From thiago.venancio at gmail.com Thu Sep 1 10:02:44 2005 From: thiago.venancio at gmail.com (Thiago Venancio) Date: Thu, 1 Sep 2005 11:02:44 -0300 Subject: [EMBOSS] Codon usage comparisons Message-ID: <44255ea8050901070221c93204@mail.gmail.com> Hi all. I have a couple questions about the codon usage comparisons in the EMBOSS. I have read some papers that use Factorial Correspondence Analysis to compensate for aminoacid composition. The EMBOSS tools compensate it by some other way or what we get could be a biased result? Regards. Thiago From pmr at ebi.ac.uk Thu Sep 1 10:55:49 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 1 Sep 2005 15:55:49 +0100 (BST) Subject: [EMBOSS] EMBL database IDs will disappear Message-ID: <1694.81.76.189.68.1125586549.squirrel@webmail.ebi.ac.uk> Next year (release 87) the EMBL database plans to have a new ID line - with no ID on it... See June 2006 changes in http://www.ebi.ac.uk/embl/Documentation/forthcomingchanges.html The primary accession number will be the only unique ID. The ID line will also have the sequence version, so the SV line will disappear (but there will still be a sequence version we can construct) Should EMBOSS still index ID (using the accession number)? Should we continue to use the ID from other databases that still do have ID and accession? There will be a file with the old IDs and the accession numbers they relate to - should be use this to keep IDs in the index files? Peter From pmr at ebi.ac.uk Fri Sep 2 10:58:25 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 02 Sep 2005 15:58:25 +0100 Subject: [EMBOSS] output of program "digest" as input for program "pepstats" ? In-Reply-To: <20050825121843.GA5549@bigben.ulb.ac.be> References: <430CD6F3.30306@gmx.de> <20050825121843.GA5549@bigben.ulb.ac.be> Message-ID: <43186891.3010807@ebi.ac.uk> Guy Bottu wrote: > Dear Ulrike, > > You can ask digest for a "Report Format" of type "List File", which you > can give as input to pepstats or iep (the peptides will be analyzed as > individual sequences and the results given the one aftert the other, they > are not merged). > > I have no experience with Taverna and hence cannot tell you exactly how > to. I know that at the command line you would have to : > digest mysequence -rformat=listfile -outfile=myreport > iep list::myreport In taverna, using the EBI SoapLab services to run EMBOSS you will not be able to use the -rformat qualifier - that will be added in a future release of SoapLab later this year. The current SoapLab has the EMBOSS qualifiers, but is missing some "associated qualifiers" including -rformat for reports and -aformat fopr alignments. If you have your own soaplab server running, one solution that has been tried is to change the rformat value in the digest.acd file to "listfile" - digest will then always produce the listfile version of the output. Hope that helps Peter From wjhaynes at wisc.edu Sun Sep 4 21:07:23 2005 From: wjhaynes at wisc.edu (W John Haynes) Date: Sun, 04 Sep 2005 20:07:23 -0500 Subject: [EMBOSS] installing zlib, libpng and gd Message-ID: <12aaf33b96daa981f2d097bed37cf40b@wisc.edu> To Whom it may concern: I am going through the process of installing and compiling the EMBOSS package for the first time. I have a G5 running OS.X.3.4 but I would say I am still a novice (this is an offline home computer). I have installed and used the BLAST package from NCBI and the Phyllip package but overall, I would say that I am still unfamiliar with installing and compiling programs. I do not yet have much experience. I have down-loaded the tar.gz files from the EMBOSS ftp site. As I was reading the Admin manual on installation there is a requirement to download and install three more tar.gz files called z, png and gd libraries. What will these actually do for the program and will this cause any conflicts with other programs previously installed? For instance I had previously installed the Phyllip package of programs, what will happen if I install the set included in the EMBOSS package? If I do not move the Phyllip package into the EMBOSS folder and expand it, will the EMBOSS install correctly? Does the installation of these libraries cause any other problems any other programs? Thanks for the help W. John Haynes From kvddrift at earthlink.net Mon Sep 5 07:02:28 2005 From: kvddrift at earthlink.net (Koen van der Drift) Date: Mon, 5 Sep 2005 07:02:28 -0400 Subject: [EMBOSS] installing zlib, libpng and gd In-Reply-To: <12aaf33b96daa981f2d097bed37cf40b@wisc.edu> References: <12aaf33b96daa981f2d097bed37cf40b@wisc.edu> Message-ID: Hi John, You may want to check out the fink project (http://fink.sf.net). It's a package manager to help with installing unix software on your Mac. If you use it to install emboss, it will automatically install all other packages that are needed (such as libpng and gd). The zlib package already comes with Mac OS X, I guess the admin guide was written for an older Mac OS X version. cheers, - Koen. On Sep 4, 2005, at 9:07 PM, W John Haynes wrote: > To Whom it may concern: > > I am going through the process of installing and compiling the EMBOSS > package for the first time. I have a G5 running OS.X.3.4 but I would > say I am still a novice (this is an offline home computer). I have > installed and used the BLAST package from NCBI and the Phyllip package > but overall, I would say that I am still unfamiliar with installing > and > compiling programs. I do not yet have much experience. I have > down-loaded the tar.gz files from the EMBOSS ftp site. As I was > reading the Admin manual on installation there is a requirement to > download and install three more tar.gz files called z, png and gd > libraries. What will these actually do for the program and will this > cause any conflicts with other programs previously installed? > For instance I had previously installed the Phyllip package of > programs, what will happen if I install the set included in the EMBOSS > package? If I do not move the Phyllip package into the EMBOSS folder > and expand it, will the EMBOSS install correctly? Does the > installation of these libraries cause any other problems any other > programs? > > Thanks for the help > W. John Haynes > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From jison at ebi.ac.uk Tue Sep 6 06:11:15 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Tue, 6 Sep 2005 11:11:15 +0100 (BST) Subject: [EMBOSS] installing zlib, libpng and gd In-Reply-To: <12aaf33b96daa981f2d097bed37cf40b@wisc.edu> References: <12aaf33b96daa981f2d097bed37cf40b@wisc.edu> Message-ID: <38013.172.31.8.12.1126001475.squirrel@webmail.ebi.ac.uk> Hi John > download and install three more tar.gz files called z, png and gd > libraries. What will these actually do for the program PNG (http://www.libpng.org/pub/png/) is an image file format. libpng is used in application programs to support the PNG file format. libpng uses zlib (http://www.zlib.net/) for compression of & decompression of PNG files. GD (http://www.boutell.com/gd/) is for the dynamic creation of images (e.g. in PNG, JPEG, GIF formats). > and will this > cause any conflicts with other programs previously installed? No, unless a program only works with an old version of the above (unlikely). > For instance I had previously installed the Phyllip package of > programs, what will happen if I install the set included in the EMBOSS > package? There shouldn't be any conflicts and you should be able to use either version. > If I do not move the Phyllip package into the EMBOSS folder > and expand it, will the EMBOSS install correctly? Yes. > Does the installation of these libraries cause any other problems > any other programs? see above Cheers Jon From jison at ebi.ac.uk Tue Sep 6 06:52:56 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Tue, 6 Sep 2005 11:52:56 +0100 (BST) Subject: [EMBOSS] Codon usage comparisons In-Reply-To: <44255ea8050901070221c93204@mail.gmail.com> References: <44255ea8050901070221c93204@mail.gmail.com> Message-ID: <38051.172.31.8.12.1126003976.squirrel@webmail.ebi.ac.uk> Dear Thiago So far as I'm aware there's no compensation made for amino acid composition, but it would be a nice complement to programs such as cai (http://emboss.sourceforge.net/apps/cai.html). If you could let us know the key papers and whether any code exists we can consider incorporating such in the future. Cheers Jon > Hi all. > I have a couple questions about the codon usage comparisons in the EMBOSS. > I have read some papers that use Factorial Correspondence Analysis to > compensate for aminoacid composition. The EMBOSS tools compensate it by > some > other way or what we get could be a biased result? > > Regards. > > Thiago > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From jison at ebi.ac.uk Tue Sep 6 08:34:54 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Tue, 6 Sep 2005 13:34:54 +0100 (BST) Subject: [EMBOSS] embossrc - configure database NPRD and AEdb In-Reply-To: <5aa3b3570508241221142887a8@mail.gmail.com> References: <5aa3b3570508241221142887a8@mail.gmail.com> Message-ID: <38091.172.31.8.12.1126010094.squirrel@webmail.ebi.ac.uk> Dear Giovanni The EMBOSS Administrators Guide (http://emboss.sourceforge.net/docs/adminguide/) should help, specificially the section on databases: http://emboss.sourceforge.net/docs/adminguide/node4.html#SECTION00420000000000000000 If it doesn't feel free to get back in touch. Cheers Jon > Hi all, > I'm trying to configure this two databases in my .embossrc - > emboss_default > , but I didn't managed to get it works: > > http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz?-page+LibInfo+-id+3Xn_71Qks76+-lib+NUCLEOSOME > http://www.ebi.ac.uk/asd-srv/AEdb-query.cgi?method=MAIN&visit=first > > For the first one, I've tried this: > > DB NPRD [ > method: srswww > format: embl > # url: " > http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz?-id+1YUkq1Qk6fN+-e+[NUCLEOSOME:'%s'] > " > # url: " > http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz?-page+LibInfo+-id+3Xn_71QkMvb+-lib+NUCLEOSOME > " > # url: " > http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz?-id+-e+[NUCLEOSOME:'%s']" > url: "http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz" > type: N > dbalias: NUCLEOSOME > app: getz > fields: "AC SQ" > ] > > But what's is wrong? How can I understand what is the 'correct' url to > choose, and how can I determine the right 'method' and 'format'? > I've seen that in the main page of this database, there are description > about the syntax and the and the structure in SRS. For example, can I use > the informations described here: > http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz?-page+icarusFile+-id+3Xn_71Qks76+-l+NUCLEOSOME+-ifile+i? > > Thank you for any reply. > Giovanni > > -- > ----------------------------------------------------------- > > Visit my website! > http://dalloliogm.altervista.org > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From pmr at ebi.ac.uk Tue Sep 6 09:09:36 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 06 Sep 2005 14:09:36 +0100 Subject: [EMBOSS] embossrc - configure database NPRD and AEdb In-Reply-To: <38091.172.31.8.12.1126010094.squirrel@webmail.ebi.ac.uk> References: <5aa3b3570508241221142887a8@mail.gmail.com> <38091.172.31.8.12.1126010094.squirrel@webmail.ebi.ac.uk> Message-ID: <431D9510.2030802@ebi.ac.uk> Dear Giovanni >>Hi all, >>I'm trying to configure this two databases in my .embossrc - >>emboss_default >>, but I didn't managed to get it works: >> >>http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz?-page+LibInfo+-id+3Xn_71Qks76+-lib+NUCLEOSOME >>http://www.ebi.ac.uk/asd-srv/AEdb-query.cgi?method=MAIN&visit=first For the SRS database, yes you should use SRSWWW ... but ... The NUCLEOSOME database at that site has problems: No standard field names (not even ID) Parser errors in SRS No text view Non-standard format No FASTA format view Even if we try the URL method, there seems to be no URL to produce output that EMBOSS can understand. From the list of public SRS servers, this is the only server that has this database. The only solution at present is to write a script (in Perl, for example) that can fetch and reformat an entry from this server, and write it in (for example) FASTA format, and to use this script with the "external" access method from EMBOSS. For the EBI Alternate Exons Database query: Again, there is no URL that returns a standard format EMBOSS can use, so a script is the best solution. You also need to decide what sequence you need (I assume the exon, but there are other sequences in the results) We are working on ways to use more complex queries and more data formats - as part of the EMBRACE project at EBI. But this will take time before it can be used for these queries. Hope this helps, Peter From sbassi at gmail.com Thu Sep 8 13:00:18 2005 From: sbassi at gmail.com (Sebastian Bassi) Date: Thu, 8 Sep 2005 14:00:18 -0300 Subject: [EMBOSS] Problem with PNG driver Message-ID: Hello, I tried to install EMBOSS 3 and got stuck in config step. This is Ubuntu Linux server installation. So I want to configure it without-x but WITH PNG support. According to the EMBOSS FAQ (http://emboss.sourceforge.net/docs/faq.html), png should be enabled automagically if I have required packages. Here is the extract of the FAQ: " If you have gd-1.7.3, zlib-1.1.3 and libpng-1.0.5 or greater then the normal configure/compile should work!" Here are the relevant programs I have installed (taken from dpkg -l): ii libgd2 2.0.33-1.1ubun GD Graphics Library version 2 ii libgd2-noxpm 2.0.33-1.1ubun GD Graphics Library version 2 (without XPM s ii zlib1g 1.2.2-4ubuntu1 compression library - runtime ii libpng10-0 1.0.18-1 PNG library, older version - runtime ii libpng12-0 1.2.8rel-1 PNG library - runtime It seems I have all that is required to produce a working EMBOSS with PNG support. But when I do a configure I get: sbassi at userver:~/EMBOSS-3.0.0$ ./configure --without-x ...lot of info cut... checking if png driver is wanted... yes checking for inflateEnd in -lz... no No png driver will be made due to librarys missing/old. .... Here is the full output (without all the creating ... at the end). checking for a BSD-compatible install... /usr/bin/install -c checking whether build environment is sane... yes checking for gawk... gawk checking whether make sets $(MAKE)... yes checking for gawk... (cached) gawk checking for gcc... gcc checking for C compiler default output file name... a.out checking whether the C compiler works... yes checking whether we are cross compiling... no checking for suffix of executables... checking for suffix of object files... o checking whether we are using the GNU C compiler... yes checking whether gcc accepts -g... yes checking for gcc option to accept ANSI C... none needed checking for style of include used by make... GNU checking dependency style of gcc... gcc3 checking how to run the C preprocessor... gcc -E checking build system type... i686-pc-linux-gnu checking host system type... i686-pc-linux-gnu checking for a sed that does not truncate output... /bin/sed checking for egrep... grep -E checking for ld used by gcc... /usr/bin/ld checking if the linker (/usr/bin/ld) is GNU ld... yes checking for /usr/bin/ld option to reload object files... -r checking for BSD-compatible nm... /usr/bin/nm -B checking whether ln -s works... yes checking how to recognise dependent libraries... pass_all checking for ANSI C header files... yes checking for sys/types.h... yes checking for sys/stat.h... yes checking for stdlib.h... yes checking for string.h... yes checking for memory.h... yes checking for strings.h... yes checking for inttypes.h... yes checking for stdint.h... yes checking for unistd.h... yes checking dlfcn.h usability... yes checking dlfcn.h presence... yes checking for dlfcn.h... yes checking for g++... g++ checking whether we are using the GNU C++ compiler... yes checking whether g++ accepts -g... yes checking dependency style of g++... gcc3 checking how to run the C++ preprocessor... g++ -E checking for g77... no checking for f77... no checking for xlf... no checking for frt... no checking for pgf77... no checking for fort77... no checking for fl32... no checking for af77... no checking for f90... no checking for xlf90... no checking for pgf90... no checking for epcf90... no checking for f95... no checking for fort... no checking for xlf95... no checking for ifc... no checking for efc... no checking for pgf95... no checking for lf95... no checking for gfortran... no checking whether we are using the GNU Fortran 77 compiler... no checking whether accepts -g... no checking the maximum length of command line arguments... 32768 checking command to parse /usr/bin/nm -B output from gcc object... ok checking for objdir... .libs checking for ar... ar checking for ranlib... ranlib checking for strip... strip checking if gcc static flag works... yes checking if gcc supports -fno-rtti -fno-exceptions... no checking for gcc option to produce PIC... -fPIC checking if gcc PIC flag -fPIC works... yes checking if gcc supports -c -o file.o... yes checking whether the gcc linker (/usr/bin/ld) supports shared libraries... yes checking whether -lc should be explicitly linked in... no checking dynamic linker characteristics... GNU/Linux ld.so checking how to hardcode library paths into programs... immediate checking whether stripping libraries is possible... yes checking if libtool supports shared libraries... yes checking whether to build shared libraries... yes checking whether to build static libraries... yes configure: creating libtool appending configuration tag "CXX" to libtool checking for ld used by g++... /usr/bin/ld checking if the linker (/usr/bin/ld) is GNU ld... yes checking whether the g++ linker (/usr/bin/ld) supports shared libraries... yes checking for g++ option to produce PIC... -fPIC checking if g++ PIC flag -fPIC works... yes checking if g++ supports -c -o file.o... yes checking whether the g++ linker (/usr/bin/ld) supports shared libraries... yes checking dynamic linker characteristics... GNU/Linux ld.so checking how to hardcode library paths into programs... immediate checking whether stripping libraries is possible... yes appending configuration tag "F77" to libtool checking whether byte ordering is bigendian... no checking for a BSD-compatible install... /usr/bin/install -c checking whether ln -s works... yes checking whether make sets $(MAKE)... (cached) yes checking for ranlib... (cached) ranlib checking for X... disabled checking for dirent.h that defines DIR... yes checking for library containing opendir... none required checking for ANSI C header files... (cached) yes checking for unistd.h... (cached) yes checking for an ANSI C-conforming const... yes checking for pid_t... yes checking for size_t... yes checking whether struct tm is in sys/time.h or time.h... time.h checking whether getpgrp requires zero arguments... yes checking for strftime... yes checking for unistd.h... (cached) yes checking vfork.h usability... no checking vfork.h presence... no checking for vfork.h... no checking for fork... yes checking for vfork... yes checking for working fork... yes checking for working vfork... (cached) yes checking for vprintf... yes checking for _doprnt... no checking for memmove... yes checking for gethostbyname in -lc... yes checking for socket in -lc... yes checking for main in -lm... yes checking if docroot is given... no checking if gcc profiling is selected... no checking if java include directory given... no checking if java OS include directory given... no checking if png driver is wanted... yes checking for inflateEnd in -lz... no No png driver will be made due to librarys missing/old. checking if any authorisation type is given... no checking for gdome2... no checking for large file support... done checking for purify... no checking if any threading type is given... no configure: creating ./config.status config.status: creating plplot/Makefile config.status: creating plplot/lib/Makefile I don't understand what is missing :( -- La web sin popups ni spyware: Usa Firefox en lugar de Internet Explorer From ajb at ebi.ac.uk Thu Sep 8 13:21:31 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 8 Sep 2005 18:21:31 +0100 (BST) Subject: [EMBOSS] Problem with PNG driver In-Reply-To: References: Message-ID: <44891.81.96.71.66.1126200091.squirrel@webmail.ebi.ac.uk> On Debian-style systems PNG, GD and ZLIB will only be recognised if you've installed the corresponding 'devel' packages. You may run into problems configuring without X11, but the above should get PNG going. If you decide to install X11 then make sure you install the development packages for that as well. HTH Alan From sbassi at gmail.com Thu Sep 8 13:25:08 2005 From: sbassi at gmail.com (Sebastian Bassi) Date: Thu, 8 Sep 2005 14:25:08 -0300 Subject: [EMBOSS] Problem with PNG driver In-Reply-To: <44891.81.96.71.66.1126200091.squirrel@webmail.ebi.ac.uk> References: <44891.81.96.71.66.1126200091.squirrel@webmail.ebi.ac.uk> Message-ID: OK, I am going to try to install the dev packages. Regarding the "without-x", why would I need x in a server that will be accessed using ssh or web (via wEMBOSS)? Do any of the EMBOSS programs requires? Thank you very much! -- La web sin popups ni spyware: Usa Firefox en lugar de Internet Explorer From smiddha at indiana.edu Thu Sep 8 13:46:52 2005 From: smiddha at indiana.edu (Sumit Middha) Date: Thu, 08 Sep 2005 12:46:52 -0500 Subject: [EMBOSS] Embassy tools In-Reply-To: References: <39102.129.111.174.49.1124381885.squirrel@biochem.uthscsa.edu> Message-ID: <4320790C.6090508@indiana.edu> Hi, I have recently installed Emboss-3.0. However I wanted to use fneighbor which I figured is not included. I tried looking online, but got confused as to how to go about installing these extra Embassy programs and integrating them with emboss, emboss-explorer, etc. Can someone suggest please. Thanks. Sumit From ajb at ebi.ac.uk Thu Sep 