However, the authors supply no documentation with their releases other
than that gleaned from using the -help flag. The meme homepage gives
similarly sparse information, although you can download a 1994 paper
as a PDF. See http://meme.sdsc.edu/meme/papers.html

In the meantime,   meme -help   will give some information.

We will try to write more material for tfm in the next release. Thanks
for reminding us.

Alan




From Ahmad.N.Abou.Tayoun at Dartmouth.EDU  Sat Feb 25 02:50:28 2006
From: Ahmad.N.Abou.Tayoun at Dartmouth.EDU (Ahmad N. Abou Tayoun)
Date: 24 Feb 2006 21:50:28 EST
Subject: [EMBOSS] Accessing Applications
Message-ID: <51444772@comet.Dartmouth.EDU>

Hello,

I am a graduate student at Dartmouth Medical School.  I was trying to use some of EMBOSS applications but it always gave me the error shown below.  Can you please help me figure that out ?


An error has been encountered in accessing this page. 

1. Server: emboss.sourceforge.net
2. URL path: /apps/groups/diffseq.html
3. Error notes: File does not exist: /home/groups/e/em/emboss/htdocs/apps/groups/diffseq.html
4. Error type: 404
5. Request method: GET
6. Request query string: 
7. Time: 2006-02-24 18:48:16 PST (1140835696)



Thank you alot,
username: Ahmadtayoun

Ahmad



From pmr at ebi.ac.uk  Tue Feb 28 09:44:12 2006
From: pmr at ebi.ac.uk (Peter Rice)
Date: Tue, 28 Feb 2006 09:44:12 +0000
Subject: [EMBOSS] Accessing Applications
In-Reply-To: <51444772@comet.Dartmouth.EDU>
References: <51444772@comet.Dartmouth.EDU>
Message-ID: <44041B6C.6030600@ebi.ac.uk>

Ahmad N. Abou Tayoun wrote:

> Hello,
> 
> I am a graduate student at Dartmouth Medical School.  I was trying to use some of EMBOSS applications but it always gave me the error shown below.  Can you please help me figure that out ?
> 
> 
> An error has been encountered in accessing this page. 
> 
> 1. Server: emboss.sourceforge.net
> 2. URL path: /apps/groups/diffseq.html
> 3. Error notes: File does not exist: /home/groups/e/em/emboss/htdocs/apps/groups/diffseq.html

Oops ... we are making changes to the documentation on the website. We appear 
to have broken some links.

What we are doing is to make separate documentation for the latest release 
and for the current development code. This has broken the links if you go via 
the application groups pages.

You will still be able to use your local EMBOSS installation (which includes 
full documentation on the programs).

 From your message it could be you are looking for a site where you can run 
EMBOSS through a web interface ... if so, there are many to choose from. We do 
not advertise any in particular, but perhaps we should.

Meanwhile, we will fix the broken links.

Hope that helps,

Peter




From Marc.Logghe at DEVGEN.com  Tue Feb 28 09:56:12 2006
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Tue, 28 Feb 2006 10:56:12 +0100
Subject: [EMBOSS] Accessing Applications
Message-ID: <0C528E3670D8CE4B8E013F6749231AA6746B65@ANTARESIA.be.devgen.com>

Hi Ahmad,

> Hello,
> 
> I am a graduate student at Dartmouth Medical School.  I was 
> trying to use some of EMBOSS applications but it always gave 
> me the error shown below.  Can you please help me figure that out ?

I have noticed some changes at the EMBOSS web site as well. The docs for
the individual applications can be found at this url:
http://emboss.sourceforge.net/apps/cvs/index.html
A direct link to the docs of diffseq is
http://emboss.sourceforge.net/apps/cvs/diffseq.html.

Beware that at the sourceforge web site you can not actually run the
applications !
You have to install it yourself and run applications at the command line
or check out some sites that publish an EMBOSS web interface.
I wanted to point you to some wEMBOSS implementations at various EMBL
nodes but ... in order to use that you need to register, unfortunately.
I don't know their policies  (http://bigben.vub.ac.be:6080/wEMBOSS,
https://emb1.bcc.univie.ac.at/component/option,com_wrapper/Itemid,104/).
Anyhow, the EMBL policies seem to differ from those used by the NCBI or
EBI for instance, cos there everybody can make use of the tools. Even if
you don't pay taxes ;-) 
HTH,
Marc 



From pmr at ebi.ac.uk  Tue Feb 28 11:06:25 2006
From: pmr at ebi.ac.uk (Peter Rice)
Date: Tue, 28 Feb 2006 11:06:25 +0000
Subject: [EMBOSS] Accessing Applications
In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA6746B65@ANTARESIA.be.devgen.com>
References: <0C528E3670D8CE4B8E013F6749231AA6746B65@ANTARESIA.be.devgen.com>
Message-ID: <44042EB1.8000204@ebi.ac.uk>

Marc Logghe wrote:

> I have noticed some changes at the EMBOSS web site as well. The docs for
> the individual applications can be found at this url:
> http://emboss.sourceforge.net/apps/cvs/index.html
> A direct link to the docs of diffseq is
> http://emboss.sourceforge.net/apps/cvs/diffseq.html.

These URLs will change as we update the website (we will change the apps/cvs 
part). A new path will appear for the docs for release 3.0.0. Thsi wil be the 
first time we have documented the latest release on the website - although few 
users noticed we were always documenting the latest CVS developers release :-)

EMBOSS does include full documentation for all programs which is installed 
into the share/EMBOSS/doc/programs/html/ directory. This will change in 
release 4.0.0 (July 2006). In release 3.0.0 the EMBASSY packages are still 
documented in the same directory as the EMBOSS main programs.

> I wanted to point you to some wEMBOSS implementations at various EMBL
> nodes but ... in order to use that you need to register, unfortunately.
> I don't know their policies  (http://bigben.vub.ac.be:6080/wEMBOSS,
> https://emb1.bcc.univie.ac.at/component/option,com_wrapper/Itemid,104/).
> Anyhow, the EMBL policies seem to differ from those used by the NCBI or
> EBI for instance, cos there everybody can make use of the tools. Even if
> you don't pay taxes ;-) 

I think you mean "EMBnet" ... I have to be picky as EBI is part of EMBL 
(European Molecular Biology Laboratory in Heidelberg, Germany) ... and also a 
member of EMBnet :-) National EMBnet servers provide access to their 
registered scientists, - that is what they are funded for - and may also allow 
access to those outside. If you are in the UK, you no longer have a national 
EMBnet server as that was the HGMP/RFCGR where EMBOSS was developed until it 
closed in July 2005. The Austrian server machine (univie.ac.at) is about to 
move so may be down for a while.

EBI does provide access to EMBOSS, but not a simple web interface to all the 
programs by name. You can also use many of EMBOSS programs through the EBI 
"Toolbox", but not diffseq which was the that started this thread. EBI also 
provides simple web service access through WSEmboss frok our External Services 
Group http://www.ebi.ac.uk/Tools/webservices/WSEmboss.html and fully featured 
web wervice access through SoapLab http://www.ebi.ac.uk/soaplab/ developed by 
Martin Senger in my group as part of the myGrid project (and now part of the 
EMBRACE project).

I still plan to survey all the EMBOSS interfaces in the near future ... once 
funding is sorted out ...

Hope that helps,

Peter