8 14:23:33 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 8 Sep 2005 19:23:33 +0100 (BST) Subject: [EMBOSS] Problem with PNG driver In-Reply-To: References: <44891.81.96.71.66.1126200091.squirrel@webmail.ebi.ac.uk> Message-ID: <35233.81.96.71.66.1126203813.squirrel@webmail.ebi.ac.uk> In theory you're quite right, you don't need X11 on such a system. There are ways that some OS/distribution setups can fool the --without-x switch though; so you may find that in practice that compilation with X11 is the path of least resistance. That is one of several areas of configuration that I'll be overhauling in the near future. Alan From David.Bauer at SCHERING.DE Fri Sep 9 01:48:44 2005 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Fri, 9 Sep 2005 07:48:44 +0200 Subject: [EMBOSS] Antwort: Embassy tools In-Reply-To: <4320790C.6090508@indiana.edu> Message-ID: The adminguide http://emboss.sourceforge.net/docs/adminguide/ contains a section about installing embassy apps. All userinterfaces which make use of the acd files (like Jemboss, Luke's GUI etc.) will smoothly integrate the embassy apps once they are installed. David. emboss-bounces at emboss.open-bio.org schrieb am 08/09/2005 19:46:52: > Hi, > I have recently installed Emboss-3.0. However I wanted to use fneighbor > which I figured is not included. I tried looking online, but got > confused as to how to go about installing these extra Embassy programs > and integrating them with emboss, emboss-explorer, etc. > > Can someone suggest please. > > Thanks. > Sumit > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss From ajb at ebi.ac.uk Fri Sep 9 02:31:34 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 9 Sep 2005 07:31:34 +0100 (BST) Subject: [EMBOSS] Embassy tools In-Reply-To: <4320790C.6090508@indiana.edu> References: <39102.129.111.174.49.1124381885.squirrel@biochem.uthscsa.edu> <4320790C.6090508@indiana.edu> Message-ID: <56436.81.96.71.66.1126247494.squirrel@webmail.ebi.ac.uk> There are also instructions at: http://emboss.sourceforge.net/docs/faq.html Look for "Q) Installing associated software PHYLIP". You need the instructions in part 'b)' of that question as you are not using the CVS version of EMBOSS. To summarise what's there in case it was that documentation which confused you, if you installed EMBOSS-3.0.0 using: ./configure --prefix=/usr/local/emboss [and any other options you chose] make make install Then you install PHYLIP using: ./configure --prefix=/usr/local/emboss [and any other options you chose] make make install There is only one exception and that is if you installed EMBOSS-3.0.0 using: ./configure make make install (i.e. you didn't supply a --prefix). In this case you have to supply an extra flag to the EMBASSY package configuration i.e. ./configure --enable-localforce make make install We recommend that you use the first approach (i.e supply a --prefix) to have EMBOSS installed in a directory of its own. The instructions at the URL above were updated last night and replace those in the EMBOSS-3.0.0/FAQ file. HTH Alan From ulrike.kaule at gmx.de Fri Sep 9 02:42:18 2005 From: ulrike.kaule at gmx.de (Ulrike Kaule) Date: Fri, 09 Sep 2005 08:42:18 +0200 Subject: [EMBOSS] output of program "digest" as input for program "pepstats" ? Message-ID: <43212ECA.2030608@gmx.de> Dear Peter, thank you very much for your help. I installed emboss locally now and I can specify output 'listfile' for digest. But the following programm (pepstats or iep) does not accept that as input (in taverna). I get the error message "Unknown input format 'listfile' ". Then I tried to specify the input format using the sformat-qualifier, but this doesn't work. My question is: is there any possibility to specify the right input format in the acd-file. Or do I have to use an other input-qualifier to tell pepstats the format? Thank you in advance Ulrike Kaule Guy Bottu wrote: > Dear Ulrike, > > You can ask digest for a "Report Format" of type "List File", which > you can give as input to pepstats or iep (the peptides will be > analyzed as individual sequences and the results given the one aftert > the other, they are not merged). > > I have no experience with Taverna and hence cannot tell you exactly > how to. I know that at the command line you would have to : > digest mysequence -rformat=listfile -outfile=myreport > iep list::myreport In taverna, using the EBI SoapLab services to run EMBOSS you will not be able to use the -rformat qualifier - that will be added in a future release of SoapLab later this year. The current SoapLab has the EMBOSS qualifiers, but is missing some "associated qualifiers" including -rformat for reports and -aformat fopr alignments. If you have your own soaplab server running, one solution that has been tried is to change the rformat value in the digest.acd file to "listfile" - digest will then always produce the listfile version of the output. Hope that helps Peter Hello, I'm a new user to emboss. Within a Taverna-Workflow I want to digest a protein-sequence first with the emboss-program "digest" and to use the output of "digest" - the seqtable with the fragments - as an input for further sequence-analysis programs. So the resulting fragments should be analysed by pepstats or iep. But I have problems with the connection of these programs, because the output of "digest" is not accepted by the other programs as input. I thougth to solve this problem with using "seqret" between "digest" and "pepstats", but this doesn't work. Is there any solution to extract the protein-fragments produced by "digest" and to use them as input for other programs? Thank you in advance Ulrike From easmith at beatrice.rutgers.edu Mon Sep 12 01:25:37 2005 From: easmith at beatrice.rutgers.edu (Allen Smith) Date: Mon, 12 Sep 2005 01:25:37 -0400 Subject: [EMBOSS] dbxfasta giving error in ajindex.c at line 541: Maximum retries (100) reached in btreeCacheFetch for page 0 Message-ID: Hi. Attempting to do a dbxfasta index of the NCBI nr (FASTA-format) file is giving the error: EMBOSS An error in ajindex.c at line 541: Maximum retries (100) reached in btreeCacheFetch for page 0 I have tried PAGESIZE 2048 and CACHESIZE 200, also PAGESIZE 4096 with CACHESIZE 100; same result. Also same result with either: dbxfasta -dbname nr -dbresource fasta -idformat ncbi -directory /disk2/usr/EMBL -filenames nr -date 11/09/05 -fields id,acc,des -indexoutdir ~/lib/EMBOSS/data/indexes/nr or dbxfasta -dbname nr -dbresource fasta -idformat ncbi -directory /disk2/usr/EMBL -filenames nr -date 11/09/05 -indexoutdir ~/lib/EMBOSS/data/indexes/nr The second is with emboss.default containing: RES fasta [ type: Index idlen: 15 acclen: 15 svlen: 10 deslen: 20 orglen: 15 ] I'm running on SGI IRIX64 6.5.20m. configure was done with --with-thread=irix --without-java --with-sgiabi --enable-large --disable-static --disable-64 plus various options for --prefix et al. dbxflat is currently running on sprot.dat and trembl.dat with no problems so far. Thanks, -Allen P.S. BTW, it is rather inconvenient how many places are hardwired to have ${prefix}/share/EMBOSS/ and do not pay attention to --datadir from configure. Something to work on (I will if I ever get the time, although that seems unlikely at the moment!)... -- Allen Smith http://cesario.rutgers.edu/easmith/ February 1, 2003 Space Shuttle Columbia Ad Astra Per Aspera To The Stars Through Asperity From ajb at ebi.ac.uk Mon Sep 12 02:09:03 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Mon, 12 Sep 2005 07:09:03 +0100 (BST) Subject: [EMBOSS] dbxfasta giving error in ajindex.c at line 541: Maximum retries (100) reached in btreeCacheFetch for page 0 In-Reply-To: References: Message-ID: <48035.81.96.71.66.1126505343.squirrel@webmail.ebi.ac.uk> Dear Allen, Is that with or without using the fixed 'ajindex.c' file from: ftp://emboss.open-bio.org/pub/EMBOSS/fixes/ If that doesn't fix it then get back to me offlist. I'll be looking at the configuration in the near future. HTH Alan From ulrike.kaule at gmx.de Mon Sep 12 14:10:09 2005 From: ulrike.kaule at gmx.de (Ulrike Kaule) Date: Mon, 12 Sep 2005 20:10:09 +0200 Subject: [EMBOSS] EMBOSS-3.0.0: changes in local acd-file are not realized Message-ID: <4325C481.2050701@gmx.de> Hello, I installed EMBOSS-3.0.0 locally, because I want to make some changes in acd-file, especially I want to change the format of the output from the default "seqtable" to "gff", because I need this setting for work with taverna. But the problem is, that this change is not realized, when I run the EMBOSS-programm (digest in this case). I changed acd-file in directory /usr/local/EMBOSS-3.0.0/emboss/acd. It looks now like ... report: outfile [ parameter: "Y" rformat: "gff" multiple: "Y" taglist: "float:molwt=Mol_Weight str:cterm str:nterm" ] When I start this programm on command-line with no specification for the -rformat-option (../../emboss/digest myseq -outfile=myreport) - it should now take the rformat from acd-file - then the rformat is still seqtable. When starting with ../../emboss/digest myseq -rformat=gff -outfile=myreport, then it produces the right output - gff. Why is the setting in acd-file not recognized? Do I have to do any recompilation after changing the acd-file? Thanks in advance Ulrike Kaule From pmr at ebi.ac.uk Tue Sep 13 03:14:01 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 13 Sep 2005 08:14:01 +0100 Subject: [EMBOSS] EMBOSS-3.0.0: changes in local acd-file are not realized In-Reply-To: <4325C481.2050701@gmx.de> References: <4325C481.2050701@gmx.de> Message-ID: <43267C39.5050207@ebi.ac.uk> Ulrike Kaule wrote: > I changed acd-file in > directory /usr/local/EMBOSS-3.0.0/emboss/acd. It looks now like > ... > report: outfile [ > parameter: "Y" > rformat: "gff" > multiple: "Y" > taglist: "float:molwt=Mol_Weight str:cterm str:nterm" > ] > > When I start this programm on command-line with no specification for the > -rformat-option (../../emboss/digest myseq -outfile=myreport) - it > should now take the rformat from acd-file - then the rformat is still > seqtable. When starting with ../../emboss/digest myseq -rformat=gff > -outfile=myreport, then it produces the right output - gff. > Why is the setting in acd-file not recognized? Do I have to do any > recompilation after changing the acd-file? EMBOSS will use an installed ACD file if it can find it. If you cd to the emboss/acd directory and "make install" it will install the modified digest.acd file. To find out which ACD file was used, you can run "digest -debug" and look in the digest.dbg file for the full path to digest.acd Hope that helps, Peter From atorrano at lsi.upc.edu Tue Sep 13 04:34:07 2005 From: atorrano at lsi.upc.edu (Alexis Torrano Martinez) Date: Tue, 13 Sep 2005 10:34:07 +0200 (MET DST) Subject: [EMBOSS] copying emboss indexes to another directory Message-ID: <3841799499atorrano@lsi.upc.es> Hello I would like to know if there is any problem if I copy my emboss index files to another directory and then define another database description in the emboss.default configuration file. I have been moving files from our current disk to another with more room, will it be necessary to regenerate the indexes again with dbiflat? Some error messages : seqret UniProtRebost:108_LYCES Reads and writes (returns) sequences Error: Cannot open database file 'uniprot_sprot.dat' Error: Unable to read sequence 'UniProtRebost:108_LYCES' Died: seqret terminated: Bad value for '-sequence' and no prompt ## UniProtRebost is the definition for our UniProt at the new disk. Done some debugging to seqret with -debug option. It seemed seqret was searching for uniprot_sprot.dat at the same directory in the new disk where I copied the indexes I had on the old disk. A lot of thanks! Alexis. ----------------------------------------------------- Alexis Torrano Martinez e-mail: atorrano at lsi.upc.edu Nodo Computacional GNHC-2 UPC-CIRI (inb.lsi.upc.edu) Instituto Nacional de Bioinformatica (www.inab.org) Barcelona Supercomputing Center Node (www.bsc.es) c/. Jordi Girona 29 Edifici Nexus II, despatx 113 Tel: (+34) 93 413 4037 E-08034 Barcelona Fax: (+34) 93 401 7055 Catalunya (Spain) Team info: http://www.inab.org/~malaga/MOWServ/services/HELP/MarcoBajo/team.html ----------------------------------------------------- From jison at ebi.ac.uk Tue Sep 13 05:46:23 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Tue, 13 Sep 2005 10:46:23 +0100 (BST) Subject: [EMBOSS] copying emboss indexes to another directory In-Reply-To: <3841799499atorrano@lsi.upc.es> References: <3841799499atorrano@lsi.upc.es> Message-ID: <33810.172.31.8.12.1126604783.squirrel@webmail.ebi.ac.uk> Dear Alexis Typically index files are kept in the same directory as the database itself. It is ok to move the index & database files (no need to regenerate the indices) so long as you reconfigure the database by updating the database declaration in your configuration files*. Use 'showdb' to get a list of valid database names currently set up. The maintenance of your config files is easier if you specify the location of your databases as an environment variable. Then if you move things you only need to update one line: set emboss_database_dir /data/databases/flatfiles This would then be referred to later in .embossrc as \$emboss_database_dir/embl for the directory /data/databases/flatfiles/embl If that doesn't help please get back in touch. Cheers Jon * emboss.default (share/EMBOSS subdirectory of your installation) or .embossrc files (in the directory specified by the EMBOSSRC environment variable / your home directory / current directory). See the admin guide: http://emboss.sourceforge.net/docs/adminguide/node4.html > > Hello > > I would like to know if there is any problem if I copy my emboss index > files to another directory and then define another database description > in the emboss.default configuration file. > I have been moving files from our current disk to another with more > room, will it be necessary to regenerate the indexes again with dbiflat? > > > > > Some error messages : > > seqret UniProtRebost:108_LYCES > Reads and writes (returns) sequences > Error: Cannot open database file 'uniprot_sprot.dat' > Error: Unable to read sequence 'UniProtRebost:108_LYCES' > Died: seqret terminated: Bad value for '-sequence' and no prompt > > ## UniProtRebost is the definition for our UniProt at the new disk. > > Done some debugging to seqret with -debug option. It seemed seqret was > searching for uniprot_sprot.dat at the same directory in the new disk > where I copied the indexes I had on the old disk. > > > A lot of thanks! > > > Alexis. > > > ----------------------------------------------------- > Alexis Torrano Martinez > e-mail: atorrano at lsi.upc.edu > > Nodo Computacional GNHC-2 UPC-CIRI (inb.lsi.upc.edu) > Instituto Nacional de Bioinformatica (www.inab.org) > Barcelona Supercomputing Center Node (www.bsc.es) > > c/. Jordi Girona 29 > Edifici Nexus II, despatx 113 Tel: (+34) 93 413 4037 > E-08034 Barcelona Fax: (+34) 93 401 7055 > Catalunya (Spain) > Team info: > http://www.inab.org/~malaga/MOWServ/services/HELP/MarcoBajo/team.html > ----------------------------------------------------- > > > > > > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From Marc.Logghe at DEVGEN.com Wed Sep 14 05:06:28 2005 From: Marc.Logghe at DEVGEN.com (Marc Logghe) Date: Wed, 14 Sep 2005 11:06:28 +0200 Subject: [EMBOSS] Cusp cfile option Message-ID: <0C528E3670D8CE4B8E013F6749231AA62F5568@ANTARESIA.be.devgen.com> Hi all, I was wondering what the purpose was for the -cfile option in cusp. After all, cusp *creates* a cut file, so why should it need one ? Also, where can I find out about the species for the CODONS/*.cut files. I looked inside these for a comment or something, but nothing was there. For instance, Eyeast.cut is obvious, but what species is used for Eyen.cut ? Just curious. Thanks, Marc From jison at ebi.ac.uk Wed Sep 14 05:57:51 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Wed, 14 Sep 2005 10:57:51 +0100 (BST) Subject: [EMBOSS] Cusp cfile option In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA62F5568@ANTARESIA.be.devgen.com> References: <0C528E3670D8CE4B8E013F6749231AA62F5568@ANTARESIA.be.devgen.com> Message-ID: <35210.172.31.8.12.1126691871.squirrel@webmail.ebi.ac.uk> Dear Marc "-cfile" isn't a valid option for cusp (at least, in my installation) Perhaps you were referring to a different program ? cusp reads a codon usage data file* as a template but doesn't use any of the data - so any file from any species will give the same results. Cheers Jon (*from your current working directory ('.'), "embossdata" subdirectory in '.', your home directory (~) or "embossdata" subdirectory in '~'. > Hi all, > I was wondering what the purpose was for the -cfile option in cusp. > After all, cusp *creates* a cut file, so why should it need one ? > Also, where can I find out about the species for the CODONS/*.cut files. > I looked inside these for a comment or something, but nothing was there. > For instance, Eyeast.cut is obvious, but what species is used for > Eyen.cut ? > Just curious. > Thanks, > Marc > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From Marc.Logghe at DEVGEN.com Wed Sep 14 06:04:46 2005 From: Marc.Logghe at DEVGEN.com (Marc Logghe) Date: Wed, 14 Sep 2005 12:04:46 +0200 Subject: [EMBOSS] Cusp cfile option Message-ID: <0C528E3670D8CE4B8E013F6749231AA62F556D@ANTARESIA.be.devgen.com> > -----Original Message----- > From: Jon Ison [mailto:jison at ebi.ac.uk] > Sent: Wednesday, September 14, 2005 11:58 AM > To: Marc Logghe > Cc: emboss at emboss.open-bio.org > Subject: Re: [EMBOSS] Cusp cfile option > > Dear Marc > > "-cfile" isn't a valid option for cusp (at least, in my > installation) Perhaps you were referring to a different program ? Ah that makes sense. I am not using a different program but a different version of EMBOSS, 2.8.0 that is. To prove it once was there ;-) http://poblano.health.unm.edu/Software/EMBOSS/Apps/cusp.html So, that's one question off. Still did not find where to get *.cut species info Thanks, Marc From pmr at ebi.ac.uk Wed Sep 14 06:17:19 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Wed, 14 Sep 2005 11:17:19 +0100 (BST) Subject: [EMBOSS] Cusp cfile option In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA62F5568@ANTARESIA.be.devgen.com> References: <0C528E3670D8CE4B8E013F6749231AA62F5568@ANTARESIA.be.devgen.com> Message-ID: <1244.128.141.130.13.1126693039.squirrel@webmail.ebi.ac.uk> Hi Mark, > I was wondering what the purpose was for the -cfile option in cusp. > After all, cusp *creates* a cut file, so why should it need one ? > Also, where can I find out about the species for the CODONS/*.cut files. > I looked inside these for a comment or something, but nothing was there. > For instance, Eyeast.cut is obvious, but what species is used for > Eyen.cut ? Changed a lot in EMBOSS 3.0.0. There was discussion at least on the developers list. cusp no longer needs the file, filenames have been cleaned up, and there is a list of species attached to the files to make names clearer. I'm not in the office today, best guess for Yen would be Yersinia enterocolitica :-) regards, Peter From Marc.Logghe at DEVGEN.com Wed Sep 14 06:18:46 2005 From: Marc.Logghe at DEVGEN.com (Marc Logghe) Date: Wed, 14 Sep 2005 12:18:46 +0200 Subject: [EMBOSS] Cusp cfile option Message-ID: <0C528E3670D8CE4B8E013F6749231AA62F556E@ANTARESIA.be.devgen.com> > Hi Mark, > > > I was wondering what the purpose was for the -cfile option in cusp. > > After all, cusp *creates* a cut file, so why should it need one ? > > Also, where can I find out about the species for the > CODONS/*.cut files. > > I looked inside these for a comment or something, but > nothing was there. > > For instance, Eyeast.cut is obvious, but what species is used for > > Eyen.cut ? > > Changed a lot in EMBOSS 3.0.0. There was discussion at least > on the developers list. cusp no longer needs the file, > filenames have been cleaned up, and there is a list of > species attached to the files to make names clearer. > > I'm not in the office today, best guess for Yen would be > Yersinia enterocolitica :-) > Thanks Peter, Think it is the right time for an upgrade ;-) Cheers, Marc From ronnieoc at gmail.com Thu Sep 15 18:45:10 2005 From: ronnieoc at gmail.com (Ronnie O) Date: Thu, 15 Sep 2005 18:45:10 -0400 Subject: [EMBOSS] Seqret stdin issues Message-ID: <6ceab7de05091515451ae539a8@mail.gmail.com> Hello everyone, I am trying to pipe sequence data into seqret via a pipe with the following command: ./seqret raw::stdin raw::stdout and i am getting the following data piped back to my app via the error pipe: Unable to read sequence 'raw::stdin raw::stdout' Died: seqret terminated: Bad value for '-sequence' and no prompt I am new to using the EMBOSS package and am not familiar with the errors. So is this a standard error for telling me that my input is not recognized or formatted correctly? This is confusing me b/c I am piping this sequence data in the same manner to a perl script it is being recognized correctly. I am just sending a sample string of "ATGCATGC". The perl script spits it back to me through: $data = ; //The dna string also has a \n added for the perl stdin which I've removed for stdin to seqret print $data; So I am hesitant to think my piping mechanism isn't sufficient, but rather seqret is looking for some other flags for stdin or a different formatting. Any ideas? Thanks, Ronnie From lukem at gene.pbi.nrc.ca Thu Sep 15 20:12:56 2005 From: lukem at gene.pbi.nrc.ca (Luke McCarthy) Date: Thu, 15 Sep 2005 18:12:56 -0600 Subject: [EMBOSS] Seqret stdin issues In-Reply-To: <6ceab7de05091515451ae539a8@mail.gmail.com> References: <6ceab7de05091515451ae539a8@mail.gmail.com> Message-ID: <1126829576.5825.3.camel@drmemory.private.virtuouspagans.org> On Thu, 2005-09-15 at 16:45, Ronnie O wrote: > Hello everyone, > I am trying to pipe sequence data into seqret via a pipe with the following > command: > ./seqret raw::stdin raw::stdout > and i am getting the following data piped back to my app via the error > pipe: > Unable to read sequence 'raw::stdin raw::stdout' For some reason, whatever mechanism you're using to run seqret thinks "raw::stdin raw::stdout" is one argument. Obviously it should be two arguments. In Perl, for example, this could happen if you tried something like system "seqret", "raw::stdin raw::stdout"; instead of: system "seqret", "raw::stdin", "raw::stdout"; or system "seqret raw::stdin raw::stdout"; >From my command line, "seqret raw::stdin raw::stdout" works as I assume you'd like it to. How exactly are you calling seqret. I mean, if you're calling it from another script or program, can you include the relevant code? Cheers, Luke From simon.andrews at bbsrc.ac.uk Fri Sep 16 03:28:03 2005 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Fri, 16 Sep 2005 08:28:03 +0100 Subject: [EMBOSS] Seqret stdin issues In-Reply-To: <6ceab7de05091515451ae539a8@mail.gmail.com> References: <6ceab7de05091515451ae539a8@mail.gmail.com> Message-ID: On 15 Sep 2005, at 23:45, Ronnie O wrote: > Hello everyone, > I am trying to pipe sequence data into seqret via a pipe with the > following > command: > ./seqret raw::stdin raw::stdout > and i am getting the following data piped back to my app via the error > pipe: > Unable to read sequence 'raw::stdin raw::stdout' A simple pipe of the type you describe works fine for me: echo "GATAGCTAG" | seqret raw::stdin fasta::stdout Reads and writes (returns) sequences >EMBOSS_001 GATAGCTAG However it sounds like you're trying to do this via a Perl script. Are you using the IPC::Open2 / Open3 modules to do this? I tried it and it seemed to work OK: #!/usr/bin/perl use warnings; use strict; use IPC::Open2; my $seq = "GATAGATATGCTAGA"; my $pid = open2(\*OUT,\*IN,"seqret","raw::stdin","raw::stdout"); print IN $seq; close IN or die "Can't close IN: $!"; while () { print; } close OUT or die "Can't close OUT: $!"; waitpid($pid,0); ################## Incidentally, it you're just using seqret as a filter then there is a -filter flag which has a slightly cleaner syntax for what you're trying to do: echo "GATAGCTAG" | seqret -filter -osf fasta If you're still having problems then can you post the piece of code which isn't working so we can have a look. Cheers Simon. -- Simon Andrews PhD Bioinformatics Dept. The Babraham Institute simon.andrews at bbsrc.ac.uk +44 (0) 1223 496463 From ronnieoc at gmail.com Mon Sep 19 08:26:25 2005 From: ronnieoc at gmail.com (Ronnie O) Date: Mon, 19 Sep 2005 08:26:25 -0400 Subject: [EMBOSS] Seqret stdin issues In-Reply-To: References: <6ceab7de05091515451ae539a8@mail.gmail.com> Message-ID: <6ceab7de05091905263552accb@mail.gmail.com> Thanks guys, Luke, the first suggestion was definitely a fix. I separated the arguments into two individual items in an array of arguments that is sent to the command line. I originally was sending the entire line "raw::stdin raw::stdout" as one item. This change deleted my error of: Unable to read sequence 'raw::stdin raw::stdout' Died: seqret terminated: Bad value for '-sequence' and no prompt So that was definitely an issue. Second, Simon, I also can run the command: echo "GATA" | ./seqret raw::stdin raw::stdout in a terminal with success. To test succesful piping of stdin from my app (which is a Cocoa app), I wrote a simple perl script to print a variable that has been initialized to . This all functions correctly. I am not familiar with modules you mentioned, but the success of the simple perl script seems to tell me that I am correctly piping data out of the cocoa app, as well as receiving it correctly from stdout. Seqret is responding otherwise, as I am not getting data echoed back to my app at all. Whether this is due to stdin or stdout, I have yet to deduce. For the time being, I am going to make sure my cocoa code is up to par (which the perl script seems to be telling me it is), and I will probably re-post once I narrow it down to a seqret issue. Unless anyone has any cocoa-specific/seqret piping suggestions? Thanks a lot, fellas! ......... Ronnie From pmr at ebi.ac.uk Mon Sep 19 11:09:05 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Mon, 19 Sep 2005 16:09:05 +0100 (BST) Subject: [EMBOSS] Seqret stdin issues In-Reply-To: <6ceab7de05091905263552accb@mail.gmail.com> References: <6ceab7de05091515451ae539a8@mail.gmail.com> <6ceab7de05091905263552accb@mail.gmail.com> Message-ID: <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> Ronnie wrote: > Unless anyone has any cocoa-specific/seqret piping > suggestions? Thanks a lot, fellas! Just to point out that seqret would also support opening your application as a pipe from within the USA - should give you the same result. We support perl-style pipe definitions to launch applications as input files. This is a feature of EMBOSS from the early days which nobody has (as far as we know) used very much. You can also launch applications as database access methods, defining the application, sending some "id" to the command line for the application, and reading the results in seqret in some format definied in the database definition. One point on reading from stdin ... EMBOSS 3.0.0 should be able to handle various carriage return/line feed file formats, but earlier releases may occasionally have problems. Running seqret with "-debug" on the commandline will create a seqret.dbg file that should help tell you what is going on - for example, how far it gets with trying to read your stdin input file. If you;re not sure what the seqret.dbg file contents mean, you can send the file to me and I'll he happy to take a look. Have fun! Peter From forward at hongyu.org Tue Sep 20 15:14:59 2005 From: forward at hongyu.org (forward at hongyu.org) Date: Tue, 20 Sep 2005 12:14:59 -0700 (PDT) Subject: [EMBOSS] consensus sequence from Prettyplot and Cons Message-ID: <43015.205.234.187.240.1127243699.squirrel@hongyu.org> Hi there, I am new to this group, sorry if it's a discussed question here. I found there is difference between the consensus sequences generated for the same alignment by the two programs: Prettyplot and Cons. I've tried adjusting the parameters such as -plurality and -identity, but failed to reconcile the two no matter how. Please let me know if you have met the same problem or whether you have good solution to it. Thanks! -- Hongyu Zhang, Ph.D. Computational Biologist Ceres Inc. 1535 Rancho Conejo Blvd Thousand Oaks, CA 91320 Phone: (805)376-6504 ext 1204 From ulrike.kaule at gmx.de Tue Sep 20 16:03:25 2005 From: ulrike.kaule at gmx.de (Ulrike Kaule) Date: Tue, 20 Sep 2005 22:03:25 +0200 Subject: [EMBOSS] sreformat: problems with parameter Message-ID: <43306B0D.60506@gmx.de> Hello, I want to develop a workflow in Taverna, which accepts a sequence in fasta-format and does some analysis with it. But a demand is also, that the user could input some other formats than fasta - so I have to convert them internally to fasta. The only programm I found for this purpose was sreformat from HMMER. At the moment this programm is not included in EMBOSS, so I wrote a new acd-file and deployed it as a web-service. The acd-file is as follows: ----------------------------------------------------- application: sreformat [ documentation: "Converts sequence file to different format" groups: "Utils" ] section: input [ information: "Input section" type: "page" ] string: format [ parameter: "Y" information: "Output format" ] sequence: seqfile [ parameter: "Y" information: "Input sequence" ] endsection: input section: output [ information: "Output section" type: "page" ] seqout: outfile [ parameter: "Y" ] endsection: output ----------------------------------------------------- To ensure, that the output-format of sreformat is 'fasta', I coded it hard in a string-constant and gave it to parameter 'osformat' of sreformat. But the error-message I got was: ---------------------------------------------------------------------------------------- Task failed due to problem invoking soaplab service SoaplabTask.execute(..) : line 201 ProcessorTask.runAndGenerateTemplates(..) : line 444 ProcessorTask.doInvocationWithRetryLogic(..) : line 397 ProcessorTask.invokeOnce(..) : line 319 ProcessorTask.invokeWithoutIteration(..) : line 503 ProcessorTask.invoke(..) : line 251 ProcessorTask.handleRun(..) : line 199 NewState$1.run(..) : line 67 org.embl.ebi.SoaplabShare.SoaplabException: CONFLICTING_INPUT. format * (Parameter (Output format): Cannot remain empty.) SOAPFaultBuilder.createFault(..) : line 221 SOAPFaultBuilder.endElement(..) : line 128 DeserializationContext.endElement(..) : line 1087 AbstractSAXParser.endElement(..) : line -1 XMLNSDocumentScannerImpl.scanEndElement(..) : line -1 XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(..) : line -1 XMLDocumentFragmentScannerImpl.scanDocument(..) : line -1 XML11Configuration.parse(..) : line -1 XML11Configuration.parse(..) : line -1 XMLParser.parse(..) : line -1 AbstractSAXParser.parse(..) : line -1 SAXParser.parse(..) : line 345 DeserializationContext.parse(..) : line 227 SOAPPart.getAsSOAPEnvelope(..) : line 696 Message.getSOAPEnvelope(..) : line 424 MustUnderstandChecker.invoke(..) : line 62 AxisClient.invoke(..) : line 206 Call.invokeEngine(..) : line 2754 Call.invoke(..) : line 2737 Call.invoke(..) : line 2413 Call.invoke(..) : line 2336 Call.invoke(..) : line 1793 SoaplabTask.execute(..) : line 98 ProcessorTask.runAndGenerateTemplates(..) : line 444 ProcessorTask.doInvocationWithRetryLogic(..) : line 397 ProcessorTask.invokeOnce(..) : line 319 ProcessorTask.invokeWithoutIteration(..) : line 503 ProcessorTask.invoke(..) : line 251 ProcessorTask.handleRun(..) : line 199 NewState$1.run(..) : line 67 ---------------------------------------------------------------------------------------- So it seems, that the string-constant is not recognized. Therefore I changed in the acd-file, the default-value for format to "fasta" : ... string: format [ parameter: "Y" information: "Output format" default: "fasta" standard: "N" ] ... but I got an error-message too. Soaplab call returned an error : Summary: Completed: Erroneously Termination status: 256 Platform: Linux linux 2.6.4-52-default #1 Wed Apr 7 02:08:30 UTC 2004 i686 i686 i386 GNU/Linux Started: 20.09.2005 20:22:43 (Europe/Berlin) Ended: 20.09.2005 20:22:43 (Europe/Berlin) Report: Name: sreformat Started: 05-09-20 20:22:43 Program and parameters: sreformat /usr/local/analysis-interfaces/a/unknown/Projects/default/Data/in1127240561172 /usr/local/analysis-interfaces/a/unknown/Projects/default/Data/out1127240561314 --- end of parameters Completed: 05-09-20 20:22:43 Exit: 1 FATAL: Unknown output format /usr/local/analysis-interfaces/a/unknown/Projects/default/Data/in1127240561172 Usage: sreformat [-options] Output format choices: Unaligned Aligned ----------- ------- fasta stockholm embl msf genbank a2m gcg phylip gcgdata clustal pir selex raw eps Available options are: -h : help; print brief help on version and usage -d : force DNA alphabet for nucleic acid sequence -r : force RNA alphabet for nucleic acid sequence -l : force lower case -u : force upper case -x : convert non-IUPAC chars in DNA to N's for IUPAC/BLAST compatibility SoaplabTask.execute(..) : line 151 ProcessorTask.runAndGenerateTemplates(..) : line 444 ProcessorTask.doInvocationWithRetryLogic(..) : line 397 ProcessorTask.invokeOnce(..) : line 319 ProcessorTask.invokeWithoutIteration(..) : line 503 ProcessorTask.invoke(..) : line 251 ProcessorTask.handleRun(..) : line 199 NewState$1.run(..) : line 67 ----------------------------------------------------------------------------------- My questions are: 1) Is there another programm in emboos, what does the same like sreformat - until now I couldn't found some. 2) Is the error-message due to a problem in acd-file or is it a problem in soaplab? (At the moment the acd-file is in soaplab-directory (analysis-interfaces/metadata/)) 3) Is there another way to tell sreformat in acd-file, that the output-format should be 'fasta ? Thank you in advance Ulrike Kaule From Marc.Logghe at DEVGEN.com Tue Sep 20 16:31:57 2005 From: Marc.Logghe at DEVGEN.com (Marc Logghe) Date: Tue, 20 Sep 2005 22:31:57 +0200 Subject: [EMBOSS] sreformat: problems with parameter Message-ID: <0C528E3670D8CE4B8E013F6749231AA607D8E2@ANTARESIA.be.devgen.com> Hi Ulrike, EMBOSS seqret is perfectly suited to perform sequence conversion. You can pass it any standard format of sequence and de default output is fasta. But you can also specify the input and output formats if you want, using the options -sformat and -osformat respectively. Check out the docs for all possible formats at http://emboss.sourceforge.net/apps/seqret.html It's really useful as a kind of filter in taverna. HTH, Marc -----Oorspronkelijk bericht----- Van: emboss-bounces at emboss.open-bio.org namens Ulrike Kaule Verzonden: di 20/09/2005 22:03 Aan: emboss at emboss.open-bio.org Onderwerp: [EMBOSS] sreformat: problems with parameter Hello, I want to develop a workflow in Taverna, which accepts a sequence in fasta-format and does some analysis with it. But a demand is also, that the user could input some other formats than fasta - so I have to convert them internally to fasta. The only programm I found for this purpose was sreformat from HMMER. At the moment this programm is not included in EMBOSS, so I wrote a new acd-file and deployed it as a web-service. The acd-file is as follows: ----------------------------------------------------- application: sreformat [ documentation: "Converts sequence file to different format" groups: "Utils" ] section: input [ information: "Input section" type: "page" ] string: format [ parameter: "Y" information: "Output format" ] sequence: seqfile [ parameter: "Y" information: "Input sequence" ] endsection: input section: output [ information: "Output section" type: "page" ] seqout: outfile [ parameter: "Y" ] endsection: output ----------------------------------------------------- To ensure, that the output-format of sreformat is 'fasta', I coded it hard in a string-constant and gave it to parameter 'osformat' of sreformat. But the error-message I got was: ---------------------------------------------------------------------------------------- Task failed due to problem invoking soaplab service SoaplabTask.execute(..) : line 201 ProcessorTask.runAndGenerateTemplates(..) : line 444 ProcessorTask.doInvocationWithRetryLogic(..) : line 397 ProcessorTask.invokeOnce(..) : line 319 ProcessorTask.invokeWithoutIteration(..) : line 503 ProcessorTask.invoke(..) : line 251 ProcessorTask.handleRun(..) : line 199 NewState$1.run(..) : line 67 org.embl.ebi.SoaplabShare.SoaplabException: CONFLICTING_INPUT. format * (Parameter (Output format): Cannot remain empty.) SOAPFaultBuilder.createFault(..) : line 221 SOAPFaultBuilder.endElement(..) : line 128 DeserializationContext.endElement(..) : line 1087 AbstractSAXParser.endElement(..) : line -1 XMLNSDocumentScannerImpl.scanEndElement(..) : line -1 XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(..) : line -1 XMLDocumentFragmentScannerImpl.scanDocument(..) : line -1 XML11Configuration.parse(..) : line -1 XML11Configuration.parse(..) : line -1 XMLParser.parse(..) : line -1 AbstractSAXParser.parse(..) : line -1 SAXParser.parse(..) : line 345 DeserializationContext.parse(..) : line 227 SOAPPart.getAsSOAPEnvelope(..) : line 696 Message.getSOAPEnvelope(..) : line 424 MustUnderstandChecker.invoke(..) : line 62 AxisClient.invoke(..) : line 206 Call.invokeEngine(..) : line 2754 Call.invoke(..) : line 2737 Call.invoke(..) : line 2413 Call.invoke(..) : line 2336 Call.invoke(..) : line 1793 SoaplabTask.execute(..) : line 98 ProcessorTask.runAndGenerateTemplates(..) : line 444 ProcessorTask.doInvocationWithRetryLogic(..) : line 397 ProcessorTask.invokeOnce(..) : line 319 ProcessorTask.invokeWithoutIteration(..) : line 503 ProcessorTask.invoke(..) : line 251 ProcessorTask.handleRun(..) : line 199 NewState$1.run(..) : line 67 ---------------------------------------------------------------------------------------- So it seems, that the string-constant is not recognized. Therefore I changed in the acd-file, the default-value for format to "fasta" : ... string: format [ parameter: "Y" information: "Output format" default: "fasta" standard: "N" ] ... but I got an error-message too. Soaplab call returned an error : Summary: Completed: Erroneously Termination status: 256 Platform: Linux linux 2.6.4-52-default #1 Wed Apr 7 02:08:30 UTC 2004 i686 i686 i386 GNU/Linux Started: 20.09.2005 20:22:43 (Europe/Berlin) Ended: 20.09.2005 20:22:43 (Europe/Berlin) Report: Name: sreformat Started: 05-09-20 20:22:43 Program and parameters: sreformat /usr/local/analysis-interfaces/a/unknown/Projects/default/Data/in1127240561172 /usr/local/analysis-interfaces/a/unknown/Projects/default/Data/out1127240561314 --- end of parameters Completed: 05-09-20 20:22:43 Exit: 1 FATAL: Unknown output format /usr/local/analysis-interfaces/a/unknown/Projects/default/Data/in1127240561172 Usage: sreformat [-options] Output format choices: Unaligned Aligned ----------- ------- fasta stockholm embl msf genbank a2m gcg phylip gcgdata clustal pir selex raw eps Available options are: -h : help; print brief help on version and usage -d : force DNA alphabet for nucleic acid sequence -r : force RNA alphabet for nucleic acid sequence -l : force lower case -u : force upper case -x : convert non-IUPAC chars in DNA to N's for IUPAC/BLAST compatibility SoaplabTask.execute(..) : line 151 ProcessorTask.runAndGenerateTemplates(..) : line 444 ProcessorTask.doInvocationWithRetryLogic(..) : line 397 ProcessorTask.invokeOnce(..) : line 319 ProcessorTask.invokeWithoutIteration(..) : line 503 ProcessorTask.invoke(..) : line 251 ProcessorTask.handleRun(..) : line 199 NewState$1.run(..) : line 67 ----------------------------------------------------------------------------------- My questions are: 1) Is there another programm in emboos, what does the same like sreformat - until now I couldn't found some. 2) Is the error-message due to a problem in acd-file or is it a problem in soaplab? (At the moment the acd-file is in soaplab-directory (analysis-interfaces/metadata/)) 3) Is there another way to tell sreformat in acd-file, that the output-format should be 'fasta ? Thank you in advance Ulrike Kaule _______________________________________________ EMBOSS mailing list EMBOSS at emboss.open-bio.org http://newportal.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Wed Sep 21 03:24:03 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 21 Sep 2005 08:24:03 +0100 Subject: [EMBOSS] consensus sequence from Prettyplot and Cons In-Reply-To: <43015.205.234.187.240.1127243699.squirrel@hongyu.org> References: <43015.205.234.187.240.1127243699.squirrel@hongyu.org> Message-ID: <43310A93.8050402@ebi.ac.uk> forward at hongyu.org wrote: > Hi there, > > I am new to this group, sorry if it's a discussed question here. > > I found there is difference between the consensus sequences generated for > the same alignment by the two programs: Prettyplot and Cons. I've tried > adjusting the parameters such as -plurality and -identity, but failed to > reconcile the two no matter how. > > Please let me know if you have met the same problem or whether you have > good solution to it. Thanks! We do have multiple copies of the consensus calculation in the current EMBOSS code. There are also different options for calculating the consensus which can affect the results you see. The -plurality and -identity should change only how the individual sequences are shown, I do not expect them to change the consensus sequence (but I may be wrong!). Can you send me: the aligned sequence input the command line for prettyplot the command line for cons regards, Peter Rice From ulrike.kaule at gmx.de Wed Sep 21 16:40:26 2005 From: ulrike.kaule at gmx.de (Ulrike Kaule) Date: Wed, 21 Sep 2005 22:40:26 +0200 Subject: [EMBOSS] "Invalid XY graph value 'png' " Message-ID: <4331C53A.8000303@gmx.de> Hello, I want to use EMBOSS-programm 'iep' in Taverna - but when running it, I get the following error message: ... Exit: 1 Devices allowed are:- postscript ps hpgl hp7470 hp7580 meta colourps cps xwindows x11 tektronics tekt tek4107t tek none null text data xterm Error: Invalid XY graph value 'png' Died: iep terminated: Bad value for '-graph' with -auto defined ... Is there any possibility to turn off this graphical mode in acd-file? Or do I have to install something else (graphical drivers, etc.)? Thank you in advance Ulrike Kaule P.S.: The version of EMBOSS is 3.0.0. and it is running on Linux-machine. From ajb at ebi.ac.uk Wed Sep 21 17:48:25 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Wed, 21 Sep 2005 22:48:25 +0100 (BST) Subject: [EMBOSS] "Invalid XY graph value 'png' " In-Reply-To: <4331C53A.8000303@gmx.de> References: <4331C53A.8000303@gmx.de> Message-ID: <58823.81.96.70.96.1127339305.squirrel@webmail.ebi.ac.uk> You mentioned linux but not what distribution. So, using Fedora as an example, make sure you have the following RPMs installed. gd, gd-devel, libpng, libpng-devel and then configure and compile emboss again. That will give you PNG support. If you're using a debian-style distribution those packages will have basenames like gd2 and libpng12. HTH Alan Bleasby EBI From pmr at ebi.ac.uk Thu Sep 22 07:31:18 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 22 Sep 2005 12:31:18 +0100 (BST) Subject: [EMBOSS] "Invalid XY graph value 'png' " In-Reply-To: <4331C53A.8000303@gmx.de> References: <4331C53A.8000303@gmx.de> Message-ID: <1505.81.78.82.193.1127388678.squirrel@webmail.ebi.ac.uk> Hi Ulrike, > I want to use EMBOSS-programm 'iep' in Taverna - but when running it, I > get the following error message: > Error: Invalid XY graph value 'png' > Died: iep terminated: Bad value for '-graph' with -auto defined > ... > > Is there any possibility to turn off this graphical mode in acd-file? > Or do I have to install something else (graphical drivers, etc.)? Taverna will need PNG output to convert into something it can view. You can follow Alan's instructions to reinstall with PNG. A quick question for everyone else : The graphics formats EMBOSS lists are the ones provided by the PLPLOT library. How many of these are useful? regards, Peter Rice From sbassi at gmail.com Thu Sep 22 08:04:09 2005 From: sbassi at gmail.com (Sebastian Bassi) Date: Thu, 22 Sep 2005 09:04:09 -0300 Subject: [EMBOSS] "Invalid XY graph value 'png' " In-Reply-To: <1505.81.78.82.193.1127388678.squirrel@webmail.ebi.ac.uk> References: <4331C53A.8000303@gmx.de> <1505.81.78.82.193.1127388678.squirrel@webmail.ebi.ac.uk> Message-ID: On 9/22/05, pmr at ebi.ac.uk wrote: > The graphics formats EMBOSS lists are the ones provided by the PLPLOT > library. How many of these are useful? Seems to be some legacy code there :) What is the difference between xwindows and x11 as graphic output format? -- La web sin popups ni spyware: Usa Firefox en lugar de Internet Explorer From David.Bauer at SCHERING.DE Thu Sep 22 10:28:37 2005 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Thu, 22 Sep 2005 16:28:37 +0200 Subject: [EMBOSS] Antwort: Re: "Invalid XY graph value 'png' " In-Reply-To: <1505.81.78.82.193.1127388678.squirrel@webmail.ebi.ac.uk> Message-ID: Hi Ulrike, the emboss configure script sometime picks up a wrong version of libgd if different versions are installed. This caused me some trouble on a very strangely configured solaris machine. Watch the configure output for a line which says somethink like "PNG driver found". Only if this is OK you will get a working png output. HTH, David. emboss-bounces at emboss.open-bio.org schrieb am 22/09/2005 13:31:18: > Hi Ulrike, > > > I want to use EMBOSS-programm 'iep' in Taverna - but when running it, I > > get the following error message: > > Error: Invalid XY graph value 'png' > > Died: iep terminated: Bad value for '-graph' with -auto defined > > ... > > > > Is there any possibility to turn off this graphical mode in acd-file? > > Or do I have to install something else (graphical drivers, etc.)? > > Taverna will need PNG output to convert into something it can view. > > You can follow Alan's instructions to reinstall with PNG. > > A quick question for everyone else : > > The graphics formats EMBOSS lists are the ones provided by the PLPLOT > library. How many of these are useful? > > regards, > > Peter Rice > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Thu Sep 22 12:00:47 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 22 Sep 2005 17:00:47 +0100 (BST) Subject: [EMBOSS] "Invalid XY graph value 'png' " In-Reply-To: References: <4331C53A.8000303@gmx.de> <1505.81.78.82.193.1127388678.squirrel@webmail.ebi.ac.uk> Message-ID: <1697.217.134.22.244.1127404847.squirrel@webmail.ebi.ac.uk> > On 9/22/05, pmr at ebi.ac.uk wrote: >> The graphics formats EMBOSS lists are the ones provided by the PLPLOT >> library. How many of these are useful? > > Seems to be some legacy code there :) Nope ... just a library that support old formats. But we do indeed plan to replace it :-) > What is the difference between xwindows and x11 as graphic output format? They are aliases for the same format. regards, Peter From sbassi at gmail.com Thu Sep 22 15:12:33 2005 From: sbassi at gmail.com (Sebastian Bassi) Date: Thu, 22 Sep 2005 16:12:33 -0300 Subject: [EMBOSS] "Invalid XY graph value 'png' " In-Reply-To: <1697.217.134.22.244.1127404847.squirrel@webmail.ebi.ac.uk> References: <4331C53A.8000303@gmx.de> <1505.81.78.82.193.1127388678.squirrel@webmail.ebi.ac.uk> <1697.217.134.22.244.1127404847.squirrel@webmail.ebi.ac.uk> Message-ID: On 9/22/05, pmr at ebi.ac.uk wrote: > > What is the difference between xwindows and x11 as graphic output format? > They are aliases for the same format. Ok, it won't hurt to put a little explanation like: Same as xwindows (next to x11). This would be helpful for converted Linux users. For people raised at Unix/Linux environment, is not an issue, but for the rest of us would help. -- La web sin popups ni spyware: Usa Firefox en lugar de Internet Explorer From ronnieoc at gmail.com Sat Sep 24 19:44:50 2005 From: ronnieoc at gmail.com (Ronnie O) Date: Sat, 24 Sep 2005 19:44:50 -0400 Subject: [EMBOSS] Seqret stdin issues In-Reply-To: <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> References: <6ceab7de05091515451ae539a8@mail.gmail.com> <6ceab7de05091905263552accb@mail.gmail.com> <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> Message-ID: <6ceab7de0509241644409f3ef1@mail.gmail.com> Hi Peter, First, thanks for your reply and sorry for my delay. I went with your suggestion of running seqret with the -debug flag set in hopes of finding something and heres what I came up with. First, I first ran seqret from the command line with the following command: ./seqret raw::testdna raw::stdout -filter -debug I created a file, "testdna", that simply held nucleotide characters in raw format. Execution was successful, as the sequence was output to the terminal window, and the seqret.dbg file was created in the emboss folder. Second, I ran my cocoa application which calls seqret with basically the same sequence of flags with the exception of "stdin" for "testdna": seqret raw::stdin raw::stdout -filter -debug My application is not receiving data from seqret as of this point. The seqret.dbg file was created in the build folder of my application. To decipher seqret's role in this fiasco, i analyzed the seqret.dbg files created in both instances. I can't say I am at all familiar with how to analyze them, but I took a quick look at both. Knowing my command line running of the program worked fine, I wanted to compare the debug files to see where seqret could be thrown off with my cocoa app call. Both files appear to have been logged to completion and I didn't notice any major differences between the two offhand. To make it easier, I ran a diff on the two files and below is the output of this (This will format poorly, i'm sure): ++seqUsaProcess 'raw::testdna' 0..0(N) '' 0 | ++seqUsaProcess 'raw::stdin' 0..0(N) '' 0 USA to test: 'raw::testdna' | USA to test: 'raw::stdin' unknown dbname testdna, try filename | unknown dbname stdin, try filename found filename testdna | found filename stdin ajSeqAccessFile testdna | ajSeqAccessFile stdin ajFileNewIn 'testdna' | ajFileNewIn 'stdin' ajFileBuffNobuff testdna buffsize: 0 | ajFileBuffNobuff stdin buffsize: 0 ++seqReadFmt format 42 (raw) 'raw::testdna' feat No | ++seqReadFmt format 42 (raw) 'raw::stdin' feat No read 'taccgcgcgtatccgtcgagcacacgtgtgccacacagcatcggtggccaatatt | Appending missing newline to 'aaaaaaaaa' > read 'aaaaaaaaa EOF ajFileGetsL file testdna | EOF ajFileGetsL file stdin ajFileNext for non-list file testdna | ajFileNext for non-list file stdin ajFileBuffClear 'testdna' (0 lines) | ajFileBuffClear 'stdin' (0 lines) ajSeqSetRange (len: 143 0..0 old 0..0) rev:No reversed:No | ajSeqSetRange (len: 9 0..0 old 0..0) rev:No reversed:No result: (len: 143 0..0) | result: (len: 9 0..0) ajSeqAllWrite '' len: 143 | ajSeqAllWrite '' len: 9 seqAllClone 0 .. 0 1 .. 143 len: 143 type: 'N' | seqAllClone 0 .. 0 1 .. 9 len: 9 type: 'N' seqSeqFormat numwidth old: 4 new: 4 | seqSeqFormat numwidth old: 2 new: 2 ajSeqRead: input file 'testdna' still there, try again | ajSeqRead: input file 'stdin' still there, try again ajFileBuffNobuff testdna buffsize: 0 | ajFileBuffNobuff stdin buffsize: 0 ++seqReadFmt format 42 (raw) 'raw::testdna' feat No | ++seqReadFmt format 42 (raw) 'raw::stdin' feat No at EOF: File already read to end testdna | at EOF: File already read to end stdin ajFileNext for non-list file testdna | ajFileNext for non-list file stdin ajFileBuffClear 'testdna' (0 lines) | ajFileBuffClear 'stdin' (0 lines) ajFileBuffEmpty Size: 0 Pos: 0 End: Y Handle: 3 Fp: a000dd44 | ajFileBuffEmpty Size: 0 Pos: 0 End: Y Handle: 3 Fp: a0001bc8 seqRead: *failed* to read sequence raw::testdna using format | seqRead: *failed* to read sequence raw::stdin using format ra ajSeqRead: open buffer usa: 'raw::testdna' returns: No | ajSeqRead: open buffer usa: 'raw::stdin' returns: No ajFileBuffClear 'testdna' (-1 lines) | ajFileBuffClear 'stdin' (-1 lines) closing file 'testdna' | closing file 'stdin' String usage (bytes): 12916 allocated, 9616 freed, 3300 in us | String usage (bytes): 12120 allocated, 9374 freed, 2746 in us String usage (number): 715 allocated, 326 freed 389 in use | String usage (number): 717 allocated, 328 freed 389 in use Memory usage (bytes): 42591 allocated, 128 reallocated 22004 | Memory usage (bytes): 41827 allocated, 128 reallocated 22036 Memory usage (number): 1903 allocates, 929 frees, 2 resizes, | Memory usage (number): 1907 allocates, 933 frees, 2 resizes, If this pasted output from diff is illegible, let me know how to better send it and I will resend. Or if the full dbg files would be more helpful, I can send them too. The only differences in the log files appear to be on lines where "testdna" is printed to the log vs "stdin" being printed. It can be seen that my sequence data is being received in both cases. And the only other differences are in length prints and the string and memory usage statistics. So my guess is that seqret is running just fine. My hypothesis is that I am not grabbing the output correctly in my cocoa app and I need to reformat my code on that end. Or is it possible that my output is somehow not being pushed to stdout (which i doubt)? If you could look at the differences in the debug files and assure me that in both cases that seqret is running correctly and throwing the output to stdout, then I can at least narrow my problem down to not grabbing stdout correctly. Also, if you would like the entire debug file from either, just let me know. Thanks again all! ........... Ronnie From ronnieoc at gmail.com Sat Sep 24 19:53:32 2005 From: ronnieoc at gmail.com (Ronnie O) Date: Sat, 24 Sep 2005 19:53:32 -0400 Subject: [EMBOSS] Seqret stdin issues In-Reply-To: <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> References: <6ceab7de05091515451ae539a8@mail.gmail.com> <6ceab7de05091905263552accb@mail.gmail.com> <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> Message-ID: <6ceab7de05092416537d8f12c8@mail.gmail.com> Just to clarify too about the output of diff, I had it output only the lines that were different. So all the other lines of the dbg files were identical. I didnt include that in the previous post. ...... Ronnie On 9/19/05, pmr at ebi.ac.uk wrote: > Ronnie wrote: > > > Unless anyone has any cocoa-specific/seqret piping > > suggestions? Thanks a lot, fellas! > > Just to point out that seqret would also support opening your application > as a pipe from within the USA - should give you the same result. We > support perl-style pipe definitions to launch applications as input files. > This is a feature of EMBOSS from the early days which nobody has (as far > as we know) used very much. > > You can also launch applications as database access methods, defining the > application, sending some "id" to the command line for the application, > and reading the results in seqret in some format definied in the database > definition. > > One point on reading from stdin ... EMBOSS 3.0.0 should be able to handle > various carriage return/line feed file formats, but earlier releases may > occasionally have problems. > > Running seqret with "-debug" on the commandline will create a seqret.dbg > file that should help tell you what is going on - for example, how far it > gets with trying to read your stdin input file. If you;re not sure what > the seqret.dbg file contents mean, you can send the file to me and I'll he > happy to take a look. > > Have fun! > > Peter > > From bobby_rgm at yahoo.com Mon Sep 26 00:05:08 2005 From: bobby_rgm at yahoo.com (chowdary manio) Date: Sun, 25 Sep 2005 21:05:08 -0700 (PDT) Subject: [EMBOSS] to use single program Message-ID: <20050926040508.85819.qmail@web53205.mail.yahoo.com> hello all, I am trying to make a tool for alignment using water and garnier programs in EMBOSS. I want to seperate the code of water and garnier to use them alone. I am unable to do that. Please let me know a way for this.. Is it possible to seperate up from EMBOSS? Thanks in anticipation, Bobby __________________________________ Yahoo! Mail - PC Magazine Editors' Choice 2005 http://mail.yahoo.com From pmr at ebi.ac.uk Mon Sep 26 04:23:07 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 26 Sep 2005 09:23:07 +0100 Subject: [EMBOSS] to use single program In-Reply-To: <20050926040508.85819.qmail@web53205.mail.yahoo.com> References: <20050926040508.85819.qmail@web53205.mail.yahoo.com> Message-ID: <4337AFEB.7060502@ebi.ac.uk> chowdary manio wrote: > hello all, > > I am trying to make a tool for alignment using water > and garnier programs in EMBOSS. > > I want to seperate the code of water and garnier to > use them alone. I am unable to do that. > > Please let me know a way for this.. > > Is it possible to seperate up from EMBOSS? Water and Garnier link to the EMBOSS libraries. Although you can in theory make standalone binaries (the sort yuo can copy to another system and expect them to run) it is tricky and we do not officially support EMBOSS programs copied that way. An alternative is to pick up the FASTA package from Virginia. FASTA includes the original versions of both garnier and matcher (the other local alignment program in EMBOSS - called lalign in FASTA). If you build these programs you will be able to copy them. Of course you will lose the EMBOSS standard command line checking and output options, but you will find most of the functionality you are likely to need is still in the FASTA programs. Hope that helps, Peter From pmr at ebi.ac.uk Mon Sep 26 04:42:45 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 26 Sep 2005 09:42:45 +0100 Subject: [EMBOSS] Seqret stdin issues In-Reply-To: <6ceab7de0509241644409f3ef1@mail.gmail.com> References: <6ceab7de05091515451ae539a8@mail.gmail.com> <6ceab7de05091905263552accb@mail.gmail.com> <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> <6ceab7de0509241644409f3ef1@mail.gmail.com> Message-ID: <4337B485.8080405@ebi.ac.uk> Ronnie O wrote: > Hi Peter, > First, thanks for your reply and sorry for my delay. I went with your > suggestion of running seqret with the -debug flag set in hopes of > finding something and heres what I came up with. > > First, I first ran seqret from the command line with the following command: > > ./seqret raw::testdna raw::stdout -filter -debug > > I created a file, "testdna", that simply held nucleotide characters in > raw format. Execution was successful, as the sequence was output to > the terminal window, and the seqret.dbg file was created in the emboss > folder. > > Second, I ran my cocoa application which calls seqret with basically > the same sequence of flags with the exception of "stdin" for > "testdna": > > seqret raw::stdin raw::stdout -filter -debug > > My application is not receiving data from seqret as of this point. It will be waiting to read from stdin (waiting for you to type something). You need to pipe the testdna file into the program, for example (depending on which shell you use): cat testdna | seqret raw::stdin raw::stdout -debug (-filter is not needed as you are already writing to stdout - but it does no harm) > Just to clarify too about the output of diff, I had it output only the > lines that were different. So all the other lines of the dbg files > were identical. That just shows the different input filename (stdin or testdna) and the first run succeeding. We need the seqret.dbg file froj a run that says something like: Unable to read sequence 'raw::stdin raw::stdout' Died: seqret terminated: Bad value for '-sequence' and no prompt to diagnose why it failed to read. Good luck! Peter From kellert at ohsu.edu Mon Sep 26 12:43:59 2005 From: kellert at ohsu.edu (Thomas J Keller) Date: Mon, 26 Sep 2005 09:43:59 -0700 Subject: [EMBOSS] fink installation In-Reply-To: <4337B485.8080405@ebi.ac.uk> References: <6ceab7de05091515451ae539a8@mail.gmail.com> <6ceab7de05091905263552accb@mail.gmail.com> <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> <6ceab7de0509241644409f3ef1@mail.gmail.com> <4337B485.8080405@ebi.ac.uk> Message-ID: <274093E0-38A4-4A16-AAC8-795EA82CCF45@ohsu.edu> Greetings, It's been awhile since I've used emboss. I had installed it using Fink on my Apple G4 running OS 10.3. $ fink apropos emboss Information about 138 packages read in 1 seconds. i emboss 2.9.0-3 Molecular Biology Open Software Suite i emboss-shlibs 2.9.0-3 Molecular Biology Open Software Suite I recently upgraded my OS from 10..3 to 10.4. So I'm currently running 10.4.2. This seems to have broken Emboss. Now I got the following message: $ tfm tfm dyld: Library not loaded: /usr/local/lib/libfreetype.6.dylib Referenced from: /sw/bin/tfm Reason: image not found Trace/BPT trap I'm surprised to see /sw/bin/tfm would reference a lib file in /usr/ local/lib and fink does not seem to have the libfreetype library. What am I missing? Thanks From kvddrift at earthlink.net Mon Sep 26 18:29:49 2005 From: kvddrift at earthlink.net (Koen van der Drift) Date: Mon, 26 Sep 2005 18:29:49 -0400 Subject: [EMBOSS] fink installation In-Reply-To: <274093E0-38A4-4A16-AAC8-795EA82CCF45@ohsu.edu> References: <6ceab7de05091515451ae539a8@mail.gmail.com> <6ceab7de05091905263552accb@mail.gmail.com> <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> <6ceab7de0509241644409f3ef1@mail.gmail.com> <4337B485.8080405@ebi.ac.uk> <274093E0-38A4-4A16-AAC8-795EA82CCF45@ohsu.edu> Message-ID: <7BD73F3C-5DCC-4518-BCED-22FB7023C4B4@earthlink.net> On Sep 26, 2005, at 12:43 PM, Thomas J Keller wrote: > Greetings, > It's been awhile since I've used emboss. I had installed it using > Fink on my Apple G4 running OS 10.3. > $ fink apropos emboss > Information about 138 packages read in 1 seconds. > i emboss 2.9.0-3 Molecular Biology Open Software > Suite > i emboss-shlibs 2.9.0-3 Molecular Biology Open Software > Suite > > > I recently upgraded my OS from 10..3 to 10.4. So I'm currently > running 10.4.2. Did you also update fink to the version for 10.4 ? See http:// fink.sourceforge.net/news/index.php for instructions. - Koen. From ulrich.bernhard at id.unizh.ch Tue Sep 27 02:47:31 2005 From: ulrich.bernhard at id.unizh.ch (Ulrich Bernhard) Date: Tue, 27 Sep 2005 08:47:31 +0200 Subject: [EMBOSS] dbxflat / dbiflat Message-ID: <4338EB03.9020906@id.unizh.ch> I just started to create the indozes for the whole embl database. I first tried to create the indizes with dbxflat: dbxflat -dbname embl -dbresource embl -date 24/09/05 -idformat embl -release 84.0 -directory /data/raw/embl -indexoutdir /data/emboss/embl -fields id,acc,sv,key,org -filenames *.dat But the job runs very very long. As an example, the dbiflat for fun*.dat tooks about 1:30 Min CPU time - the dbxflat for the same file tooks more than 20 Min CPU time. Is that normal? Thanks for any hint Ulrich -- +-----------------------------------------------------------+ | Ulrich Bernhard | | Informatikdienste Tel: (+41-44) 635 67 73 | | Universitaet Zuerich Fax: (+41-44) 635 45 05 | | Winterthurerstr. 190 | | CH-8057 Zuerich Email: ulrich.bernhard at id.unizh.ch | | Switzerland | +-----------------------------------------------------------+ From ajb at ebi.ac.uk Tue Sep 27 05:54:57 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Tue, 27 Sep 2005 10:54:57 +0100 (BST) Subject: [EMBOSS] dbxflat / dbiflat In-Reply-To: <4338EB03.9020906@id.unizh.ch> References: <4338EB03.9020906@id.unizh.ch> Message-ID: <49122.172.31.100.157.1127814897.squirrel@webmail.ebi.ac.uk> Dear Ulrich, > But the job runs very very long. As an example, the dbiflat for fun*.dat > tooks about 1:30 Min CPU time - the dbxflat for the same file tooks more > than 20 Min CPU time. > > Is that normal? It is certainly believable, depending on the resource settings. For the id, acc and sv indexes the dbx* programs have to create B+ trees; for the org, key & des indexes the dbx* programs have to create B+trees-of-B+trees. The extra work involved will account for the extra CPU. The B+ structures do allow for future on-the-fly updating of the indexes. The dbi* programs create much more simple indexes: but not updateable ones. The dbx* programs are still beta and some speedups can be introduced in later releases. HTH Alan From khayeni at cs.wits.ac.za Thu Sep 29 08:41:23 2005 From: khayeni at cs.wits.ac.za (Khayeni Ndlovu) Date: Thu, 29 Sep 2005 15:41:23 +0300 Subject: [EMBOSS] showdb not a valid emboss application Message-ID: <20050929123746.M32631@cs.wits.ac.za> hie folks i recently installed emboss and wemboss from source when i try to run a program from wemboss i get an error msg wEMBOSS: error... showdb is not a valid EMBOSS application please advise on how to rectify this thanks in advance for your assistance platform :Ubuntu hoary,apache 1.3 From ajb at ebi.ac.uk Thu Sep 29 11:04:39 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 29 Sep 2005 16:04:39 +0100 (BST) Subject: [EMBOSS] showdb not a valid emboss application In-Reply-To: <20050929123746.M32631@cs.wits.ac.za> References: <20050929123746.M32631@cs.wits.ac.za> Message-ID: <51451.81.96.70.96.1128006279.squirrel@webmail.ebi.ac.uk> Dear Khayeni, It is conceivable that someone on this list may be able to help you, however, this being a wEMBOSS rather than an EMBOSS problem you may have more success contacting the authors of wEMBOSS. Their email contact addresses are given on their www.wemboss.org homepage. HTH Alan Bleasby EBI > hie folks > > i recently installed emboss and wemboss from source when i try to run a > program from wemboss i get an error msg > > > wEMBOSS: error... > > showdb is not a valid EMBOSS application > > > > please advise on how to rectify this > > thanks in advance for your assistance > > platform :Ubuntu hoary,apache 1.3 > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From thiago.venancio at gmail.com Thu Sep 1 14:02:44 2005 From: thiago.venancio at gmail.com (Thiago Venancio) Date: Thu, 1 Sep 2005 11:02:44 -0300 Subject: [EMBOSS] Codon usage comparisons Message-ID: <44255ea8050901070221c93204@mail.gmail.com> Hi all. I have a couple questions about the codon usage comparisons in the EMBOSS. I have read some papers that use Factorial Correspondence Analysis to compensate for aminoacid composition. The EMBOSS tools compensate it by some other way or what we get could be a biased result? Regards. Thiago From pmr at ebi.ac.uk Thu Sep 1 14:55:49 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 1 Sep 2005 15:55:49 +0100 (BST) Subject: [EMBOSS] EMBL database IDs will disappear Message-ID: <1694.81.76.189.68.1125586549.squirrel@webmail.ebi.ac.uk> Next year (release 87) the EMBL database plans to have a new ID line - with no ID on it... See June 2006 changes in http://www.ebi.ac.uk/embl/Documentation/forthcomingchanges.html The primary accession number will be the only unique ID. The ID line will also have the sequence version, so the SV line will disappear (but there will still be a sequence version we can construct) Should EMBOSS still index ID (using the accession number)? Should we continue to use the ID from other databases that still do have ID and accession? There will be a file with the old IDs and the accession numbers they relate to - should be use this to keep IDs in the index files? Peter From pmr at ebi.ac.uk Fri Sep 2 14:58:25 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 02 Sep 2005 15:58:25 +0100 Subject: [EMBOSS] output of program "digest" as input for program "pepstats" ? In-Reply-To: <20050825121843.GA5549@bigben.ulb.ac.be> References: <430CD6F3.30306@gmx.de> <20050825121843.GA5549@bigben.ulb.ac.be> Message-ID: <43186891.3010807@ebi.ac.uk> Guy Bottu wrote: > Dear Ulrike, > > You can ask digest for a "Report Format" of type "List File", which you > can give as input to pepstats or iep (the peptides will be analyzed as > individual sequences and the results given the one aftert the other, they > are not merged). > > I have no experience with Taverna and hence cannot tell you exactly how > to. I know that at the command line you would have to : > digest mysequence -rformat=listfile -outfile=myreport > iep list::myreport In taverna, using the EBI SoapLab services to run EMBOSS you will not be able to use the -rformat qualifier - that will be added in a future release of SoapLab later this year. The current SoapLab has the EMBOSS qualifiers, but is missing some "associated qualifiers" including -rformat for reports and -aformat fopr alignments. If you have your own soaplab server running, one solution that has been tried is to change the rformat value in the digest.acd file to "listfile" - digest will then always produce the listfile version of the output. Hope that helps Peter From wjhaynes at wisc.edu Mon Sep 5 01:07:23 2005 From: wjhaynes at wisc.edu (W John Haynes) Date: Sun, 04 Sep 2005 20:07:23 -0500 Subject: [EMBOSS] installing zlib, libpng and gd Message-ID: <12aaf33b96daa981f2d097bed37cf40b@wisc.edu> To Whom it may concern: I am going through the process of installing and compiling the EMBOSS package for the first time. I have a G5 running OS.X.3.4 but I would say I am still a novice (this is an offline home computer). I have installed and used the BLAST package from NCBI and the Phyllip package but overall, I would say that I am still unfamiliar with installing and compiling programs. I do not yet have much experience. I have down-loaded the tar.gz files from the EMBOSS ftp site. As I was reading the Admin manual on installation there is a requirement to download and install three more tar.gz files called z, png and gd libraries. What will these actually do for the program and will this cause any conflicts with other programs previously installed? For instance I had previously installed the Phyllip package of programs, what will happen if I install the set included in the EMBOSS package? If I do not move the Phyllip package into the EMBOSS folder and expand it, will the EMBOSS install correctly? Does the installation of these libraries cause any other problems any other programs? Thanks for the help W. John Haynes From kvddrift at earthlink.net Mon Sep 5 11:02:28 2005 From: kvddrift at earthlink.net (Koen van der Drift) Date: Mon, 5 Sep 2005 07:02:28 -0400 Subject: [EMBOSS] installing zlib, libpng and gd In-Reply-To: <12aaf33b96daa981f2d097bed37cf40b@wisc.edu> References: <12aaf33b96daa981f2d097bed37cf40b@wisc.edu> Message-ID: Hi John, You may want to check out the fink project (http://fink.sf.net). It's a package manager to help with installing unix software on your Mac. If you use it to install emboss, it will automatically install all other packages that are needed (such as libpng and gd). The zlib package already comes with Mac OS X, I guess the admin guide was written for an older Mac OS X version. cheers, - Koen. On Sep 4, 2005, at 9:07 PM, W John Haynes wrote: > To Whom it may concern: > > I am going through the process of installing and compiling the EMBOSS > package for the first time. I have a G5 running OS.X.3.4 but I would > say I am still a novice (this is an offline home computer). I have > installed and used the BLAST package from NCBI and the Phyllip package > but overall, I would say that I am still unfamiliar with installing > and > compiling programs. I do not yet have much experience. I have > down-loaded the tar.gz files from the EMBOSS ftp site. As I was > reading the Admin manual on installation there is a requirement to > download and install three more tar.gz files called z, png and gd > libraries. What will these actually do for the program and will this > cause any conflicts with other programs previously installed? > For instance I had previously installed the Phyllip package of > programs, what will happen if I install the set included in the EMBOSS > package? If I do not move the Phyllip package into the EMBOSS folder > and expand it, will the EMBOSS install correctly? Does the > installation of these libraries cause any other problems any other > programs? > > Thanks for the help > W. John Haynes > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From jison at ebi.ac.uk Tue Sep 6 10:11:15 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Tue, 6 Sep 2005 11:11:15 +0100 (BST) Subject: [EMBOSS] installing zlib, libpng and gd In-Reply-To: <12aaf33b96daa981f2d097bed37cf40b@wisc.edu> References: <12aaf33b96daa981f2d097bed37cf40b@wisc.edu> Message-ID: <38013.172.31.8.12.1126001475.squirrel@webmail.ebi.ac.uk> Hi John > download and install three more tar.gz files called z, png and gd > libraries. What will these actually do for the program PNG (http://www.libpng.org/pub/png/) is an image file format. libpng is used in application programs to support the PNG file format. libpng uses zlib (http://www.zlib.net/) for compression of & decompression of PNG files. GD (http://www.boutell.com/gd/) is for the dynamic creation of images (e.g. in PNG, JPEG, GIF formats). > and will this > cause any conflicts with other programs previously installed? No, unless a program only works with an old version of the above (unlikely). > For instance I had previously installed the Phyllip package of > programs, what will happen if I install the set included in the EMBOSS > package? There shouldn't be any conflicts and you should be able to use either version. > If I do not move the Phyllip package into the EMBOSS folder > and expand it, will the EMBOSS install correctly? Yes. > Does the installation of these libraries cause any other problems > any other programs? see above Cheers Jon From jison at ebi.ac.uk Tue Sep 6 10:52:56 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Tue, 6 Sep 2005 11:52:56 +0100 (BST) Subject: [EMBOSS] Codon usage comparisons In-Reply-To: <44255ea8050901070221c93204@mail.gmail.com> References: <44255ea8050901070221c93204@mail.gmail.com> Message-ID: <38051.172.31.8.12.1126003976.squirrel@webmail.ebi.ac.uk> Dear Thiago So far as I'm aware there's no compensation made for amino acid composition, but it would be a nice complement to programs such as cai (http://emboss.sourceforge.net/apps/cai.html). If you could let us know the key papers and whether any code exists we can consider incorporating such in the future. Cheers Jon > Hi all. > I have a couple questions about the codon usage comparisons in the EMBOSS. > I have read some papers that use Factorial Correspondence Analysis to > compensate for aminoacid composition. The EMBOSS tools compensate it by > some > other way or what we get could be a biased result? > > Regards. > > Thiago > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From jison at ebi.ac.uk Tue Sep 6 12:34:54 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Tue, 6 Sep 2005 13:34:54 +0100 (BST) Subject: [EMBOSS] embossrc - configure database NPRD and AEdb In-Reply-To: <5aa3b3570508241221142887a8@mail.gmail.com> References: <5aa3b3570508241221142887a8@mail.gmail.com> Message-ID: <38091.172.31.8.12.1126010094.squirrel@webmail.ebi.ac.uk> Dear Giovanni The EMBOSS Administrators Guide (http://emboss.sourceforge.net/docs/adminguide/) should help, specificially the section on databases: http://emboss.sourceforge.net/docs/adminguide/node4.html#SECTION00420000000000000000 If it doesn't feel free to get back in touch. Cheers Jon > Hi all, > I'm trying to configure this two databases in my .embossrc - > emboss_default > , but I didn't managed to get it works: > > http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz?-page+LibInfo+-id+3Xn_71Qks76+-lib+NUCLEOSOME > http://www.ebi.ac.uk/asd-srv/AEdb-query.cgi?method=MAIN&visit=first > > For the first one, I've tried this: > > DB NPRD [ > method: srswww > format: embl > # url: " > http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz?-id+1YUkq1Qk6fN+-e+[NUCLEOSOME:'%s'] > " > # url: " > http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz?-page+LibInfo+-id+3Xn_71QkMvb+-lib+NUCLEOSOME > " > # url: " > http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz?-id+-e+[NUCLEOSOME:'%s']" > url: "http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz" > type: N > dbalias: NUCLEOSOME > app: getz > fields: "AC SQ" > ] > > But what's is wrong? How can I understand what is the 'correct' url to > choose, and how can I determine the right 'method' and 'format'? > I've seen that in the main page of this database, there are description > about the syntax and the and the structure in SRS. For example, can I use > the informations described here: > http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz?-page+icarusFile+-id+3Xn_71Qks76+-l+NUCLEOSOME+-ifile+i? > > Thank you for any reply. > Giovanni > > -- > ----------------------------------------------------------- > > Visit my website! > http://dalloliogm.altervista.org > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From pmr at ebi.ac.uk Tue Sep 6 13:09:36 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 06 Sep 2005 14:09:36 +0100 Subject: [EMBOSS] embossrc - configure database NPRD and AEdb In-Reply-To: <38091.172.31.8.12.1126010094.squirrel@webmail.ebi.ac.uk> References: <5aa3b3570508241221142887a8@mail.gmail.com> <38091.172.31.8.12.1126010094.squirrel@webmail.ebi.ac.uk> Message-ID: <431D9510.2030802@ebi.ac.uk> Dear Giovanni >>Hi all, >>I'm trying to configure this two databases in my .embossrc - >>emboss_default >>, but I didn't managed to get it works: >> >>http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz?-page+LibInfo+-id+3Xn_71Qks76+-lib+NUCLEOSOME >>http://www.ebi.ac.uk/asd-srv/AEdb-query.cgi?method=MAIN&visit=first For the SRS database, yes you should use SRSWWW ... but ... The NUCLEOSOME database at that site has problems: No standard field names (not even ID) Parser errors in SRS No text view Non-standard format No FASTA format view Even if we try the URL method, there seems to be no URL to produce output that EMBOSS can understand. From the list of public SRS servers, this is the only server that has this database. The only solution at present is to write a script (in Perl, for example) that can fetch and reformat an entry from this server, and write it in (for example) FASTA format, and to use this script with the "external" access method from EMBOSS. For the EBI Alternate Exons Database query: Again, there is no URL that returns a standard format EMBOSS can use, so a script is the best solution. You also need to decide what sequence you need (I assume the exon, but there are other sequences in the results) We are working on ways to use more complex queries and more data formats - as part of the EMBRACE project at EBI. But this will take time before it can be used for these queries. Hope this helps, Peter From sbassi at gmail.com Thu Sep 8 17:00:18 2005 From: sbassi at gmail.com (Sebastian Bassi) Date: Thu, 8 Sep 2005 14:00:18 -0300 Subject: [EMBOSS] Problem with PNG driver Message-ID: Hello, I tried to install EMBOSS 3 and got stuck in config step. This is Ubuntu Linux server installation. So I want to configure it without-x but WITH PNG support. According to the EMBOSS FAQ (http://emboss.sourceforge.net/docs/faq.html), png should be enabled automagically if I have required packages. Here is the extract of the FAQ: " If you have gd-1.7.3, zlib-1.1.3 and libpng-1.0.5 or greater then the normal configure/compile should work!" Here are the relevant programs I have installed (taken from dpkg -l): ii libgd2 2.0.33-1.1ubun GD Graphics Library version 2 ii libgd2-noxpm 2.0.33-1.1ubun GD Graphics Library version 2 (without XPM s ii zlib1g 1.2.2-4ubuntu1 compression library - runtime ii libpng10-0 1.0.18-1 PNG library, older version - runtime ii libpng12-0 1.2.8rel-1 PNG library - runtime It seems I have all that is required to produce a working EMBOSS with PNG support. But when I do a configure I get: sbassi at userver:~/EMBOSS-3.0.0$ ./configure --without-x ...lot of info cut... checking if png driver is wanted... yes checking for inflateEnd in -lz... no No png driver will be made due to librarys missing/old. .... Here is the full output (without all the creating ... at the end). checking for a BSD-compatible install... /usr/bin/install -c checking whether build environment is sane... yes checking for gawk... gawk checking whether make sets $(MAKE)... yes checking for gawk... (cached) gawk checking for gcc... gcc checking for C compiler default output file name... a.out checking whether the C compiler works... yes checking whether we are cross compiling... no checking for suffix of executables... checking for suffix of object files... o checking whether we are using the GNU C compiler... yes checking whether gcc accepts -g... yes checking for gcc option to accept ANSI C... none needed checking for style of include used by make... GNU checking dependency style of gcc... gcc3 checking how to run the C preprocessor... gcc -E checking build system type... i686-pc-linux-gnu checking host system type... i686-pc-linux-gnu checking for a sed that does not truncate output... /bin/sed checking for egrep... grep -E checking for ld used by gcc... /usr/bin/ld checking if the linker (/usr/bin/ld) is GNU ld... yes checking for /usr/bin/ld option to reload object files... -r checking for BSD-compatible nm... /usr/bin/nm -B checking whether ln -s works... yes checking how to recognise dependent libraries... pass_all checking for ANSI C header files... yes checking for sys/types.h... yes checking for sys/stat.h... yes checking for stdlib.h... yes checking for string.h... yes checking for memory.h... yes checking for strings.h... yes checking for inttypes.h... yes checking for stdint.h... yes checking for unistd.h... yes checking dlfcn.h usability... yes checking dlfcn.h presence... yes checking for dlfcn.h... yes checking for g++... g++ checking whether we are using the GNU C++ compiler... yes checking whether g++ accepts -g... yes checking dependency style of g++... gcc3 checking how to run the C++ preprocessor... g++ -E checking for g77... no checking for f77... no checking for xlf... no checking for frt... no checking for pgf77... no checking for fort77... no checking for fl32... no checking for af77... no checking for f90... no checking for xlf90... no checking for pgf90... no checking for epcf90... no checking for f95... no checking for fort... no checking for xlf95... no checking for ifc... no checking for efc... no checking for pgf95... no checking for lf95... no checking for gfortran... no checking whether we are using the GNU Fortran 77 compiler... no checking whether accepts -g... no checking the maximum length of command line arguments... 32768 checking command to parse /usr/bin/nm -B output from gcc object... ok checking for objdir... .libs checking for ar... ar checking for ranlib... ranlib checking for strip... strip checking if gcc static flag works... yes checking if gcc supports -fno-rtti -fno-exceptions... no checking for gcc option to produce PIC... -fPIC checking if gcc PIC flag -fPIC works... yes checking if gcc supports -c -o file.o... yes checking whether the gcc linker (/usr/bin/ld) supports shared libraries... yes checking whether -lc should be explicitly linked in... no checking dynamic linker characteristics... GNU/Linux ld.so checking how to hardcode library paths into programs... immediate checking whether stripping libraries is possible... yes checking if libtool supports shared libraries... yes checking whether to build shared libraries... yes checking whether to build static libraries... yes configure: creating libtool appending configuration tag "CXX" to libtool checking for ld used by g++... /usr/bin/ld checking if the linker (/usr/bin/ld) is GNU ld... yes checking whether the g++ linker (/usr/bin/ld) supports shared libraries... yes checking for g++ option to produce PIC... -fPIC checking if g++ PIC flag -fPIC works... yes checking if g++ supports -c -o file.o... yes checking whether the g++ linker (/usr/bin/ld) supports shared libraries... yes checking dynamic linker characteristics... GNU/Linux ld.so checking how to hardcode library paths into programs... immediate checking whether stripping libraries is possible... yes appending configuration tag "F77" to libtool checking whether byte ordering is bigendian... no checking for a BSD-compatible install... /usr/bin/install -c checking whether ln -s works... yes checking whether make sets $(MAKE)... (cached) yes checking for ranlib... (cached) ranlib checking for X... disabled checking for dirent.h that defines DIR... yes checking for library containing opendir... none required checking for ANSI C header files... (cached) yes checking for unistd.h... (cached) yes checking for an ANSI C-conforming const... yes checking for pid_t... yes checking for size_t... yes checking whether struct tm is in sys/time.h or time.h... time.h checking whether getpgrp requires zero arguments... yes checking for strftime... yes checking for unistd.h... (cached) yes checking vfork.h usability... no checking vfork.h presence... no checking for vfork.h... no checking for fork... yes checking for vfork... yes checking for working fork... yes checking for working vfork... (cached) yes checking for vprintf... yes checking for _doprnt... no checking for memmove... yes checking for gethostbyname in -lc... yes checking for socket in -lc... yes checking for main in -lm... yes checking if docroot is given... no checking if gcc profiling is selected... no checking if java include directory given... no checking if java OS include directory given... no checking if png driver is wanted... yes checking for inflateEnd in -lz... no No png driver will be made due to librarys missing/old. checking if any authorisation type is given... no checking for gdome2... no checking for large file support... done checking for purify... no checking if any threading type is given... no configure: creating ./config.status config.status: creating plplot/Makefile config.status: creating plplot/lib/Makefile I don't understand what is missing :( -- La web sin popups ni spyware: Usa Firefox en lugar de Internet Explorer From ajb at ebi.ac.uk Thu Sep 8 17:21:31 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 8 Sep 2005 18:21:31 +0100 (BST) Subject: [EMBOSS] Problem with PNG driver In-Reply-To: References: Message-ID: <44891.81.96.71.66.1126200091.squirrel@webmail.ebi.ac.uk> On Debian-style systems PNG, GD and ZLIB will only be recognised if you've installed the corresponding 'devel' packages. You may run into problems configuring without X11, but the above should get PNG going. If you decide to install X11 then make sure you install the development packages for that as well. HTH Alan From sbassi at gmail.com Thu Sep 8 17:25:08 2005 From: sbassi at gmail.com (Sebastian Bassi) Date: Thu, 8 Sep 2005 14:25:08 -0300 Subject: [EMBOSS] Problem with PNG driver In-Reply-To: <44891.81.96.71.66.1126200091.squirrel@webmail.ebi.ac.uk> References: <44891.81.96.71.66.1126200091.squirrel@webmail.ebi.ac.uk> Message-ID: OK, I am going to try to install the dev packages. Regarding the "without-x", why would I need x in a server that will be accessed using ssh or web (via wEMBOSS)? Do any of the EMBOSS programs requires? Thank you very much! -- La web sin popups ni spyware: Usa Firefox en lugar de Internet Explorer From smiddha at indiana.edu Thu Sep 8 17:46:52 2005 From: smiddha at indiana.edu (Sumit Middha) Date: Thu, 08 Sep 2005 12:46:52 -0500 Subject: [EMBOSS] Embassy tools In-Reply-To: References: <39102.129.111.174.49.1124381885.squirrel@biochem.uthscsa.edu> Message-ID: <4320790C.6090508@indiana.edu> Hi, I have recently installed Emboss-3.0. However I wanted to use fneighbor which I figured is not included. I tried looking online, but got confused as to how to go about installing these extra Embassy programs and integrating them with emboss, emboss-explorer, etc. Can someone suggest please. Thanks. Sumit From ajb at ebi.ac.uk Thu Sep 8 18:23:33 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 8 Sep 2005 19:23:33 +0100 (BST) Subject: [EMBOSS] Problem with PNG driver In-Reply-To: References: <44891.81.96.71.66.1126200091.squirrel@webmail.ebi.ac.uk> Message-ID: <35233.81.96.71.66.1126203813.squirrel@webmail.ebi.ac.uk> In theory you're quite right, you don't need X11 on such a system. There are ways that some OS/distribution setups can fool the --without-x switch though; so you may find that in practice that compilation with X11 is the path of least resistance. That is one of several areas of configuration that I'll be overhauling in the near future. Alan From David.Bauer at SCHERING.DE Fri Sep 9 05:48:44 2005 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Fri, 9 Sep 2005 07:48:44 +0200 Subject: [EMBOSS] Antwort: Embassy tools In-Reply-To: <4320790C.6090508@indiana.edu> Message-ID: The adminguide http://emboss.sourceforge.net/docs/adminguide/ contains a section about installing embassy apps. All userinterfaces which make use of the acd files (like Jemboss, Luke's GUI etc.) will smoothly integrate the embassy apps once they are installed. David. emboss-bounces at emboss.open-bio.org schrieb am 08/09/2005 19:46:52: > Hi, > I have recently installed Emboss-3.0. However I wanted to use fneighbor > which I figured is not included. I tried looking online, but got > confused as to how to go about installing these extra Embassy programs > and integrating them with emboss, emboss-explorer, etc. > > Can someone suggest please. > > Thanks. > Sumit > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss From ajb at ebi.ac.uk Fri Sep 9 06:31:34 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 9 Sep 2005 07:31:34 +0100 (BST) Subject: [EMBOSS] Embassy tools In-Reply-To: <4320790C.6090508@indiana.edu> References: <39102.129.111.174.49.1124381885.squirrel@biochem.uthscsa.edu> <4320790C.6090508@indiana.edu> Message-ID: <56436.81.96.71.66.1126247494.squirrel@webmail.ebi.ac.uk> There are also instructions at: http://emboss.sourceforge.net/docs/faq.html Look for "Q) Installing associated software PHYLIP". You need the instructions in part 'b)' of that question as you are not using the CVS version of EMBOSS. To summarise what's there in case it was that documentation which confused you, if you installed EMBOSS-3.0.0 using: ./configure --prefix=/usr/local/emboss [and any other options you chose] make make install Then you install PHYLIP using: ./configure --prefix=/usr/local/emboss [and any other options you chose] make make install There is only one exception and that is if you installed EMBOSS-3.0.0 using: ./configure make make install (i.e. you didn't supply a --prefix). In this case you have to supply an extra flag to the EMBASSY package configuration i.e. ./configure --enable-localforce make make install We recommend that you use the first approach (i.e supply a --prefix) to have EMBOSS installed in a directory of its own. The instructions at the URL above were updated last night and replace those in the EMBOSS-3.0.0/FAQ file. HTH Alan From ulrike.kaule at gmx.de Fri Sep 9 06:42:18 2005 From: ulrike.kaule at gmx.de (Ulrike Kaule) Date: Fri, 09 Sep 2005 08:42:18 +0200 Subject: [EMBOSS] output of program "digest" as input for program "pepstats" ? Message-ID: <43212ECA.2030608@gmx.de> Dear Peter, thank you very much for your help. I installed emboss locally now and I can specify output 'listfile' for digest. But the following programm (pepstats or iep) does not accept that as input (in taverna). I get the error message "Unknown input format 'listfile' ". Then I tried to specify the input format using the sformat-qualifier, but this doesn't work. My question is: is there any possibility to specify the right input format in the acd-file. Or do I have to use an other input-qualifier to tell pepstats the format? Thank you in advance Ulrike Kaule Guy Bottu wrote: > Dear Ulrike, > > You can ask digest for a "Report Format" of type "List File", which > you can give as input to pepstats or iep (the peptides will be > analyzed as individual sequences and the results given the one aftert > the other, they are not merged). > > I have no experience with Taverna and hence cannot tell you exactly > how to. I know that at the command line you would have to : > digest mysequence -rformat=listfile -outfile=myreport > iep list::myreport In taverna, using the EBI SoapLab services to run EMBOSS you will not be able to use the -rformat qualifier - that will be added in a future release of SoapLab later this year. The current SoapLab has the EMBOSS qualifiers, but is missing some "associated qualifiers" including -rformat for reports and -aformat fopr alignments. If you have your own soaplab server running, one solution that has been tried is to change the rformat value in the digest.acd file to "listfile" - digest will then always produce the listfile version of the output. Hope that helps Peter Hello, I'm a new user to emboss. Within a Taverna-Workflow I want to digest a protein-sequence first with the emboss-program "digest" and to use the output of "digest" - the seqtable with the fragments - as an input for further sequence-analysis programs. So the resulting fragments should be analysed by pepstats or iep. But I have problems with the connection of these programs, because the output of "digest" is not accepted by the other programs as input. I thougth to solve this problem with using "seqret" between "digest" and "pepstats", but this doesn't work. Is there any solution to extract the protein-fragments produced by "digest" and to use them as input for other programs? Thank you in advance Ulrike From easmith at beatrice.rutgers.edu Mon Sep 12 05:25:37 2005 From: easmith at beatrice.rutgers.edu (Allen Smith) Date: Mon, 12 Sep 2005 01:25:37 -0400 Subject: [EMBOSS] dbxfasta giving error in ajindex.c at line 541: Maximum retries (100) reached in btreeCacheFetch for page 0 Message-ID: Hi. Attempting to do a dbxfasta index of the NCBI nr (FASTA-format) file is giving the error: EMBOSS An error in ajindex.c at line 541: Maximum retries (100) reached in btreeCacheFetch for page 0 I have tried PAGESIZE 2048 and CACHESIZE 200, also PAGESIZE 4096 with CACHESIZE 100; same result. Also same result with either: dbxfasta -dbname nr -dbresource fasta -idformat ncbi -directory /disk2/usr/EMBL -filenames nr -date 11/09/05 -fields id,acc,des -indexoutdir ~/lib/EMBOSS/data/indexes/nr or dbxfasta -dbname nr -dbresource fasta -idformat ncbi -directory /disk2/usr/EMBL -filenames nr -date 11/09/05 -indexoutdir ~/lib/EMBOSS/data/indexes/nr The second is with emboss.default containing: RES fasta [ type: Index idlen: 15 acclen: 15 svlen: 10 deslen: 20 orglen: 15 ] I'm running on SGI IRIX64 6.5.20m. configure was done with --with-thread=irix --without-java --with-sgiabi --enable-large --disable-static --disable-64 plus various options for --prefix et al. dbxflat is currently running on sprot.dat and trembl.dat with no problems so far. Thanks, -Allen P.S. BTW, it is rather inconvenient how many places are hardwired to have ${prefix}/share/EMBOSS/ and do not pay attention to --datadir from configure. Something to work on (I will if I ever get the time, although that seems unlikely at the moment!)... -- Allen Smith http://cesario.rutgers.edu/easmith/ February 1, 2003 Space Shuttle Columbia Ad Astra Per Aspera To The Stars Through Asperity From ajb at ebi.ac.uk Mon Sep 12 06:09:03 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Mon, 12 Sep 2005 07:09:03 +0100 (BST) Subject: [EMBOSS] dbxfasta giving error in ajindex.c at line 541: Maximum retries (100) reached in btreeCacheFetch for page 0 In-Reply-To: References: Message-ID: <48035.81.96.71.66.1126505343.squirrel@webmail.ebi.ac.uk> Dear Allen, Is that with or without using the fixed 'ajindex.c' file from: ftp://emboss.open-bio.org/pub/EMBOSS/fixes/ If that doesn't fix it then get back to me offlist. I'll be looking at the configuration in the near future. HTH Alan From ulrike.kaule at gmx.de Mon Sep 12 18:10:09 2005 From: ulrike.kaule at gmx.de (Ulrike Kaule) Date: Mon, 12 Sep 2005 20:10:09 +0200 Subject: [EMBOSS] EMBOSS-3.0.0: changes in local acd-file are not realized Message-ID: <4325C481.2050701@gmx.de> Hello, I installed EMBOSS-3.0.0 locally, because I want to make some changes in acd-file, especially I want to change the format of the output from the default "seqtable" to "gff", because I need this setting for work with taverna. But the problem is, that this change is not realized, when I run the EMBOSS-programm (digest in this case). I changed acd-file in directory /usr/local/EMBOSS-3.0.0/emboss/acd. It looks now like ... report: outfile [ parameter: "Y" rformat: "gff" multiple: "Y" taglist: "float:molwt=Mol_Weight str:cterm str:nterm" ] When I start this programm on command-line with no specification for the -rformat-option (../../emboss/digest myseq -outfile=myreport) - it should now take the rformat from acd-file - then the rformat is still seqtable. When starting with ../../emboss/digest myseq -rformat=gff -outfile=myreport, then it produces the right output - gff. Why is the setting in acd-file not recognized? Do I have to do any recompilation after changing the acd-file? Thanks in advance Ulrike Kaule From pmr at ebi.ac.uk Tue Sep 13 07:14:01 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 13 Sep 2005 08:14:01 +0100 Subject: [EMBOSS] EMBOSS-3.0.0: changes in local acd-file are not realized In-Reply-To: <4325C481.2050701@gmx.de> References: <4325C481.2050701@gmx.de> Message-ID: <43267C39.5050207@ebi.ac.uk> Ulrike Kaule wrote: > I changed acd-file in > directory /usr/local/EMBOSS-3.0.0/emboss/acd. It looks now like > ... > report: outfile [ > parameter: "Y" > rformat: "gff" > multiple: "Y" > taglist: "float:molwt=Mol_Weight str:cterm str:nterm" > ] > > When I start this programm on command-line with no specification for the > -rformat-option (../../emboss/digest myseq -outfile=myreport) - it > should now take the rformat from acd-file - then the rformat is still > seqtable. When starting with ../../emboss/digest myseq -rformat=gff > -outfile=myreport, then it produces the right output - gff. > Why is the setting in acd-file not recognized? Do I have to do any > recompilation after changing the acd-file? EMBOSS will use an installed ACD file if it can find it. If you cd to the emboss/acd directory and "make install" it will install the modified digest.acd file. To find out which ACD file was used, you can run "digest -debug" and look in the digest.dbg file for the full path to digest.acd Hope that helps, Peter From atorrano at lsi.upc.edu Tue Sep 13 08:34:07 2005 From: atorrano at lsi.upc.edu (Alexis Torrano Martinez) Date: Tue, 13 Sep 2005 10:34:07 +0200 (MET DST) Subject: [EMBOSS] copying emboss indexes to another directory Message-ID: <3841799499atorrano@lsi.upc.es> Hello I would like to know if there is any problem if I copy my emboss index files to another directory and then define another database description in the emboss.default configuration file. I have been moving files from our current disk to another with more room, will it be necessary to regenerate the indexes again with dbiflat? Some error messages : seqret UniProtRebost:108_LYCES Reads and writes (returns) sequences Error: Cannot open database file 'uniprot_sprot.dat' Error: Unable to read sequence 'UniProtRebost:108_LYCES' Died: seqret terminated: Bad value for '-sequence' and no prompt ## UniProtRebost is the definition for our UniProt at the new disk. Done some debugging to seqret with -debug option. It seemed seqret was searching for uniprot_sprot.dat at the same directory in the new disk where I copied the indexes I had on the old disk. A lot of thanks! Alexis. ----------------------------------------------------- Alexis Torrano Martinez e-mail: atorrano at lsi.upc.edu Nodo Computacional GNHC-2 UPC-CIRI (inb.lsi.upc.edu) Instituto Nacional de Bioinformatica (www.inab.org) Barcelona Supercomputing Center Node (www.bsc.es) c/. Jordi Girona 29 Edifici Nexus II, despatx 113 Tel: (+34) 93 413 4037 E-08034 Barcelona Fax: (+34) 93 401 7055 Catalunya (Spain) Team info: http://www.inab.org/~malaga/MOWServ/services/HELP/MarcoBajo/team.html ----------------------------------------------------- From jison at ebi.ac.uk Tue Sep 13 09:46:23 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Tue, 13 Sep 2005 10:46:23 +0100 (BST) Subject: [EMBOSS] copying emboss indexes to another directory In-Reply-To: <3841799499atorrano@lsi.upc.es> References: <3841799499atorrano@lsi.upc.es> Message-ID: <33810.172.31.8.12.1126604783.squirrel@webmail.ebi.ac.uk> Dear Alexis Typically index files are kept in the same directory as the database itself. It is ok to move the index & database files (no need to regenerate the indices) so long as you reconfigure the database by updating the database declaration in your configuration files*. Use 'showdb' to get a list of valid database names currently set up. The maintenance of your config files is easier if you specify the location of your databases as an environment variable. Then if you move things you only need to update one line: set emboss_database_dir /data/databases/flatfiles This would then be referred to later in .embossrc as \$emboss_database_dir/embl for the directory /data/databases/flatfiles/embl If that doesn't help please get back in touch. Cheers Jon * emboss.default (share/EMBOSS subdirectory of your installation) or .embossrc files (in the directory specified by the EMBOSSRC environment variable / your home directory / current directory). See the admin guide: http://emboss.sourceforge.net/docs/adminguide/node4.html > > Hello > > I would like to know if there is any problem if I copy my emboss index > files to another directory and then define another database description > in the emboss.default configuration file. > I have been moving files from our current disk to another with more > room, will it be necessary to regenerate the indexes again with dbiflat? > > > > > Some error messages : > > seqret UniProtRebost:108_LYCES > Reads and writes (returns) sequences > Error: Cannot open database file 'uniprot_sprot.dat' > Error: Unable to read sequence 'UniProtRebost:108_LYCES' > Died: seqret terminated: Bad value for '-sequence' and no prompt > > ## UniProtRebost is the definition for our UniProt at the new disk. > > Done some debugging to seqret with -debug option. It seemed seqret was > searching for uniprot_sprot.dat at the same directory in the new disk > where I copied the indexes I had on the old disk. > > > A lot of thanks! > > > Alexis. > > > ----------------------------------------------------- > Alexis Torrano Martinez > e-mail: atorrano at lsi.upc.edu > > Nodo Computacional GNHC-2 UPC-CIRI (inb.lsi.upc.edu) > Instituto Nacional de Bioinformatica (www.inab.org) > Barcelona Supercomputing Center Node (www.bsc.es) > > c/. Jordi Girona 29 > Edifici Nexus II, despatx 113 Tel: (+34) 93 413 4037 > E-08034 Barcelona Fax: (+34) 93 401 7055 > Catalunya (Spain) > Team info: > http://www.inab.org/~malaga/MOWServ/services/HELP/MarcoBajo/team.html > ----------------------------------------------------- > > > > > > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From Marc.Logghe at DEVGEN.com Wed Sep 14 09:06:28 2005 From: Marc.Logghe at DEVGEN.com (Marc Logghe) Date: Wed, 14 Sep 2005 11:06:28 +0200 Subject: [EMBOSS] Cusp cfile option Message-ID: <0C528E3670D8CE4B8E013F6749231AA62F5568@ANTARESIA.be.devgen.com> Hi all, I was wondering what the purpose was for the -cfile option in cusp. After all, cusp *creates* a cut file, so why should it need one ? Also, where can I find out about the species for the CODONS/*.cut files. I looked inside these for a comment or something, but nothing was there. For instance, Eyeast.cut is obvious, but what species is used for Eyen.cut ? Just curious. Thanks, Marc From jison at ebi.ac.uk Wed Sep 14 09:57:51 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Wed, 14 Sep 2005 10:57:51 +0100 (BST) Subject: [EMBOSS] Cusp cfile option In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA62F5568@ANTARESIA.be.devgen.com> References: <0C528E3670D8CE4B8E013F6749231AA62F5568@ANTARESIA.be.devgen.com> Message-ID: <35210.172.31.8.12.1126691871.squirrel@webmail.ebi.ac.uk> Dear Marc "-cfile" isn't a valid option for cusp (at least, in my installation) Perhaps you were referring to a different program ? cusp reads a codon usage data file* as a template but doesn't use any of the data - so any file from any species will give the same results. Cheers Jon (*from your current working directory ('.'), "embossdata" subdirectory in '.', your home directory (~) or "embossdata" subdirectory in '~'. > Hi all, > I was wondering what the purpose was for the -cfile option in cusp. > After all, cusp *creates* a cut file, so why should it need one ? > Also, where can I find out about the species for the CODONS/*.cut files. > I looked inside these for a comment or something, but nothing was there. > For instance, Eyeast.cut is obvious, but what species is used for > Eyen.cut ? > Just curious. > Thanks, > Marc > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From Marc.Logghe at DEVGEN.com Wed Sep 14 10:04:46 2005 From: Marc.Logghe at DEVGEN.com (Marc Logghe) Date: Wed, 14 Sep 2005 12:04:46 +0200 Subject: [EMBOSS] Cusp cfile option Message-ID: <0C528E3670D8CE4B8E013F6749231AA62F556D@ANTARESIA.be.devgen.com> > -----Original Message----- > From: Jon Ison [mailto:jison at ebi.ac.uk] > Sent: Wednesday, September 14, 2005 11:58 AM > To: Marc Logghe > Cc: emboss at emboss.open-bio.org > Subject: Re: [EMBOSS] Cusp cfile option > > Dear Marc > > "-cfile" isn't a valid option for cusp (at least, in my > installation) Perhaps you were referring to a different program ? Ah that makes sense. I am not using a different program but a different version of EMBOSS, 2.8.0 that is. To prove it once was there ;-) http://poblano.health.unm.edu/Software/EMBOSS/Apps/cusp.html So, that's one question off. Still did not find where to get *.cut species info Thanks, Marc From pmr at ebi.ac.uk Wed Sep 14 10:17:19 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Wed, 14 Sep 2005 11:17:19 +0100 (BST) Subject: [EMBOSS] Cusp cfile option In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA62F5568@ANTARESIA.be.devgen.com> References: <0C528E3670D8CE4B8E013F6749231AA62F5568@ANTARESIA.be.devgen.com> Message-ID: <1244.128.141.130.13.1126693039.squirrel@webmail.ebi.ac.uk> Hi Mark, > I was wondering what the purpose was for the -cfile option in cusp. > After all, cusp *creates* a cut file, so why should it need one ? > Also, where can I find out about the species for the CODONS/*.cut files. > I looked inside these for a comment or something, but nothing was there. > For instance, Eyeast.cut is obvious, but what species is used for > Eyen.cut ? Changed a lot in EMBOSS 3.0.0. There was discussion at least on the developers list. cusp no longer needs the file, filenames have been cleaned up, and there is a list of species attached to the files to make names clearer. I'm not in the office today, best guess for Yen would be Yersinia enterocolitica :-) regards, Peter From Marc.Logghe at DEVGEN.com Wed Sep 14 10:18:46 2005 From: Marc.Logghe at DEVGEN.com (Marc Logghe) Date: Wed, 14 Sep 2005 12:18:46 +0200 Subject: [EMBOSS] Cusp cfile option Message-ID: <0C528E3670D8CE4B8E013F6749231AA62F556E@ANTARESIA.be.devgen.com> > Hi Mark, > > > I was wondering what the purpose was for the -cfile option in cusp. > > After all, cusp *creates* a cut file, so why should it need one ? > > Also, where can I find out about the species for the > CODONS/*.cut files. > > I looked inside these for a comment or something, but > nothing was there. > > For instance, Eyeast.cut is obvious, but what species is used for > > Eyen.cut ? > > Changed a lot in EMBOSS 3.0.0. There was discussion at least > on the developers list. cusp no longer needs the file, > filenames have been cleaned up, and there is a list of > species attached to the files to make names clearer. > > I'm not in the office today, best guess for Yen would be > Yersinia enterocolitica :-) > Thanks Peter, Think it is the right time for an upgrade ;-) Cheers, Marc From ronnieoc at gmail.com Thu Sep 15 22:45:10 2005 From: ronnieoc at gmail.com (Ronnie O) Date: Thu, 15 Sep 2005 18:45:10 -0400 Subject: [EMBOSS] Seqret stdin issues Message-ID: <6ceab7de05091515451ae539a8@mail.gmail.com> Hello everyone, I am trying to pipe sequence data into seqret via a pipe with the following command: ./seqret raw::stdin raw::stdout and i am getting the following data piped back to my app via the error pipe: Unable to read sequence 'raw::stdin raw::stdout' Died: seqret terminated: Bad value for '-sequence' and no prompt I am new to using the EMBOSS package and am not familiar with the errors. So is this a standard error for telling me that my input is not recognized or formatted correctly? This is confusing me b/c I am piping this sequence data in the same manner to a perl script it is being recognized correctly. I am just sending a sample string of "ATGCATGC". The perl script spits it back to me through: $data = ; //The dna string also has a \n added for the perl stdin which I've removed for stdin to seqret print $data; So I am hesitant to think my piping mechanism isn't sufficient, but rather seqret is looking for some other flags for stdin or a different formatting. Any ideas? Thanks, Ronnie From lukem at gene.pbi.nrc.ca Fri Sep 16 00:12:56 2005 From: lukem at gene.pbi.nrc.ca (Luke McCarthy) Date: Thu, 15 Sep 2005 18:12:56 -0600 Subject: [EMBOSS] Seqret stdin issues In-Reply-To: <6ceab7de05091515451ae539a8@mail.gmail.com> References: <6ceab7de05091515451ae539a8@mail.gmail.com> Message-ID: <1126829576.5825.3.camel@drmemory.private.virtuouspagans.org> On Thu, 2005-09-15 at 16:45, Ronnie O wrote: > Hello everyone, > I am trying to pipe sequence data into seqret via a pipe with the following > command: > ./seqret raw::stdin raw::stdout > and i am getting the following data piped back to my app via the error > pipe: > Unable to read sequence 'raw::stdin raw::stdout' For some reason, whatever mechanism you're using to run seqret thinks "raw::stdin raw::stdout" is one argument. Obviously it should be two arguments. In Perl, for example, this could happen if you tried something like system "seqret", "raw::stdin raw::stdout"; instead of: system "seqret", "raw::stdin", "raw::stdout"; or system "seqret raw::stdin raw::stdout"; >From my command line, "seqret raw::stdin raw::stdout" works as I assume you'd like it to. How exactly are you calling seqret. I mean, if you're calling it from another script or program, can you include the relevant code? Cheers, Luke From simon.andrews at bbsrc.ac.uk Fri Sep 16 07:28:03 2005 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Fri, 16 Sep 2005 08:28:03 +0100 Subject: [EMBOSS] Seqret stdin issues In-Reply-To: <6ceab7de05091515451ae539a8@mail.gmail.com> References: <6ceab7de05091515451ae539a8@mail.gmail.com> Message-ID: On 15 Sep 2005, at 23:45, Ronnie O wrote: > Hello everyone, > I am trying to pipe sequence data into seqret via a pipe with the > following > command: > ./seqret raw::stdin raw::stdout > and i am getting the following data piped back to my app via the error > pipe: > Unable to read sequence 'raw::stdin raw::stdout' A simple pipe of the type you describe works fine for me: echo "GATAGCTAG" | seqret raw::stdin fasta::stdout Reads and writes (returns) sequences >EMBOSS_001 GATAGCTAG However it sounds like you're trying to do this via a Perl script. Are you using the IPC::Open2 / Open3 modules to do this? I tried it and it seemed to work OK: #!/usr/bin/perl use warnings; use strict; use IPC::Open2; my $seq = "GATAGATATGCTAGA"; my $pid = open2(\*OUT,\*IN,"seqret","raw::stdin","raw::stdout"); print IN $seq; close IN or die "Can't close IN: $!"; while () { print; } close OUT or die "Can't close OUT: $!"; waitpid($pid,0); ################## Incidentally, it you're just using seqret as a filter then there is a -filter flag which has a slightly cleaner syntax for what you're trying to do: echo "GATAGCTAG" | seqret -filter -osf fasta If you're still having problems then can you post the piece of code which isn't working so we can have a look. Cheers Simon. -- Simon Andrews PhD Bioinformatics Dept. The Babraham Institute simon.andrews at bbsrc.ac.uk +44 (0) 1223 496463 From ronnieoc at gmail.com Mon Sep 19 12:26:25 2005 From: ronnieoc at gmail.com (Ronnie O) Date: Mon, 19 Sep 2005 08:26:25 -0400 Subject: [EMBOSS] Seqret stdin issues In-Reply-To: References: <6ceab7de05091515451ae539a8@mail.gmail.com> Message-ID: <6ceab7de05091905263552accb@mail.gmail.com> Thanks guys, Luke, the first suggestion was definitely a fix. I separated the arguments into two individual items in an array of arguments that is sent to the command line. I originally was sending the entire line "raw::stdin raw::stdout" as one item. This change deleted my error of: Unable to read sequence 'raw::stdin raw::stdout' Died: seqret terminated: Bad value for '-sequence' and no prompt So that was definitely an issue. Second, Simon, I also can run the command: echo "GATA" | ./seqret raw::stdin raw::stdout in a terminal with success. To test succesful piping of stdin from my app (which is a Cocoa app), I wrote a simple perl script to print a variable that has been initialized to . This all functions correctly. I am not familiar with modules you mentioned, but the success of the simple perl script seems to tell me that I am correctly piping data out of the cocoa app, as well as receiving it correctly from stdout. Seqret is responding otherwise, as I am not getting data echoed back to my app at all. Whether this is due to stdin or stdout, I have yet to deduce. For the time being, I am going to make sure my cocoa code is up to par (which the perl script seems to be telling me it is), and I will probably re-post once I narrow it down to a seqret issue. Unless anyone has any cocoa-specific/seqret piping suggestions? Thanks a lot, fellas! ......... Ronnie From pmr at ebi.ac.uk Mon Sep 19 15:09:05 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Mon, 19 Sep 2005 16:09:05 +0100 (BST) Subject: [EMBOSS] Seqret stdin issues In-Reply-To: <6ceab7de05091905263552accb@mail.gmail.com> References: <6ceab7de05091515451ae539a8@mail.gmail.com> <6ceab7de05091905263552accb@mail.gmail.com> Message-ID: <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> Ronnie wrote: > Unless anyone has any cocoa-specific/seqret piping > suggestions? Thanks a lot, fellas! Just to point out that seqret would also support opening your application as a pipe from within the USA - should give you the same result. We support perl-style pipe definitions to launch applications as input files. This is a feature of EMBOSS from the early days which nobody has (as far as we know) used very much. You can also launch applications as database access methods, defining the application, sending some "id" to the command line for the application, and reading the results in seqret in some format definied in the database definition. One point on reading from stdin ... EMBOSS 3.0.0 should be able to handle various carriage return/line feed file formats, but earlier releases may occasionally have problems. Running seqret with "-debug" on the commandline will create a seqret.dbg file that should help tell you what is going on - for example, how far it gets with trying to read your stdin input file. If you;re not sure what the seqret.dbg file contents mean, you can send the file to me and I'll he happy to take a look. Have fun! Peter From forward at hongyu.org Tue Sep 20 19:14:59 2005 From: forward at hongyu.org (forward at hongyu.org) Date: Tue, 20 Sep 2005 12:14:59 -0700 (PDT) Subject: [EMBOSS] consensus sequence from Prettyplot and Cons Message-ID: <43015.205.234.187.240.1127243699.squirrel@hongyu.org> Hi there, I am new to this group, sorry if it's a discussed question here. I found there is difference between the consensus sequences generated for the same alignment by the two programs: Prettyplot and Cons. I've tried adjusting the parameters such as -plurality and -identity, but failed to reconcile the two no matter how. Please let me know if you have met the same problem or whether you have good solution to it. Thanks! -- Hongyu Zhang, Ph.D. Computational Biologist Ceres Inc. 1535 Rancho Conejo Blvd Thousand Oaks, CA 91320 Phone: (805)376-6504 ext 1204 From ulrike.kaule at gmx.de Tue Sep 20 20:03:25 2005 From: ulrike.kaule at gmx.de (Ulrike Kaule) Date: Tue, 20 Sep 2005 22:03:25 +0200 Subject: [EMBOSS] sreformat: problems with parameter Message-ID: <43306B0D.60506@gmx.de> Hello, I want to develop a workflow in Taverna, which accepts a sequence in fasta-format and does some analysis with it. But a demand is also, that the user could input some other formats than fasta - so I have to convert them internally to fasta. The only programm I found for this purpose was sreformat from HMMER. At the moment this programm is not included in EMBOSS, so I wrote a new acd-file and deployed it as a web-service. The acd-file is as follows: ----------------------------------------------------- application: sreformat [ documentation: "Converts sequence file to different format" groups: "Utils" ] section: input [ information: "Input section" type: "page" ] string: format [ parameter: "Y" information: "Output format" ] sequence: seqfile [ parameter: "Y" information: "Input sequence" ] endsection: input section: output [ information: "Output section" type: "page" ] seqout: outfile [ parameter: "Y" ] endsection: output ----------------------------------------------------- To ensure, that the output-format of sreformat is 'fasta', I coded it hard in a string-constant and gave it to parameter 'osformat' of sreformat. But the error-message I got was: ---------------------------------------------------------------------------------------- Task failed due to problem invoking soaplab service SoaplabTask.execute(..) : line 201 ProcessorTask.runAndGenerateTemplates(..) : line 444 ProcessorTask.doInvocationWithRetryLogic(..) : line 397 ProcessorTask.invokeOnce(..) : line 319 ProcessorTask.invokeWithoutIteration(..) : line 503 ProcessorTask.invoke(..) : line 251 ProcessorTask.handleRun(..) : line 199 NewState$1.run(..) : line 67 org.embl.ebi.SoaplabShare.SoaplabException: CONFLICTING_INPUT. format * (Parameter (Output format): Cannot remain empty.) SOAPFaultBuilder.createFault(..) : line 221 SOAPFaultBuilder.endElement(..) : line 128 DeserializationContext.endElement(..) : line 1087 AbstractSAXParser.endElement(..) : line -1 XMLNSDocumentScannerImpl.scanEndElement(..) : line -1 XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(..) : line -1 XMLDocumentFragmentScannerImpl.scanDocument(..) : line -1 XML11Configuration.parse(..) : line -1 XML11Configuration.parse(..) : line -1 XMLParser.parse(..) : line -1 AbstractSAXParser.parse(..) : line -1 SAXParser.parse(..) : line 345 DeserializationContext.parse(..) : line 227 SOAPPart.getAsSOAPEnvelope(..) : line 696 Message.getSOAPEnvelope(..) : line 424 MustUnderstandChecker.invoke(..) : line 62 AxisClient.invoke(..) : line 206 Call.invokeEngine(..) : line 2754 Call.invoke(..) : line 2737 Call.invoke(..) : line 2413 Call.invoke(..) : line 2336 Call.invoke(..) : line 1793 SoaplabTask.execute(..) : line 98 ProcessorTask.runAndGenerateTemplates(..) : line 444 ProcessorTask.doInvocationWithRetryLogic(..) : line 397 ProcessorTask.invokeOnce(..) : line 319 ProcessorTask.invokeWithoutIteration(..) : line 503 ProcessorTask.invoke(..) : line 251 ProcessorTask.handleRun(..) : line 199 NewState$1.run(..) : line 67 ---------------------------------------------------------------------------------------- So it seems, that the string-constant is not recognized. Therefore I changed in the acd-file, the default-value for format to "fasta" : ... string: format [ parameter: "Y" information: "Output format" default: "fasta" standard: "N" ] ... but I got an error-message too. Soaplab call returned an error : Summary: Completed: Erroneously Termination status: 256 Platform: Linux linux 2.6.4-52-default #1 Wed Apr 7 02:08:30 UTC 2004 i686 i686 i386 GNU/Linux Started: 20.09.2005 20:22:43 (Europe/Berlin) Ended: 20.09.2005 20:22:43 (Europe/Berlin) Report: Name: sreformat Started: 05-09-20 20:22:43 Program and parameters: sreformat /usr/local/analysis-interfaces/a/unknown/Projects/default/Data/in1127240561172 /usr/local/analysis-interfaces/a/unknown/Projects/default/Data/out1127240561314 --- end of parameters Completed: 05-09-20 20:22:43 Exit: 1 FATAL: Unknown output format /usr/local/analysis-interfaces/a/unknown/Projects/default/Data/in1127240561172 Usage: sreformat [-options] Output format choices: Unaligned Aligned ----------- ------- fasta stockholm embl msf genbank a2m gcg phylip gcgdata clustal pir selex raw eps Available options are: -h : help; print brief help on version and usage -d : force DNA alphabet for nucleic acid sequence -r : force RNA alphabet for nucleic acid sequence -l : force lower case -u : force upper case -x : convert non-IUPAC chars in DNA to N's for IUPAC/BLAST compatibility SoaplabTask.execute(..) : line 151 ProcessorTask.runAndGenerateTemplates(..) : line 444 ProcessorTask.doInvocationWithRetryLogic(..) : line 397 ProcessorTask.invokeOnce(..) : line 319 ProcessorTask.invokeWithoutIteration(..) : line 503 ProcessorTask.invoke(..) : line 251 ProcessorTask.handleRun(..) : line 199 NewState$1.run(..) : line 67 ----------------------------------------------------------------------------------- My questions are: 1) Is there another programm in emboos, what does the same like sreformat - until now I couldn't found some. 2) Is the error-message due to a problem in acd-file or is it a problem in soaplab? (At the moment the acd-file is in soaplab-directory (analysis-interfaces/metadata/)) 3) Is there another way to tell sreformat in acd-file, that the output-format should be 'fasta ? Thank you in advance Ulrike Kaule From Marc.Logghe at DEVGEN.com Tue Sep 20 20:31:57 2005 From: Marc.Logghe at DEVGEN.com (Marc Logghe) Date: Tue, 20 Sep 2005 22:31:57 +0200 Subject: [EMBOSS] sreformat: problems with parameter Message-ID: <0C528E3670D8CE4B8E013F6749231AA607D8E2@ANTARESIA.be.devgen.com> Hi Ulrike, EMBOSS seqret is perfectly suited to perform sequence conversion. You can pass it any standard format of sequence and de default output is fasta. But you can also specify the input and output formats if you want, using the options -sformat and -osformat respectively. Check out the docs for all possible formats at http://emboss.sourceforge.net/apps/seqret.html It's really useful as a kind of filter in taverna. HTH, Marc -----Oorspronkelijk bericht----- Van: emboss-bounces at emboss.open-bio.org namens Ulrike Kaule Verzonden: di 20/09/2005 22:03 Aan: emboss at emboss.open-bio.org Onderwerp: [EMBOSS] sreformat: problems with parameter Hello, I want to develop a workflow in Taverna, which accepts a sequence in fasta-format and does some analysis with it. But a demand is also, that the user could input some other formats than fasta - so I have to convert them internally to fasta. The only programm I found for this purpose was sreformat from HMMER. At the moment this programm is not included in EMBOSS, so I wrote a new acd-file and deployed it as a web-service. The acd-file is as follows: ----------------------------------------------------- application: sreformat [ documentation: "Converts sequence file to different format" groups: "Utils" ] section: input [ information: "Input section" type: "page" ] string: format [ parameter: "Y" information: "Output format" ] sequence: seqfile [ parameter: "Y" information: "Input sequence" ] endsection: input section: output [ information: "Output section" type: "page" ] seqout: outfile [ parameter: "Y" ] endsection: output ----------------------------------------------------- To ensure, that the output-format of sreformat is 'fasta', I coded it hard in a string-constant and gave it to parameter 'osformat' of sreformat. But the error-message I got was: ---------------------------------------------------------------------------------------- Task failed due to problem invoking soaplab service SoaplabTask.execute(..) : line 201 ProcessorTask.runAndGenerateTemplates(..) : line 444 ProcessorTask.doInvocationWithRetryLogic(..) : line 397 ProcessorTask.invokeOnce(..) : line 319 ProcessorTask.invokeWithoutIteration(..) : line 503 ProcessorTask.invoke(..) : line 251 ProcessorTask.handleRun(..) : line 199 NewState$1.run(..) : line 67 org.embl.ebi.SoaplabShare.SoaplabException: CONFLICTING_INPUT. format * (Parameter (Output format): Cannot remain empty.) SOAPFaultBuilder.createFault(..) : line 221 SOAPFaultBuilder.endElement(..) : line 128 DeserializationContext.endElement(..) : line 1087 AbstractSAXParser.endElement(..) : line -1 XMLNSDocumentScannerImpl.scanEndElement(..) : line -1 XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(..) : line -1 XMLDocumentFragmentScannerImpl.scanDocument(..) : line -1 XML11Configuration.parse(..) : line -1 XML11Configuration.parse(..) : line -1 XMLParser.parse(..) : line -1 AbstractSAXParser.parse(..) : line -1 SAXParser.parse(..) : line 345 DeserializationContext.parse(..) : line 227 SOAPPart.getAsSOAPEnvelope(..) : line 696 Message.getSOAPEnvelope(..) : line 424 MustUnderstandChecker.invoke(..) : line 62 AxisClient.invoke(..) : line 206 Call.invokeEngine(..) : line 2754 Call.invoke(..) : line 2737 Call.invoke(..) : line 2413 Call.invoke(..) : line 2336 Call.invoke(..) : line 1793 SoaplabTask.execute(..) : line 98 ProcessorTask.runAndGenerateTemplates(..) : line 444 ProcessorTask.doInvocationWithRetryLogic(..) : line 397 ProcessorTask.invokeOnce(..) : line 319 ProcessorTask.invokeWithoutIteration(..) : line 503 ProcessorTask.invoke(..) : line 251 ProcessorTask.handleRun(..) : line 199 NewState$1.run(..) : line 67 ---------------------------------------------------------------------------------------- So it seems, that the string-constant is not recognized. Therefore I changed in the acd-file, the default-value for format to "fasta" : ... string: format [ parameter: "Y" information: "Output format" default: "fasta" standard: "N" ] ... but I got an error-message too. Soaplab call returned an error : Summary: Completed: Erroneously Termination status: 256 Platform: Linux linux 2.6.4-52-default #1 Wed Apr 7 02:08:30 UTC 2004 i686 i686 i386 GNU/Linux Started: 20.09.2005 20:22:43 (Europe/Berlin) Ended: 20.09.2005 20:22:43 (Europe/Berlin) Report: Name: sreformat Started: 05-09-20 20:22:43 Program and parameters: sreformat /usr/local/analysis-interfaces/a/unknown/Projects/default/Data/in1127240561172 /usr/local/analysis-interfaces/a/unknown/Projects/default/Data/out1127240561314 --- end of parameters Completed: 05-09-20 20:22:43 Exit: 1 FATAL: Unknown output format /usr/local/analysis-interfaces/a/unknown/Projects/default/Data/in1127240561172 Usage: sreformat [-options] Output format choices: Unaligned Aligned ----------- ------- fasta stockholm embl msf genbank a2m gcg phylip gcgdata clustal pir selex raw eps Available options are: -h : help; print brief help on version and usage -d : force DNA alphabet for nucleic acid sequence -r : force RNA alphabet for nucleic acid sequence -l : force lower case -u : force upper case -x : convert non-IUPAC chars in DNA to N's for IUPAC/BLAST compatibility SoaplabTask.execute(..) : line 151 ProcessorTask.runAndGenerateTemplates(..) : line 444 ProcessorTask.doInvocationWithRetryLogic(..) : line 397 ProcessorTask.invokeOnce(..) : line 319 ProcessorTask.invokeWithoutIteration(..) : line 503 ProcessorTask.invoke(..) : line 251 ProcessorTask.handleRun(..) : line 199 NewState$1.run(..) : line 67 ----------------------------------------------------------------------------------- My questions are: 1) Is there another programm in emboos, what does the same like sreformat - until now I couldn't found some. 2) Is the error-message due to a problem in acd-file or is it a problem in soaplab? (At the moment the acd-file is in soaplab-directory (analysis-interfaces/metadata/)) 3) Is there another way to tell sreformat in acd-file, that the output-format should be 'fasta ? Thank you in advance Ulrike Kaule _______________________________________________ EMBOSS mailing list EMBOSS at emboss.open-bio.org http://newportal.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Wed Sep 21 07:24:03 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 21 Sep 2005 08:24:03 +0100 Subject: [EMBOSS] consensus sequence from Prettyplot and Cons In-Reply-To: <43015.205.234.187.240.1127243699.squirrel@hongyu.org> References: <43015.205.234.187.240.1127243699.squirrel@hongyu.org> Message-ID: <43310A93.8050402@ebi.ac.uk> forward at hongyu.org wrote: > Hi there, > > I am new to this group, sorry if it's a discussed question here. > > I found there is difference between the consensus sequences generated for > the same alignment by the two programs: Prettyplot and Cons. I've tried > adjusting the parameters such as -plurality and -identity, but failed to > reconcile the two no matter how. > > Please let me know if you have met the same problem or whether you have > good solution to it. Thanks! We do have multiple copies of the consensus calculation in the current EMBOSS code. There are also different options for calculating the consensus which can affect the results you see. The -plurality and -identity should change only how the individual sequences are shown, I do not expect them to change the consensus sequence (but I may be wrong!). Can you send me: the aligned sequence input the command line for prettyplot the command line for cons regards, Peter Rice From ulrike.kaule at gmx.de Wed Sep 21 20:40:26 2005 From: ulrike.kaule at gmx.de (Ulrike Kaule) Date: Wed, 21 Sep 2005 22:40:26 +0200 Subject: [EMBOSS] "Invalid XY graph value 'png' " Message-ID: <4331C53A.8000303@gmx.de> Hello, I want to use EMBOSS-programm 'iep' in Taverna - but when running it, I get the following error message: ... Exit: 1 Devices allowed are:- postscript ps hpgl hp7470 hp7580 meta colourps cps xwindows x11 tektronics tekt tek4107t tek none null text data xterm Error: Invalid XY graph value 'png' Died: iep terminated: Bad value for '-graph' with -auto defined ... Is there any possibility to turn off this graphical mode in acd-file? Or do I have to install something else (graphical drivers, etc.)? Thank you in advance Ulrike Kaule P.S.: The version of EMBOSS is 3.0.0. and it is running on Linux-machine. From ajb at ebi.ac.uk Wed Sep 21 21:48:25 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Wed, 21 Sep 2005 22:48:25 +0100 (BST) Subject: [EMBOSS] "Invalid XY graph value 'png' " In-Reply-To: <4331C53A.8000303@gmx.de> References: <4331C53A.8000303@gmx.de> Message-ID: <58823.81.96.70.96.1127339305.squirrel@webmail.ebi.ac.uk> You mentioned linux but not what distribution. So, using Fedora as an example, make sure you have the following RPMs installed. gd, gd-devel, libpng, libpng-devel and then configure and compile emboss again. That will give you PNG support. If you're using a debian-style distribution those packages will have basenames like gd2 and libpng12. HTH Alan Bleasby EBI From pmr at ebi.ac.uk Thu Sep 22 11:31:18 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 22 Sep 2005 12:31:18 +0100 (BST) Subject: [EMBOSS] "Invalid XY graph value 'png' " In-Reply-To: <4331C53A.8000303@gmx.de> References: <4331C53A.8000303@gmx.de> Message-ID: <1505.81.78.82.193.1127388678.squirrel@webmail.ebi.ac.uk> Hi Ulrike, > I want to use EMBOSS-programm 'iep' in Taverna - but when running it, I > get the following error message: > Error: Invalid XY graph value 'png' > Died: iep terminated: Bad value for '-graph' with -auto defined > ... > > Is there any possibility to turn off this graphical mode in acd-file? > Or do I have to install something else (graphical drivers, etc.)? Taverna will need PNG output to convert into something it can view. You can follow Alan's instructions to reinstall with PNG. A quick question for everyone else : The graphics formats EMBOSS lists are the ones provided by the PLPLOT library. How many of these are useful? regards, Peter Rice From sbassi at gmail.com Thu Sep 22 12:04:09 2005 From: sbassi at gmail.com (Sebastian Bassi) Date: Thu, 22 Sep 2005 09:04:09 -0300 Subject: [EMBOSS] "Invalid XY graph value 'png' " In-Reply-To: <1505.81.78.82.193.1127388678.squirrel@webmail.ebi.ac.uk> References: <4331C53A.8000303@gmx.de> <1505.81.78.82.193.1127388678.squirrel@webmail.ebi.ac.uk> Message-ID: On 9/22/05, pmr at ebi.ac.uk wrote: > The graphics formats EMBOSS lists are the ones provided by the PLPLOT > library. How many of these are useful? Seems to be some legacy code there :) What is the difference between xwindows and x11 as graphic output format? -- La web sin popups ni spyware: Usa Firefox en lugar de Internet Explorer From David.Bauer at SCHERING.DE Thu Sep 22 14:28:37 2005 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Thu, 22 Sep 2005 16:28:37 +0200 Subject: [EMBOSS] Antwort: Re: "Invalid XY graph value 'png' " In-Reply-To: <1505.81.78.82.193.1127388678.squirrel@webmail.ebi.ac.uk> Message-ID: Hi Ulrike, the emboss configure script sometime picks up a wrong version of libgd if different versions are installed. This caused me some trouble on a very strangely configured solaris machine. Watch the configure output for a line which says somethink like "PNG driver found". Only if this is OK you will get a working png output. HTH, David. emboss-bounces at emboss.open-bio.org schrieb am 22/09/2005 13:31:18: > Hi Ulrike, > > > I want to use EMBOSS-programm 'iep' in Taverna - but when running it, I > > get the following error message: > > Error: Invalid XY graph value 'png' > > Died: iep terminated: Bad value for '-graph' with -auto defined > > ... > > > > Is there any possibility to turn off this graphical mode in acd-file? > > Or do I have to install something else (graphical drivers, etc.)? > > Taverna will need PNG output to convert into something it can view. > > You can follow Alan's instructions to reinstall with PNG. > > A quick question for everyone else : > > The graphics formats EMBOSS lists are the ones provided by the PLPLOT > library. How many of these are useful? > > regards, > > Peter Rice > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Thu Sep 22 16:00:47 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 22 Sep 2005 17:00:47 +0100 (BST) Subject: [EMBOSS] "Invalid XY graph value 'png' " In-Reply-To: References: <4331C53A.8000303@gmx.de> <1505.81.78.82.193.1127388678.squirrel@webmail.ebi.ac.uk> Message-ID: <1697.217.134.22.244.1127404847.squirrel@webmail.ebi.ac.uk> > On 9/22/05, pmr at ebi.ac.uk wrote: >> The graphics formats EMBOSS lists are the ones provided by the PLPLOT >> library. How many of these are useful? > > Seems to be some legacy code there :) Nope ... just a library that support old formats. But we do indeed plan to replace it :-) > What is the difference between xwindows and x11 as graphic output format? They are aliases for the same format. regards, Peter From sbassi at gmail.com Thu Sep 22 19:12:33 2005 From: sbassi at gmail.com (Sebastian Bassi) Date: Thu, 22 Sep 2005 16:12:33 -0300 Subject: [EMBOSS] "Invalid XY graph value 'png' " In-Reply-To: <1697.217.134.22.244.1127404847.squirrel@webmail.ebi.ac.uk> References: <4331C53A.8000303@gmx.de> <1505.81.78.82.193.1127388678.squirrel@webmail.ebi.ac.uk> <1697.217.134.22.244.1127404847.squirrel@webmail.ebi.ac.uk> Message-ID: On 9/22/05, pmr at ebi.ac.uk wrote: > > What is the difference between xwindows and x11 as graphic output format? > They are aliases for the same format. Ok, it won't hurt to put a little explanation like: Same as xwindows (next to x11). This would be helpful for converted Linux users. For people raised at Unix/Linux environment, is not an issue, but for the rest of us would help. -- La web sin popups ni spyware: Usa Firefox en lugar de Internet Explorer From ronnieoc at gmail.com Sat Sep 24 23:44:50 2005 From: ronnieoc at gmail.com (Ronnie O) Date: Sat, 24 Sep 2005 19:44:50 -0400 Subject: [EMBOSS] Seqret stdin issues In-Reply-To: <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> References: <6ceab7de05091515451ae539a8@mail.gmail.com> <6ceab7de05091905263552accb@mail.gmail.com> <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> Message-ID: <6ceab7de0509241644409f3ef1@mail.gmail.com> Hi Peter, First, thanks for your reply and sorry for my delay. I went with your suggestion of running seqret with the -debug flag set in hopes of finding something and heres what I came up with. First, I first ran seqret from the command line with the following command: ./seqret raw::testdna raw::stdout -filter -debug I created a file, "testdna", that simply held nucleotide characters in raw format. Execution was successful, as the sequence was output to the terminal window, and the seqret.dbg file was created in the emboss folder. Second, I ran my cocoa application which calls seqret with basically the same sequence of flags with the exception of "stdin" for "testdna": seqret raw::stdin raw::stdout -filter -debug My application is not receiving data from seqret as of this point. The seqret.dbg file was created in the build folder of my application. To decipher seqret's role in this fiasco, i analyzed the seqret.dbg files created in both instances. I can't say I am at all familiar with how to analyze them, but I took a quick look at both. Knowing my command line running of the program worked fine, I wanted to compare the debug files to see where seqret could be thrown off with my cocoa app call. Both files appear to have been logged to completion and I didn't notice any major differences between the two offhand. To make it easier, I ran a diff on the two files and below is the output of this (This will format poorly, i'm sure): ++seqUsaProcess 'raw::testdna' 0..0(N) '' 0 | ++seqUsaProcess 'raw::stdin' 0..0(N) '' 0 USA to test: 'raw::testdna' | USA to test: 'raw::stdin' unknown dbname testdna, try filename | unknown dbname stdin, try filename found filename testdna | found filename stdin ajSeqAccessFile testdna | ajSeqAccessFile stdin ajFileNewIn 'testdna' | ajFileNewIn 'stdin' ajFileBuffNobuff testdna buffsize: 0 | ajFileBuffNobuff stdin buffsize: 0 ++seqReadFmt format 42 (raw) 'raw::testdna' feat No | ++seqReadFmt format 42 (raw) 'raw::stdin' feat No read 'taccgcgcgtatccgtcgagcacacgtgtgccacacagcatcggtggccaatatt | Appending missing newline to 'aaaaaaaaa' > read 'aaaaaaaaa EOF ajFileGetsL file testdna | EOF ajFileGetsL file stdin ajFileNext for non-list file testdna | ajFileNext for non-list file stdin ajFileBuffClear 'testdna' (0 lines) | ajFileBuffClear 'stdin' (0 lines) ajSeqSetRange (len: 143 0..0 old 0..0) rev:No reversed:No | ajSeqSetRange (len: 9 0..0 old 0..0) rev:No reversed:No result: (len: 143 0..0) | result: (len: 9 0..0) ajSeqAllWrite '' len: 143 | ajSeqAllWrite '' len: 9 seqAllClone 0 .. 0 1 .. 143 len: 143 type: 'N' | seqAllClone 0 .. 0 1 .. 9 len: 9 type: 'N' seqSeqFormat numwidth old: 4 new: 4 | seqSeqFormat numwidth old: 2 new: 2 ajSeqRead: input file 'testdna' still there, try again | ajSeqRead: input file 'stdin' still there, try again ajFileBuffNobuff testdna buffsize: 0 | ajFileBuffNobuff stdin buffsize: 0 ++seqReadFmt format 42 (raw) 'raw::testdna' feat No | ++seqReadFmt format 42 (raw) 'raw::stdin' feat No at EOF: File already read to end testdna | at EOF: File already read to end stdin ajFileNext for non-list file testdna | ajFileNext for non-list file stdin ajFileBuffClear 'testdna' (0 lines) | ajFileBuffClear 'stdin' (0 lines) ajFileBuffEmpty Size: 0 Pos: 0 End: Y Handle: 3 Fp: a000dd44 | ajFileBuffEmpty Size: 0 Pos: 0 End: Y Handle: 3 Fp: a0001bc8 seqRead: *failed* to read sequence raw::testdna using format | seqRead: *failed* to read sequence raw::stdin using format ra ajSeqRead: open buffer usa: 'raw::testdna' returns: No | ajSeqRead: open buffer usa: 'raw::stdin' returns: No ajFileBuffClear 'testdna' (-1 lines) | ajFileBuffClear 'stdin' (-1 lines) closing file 'testdna' | closing file 'stdin' String usage (bytes): 12916 allocated, 9616 freed, 3300 in us | String usage (bytes): 12120 allocated, 9374 freed, 2746 in us String usage (number): 715 allocated, 326 freed 389 in use | String usage (number): 717 allocated, 328 freed 389 in use Memory usage (bytes): 42591 allocated, 128 reallocated 22004 | Memory usage (bytes): 41827 allocated, 128 reallocated 22036 Memory usage (number): 1903 allocates, 929 frees, 2 resizes, | Memory usage (number): 1907 allocates, 933 frees, 2 resizes, If this pasted output from diff is illegible, let me know how to better send it and I will resend. Or if the full dbg files would be more helpful, I can send them too. The only differences in the log files appear to be on lines where "testdna" is printed to the log vs "stdin" being printed. It can be seen that my sequence data is being received in both cases. And the only other differences are in length prints and the string and memory usage statistics. So my guess is that seqret is running just fine. My hypothesis is that I am not grabbing the output correctly in my cocoa app and I need to reformat my code on that end. Or is it possible that my output is somehow not being pushed to stdout (which i doubt)? If you could look at the differences in the debug files and assure me that in both cases that seqret is running correctly and throwing the output to stdout, then I can at least narrow my problem down to not grabbing stdout correctly. Also, if you would like the entire debug file from either, just let me know. Thanks again all! ........... Ronnie From ronnieoc at gmail.com Sat Sep 24 23:53:32 2005 From: ronnieoc at gmail.com (Ronnie O) Date: Sat, 24 Sep 2005 19:53:32 -0400 Subject: [EMBOSS] Seqret stdin issues In-Reply-To: <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> References: <6ceab7de05091515451ae539a8@mail.gmail.com> <6ceab7de05091905263552accb@mail.gmail.com> <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> Message-ID: <6ceab7de05092416537d8f12c8@mail.gmail.com> Just to clarify too about the output of diff, I had it output only the lines that were different. So all the other lines of the dbg files were identical. I didnt include that in the previous post. ...... Ronnie On 9/19/05, pmr at ebi.ac.uk wrote: > Ronnie wrote: > > > Unless anyone has any cocoa-specific/seqret piping > > suggestions? Thanks a lot, fellas! > > Just to point out that seqret would also support opening your application > as a pipe from within the USA - should give you the same result. We > support perl-style pipe definitions to launch applications as input files. > This is a feature of EMBOSS from the early days which nobody has (as far > as we know) used very much. > > You can also launch applications as database access methods, defining the > application, sending some "id" to the command line for the application, > and reading the results in seqret in some format definied in the database > definition. > > One point on reading from stdin ... EMBOSS 3.0.0 should be able to handle > various carriage return/line feed file formats, but earlier releases may > occasionally have problems. > > Running seqret with "-debug" on the commandline will create a seqret.dbg > file that should help tell you what is going on - for example, how far it > gets with trying to read your stdin input file. If you;re not sure what > the seqret.dbg file contents mean, you can send the file to me and I'll he > happy to take a look. > > Have fun! > > Peter > > From bobby_rgm at yahoo.com Mon Sep 26 04:05:08 2005 From: bobby_rgm at yahoo.com (chowdary manio) Date: Sun, 25 Sep 2005 21:05:08 -0700 (PDT) Subject: [EMBOSS] to use single program Message-ID: <20050926040508.85819.qmail@web53205.mail.yahoo.com> hello all, I am trying to make a tool for alignment using water and garnier programs in EMBOSS. I want to seperate the code of water and garnier to use them alone. I am unable to do that. Please let me know a way for this.. Is it possible to seperate up from EMBOSS? Thanks in anticipation, Bobby __________________________________ Yahoo! Mail - PC Magazine Editors' Choice 2005 http://mail.yahoo.com From pmr at ebi.ac.uk Mon Sep 26 08:23:07 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 26 Sep 2005 09:23:07 +0100 Subject: [EMBOSS] to use single program In-Reply-To: <20050926040508.85819.qmail@web53205.mail.yahoo.com> References: <20050926040508.85819.qmail@web53205.mail.yahoo.com> Message-ID: <4337AFEB.7060502@ebi.ac.uk> chowdary manio wrote: > hello all, > > I am trying to make a tool for alignment using water > and garnier programs in EMBOSS. > > I want to seperate the code of water and garnier to > use them alone. I am unable to do that. > > Please let me know a way for this.. > > Is it possible to seperate up from EMBOSS? Water and Garnier link to the EMBOSS libraries. Although you can in theory make standalone binaries (the sort yuo can copy to another system and expect them to run) it is tricky and we do not officially support EMBOSS programs copied that way. An alternative is to pick up the FASTA package from Virginia. FASTA includes the original versions of both garnier and matcher (the other local alignment program in EMBOSS - called lalign in FASTA). If you build these programs you will be able to copy them. Of course you will lose the EMBOSS standard command line checking and output options, but you will find most of the functionality you are likely to need is still in the FASTA programs. Hope that helps, Peter From pmr at ebi.ac.uk Mon Sep 26 08:42:45 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 26 Sep 2005 09:42:45 +0100 Subject: [EMBOSS] Seqret stdin issues In-Reply-To: <6ceab7de0509241644409f3ef1@mail.gmail.com> References: <6ceab7de05091515451ae539a8@mail.gmail.com> <6ceab7de05091905263552accb@mail.gmail.com> <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> <6ceab7de0509241644409f3ef1@mail.gmail.com> Message-ID: <4337B485.8080405@ebi.ac.uk> Ronnie O wrote: > Hi Peter, > First, thanks for your reply and sorry for my delay. I went with your > suggestion of running seqret with the -debug flag set in hopes of > finding something and heres what I came up with. > > First, I first ran seqret from the command line with the following command: > > ./seqret raw::testdna raw::stdout -filter -debug > > I created a file, "testdna", that simply held nucleotide characters in > raw format. Execution was successful, as the sequence was output to > the terminal window, and the seqret.dbg file was created in the emboss > folder. > > Second, I ran my cocoa application which calls seqret with basically > the same sequence of flags with the exception of "stdin" for > "testdna": > > seqret raw::stdin raw::stdout -filter -debug > > My application is not receiving data from seqret as of this point. It will be waiting to read from stdin (waiting for you to type something). You need to pipe the testdna file into the program, for example (depending on which shell you use): cat testdna | seqret raw::stdin raw::stdout -debug (-filter is not needed as you are already writing to stdout - but it does no harm) > Just to clarify too about the output of diff, I had it output only the > lines that were different. So all the other lines of the dbg files > were identical. That just shows the different input filename (stdin or testdna) and the first run succeeding. We need the seqret.dbg file froj a run that says something like: Unable to read sequence 'raw::stdin raw::stdout' Died: seqret terminated: Bad value for '-sequence' and no prompt to diagnose why it failed to read. Good luck! Peter From kellert at ohsu.edu Mon Sep 26 16:43:59 2005 From: kellert at ohsu.edu (Thomas J Keller) Date: Mon, 26 Sep 2005 09:43:59 -0700 Subject: [EMBOSS] fink installation In-Reply-To: <4337B485.8080405@ebi.ac.uk> References: <6ceab7de05091515451ae539a8@mail.gmail.com> <6ceab7de05091905263552accb@mail.gmail.com> <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> <6ceab7de0509241644409f3ef1@mail.gmail.com> <4337B485.8080405@ebi.ac.uk> Message-ID: <274093E0-38A4-4A16-AAC8-795EA82CCF45@ohsu.edu> Greetings, It's been awhile since I've used emboss. I had installed it using Fink on my Apple G4 running OS 10.3. $ fink apropos emboss Information about 138 packages read in 1 seconds. i emboss 2.9.0-3 Molecular Biology Open Software Suite i emboss-shlibs 2.9.0-3 Molecular Biology Open Software Suite I recently upgraded my OS from 10..3 to 10.4. So I'm currently running 10.4.2. This seems to have broken Emboss. Now I got the following message: $ tfm tfm dyld: Library not loaded: /usr/local/lib/libfreetype.6.dylib Referenced from: /sw/bin/tfm Reason: image not found Trace/BPT trap I'm surprised to see /sw/bin/tfm would reference a lib file in /usr/ local/lib and fink does not seem to have the libfreetype library. What am I missing? Thanks From kvddrift at earthlink.net Mon Sep 26 22:29:49 2005 From: kvddrift at earthlink.net (Koen van der Drift) Date: Mon, 26 Sep 2005 18:29:49 -0400 Subject: [EMBOSS] fink installation In-Reply-To: <274093E0-38A4-4A16-AAC8-795EA82CCF45@ohsu.edu> References: <6ceab7de05091515451ae539a8@mail.gmail.com> <6ceab7de05091905263552accb@mail.gmail.com> <1087.80.187.150.36.1127142545.squirrel@webmail.ebi.ac.uk> <6ceab7de0509241644409f3ef1@mail.gmail.com> <4337B485.8080405@ebi.ac.uk> <274093E0-38A4-4A16-AAC8-795EA82CCF45@ohsu.edu> Message-ID: <7BD73F3C-5DCC-4518-BCED-22FB7023C4B4@earthlink.net> On Sep 26, 2005, at 12:43 PM, Thomas J Keller wrote: > Greetings, > It's been awhile since I've used emboss. I had installed it using > Fink on my Apple G4 running OS 10.3. > $ fink apropos emboss > Information about 138 packages read in 1 seconds. > i emboss 2.9.0-3 Molecular Biology Open Software > Suite > i emboss-shlibs 2.9.0-3 Molecular Biology Open Software > Suite > > > I recently upgraded my OS from 10..3 to 10.4. So I'm currently > running 10.4.2. Did you also update fink to the version for 10.4 ? See http:// fink.sourceforge.net/news/index.php for instructions. - Koen. From ulrich.bernhard at id.unizh.ch Tue Sep 27 06:47:31 2005 From: ulrich.bernhard at id.unizh.ch (Ulrich Bernhard) Date: Tue, 27 Sep 2005 08:47:31 +0200 Subject: [EMBOSS] dbxflat / dbiflat Message-ID: <4338EB03.9020906@id.unizh.ch> I just started to create the indozes for the whole embl database. I first tried to create the indizes with dbxflat: dbxflat -dbname embl -dbresource embl -date 24/09/05 -idformat embl -release 84.0 -directory /data/raw/embl -indexoutdir /data/emboss/embl -fields id,acc,sv,key,org -filenames *.dat But the job runs very very long. As an example, the dbiflat for fun*.dat tooks about 1:30 Min CPU time - the dbxflat for the same file tooks more than 20 Min CPU time. Is that normal? Thanks for any hint Ulrich -- +-----------------------------------------------------------+ | Ulrich Bernhard | | Informatikdienste Tel: (+41-44) 635 67 73 | | Universitaet Zuerich Fax: (+41-44) 635 45 05 | | Winterthurerstr. 190 | | CH-8057 Zuerich Email: ulrich.bernhard at id.unizh.ch | | Switzerland | +-----------------------------------------------------------+ From ajb at ebi.ac.uk Tue Sep 27 09:54:57 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Tue, 27 Sep 2005 10:54:57 +0100 (BST) Subject: [EMBOSS] dbxflat / dbiflat In-Reply-To: <4338EB03.9020906@id.unizh.ch> References: <4338EB03.9020906@id.unizh.ch> Message-ID: <49122.172.31.100.157.1127814897.squirrel@webmail.ebi.ac.uk> Dear Ulrich, > But the job runs very very long. As an example, the dbiflat for fun*.dat > tooks about 1:30 Min CPU time - the dbxflat for the same file tooks more > than 20 Min CPU time. > > Is that normal? It is certainly believable, depending on the resource settings. For the id, acc and sv indexes the dbx* programs have to create B+ trees; for the org, key & des indexes the dbx* programs have to create B+trees-of-B+trees. The extra work involved will account for the extra CPU. The B+ structures do allow for future on-the-fly updating of the indexes. The dbi* programs create much more simple indexes: but not updateable ones. The dbx* programs are still beta and some speedups can be introduced in later releases. HTH Alan From khayeni at cs.wits.ac.za Thu Sep 29 12:41:23 2005 From: khayeni at cs.wits.ac.za (Khayeni Ndlovu) Date: Thu, 29 Sep 2005 15:41:23 +0300 Subject: [EMBOSS] showdb not a valid emboss application Message-ID: <20050929123746.M32631@cs.wits.ac.za> hie folks i recently installed emboss and wemboss from source when i try to run a program from wemboss i get an error msg wEMBOSS: error... showdb is not a valid EMBOSS application please advise on how to rectify this thanks in advance for your assistance platform :Ubuntu hoary,apache 1.3 From ajb at ebi.ac.uk Thu Sep 29 15:04:39 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 29 Sep 2005 16:04:39 +0100 (BST) Subject: [EMBOSS] showdb not a valid emboss application In-Reply-To: <20050929123746.M32631@cs.wits.ac.za> References: <20050929123746.M32631@cs.wits.ac.za> Message-ID: <51451.81.96.70.96.1128006279.squirrel@webmail.ebi.ac.uk> Dear Khayeni, It is conceivable that someone on this list may be able to help you, however, this being a wEMBOSS rather than an EMBOSS problem you may have more success contacting the authors of wEMBOSS. Their email contact addresses are given on their www.wemboss.org homepage. HTH Alan Bleasby EBI > hie folks > > i recently installed emboss and wemboss from source when i try to run a > program from wemboss i get an error msg > > > wEMBOSS: error... > > showdb is not a valid EMBOSS application > > > > please advise on how to rectify this > > thanks in advance for your assistance > > platform :Ubuntu hoary,apache 1.3 > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss >