From enrique.deandres at pcm.uam.es Wed Nov 2 05:29:35 2005 From: enrique.deandres at pcm.uam.es (Enrique de Andres Saiz) Date: Wed, 02 Nov 2005 11:29:35 +0100 Subject: [EMBOSS] Problems with Refseq Message-ID: <4368950F.6020706@pcm.uam.es> Hi, I have some problems working with Refseq database. I am using Emboss 3.0.0 and when I am indexing the database (.g?ff files) using dbiflat command I get many warnings as: Warning: Duplicate ID skipped: 'NP_857944' All hits will point to first ID found Another problem is that when I try to get an entry using seqret command, I get another sequence with the accession I have selected. When I try to get the entry using entret, I get several sequences. I have tried to index only one file of the database and then access it with seqret and entret. I get the same behaviour. For example, I have next definition in emboss.default file: DB rs_test [ type: N method: emblcd format: genbank dir: $emboss_data/refseq file: vertebrate_mammalian2.genomic.gbff indexdir: /usr/users/bioadmin/opt/prueba comment: "RefSeq test" ] If I edit file vertebrate_mammalian2.genomic.gbff, I can see next entry: LOCUS NW_113053 1059 bp DNA linear CON 09-NOV-2004 DEFINITION Pan troglodytes chromosome 10 genomic contig, whole genome shotgun sequence. ACCESSION NW_113053 VERSION NW_113053.1 GI:52318716 KEYWORDS WGS. SOURCE Pan troglodytes (chimpanzee) ORGANISM Pan troglodytes Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Pan. COMMENT GENOME ANNOTATION REFSEQ: Features on this sequence have been produced for build 1 version 1 of the NCBI's genome annotation [see documentation]. The DNA sequence for this assembly was produced by the Chimpanzee Genome Sequencing Consortium. This assembly was produced by the Arachne assembler and made available in Nov. 2003. FEATURES Location/Qualifiers source 1..1059 /organism="Pan troglodytes" /mol_type="genomic DNA" /isolate="Yerkes chimp pedigree #C0471 (Clint)" /db_xref="taxon:9598" /chromosome="10" CONTIG join(AADA01324841.1:1..1059) If I run: seqret rs_test:NW_113053, I get: $> seqret rs_test:NW_113053 Reads and writes (returns) sequences Output sequence [nw_113053.fasta]: stdout >NW_113053 NW_113053.1 Pan troglodytes olfactory receptor pseudogene PTOR3A5P (PTOR3A5P) onchromosome 17. ggaacgtactgcagcccatccgttttgctgtcttccgctttgcctacatcatcatagttg ggggcaacctcagcatcctggctgccatctttgtggaccccaaactccatactcccatgt attacttcctggggaacttgtctctgctggacatcgggtgcatcagtcactgttcctccg atgctggcgtgtctcctggcccaccagtgcagagttccctatgctgcctgcatttcacaa ctcttctttttccacctcctggctggggtggactgtcacctcttaatagccacggcctat gactgctacctggctatctgtcagcttctcaccaacagcactcgcatgagctgtgaagtc cagggtgccctggtgggaatttgctgcactgtctccttcatcaatgctctgactcacaca gtggctgtgtctgtgcttgacttctgtggccctaatgtggtcaaccacttctgctgtgac ctcccacctcttttccagctctcttgctccagcatccacctcaatgggcagctgctgctt gtgggggccaccttcataggagtgctccccatgatctttatctcagtgtcctatgcccac gtcacagccgcaatattacgaatccgctcagctgaggggaggaagaaggctttctccacg tgtggctcccacctcaccgtggtctgaatcttttatggaactggcttcttcagttacatg tgtctgggctcagtctcagcctcagacaaagataaggggattgggatcctcaacactatc ctcagtcccatgctgaacccagtcatttacagcctccagaaccctgatgtgcagggcacc ctgaaaagggtgctgacagggaagaggcccccagcttga If I run: entret rs_test:NW_113053, I get several entries (the first one is the correct one). Any idea about what happens and how can I solve it? Thanks in advance, Enrique. From michael.watson at bbsrc.ac.uk Wed Nov 2 07:33:38 2005 From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C)) Date: Wed, 2 Nov 2005 12:33:38 -0000 Subject: [EMBOSS] Help with stretcher Message-ID: <8975119BCD0AC5419D61A9CF1A923E95024C5337@iahce2knas1.iah.bbsrc.reserved> Hi I am using stretcher from emboss in a perl script. I am trying to globally align a relatively short sequence with quite a long one. Basically, the short one sits bang in the middle of the long one, with almost 100% identity. However, no matter how much I play with the gaplength and gappenalty options, stretcher insists that the the first base of the short sequence aligns with the first base of the long sequence, followed by a HUGE gap in the alignment, followed by the rest of the sequences, correctly aligned. It's doing my nut in. I'm using EMBOSS 2.9.0 on Suse Linux. Any help? Mick From cquijano at iib.uam.es Wed Nov 2 07:34:26 2005 From: cquijano at iib.uam.es (Carlos Quijano) Date: Wed, 02 Nov 2005 13:34:26 +0100 Subject: [EMBOSS] Problems with Refseq In-Reply-To: <4368950F.6020706@pcm.uam.es> References: <4368950F.6020706@pcm.uam.es> Message-ID: <1130934866.8717.15.camel@localhost.localdomain> El mi?, 02-11-2005 a las 11:29 +0100, Enrique de Andres Saiz escribi?: > Hi, > I have some problems working with Refseq database. > I am using Emboss 3.0.0 and when I am indexing the database (.g?ff > files) using dbiflat command I get many warnings as: > > Warning: Duplicate ID skipped: 'NP_857944' All hits will point to first > ID found > And this warning should point to the very problem. Try to fix the duplicates somehow. Probably there is a ID length trunkating method specific to dbiflat when dealing with your flat files, so the best solution is to modify your flat files if there is no way of forcing dbiflat to accept your IDs... The rest of symptoms are consistent with this observation. I hope it helps you in some way. > Another problem is that when I try to get an entry using seqret command, > I get another sequence with the accession I have selected. When I try > to get the entry using entret, I get several sequences. > > I have tried to index only one file of the database and then access it > with seqret and entret. I get the same behaviour. For example, I have > next definition in emboss.default file: > > DB rs_test [ > type: N > method: emblcd > format: genbank > dir: $emboss_data/refseq > file: vertebrate_mammalian2.genomic.gbff > indexdir: /usr/users/bioadmin/opt/prueba > comment: "RefSeq test" > ] > > If I edit file vertebrate_mammalian2.genomic.gbff, I can see next entry: > > LOCUS NW_113053 1059 bp DNA linear CON > 09-NOV-2004 > DEFINITION Pan troglodytes chromosome 10 genomic contig, whole genome > shotgun > sequence. > ACCESSION NW_113053 > VERSION NW_113053.1 GI:52318716 > KEYWORDS WGS. > SOURCE Pan troglodytes (chimpanzee) > ORGANISM Pan troglodytes > Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; > Euteleostomi; > Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; > Hominidae; Pan. > COMMENT GENOME ANNOTATION REFSEQ: Features on this sequence have been > produced for build 1 version 1 of the NCBI's genome > annotation [see > documentation]. > The DNA sequence for this assembly was produced by the > Chimpanzee > Genome Sequencing Consortium. This assembly was produced by the > Arachne assembler and made available in Nov. 2003. > FEATURES Location/Qualifiers > source 1..1059 > /organism="Pan troglodytes" > /mol_type="genomic DNA" > /isolate="Yerkes chimp pedigree #C0471 (Clint)" > /db_xref="taxon:9598" > /chromosome="10" > CONTIG join(AADA01324841.1:1..1059) > > If I run: seqret rs_test:NW_113053, I get: > > $> seqret rs_test:NW_113053 > Reads and writes (returns) sequences > Output sequence [nw_113053.fasta]: stdout > >NW_113053 NW_113053.1 Pan troglodytes olfactory receptor pseudogene > PTOR3A5P (PTOR3A5P) onchromosome 17. > ggaacgtactgcagcccatccgttttgctgtcttccgctttgcctacatcatcatagttg > ggggcaacctcagcatcctggctgccatctttgtggaccccaaactccatactcccatgt > attacttcctggggaacttgtctctgctggacatcgggtgcatcagtcactgttcctccg > atgctggcgtgtctcctggcccaccagtgcagagttccctatgctgcctgcatttcacaa > ctcttctttttccacctcctggctggggtggactgtcacctcttaatagccacggcctat > gactgctacctggctatctgtcagcttctcaccaacagcactcgcatgagctgtgaagtc > cagggtgccctggtgggaatttgctgcactgtctccttcatcaatgctctgactcacaca > gtggctgtgtctgtgcttgacttctgtggccctaatgtggtcaaccacttctgctgtgac > ctcccacctcttttccagctctcttgctccagcatccacctcaatgggcagctgctgctt > gtgggggccaccttcataggagtgctccccatgatctttatctcagtgtcctatgcccac > gtcacagccgcaatattacgaatccgctcagctgaggggaggaagaaggctttctccacg > tgtggctcccacctcaccgtggtctgaatcttttatggaactggcttcttcagttacatg > tgtctgggctcagtctcagcctcagacaaagataaggggattgggatcctcaacactatc > ctcagtcccatgctgaacccagtcatttacagcctccagaaccctgatgtgcagggcacc > ctgaaaagggtgctgacagggaagaggcccccagcttga > > If I run: entret rs_test:NW_113053, I get several entries (the first one > is the correct one). > > Any idea about what happens and how can I solve it? > > Thanks in advance, > Enrique. > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Wed Nov 2 08:25:53 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 02 Nov 2005 13:25:53 +0000 Subject: [EMBOSS] Help with stretcher In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E95024C5337@iahce2knas1.iah.bbsrc.reserved> References: <8975119BCD0AC5419D61A9CF1A923E95024C5337@iahce2knas1.iah.bbsrc.reserved> Message-ID: <4368BE61.9040609@ebi.ac.uk> michael watson (IAH-C) wrote: > Hi > > I am using stretcher from emboss in a perl script. I am trying to > globally align a relatively short sequence with quite a long one. > Basically, the short one sits bang in the middle of the long one, with > almost 100% identity. However, no matter how much I play with the > gaplength and gappenalty options, stretcher insists that the the first > base of the short sequence aligns with the first base of the long > sequence, followed by a HUGE gap in the alignment, followed by the rest > of the sequences, correctly aligned. It's doing my nut in. global alignemnts come ni two flavours - those that insist on aligning the entire length of both sequences (like stretcher) and those that allow gaps at the end without penalties (like needle). What you want depends on the sequences you are aligning (i.e. what the ends really mean) You can simply use the needle program instead to get the results you want. Stretcher was originally part of the FASTA package. We can look at adding an option for end weighting (and maybe making the default the same as for needle). Hope that helps, Peter From michael.watson at bbsrc.ac.uk Wed Nov 2 08:29:36 2005 From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C)) Date: Wed, 2 Nov 2005 13:29:36 -0000 Subject: [EMBOSS] Help with stretcher Message-ID: <8975119BCD0AC5419D61A9CF1A923E95024C533A@iahce2knas1.iah.bbsrc.reserved> Hi Peter The thing is, stretcher works fine for a lot of other examples (I'm running a whole pipeline here) of the same problem; and I tried needle but it complained the sequences were too long and that I should try stretcher... It would be good to remove this problem from stretcher given the size limit on needle... Many thanks Mick -----Original Message----- From: Peter Rice [mailto:pmr at ebi.ac.uk] Sent: 02 November 2005 13:26 To: michael watson (IAH-C) Cc: emboss at emboss.open-bio.org Subject: Re: [EMBOSS] Help with stretcher michael watson (IAH-C) wrote: > Hi > > I am using stretcher from emboss in a perl script. I am trying to > globally align a relatively short sequence with quite a long one. > Basically, the short one sits bang in the middle of the long one, with > almost 100% identity. However, no matter how much I play with the > gaplength and gappenalty options, stretcher insists that the the first > base of the short sequence aligns with the first base of the long > sequence, followed by a HUGE gap in the alignment, followed by the > rest of the sequences, correctly aligned. It's doing my nut in. global alignemnts come ni two flavours - those that insist on aligning the entire length of both sequences (like stretcher) and those that allow gaps at the end without penalties (like needle). What you want depends on the sequences you are aligning (i.e. what the ends really mean) You can simply use the needle program instead to get the results you want. Stretcher was originally part of the FASTA package. We can look at adding an option for end weighting (and maybe making the default the same as for needle). Hope that helps, Peter From pmr at ebi.ac.uk Wed Nov 2 08:36:50 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 02 Nov 2005 13:36:50 +0000 Subject: [EMBOSS] Help with stretcher In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E95024C533A@iahce2knas1.iah.bbsrc.reserved> References: <8975119BCD0AC5419D61A9CF1A923E95024C533A@iahce2knas1.iah.bbsrc.reserved> Message-ID: <4368C0F2.5070808@ebi.ac.uk> Hi Michael, > The thing is, stretcher works fine for a lot of other examples (I'm > running a whole pipeline here) of the same problem; and I tried needle > but it complained the sequences were too long and that I should try > stretcher... Ah ... that is because stretcher uses a more memory-efficient implementation of the Needleman-Wunsch algorithm. > It would be good to remove this problem from stretcher given the size > limit on needle... We will try. As we did not write stretcher we have some problems understanding the code, but we do know where to look. regards, Peter From golharam at umdnj.edu Wed Nov 2 10:07:12 2005 From: golharam at umdnj.edu (Ryan Golhar) Date: Wed, 02 Nov 2005 10:07:12 -0500 Subject: [EMBOSS] Help with stretcher In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E95024C5337@iahce2knas1.iah.bbsrc.reserved> Message-ID: <002401c5dfbf$1a97f100$e6028a0a@GOLHARMOBILE1> >From what you are describing, it sounds like you should use water or another local alignment program. -----Original Message----- From: emboss-bounces at emboss.open-bio.org [mailto:emboss-bounces at emboss.open-bio.org] On Behalf Of michael watson (IAH-C) Sent: Wednesday, November 02, 2005 7:34 AM To: emboss at emboss.open-bio.org Subject: [EMBOSS] Help with stretcher Hi I am using stretcher from emboss in a perl script. I am trying to globally align a relatively short sequence with quite a long one. Basically, the short one sits bang in the middle of the long one, with almost 100% identity. However, no matter how much I play with the gaplength and gappenalty options, stretcher insists that the the first base of the short sequence aligns with the first base of the long sequence, followed by a HUGE gap in the alignment, followed by the rest of the sequences, correctly aligned. It's doing my nut in. I'm using EMBOSS 2.9.0 on Suse Linux. Any help? Mick _______________________________________________ EMBOSS mailing list EMBOSS at emboss.open-bio.org http://newportal.open-bio.org/mailman/listinfo/emboss From michael.watson at bbsrc.ac.uk Wed Nov 2 10:11:44 2005 From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C)) Date: Wed, 2 Nov 2005 15:11:44 -0000 Subject: [EMBOSS] Help with stretcher Message-ID: <8975119BCD0AC5419D61A9CF1A923E95024C533E@iahce2knas1.iah.bbsrc.reserved> What I want to avoid is my smaller sequence being split up into multiple "HSPs" that I then have to process... -----Original Message----- From: Ryan Golhar [mailto:golharam at umdnj.edu] Sent: 02 November 2005 15:07 To: michael watson (IAH-C); emboss at emboss.open-bio.org Subject: RE: [EMBOSS] Help with stretcher >From what you are describing, it sounds like you should use water or another local alignment program. -----Original Message----- From: emboss-bounces at emboss.open-bio.org [mailto:emboss-bounces at emboss.open-bio.org] On Behalf Of michael watson (IAH-C) Sent: Wednesday, November 02, 2005 7:34 AM To: emboss at emboss.open-bio.org Subject: [EMBOSS] Help with stretcher Hi I am using stretcher from emboss in a perl script. I am trying to globally align a relatively short sequence with quite a long one. Basically, the short one sits bang in the middle of the long one, with almost 100% identity. However, no matter how much I play with the gaplength and gappenalty options, stretcher insists that the the first base of the short sequence aligns with the first base of the long sequence, followed by a HUGE gap in the alignment, followed by the rest of the sequences, correctly aligned. It's doing my nut in. I'm using EMBOSS 2.9.0 on Suse Linux. Any help? Mick _______________________________________________ EMBOSS mailing list EMBOSS at emboss.open-bio.org http://newportal.open-bio.org/mailman/listinfo/emboss From pmiguel at purdue.edu Wed Nov 2 16:22:53 2005 From: pmiguel at purdue.edu (Phillip San Miguel) Date: Wed, 02 Nov 2005 16:22:53 -0500 Subject: [EMBOSS] Gaps converted to "n's" in showalign consensus Message-ID: <43692E2D.7050602@purdue.edu> It would be great if showalign had a switch that would prevent it from converting "-" to "n" in the consensus it generates for an alignment. I frequently have long stretches of leading and trailing "n's" caused by this behavior. I would like to be able to turn this behavior off in consense as well. -- Phillip From golharam at umdnj.edu Wed Nov 2 19:15:06 2005 From: golharam at umdnj.edu (Ryan Golhar) Date: Wed, 02 Nov 2005 19:15:06 -0500 Subject: [EMBOSS] Parameter discrepency Message-ID: <007e01c5e00b$a5275e90$e6028a0a@GOLHARMOBILE1> I'm using needle to align sequences...I need the output in fasta format. Looking the the tfm for needle, under associated qualifers for -outfile, the parameter -aformat3 is listed. Further below is the section on Output file format which lists the parameter as -aformat. I tried -aformat and that seems to work, so does -aformat3. Is one of them not supposed to be there or just a carryover from an older version of emboss? The docs talk about one version but use the other in the example... Ryan From Marc.Logghe at DEVGEN.com Thu Nov 3 02:56:09 2005 From: Marc.Logghe at DEVGEN.com (Marc Logghe) Date: Thu, 3 Nov 2005 08:56:09 +0100 Subject: [EMBOSS] How to search the arhives ? Message-ID: <0C528E3670D8CE4B8E013F6749231AA62F56CB@ANTARESIA.be.devgen.com> Hi all, This is probably a stupid question but I did not find a way to search the emboss archives. I've found them, though, but only to access the chunks by date. Not very efficient if you don't know the date of the post anymore :-( I was actually looking for a post Peter once send about how to hardcode the clustalw option '-outorder=input' in emma. I think you had to set an environmental variable, but I don't recall which one that was. One thing I tried was to set 'clustalw -outorder=input' in the acd file, but that did not work out. Does anybody know how to dig out his answer ? Thanks, Marc From natalia.jimenez at pcm.uam.es Thu Nov 3 04:19:08 2005 From: natalia.jimenez at pcm.uam.es (Natalia Jimenez Lozano) Date: Thu, 03 Nov 2005 10:19:08 +0100 Subject: [EMBOSS] Parameter discrepency In-Reply-To: <007e01c5e00b$a5275e90$e6028a0a@GOLHARMOBILE1> References: <007e01c5e00b$a5275e90$e6028a0a@GOLHARMOBILE1> Message-ID: <4369D60C.8050001@pcm.uam.es> Hi, I'm trying to do a retrieval (entret -EMBOSS-) of CON-division of genbank database previously indexed through dbiflat but I don't obtain any result. Does anybody know how can I solve this problem? Thank you in advance, Natalia From natalia.jimenez at pcm.uam.es Thu Nov 3 04:23:55 2005 From: natalia.jimenez at pcm.uam.es (Natalia Jimenez Lozano) Date: Thu, 03 Nov 2005 10:23:55 +0100 Subject: [EMBOSS] genbank retrieval Message-ID: <4369D72B.9080507@pcm.uam.es> Hi, I'm trying to do a retrieval (entret -EMBOSS-) of CON-division of genbank database previously indexed through dbiflat but I don't obtain any result. Does anybody know how can I solve this problem? Thank you in advance, Natalia From pmr at ebi.ac.uk Thu Nov 3 04:42:32 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 09:42:32 -0000 (GMT) Subject: [EMBOSS] How to search the arhives ? In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA62F56CB@ANTARESIA.be.devgen.com> References: <0C528E3670D8CE4B8E013F6749231AA62F56CB@ANTARESIA.be.devgen.com> Message-ID: <1488.86.133.37.211.1131010952.squirrel@webmail.ebi.ac.uk> Hi Mark, > This is probably a stupid question but I did not find a way to search > the emboss archives. I've found them, though, but only to access the > chunks by date. Not very efficient if you don't know the date of the > post anymore :-( Hmmmm ... the archives have moved a couiple of times. I keep copies of the important mails, but I've moved twice too so they are hard to search. While I'm figuring out how to search, I'll try answering again to see if I give the same reply :-) > I was actually looking for a post Peter once send about how to hardcode > the clustalw option '-outorder=input' in emma. I think you had to set an > environmental variable, but I don't recall which one that was. > One thing I tried was to set 'clustalw -outorder=input' in the acd file, > but that did not work out. I suspect it was to define EMBOSS_CLUSTALW to be : setenv EMBOSS_CLUSTALW "clustalw -outorder=input" Works for me! (If you already define this variable to set the full path or executable name for clustalw, preserve that part in the new value) I suppose adding this as an option to emma would be reasonable. yet another emma option - maybe this was one added since emma was originally written (to test just how far we could stretch ACD :-) I will look for any other new clustalw options at the same time. regards, Peter From pmr at ebi.ac.uk Thu Nov 3 04:44:14 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 09:44:14 -0000 (GMT) Subject: [EMBOSS] Gaps converted to "n's" in showalign consensus In-Reply-To: <43692E2D.7050602@purdue.edu> References: <43692E2D.7050602@purdue.edu> Message-ID: <1493.86.133.37.211.1131011054.squirrel@webmail.ebi.ac.uk> Hi Phillip, > It would be great if showalign had a switch that would prevent it from > converting "-" to "n" in the consensus it generates for an alignment. I > frequently have long stretches of leading and trailing "n's" caused by > this behavior. I would like to be able to turn this behavior off in > consense as well. That's a bug (as '-' is clearly the consensus). I will look into it. Peter From David.Bauer at SCHERING.DE Thu Nov 3 04:55:53 2005 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Thu, 3 Nov 2005 10:55:53 +0100 Subject: [EMBOSS] Antwort: genbank retrieval In-Reply-To: <4369D72B.9080507@pcm.uam.es> Message-ID: Hi, I assume you mean gbcon.seq from the NCBI. This is a bit strange sequence database, with no sequence in it. It just contains instructions which part of which genbank file has to be used to create a non-overlapping contig. So this file can not be indexed with dbiflat. David. emboss-bounces at emboss.open-bio.org schrieb am 03/11/2005 10:23:55: > Hi, > > I'm trying to do a retrieval (entret -EMBOSS-) of CON-division of > genbank database previously indexed through dbiflat but I don't obtain > any result. > Does anybody know how can I solve this problem? > Thank you in advance, > Natalia > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Thu Nov 3 04:49:53 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 09:49:53 -0000 (GMT) Subject: [EMBOSS] genbank retrieval In-Reply-To: <4369D72B.9080507@pcm.uam.es> References: <4369D72B.9080507@pcm.uam.es> Message-ID: <1521.86.133.37.211.1131011393.squirrel@webmail.ebi.ac.uk> Hi Natalia, > I'm trying to do a retrieval (entret -EMBOSS-) of CON-division of > genbank database previously indexed through dbiflat but I don't obtain > any result. > Does anybody know how can I solve this problem? Ah, the CON division is on my "to do" list. It needs some effort to do the EMBL version (rebuild the sequence and features from the composite entries). I have not looked specifically at the GenBank version, but assume it is the same. So, you will need a server (or a script) that puts the CON entry together for you. Does anyone know where to find one? regards, Peter From natalia.jimenez at pcm.uam.es Thu Nov 3 05:23:37 2005 From: natalia.jimenez at pcm.uam.es (Natalia Jimenez Lozano) Date: Thu, 03 Nov 2005 11:23:37 +0100 Subject: [EMBOSS] genbank retrieval In-Reply-To: <1521.86.133.37.211.1131011393.squirrel@webmail.ebi.ac.uk> References: <4369D72B.9080507@pcm.uam.es> <1521.86.133.37.211.1131011393.squirrel@webmail.ebi.ac.uk> Message-ID: <4369E529.908@pcm.uam.es> Thank you very much for your answer >>I'm trying to do a retrieval (entret -EMBOSS-) of CON-division of >>genbank database previously indexed through dbiflat but I don't obtain >>any result. >>Does anybody know how can I solve this problem? >> >> > >Ah, the CON division is on my "to do" list. It needs some effort to do the >EMBL version (rebuild the sequence and features from the composite >entries). > > You know if this enhancement will be available in the next EMBOSS release? >I have not looked specifically at the GenBank version, but assume it is >the same. > > Yes exactly the same. >So, you will need a server (or a script) that puts the CON entry together >for you. Does anyone know where to find one? > > Suggestions will be welcome >regards, > >Peter > > Thank you very much, Regards, Natalia From pmr at ebi.ac.uk Thu Nov 3 05:24:57 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 10:24:57 -0000 (GMT) Subject: [EMBOSS] Parameter discrepency In-Reply-To: <007e01c5e00b$a5275e90$e6028a0a@GOLHARMOBILE1> References: <007e01c5e00b$a5275e90$e6028a0a@GOLHARMOBILE1> Message-ID: <1568.86.133.37.211.1131013497.squirrel@webmail.ebi.ac.uk> Hi Ryan, > I tried -aformat and that seems to work, so does -aformat3. Is one of > them not supposed to be there or just a carryover from an older version > of emboss? The docs talk about one version but use the other in the > example... For all current programs, -aformat is fine. To explain what is going on, consider the -osformat (output sequence format) qualifier for a program that writes two sequences. The more complex inputs and outputs have "associated qualifiers" in EMBOSS - sequences for input, sequences, alignments, reports for output. We usually make these parameters, as it is useful in scripts to simply put the sequence "USA" or output filename on the commandline. Simply using -osformat could apply to one or both sequences. There are ways to specify one or both. -osformat3 would apply to the third parameter (maybe one input sequence and two output sequences - we try to insist on inputs first and outputs last in the parameter order). The number is not recommended - as it would change if we add or remove other qualifiers. However, the output of "needle -help -verbose" is too long-winded if we use the full name (see below) so we shorten it to -aformat3, -sformat1, -sformat2 for your needle example) Global settings: -osformat at the start of the command line (strictly, before the first parameter) applies to all. Positional qualilfiers (an idea borrows from the VMS operating system): -osformat after a parameter/qualifier that it is associated with applies specifically to that parameter/qualifier Full names: -osformat_outseq refers to the -outseq parameter (all parameters also have qualifier names). For needle, this would be aformat_outfile and is safer than -aformat3 Normal users will use -aformat. Wrappers and scripts should use -aformat_outfile (but can safely use -aformat before specifying the output file) Hope that helps to make things clearer. Peter From j.abbott at imperial.ac.uk Thu Nov 3 05:45:11 2005 From: j.abbott at imperial.ac.uk (Abbott, James) Date: Thu, 3 Nov 2005 10:45:11 -0000 Subject: [EMBOSS] How to search the arhives ? Message-ID: Hi Guys, pmr at ebi.ac.uk wrote: >>This is probably a stupid question but I did not find a way to search >>the emboss archives. > > >Hmmmm ... the archives have moved a couiple of times. I keep copies of the >important mails, but I've moved twice too so they are hard to search. > Google to the rescue! It is possible to restrict google to searching within a particular site, which can be very handy for list archives. You just need to enter 'site:www.url.org' as one of your query terms, so to search the EMBOSS archives for 'clustal' and 'outorder', google for the terms 'site:http://emboss.open-bio.org/pipermail/emboss/ clustal outorder' which returns one hit: http://www.google.co.uk/search?hl=en&q=+site%3Ahttp%3A%2F%2Femboss.open-bio.org%2Fpipermail%2Femboss%2F+clustal+outorder&btnG=Search&meta= which unfortunately does not seem to answer your question... Oh well...It's not a perfect solution, but very useful for (mainly pipermail) list archives which don't have a search capabililty. James -- Dr. James Abbott Bioinformatics Software Developer, Bioinformatics Support Service Imperial College, London From Marc.Logghe at DEVGEN.com Thu Nov 3 06:15:40 2005 From: Marc.Logghe at DEVGEN.com (Marc Logghe) Date: Thu, 3 Nov 2005 12:15:40 +0100 Subject: [EMBOSS] How to search the arhives ? Message-ID: <0C528E3670D8CE4B8E013F6749231AA62F56CC@ANTARESIA.be.devgen.com> > -----Original Message----- > From: pmr at ebi.ac.uk [mailto:pmr at ebi.ac.uk] > Sent: Thursday, November 03, 2005 10:43 AM > To: Marc Logghe > Cc: emboss at emboss.open-bio.org > Subject: Re: [EMBOSS] How to search the arhives ? > > Hi Mark, > > > This is probably a stupid question but I did not find a way > to search > > the emboss archives. I've found them, though, but only to > access the > > chunks by date. Not very efficient if you don't know the > date of the > > post anymore :-( > > Hmmmm ... the archives have moved a couiple of times. I keep > copies of the important mails, but I've moved twice too so > they are hard to search. > > While I'm figuring out how to search, I'll try answering > again to see if I give the same reply :-) You seem to be pretty consistent in your answers :-) Thanks a lot, that was it ! > > I suspect it was to define EMBOSS_CLUSTALW to be : > > setenv EMBOSS_CLUSTALW "clustalw -outorder=input" > > Works for me! (If you already define this variable to set the > full path or executable name for clustalw, preserve that part > in the new value) > Regards, Marc From pmr at ebi.ac.uk Thu Nov 3 07:06:37 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 12:06:37 -0000 (GMT) Subject: [EMBOSS] genbank retrieval In-Reply-To: <4369E529.908@pcm.uam.es> References: <4369D72B.9080507@pcm.uam.es> <1521.86.133.37.211.1131011393.squirrel@webmail.ebi.ac.uk> <4369E529.908@pcm.uam.es> Message-ID: <1669.86.133.37.211.1131019597.squirrel@webmail.ebi.ac.uk> Hi Natalia, >>Ah, the CON division is on my "to do" list. It needs some effort to do >> the >>EMBL version (rebuild the sequence and features from the composite >>entries). >> >> > You know if this enhancement will be available in the next EMBOSS release? Maybe some time next summer. We have a list of urgent tasks until the end of April and then I can have time to think about it. regards, Peter From rls at ebi.ac.uk Thu Nov 3 07:25:35 2005 From: rls at ebi.ac.uk (Rodrigo Lopez) Date: Thu, 03 Nov 2005 12:25:35 +0000 Subject: [EMBOSS] Antwort: genbank retrieval In-Reply-To: References: Message-ID: <436A01BF.9060705@ebi.ac.uk> CON entries do not have sequences as described in the EMBL/NCBI/DDBJ guidelines. Please see: http://www.ebi.ac.uk/embl/Documentation/Release_notes/current/relnotes.html#1_2_9 1.2.9 CON Database File CON files include construct information for building contig sequences of chromosomes, genomes and other long DNA sequences. CON entries in file 'embl.con' do not contain sequence data per se. However, EMBL-EBI make EMBLCONEXP available. These do have the sequences and are available from: ftp://ftp.ebi.ac.uk/pub/databases/embl/expanded_con/ I have not tested these with the EMBOSS dbiflat/dbxflat - but in principle they should work. R:) David.Bauer at schering.de wrote: > > Hi, > > I assume you mean gbcon.seq from the NCBI. > This is a bit strange sequence database, with no sequence in it. > It just contains instructions which part of which genbank file has to be > used to create a non-overlapping contig. > So this file can not be indexed with dbiflat. > > David. > emboss-bounces at emboss.open-bio.org schrieb am 03/11/2005 10:23:55: > > >>Hi, >> >>I'm trying to do a retrieval (entret -EMBOSS-) of CON-division of >>genbank database previously indexed through dbiflat but I don't obtain >>any result. >>Does anybody know how can I solve this problem? >>Thank you in advance, >>Natalia >>_______________________________________________ >>EMBOSS mailing list >>EMBOSS at emboss.open-bio.org >>http://newportal.open-bio.org/mailman/listinfo/emboss > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss From Tim.Troup at ed.ac.uk Thu Nov 3 09:22:24 2005 From: Tim.Troup at ed.ac.uk (Tim Troup) Date: Thu, 3 Nov 2005 14:22:24 +0000 Subject: [EMBOSS] Cannot open division file Message-ID: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> Hi, I have just installed emboss and was running a few programs over the test databases to ensure everything was working properly. When I run seqret for example i get the following error: wilkie226:~ troup$ seqret Reads and writes (returns) sequences Input sequence(s): tsw:hba_human Warning: Cannot open division file '' for database 'tsw' Warning: seqCdQry failed Error: Unable to read sequence 'tsw:hba_human' Or if i run whichdb i get: wilkie226:~ troup$ whichdb Search all databases for an entry ID or Accession number: hsfau Output file [outfile.whichdb]: Warning: Cannot open division file '' for database 'twp' Warning: seqCdQry failed Warning: Cannot open division file '' for database 'tsw' Warning: seqCdQry failed Warning: Cannot open division file '' for database 'tgenbank' Warning: seqCdQry failed Warning: Cannot open division file '' for database 'tpir' EMBOSS An error in ajseqdb.c at line 2597: seqCdQryOpen failed Having trawled through the mailing list archives I see others have experienced this problem in the past. Unfortunately I could not see any replies suggesting solutions. Any suggestions as to how i can remedy this situation would be greatly appreciated. Thanks, Tim From golharam at umdnj.edu Thu Nov 3 10:14:28 2005 From: golharam at umdnj.edu (Ryan Golhar) Date: Thu, 03 Nov 2005 10:14:28 -0500 Subject: [EMBOSS] Parameter discrepency In-Reply-To: <1568.86.133.37.211.1131013497.squirrel@webmail.ebi.ac.uk> Message-ID: <00c401c5e089$4980b400$e6028a0a@GOLHARMOBILE1> Yes it does clear things up. This should be added to the help docs -----Original Message----- From: pmr at ebi.ac.uk [mailto:pmr at ebi.ac.uk] Sent: Thursday, November 03, 2005 5:25 AM To: golharam at umdnj.edu Cc: emboss at emboss.open-bio.org Subject: Re: [EMBOSS] Parameter discrepency Hi Ryan, > I tried -aformat and that seems to work, so does -aformat3. Is one of > them not supposed to be there or just a carryover from an older > version of emboss? The docs talk about one version but use the other > in the example... For all current programs, -aformat is fine. To explain what is going on, consider the -osformat (output sequence format) qualifier for a program that writes two sequences. The more complex inputs and outputs have "associated qualifiers" in EMBOSS - sequences for input, sequences, alignments, reports for output. We usually make these parameters, as it is useful in scripts to simply put the sequence "USA" or output filename on the commandline. Simply using -osformat could apply to one or both sequences. There are ways to specify one or both. -osformat3 would apply to the third parameter (maybe one input sequence and two output sequences - we try to insist on inputs first and outputs last in the parameter order). The number is not recommended - as it would change if we add or remove other qualifiers. However, the output of "needle -help -verbose" is too long-winded if we use the full name (see below) so we shorten it to -aformat3, -sformat1, -sformat2 for your needle example) Global settings: -osformat at the start of the command line (strictly, before the first parameter) applies to all. Positional qualilfiers (an idea borrows from the VMS operating system): -osformat after a parameter/qualifier that it is associated with applies specifically to that parameter/qualifier Full names: -osformat_outseq refers to the -outseq parameter (all parameters also have qualifier names). For needle, this would be aformat_outfile and is safer than -aformat3 Normal users will use -aformat. Wrappers and scripts should use -aformat_outfile (but can safely use -aformat before specifying the output file) Hope that helps to make things clearer. Peter From pmr at ebi.ac.uk Thu Nov 3 11:21:23 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 16:21:23 -0000 (GMT) Subject: [EMBOSS] Cannot open division file In-Reply-To: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> Message-ID: <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> Hi Tim, > I have just installed emboss and was running a few programs over the > test databases to ensure everything was working properly. When I run > seqret for example i get the following error: > > wilkie226:~ troup$ seqret > Reads and writes (returns) sequences > Input sequence(s): tsw:hba_human > Warning: Cannot open division file '' for database 'tsw' > Warning: seqCdQry failed > Error: Unable to read sequence 'tsw:hba_human' If you look in the emboss.defaults file you will see, near the top, a line like this: # SET emboss_tempdata /homes/pmr/local/share/EMBOSS/test You need to uncomment this, and set the directory (the /homes/pmr/local part) to be wherever you installed EMBOSS. If you look further down to the database definition of tsw you will see emboss_tempdata is used ... and also for the other test databases we use for the progam manual examples and for our QA testing .... but you can of course use the real databases (locally indexed, or pointing to - for example - the EBI's SRS server). # swissprot (Puffer fish entries) # ========= DB tsw [ type: P dir: $emboss_tempdata/swiss method: emblcd format: swiss release: 36 fields: "sv des org key" comment: "Swissprot native format with EMBL CD-ROM index" ] Hope that clears things up Peter From gbottu at ben.vub.ac.be Thu Nov 3 11:21:32 2005 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Thu, 3 Nov 2005 17:21:32 +0100 Subject: [EMBOSS] CON division - Checked by AntiVir DEMO version - Message-ID: <20051103162132.GA19503@bigben.ulb.ac.be> Dear colleagues, Maybe interesting to mention that there is already a preliminary solution for retrieving entries from the EMBL or GenBank CON division, provided SRS (version 7.1 or 8) is used as access mechanism : DB emblcontigs [ type: N comment: 'EMBL contig sequences' format: embl methodquery: app app: "....../getz -e '[emblcontigs:%s]>[emblcontigs-ftk:contig]'" ] Regards, Guy Bottu, Belgian EMBnet Node From Tim.Troup at ed.ac.uk Thu Nov 3 11:42:27 2005 From: Tim.Troup at ed.ac.uk (Tim Troup) Date: Thu, 3 Nov 2005 16:42:27 +0000 Subject: [EMBOSS] Cannot open division file In-Reply-To: <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> Message-ID: <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> Hi, Thanks for replying so quickly. I have installed emboss locally under /usr/local/emboss. I uncommented the SET emboss_tempdata line within the emboss.default file stored at /usr/local/emboss/share/EMBOSS so it now reads: SET emboss_tempdata /usr/local/emboss/share/EMBOSS/test/ I restarted my machine. Unfortunately i still get the same error messages as before. Any further suggestions would greatly appreciated. Thanks, Tim On 3 Nov 2005, at 16:21, pmr at ebi.ac.uk wrote: > Hi Tim, > >> I have just installed emboss and was running a few programs over the >> test databases to ensure everything was working properly. When I run >> seqret for example i get the following error: >> >> wilkie226:~ troup$ seqret >> Reads and writes (returns) sequences >> Input sequence(s): tsw:hba_human >> Warning: Cannot open division file '' for database 'tsw' >> Warning: seqCdQry failed >> Error: Unable to read sequence 'tsw:hba_human' > > If you look in the emboss.defaults file you will see, near the top, > a line > like this: > > > # SET emboss_tempdata /homes/pmr/local/share/EMBOSS/test > > > You need to uncomment this, and set the directory (the /homes/pmr/ > local > part) to be wherever you installed EMBOSS. > > If you look further down to the database definition of tsw you will > see > emboss_tempdata is used ... and also for the other test databases > we use > for the progam manual examples and for our QA testing .... but you > can of > course use the real databases (locally indexed, or pointing to - for > example - the EBI's SRS server). > > > # swissprot (Puffer fish entries) > # ========= > > DB tsw [ type: P dir: $emboss_tempdata/swiss > method: emblcd format: swiss release: 36 > fields: "sv des org key" > comment: "Swissprot native format with EMBL CD-ROM index" ] > > > Hope that clears things up > > Peter > > From golharam at umdnj.edu Thu Nov 3 12:05:12 2005 From: golharam at umdnj.edu (Ryan Golhar) Date: Thu, 03 Nov 2005 12:05:12 -0500 Subject: [EMBOSS] Needle Message-ID: <010b01c5e098$c16f39f0$e6028a0a@GOLHARMOBILE1> I have a bunch of protein sequences that are fairly short. I'm using needle to align them. Occassionally, needle will give me that error "Sequence is not nucleic". I suspect needle is interpreting the sequence as DNA because of its content, however they are both protein sequences. Is there a way I can force needle to interpret them as protein sequences? Ryan From pmr at ebi.ac.uk Thu Nov 3 12:50:54 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 17:50:54 -0000 (GMT) Subject: [EMBOSS] Needle In-Reply-To: <010b01c5e098$c16f39f0$e6028a0a@GOLHARMOBILE1> References: <010b01c5e098$c16f39f0$e6028a0a@GOLHARMOBILE1> Message-ID: <3758.86.133.37.211.1131040254.squirrel@webmail.ebi.ac.uk> Hi Ryan, > I have a bunch of protein sequences that are fairly short. I'm using > needle to align them. Occassionally, needle will give me that error > "Sequence is not nucleic". > > I suspect needle is interpreting the sequence as DNA because of its > content, however they are both protein sequences. Is there a way I can > force needle to interpret them as protein sequences? Yes ... for any sequence input in any program you can use the command line qualifiers: -sprotein if it is protein -snucleotide (or -snuc) if it is DNA regards, Peter From pmr at ebi.ac.uk Thu Nov 3 12:54:45 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 17:54:45 -0000 (GMT) Subject: [EMBOSS] Cannot open division file In-Reply-To: <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> Message-ID: <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> Hi Tim, > I have installed emboss locally under /usr/local/emboss. > > I uncommented the SET emboss_tempdata line within the emboss.default > file stored at /usr/local/emboss/share/EMBOSS so it now reads: > > SET emboss_tempdata /usr/local/emboss/share/EMBOSS/test/ > > I restarted my machine. > > Unfortunately i still get the same error messages as before. Do you find the database directories under /usr/local/emboss/share/EMBOSS/test/ and can you read, for example, the swiss/seq.dat file (for tsw) from the account where you are running the applications? You can also run with -debug on the command line ... the *.dbg file it writes will tell you where is is looking for the files (or, if you send it to me, I can find the appropriate lines) Hope that helps ... we'll get there soon Peter From pmr at ebi.ac.uk Thu Nov 3 14:11:27 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 19:11:27 -0000 (GMT) Subject: [EMBOSS] Antwort: genbank retrieval In-Reply-To: <436A01BF.9060705@ebi.ac.uk> References: <436A01BF.9060705@ebi.ac.uk> Message-ID: <4738.86.133.37.211.1131045087.squirrel@webmail.ebi.ac.uk> Rodrigo Lopez wrote: > However, EMBL-EBI make EMBLCONEXP available. These do have the sequences > and are available from: > > ftp://ftp.ebi.ac.uk/pub/databases/embl/expanded_con/ > > I have not tested these with the EMBOSS dbiflat/dbxflat - but in > principle they should work. They worked for me with the current CVS code for dbiflat. They are frozen at the time of the EMBL release, which is fine for most purposes (all other EMBL entries are frozen in the same way). If I can make the CON entries work - reading the list of entries and building the expanded_con entry on the fly - EMBOSS will also be able to use the latest versions. Does anyone have a GenBank expanded CON division (as that was the original request - although the data in EMBL and GenBank should be identical). regards, Peter From Tim.Troup at ed.ac.uk Fri Nov 4 08:07:09 2005 From: Tim.Troup at ed.ac.uk (Tim Troup) Date: Fri, 4 Nov 2005 13:07:09 +0000 Subject: [EMBOSS] Cannot open division file In-Reply-To: <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> Message-ID: <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> Hi, > Do you find the database directories under > /usr/local/emboss/share/EMBOSS/test/ and can you read, for example, > the > swiss/seq.dat file (for tsw) from the account where you are running > the > applications? > The database directories are under /usr/local/emboss/share/EMBOSS/ test and the files within these directories can be read no problem. > You can also run with -debug on the command line ... the *.dbg file it > writes will tell you where is is looking for the files (or, if you > send it > to me, I can find the appropriate lines) > I ran seqret again from the command line with the -debug switch as follows: wilkie226:/usr/local/emboss/share/EMBOSS/test troup$ seqret -debug Reads and writes (returns) sequences Input sequence(s): tsw:hba_human Warning: Cannot open division file '' for database 'tsw' Warning: seqCdQry failed Error: Unable to read sequence 'tsw:hba_human' Input sequence(s): tsw:hba_human Warning: Cannot open division file '' for database 'tsw' Warning: seqCdQry failed Error: Unable to read sequence 'tsw:hba_human' Died: seqret terminated: Bad value for '-sequence' and no more retries The seqret.dbg file generated is pasted below. Thanks, Tim Debug file seqret.dbg buffered:No ajFileNewIn '/usr/local/emboss/share/EMBOSS/acd/seqret.acd' EOF ajFileGetsL file /usr/local/emboss/share/EMBOSS/acd/seqret.acd closing file '/usr/local/emboss/share/EMBOSS/acd/seqret.acd' Set acdprotein value '$(sequence.protein)' ajFeatTabInNew 50ba40 ajUserGet buffer len: 0 res: 2048 ptr: 1800a00 ajSeqinClear called ajFeattabInClear called ++seqUsaProcess 'tsw:hba_human' 0..0(N) '' 0 USA to test: 'tsw:hba_human' format regexp: No list:No no format specified in USA ...input format not set dbname dbexp: Yes found dbname 'tsw' level: '' qry->QryString: 'hba_human' namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' seqQueryFieldC usa 'sv' fields 'sv des org key' seqQueryField test 'sv' seqQueryField match 'sv' ajSeqQueryWild id 'hba_human' acc 'hba_human' sv 'hba_human' des '' org '' key '' wild (has) query Sv 'hba_human' database type: 'P' format 'swiss' use access method 'emblcd' Matched seqAccess[0] 'emblcd' seqAccessEmblcd type 2 directory '/usr/local/share/EMBOSS/test/swiss' entry 'hba_human' acc 'hba_human' ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' Database 'tsw' : access method 'emblcd' failed ajUserGet buffer len: 0 res: 2048 ptr: 1800a00 ajSeqinClear called ajFeattabInClear called ++seqUsaProcess 'tsw:hba_human' 0..0(N) '' 0 USA to test: 'tsw:hba_human' format regexp: No list:No no format specified in USA ...input format not set dbname dbexp: Yes found dbname 'tsw' level: '' qry->QryString: 'hba_human' namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' seqQueryFieldC usa 'sv' fields 'sv des org key' seqQueryField test 'sv' seqQueryField match 'sv' ajSeqQueryWild id 'hba_human' acc 'hba_human' sv 'hba_human' des '' org '' key '' wild (has) query Sv 'hba_human' database type: 'P' format 'swiss' use access method 'emblcd' Matched seqAccess[0] 'emblcd' seqAccessEmblcd type 2 directory '/usr/local/share/EMBOSS/test/swiss' entry 'hba_human' acc 'hba_human' ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' Database 'tsw' : access method 'emblcd' failed From pmr at ebi.ac.uk Fri Nov 4 08:54:29 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Fri, 4 Nov 2005 13:54:29 -0000 (GMT) Subject: [EMBOSS] Cannot open division file In-Reply-To: <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> Message-ID: <1083.86.133.37.211.1131112469.squirrel@webmail.ebi.ac.uk> Hi Tim, >> Do you find the database directories under >> /usr/local/emboss/share/EMBOSS/test/ and can you read, for example, >> the >> swiss/seq.dat file (for tsw) from the account where you are running >> the >> applications? >> > > The database directories are under /usr/local/emboss/share/EMBOSS/ > test and the files within these directories can be read no problem. >From the seqret.dbg file: ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' This is the division file - and should be correct. Can you check it has read permissions (it is a binary file) regards, Peter From Tim.Troup at ed.ac.uk Fri Nov 4 09:00:15 2005 From: Tim.Troup at ed.ac.uk (Tim Troup) Date: Fri, 4 Nov 2005 14:00:15 +0000 Subject: [EMBOSS] Cannot open division file In-Reply-To: <1083.86.133.37.211.1131112469.squirrel@webmail.ebi.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> <1083.86.133.37.211.1131112469.squirrel@webmail.ebi.ac.uk> Message-ID: > > From the seqret.dbg file: > > ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' > > This is the division file - and should be correct. Can you check it > has > read permissions (it is a binary file) > > /usr/local/share/EMBOSS/test/swiss/division.lkp permissions are set to 644. So everyone should have read permission. wilkie226:/usr/local/emboss/share/EMBOSS/test/swiss troup$ ls -al total 880 drwxr-xr-x 15 troup wheel 510 Nov 3 13:37 . drwxr-xr-x 11 troup wheel 374 Nov 4 12:54 .. -rw-r--r-- 1 troup wheel 732 Nov 3 13:37 acnum.hit -rw-r--r-- 1 troup wheel 1812 Nov 3 13:37 acnum.trg -rw-r--r-- 1 troup wheel 1704 Nov 3 13:37 des.hit -rw-r--r-- 1 troup wheel 4225 Nov 3 13:37 des.trg -rw-r--r-- 1 troup wheel 322 Nov 3 13:37 division.lkp -rw-r--r-- 1 troup wheel 2020 Nov 3 13:37 entrynam.idx -rw-r--r-- 1 troup wheel 1880 Nov 3 13:37 keyword.hit -rw-r--r-- 1 troup wheel 3540 Nov 3 13:37 keyword.trg -rw-r--r-- 1 troup wheel 386698 Nov 3 13:37 seq.dat -rw-r--r-- 1 troup wheel 644 Nov 3 13:37 seqvn.hit -rw-r--r-- 1 troup wheel 1676 Nov 3 13:37 seqvn.trg -rw-r--r-- 1 troup wheel 3980 Nov 3 13:37 taxon.hit -rw-r--r-- 1 troup wheel 8884 Nov 3 13:37 taxon.trg Thanks again for your time. Tim From ajb at ebi.ac.uk Fri Nov 4 09:02:37 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 4 Nov 2005 14:02:37 -0000 (GMT) Subject: [EMBOSS] Cannot open division file In-Reply-To: <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> Message-ID: <60806.81.96.70.96.1131112957.squirrel@webmail.ebi.ac.uk> Hi, The line in the debug output: namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' implies that you've set emboss_tempdata incorrectly in emboss.default. It should be /usr/local/emboss/share/EMBOSS/test according to the rest of the information you give. HTH Alan > Hi, > >> Do you find the database directories under >> /usr/local/emboss/share/EMBOSS/test/ and can you read, for example, >> the >> swiss/seq.dat file (for tsw) from the account where you are running >> the >> applications? >> > > The database directories are under /usr/local/emboss/share/EMBOSS/ > test and the files within these directories can be read no problem. > > > >> You can also run with -debug on the command line ... the *.dbg file it >> writes will tell you where is is looking for the files (or, if you >> send it >> to me, I can find the appropriate lines) >> > > I ran seqret again from the command line with the -debug switch as > follows: > > wilkie226:/usr/local/emboss/share/EMBOSS/test troup$ seqret -debug > Reads and writes (returns) sequences > Input sequence(s): tsw:hba_human > Warning: Cannot open division file '' for database 'tsw' > Warning: seqCdQry failed > Error: Unable to read sequence 'tsw:hba_human' > Input sequence(s): tsw:hba_human > Warning: Cannot open division file '' for database 'tsw' > Warning: seqCdQry failed > Error: Unable to read sequence 'tsw:hba_human' > Died: seqret terminated: Bad value for '-sequence' and no more retries > > The seqret.dbg file generated is pasted below. > > Thanks, Tim > > > > Debug file seqret.dbg buffered:No > ajFileNewIn '/usr/local/emboss/share/EMBOSS/acd/seqret.acd' > EOF ajFileGetsL file /usr/local/emboss/share/EMBOSS/acd/seqret.acd > closing file '/usr/local/emboss/share/EMBOSS/acd/seqret.acd' > Set acdprotein value '$(sequence.protein)' > ajFeatTabInNew 50ba40 > ajUserGet buffer len: 0 res: 2048 ptr: 1800a00 > ajSeqinClear called > ajFeattabInClear called > ++seqUsaProcess 'tsw:hba_human' 0..0(N) '' 0 > USA to test: 'tsw:hba_human' > > format regexp: No list:No > no format specified in USA > > ...input format not set > dbname dbexp: Yes > found dbname 'tsw' level: '' qry->QryString: 'hba_human' > namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' > namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' > seqQueryFieldC usa 'sv' fields 'sv des org key' > seqQueryField test 'sv' > seqQueryField match 'sv' > ajSeqQueryWild id 'hba_human' acc 'hba_human' sv 'hba_human' des '' > org '' key '' > wild (has) query Sv 'hba_human' > database type: 'P' format 'swiss' > use access method 'emblcd' > Matched seqAccess[0] 'emblcd' > seqAccessEmblcd type 2 > directory '/usr/local/share/EMBOSS/test/swiss' entry 'hba_human' acc > 'hba_human' > ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' > Database 'tsw' : access method 'emblcd' failed > ajUserGet buffer len: 0 res: 2048 ptr: 1800a00 > ajSeqinClear called > ajFeattabInClear called > ++seqUsaProcess 'tsw:hba_human' 0..0(N) '' 0 > USA to test: 'tsw:hba_human' > > format regexp: No list:No > no format specified in USA > > ...input format not set > dbname dbexp: Yes > found dbname 'tsw' level: '' qry->QryString: 'hba_human' > namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' > namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' > seqQueryFieldC usa 'sv' fields 'sv des org key' > seqQueryField test 'sv' > seqQueryField match 'sv' > ajSeqQueryWild id 'hba_human' acc 'hba_human' sv 'hba_human' des '' > org '' key '' > wild (has) query Sv 'hba_human' > database type: 'P' format 'swiss' > use access method 'emblcd' > Matched seqAccess[0] 'emblcd' > seqAccessEmblcd type 2 > directory '/usr/local/share/EMBOSS/test/swiss' entry 'hba_human' acc > 'hba_human' > ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' > Database 'tsw' : access method 'emblcd' failed > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From Tim.Troup at ed.ac.uk Fri Nov 4 09:10:16 2005 From: Tim.Troup at ed.ac.uk (Tim Troup) Date: Fri, 4 Nov 2005 14:10:16 +0000 Subject: [EMBOSS] Cannot open division file In-Reply-To: <60806.81.96.70.96.1131112957.squirrel@webmail.ebi.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> <60806.81.96.70.96.1131112957.squirrel@webmail.ebi.ac.uk> Message-ID: Hi, I corrected the path emboss_tempdata variable in the emboss.default file and all now works smoothly. Thanks, Tim On 4 Nov 2005, at 14:02, ajb at ebi.ac.uk wrote: > Hi, > > The line in the debug output: > > namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' > > implies that you've set emboss_tempdata incorrectly in emboss.default. > It should be /usr/local/emboss/share/EMBOSS/test according to > the rest of the information you give. > > HTH > > Alan > >> Hi, >> >>> Do you find the database directories under >>> /usr/local/emboss/share/EMBOSS/test/ and can you read, for example, >>> the >>> swiss/seq.dat file (for tsw) from the account where you are running >>> the >>> applications? >>> >> >> The database directories are under /usr/local/emboss/share/EMBOSS/ >> test and the files within these directories can be read no problem. >> >> >> >>> You can also run with -debug on the command line ... the *.dbg >>> file it >>> writes will tell you where is is looking for the files (or, if you >>> send it >>> to me, I can find the appropriate lines) >>> >> >> I ran seqret again from the command line with the -debug switch as >> follows: >> >> wilkie226:/usr/local/emboss/share/EMBOSS/test troup$ seqret -debug >> Reads and writes (returns) sequences >> Input sequence(s): tsw:hba_human >> Warning: Cannot open division file '' for database 'tsw' >> Warning: seqCdQry failed >> Error: Unable to read sequence 'tsw:hba_human' >> Input sequence(s): tsw:hba_human >> Warning: Cannot open division file '' for database 'tsw' >> Warning: seqCdQry failed >> Error: Unable to read sequence 'tsw:hba_human' >> Died: seqret terminated: Bad value for '-sequence' and no more >> retries >> >> The seqret.dbg file generated is pasted below. >> >> Thanks, Tim >> >> >> >> Debug file seqret.dbg buffered:No >> ajFileNewIn '/usr/local/emboss/share/EMBOSS/acd/seqret.acd' >> EOF ajFileGetsL file /usr/local/emboss/share/EMBOSS/acd/seqret.acd >> closing file '/usr/local/emboss/share/EMBOSS/acd/seqret.acd' >> Set acdprotein value '$(sequence.protein)' >> ajFeatTabInNew 50ba40 >> ajUserGet buffer len: 0 res: 2048 ptr: 1800a00 >> ajSeqinClear called >> ajFeattabInClear called >> ++seqUsaProcess 'tsw:hba_human' 0..0(N) '' 0 >> USA to test: 'tsw:hba_human' >> >> format regexp: No list:No >> no format specified in USA >> >> ...input format not set >> dbname dbexp: Yes >> found dbname 'tsw' level: '' qry->QryString: 'hba_human' >> namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' >> namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' >> seqQueryFieldC usa 'sv' fields 'sv des org key' >> seqQueryField test 'sv' >> seqQueryField match 'sv' >> ajSeqQueryWild id 'hba_human' acc 'hba_human' sv 'hba_human' des '' >> org '' key '' >> wild (has) query Sv 'hba_human' >> database type: 'P' format 'swiss' >> use access method 'emblcd' >> Matched seqAccess[0] 'emblcd' >> seqAccessEmblcd type 2 >> directory '/usr/local/share/EMBOSS/test/swiss' entry 'hba_human' acc >> 'hba_human' >> ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' >> Database 'tsw' : access method 'emblcd' failed >> ajUserGet buffer len: 0 res: 2048 ptr: 1800a00 >> ajSeqinClear called >> ajFeattabInClear called >> ++seqUsaProcess 'tsw:hba_human' 0..0(N) '' 0 >> USA to test: 'tsw:hba_human' >> >> format regexp: No list:No >> no format specified in USA >> >> ...input format not set >> dbname dbexp: Yes >> found dbname 'tsw' level: '' qry->QryString: 'hba_human' >> namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' >> namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' >> seqQueryFieldC usa 'sv' fields 'sv des org key' >> seqQueryField test 'sv' >> seqQueryField match 'sv' >> ajSeqQueryWild id 'hba_human' acc 'hba_human' sv 'hba_human' des '' >> org '' key '' >> wild (has) query Sv 'hba_human' >> database type: 'P' format 'swiss' >> use access method 'emblcd' >> Matched seqAccess[0] 'emblcd' >> seqAccessEmblcd type 2 >> directory '/usr/local/share/EMBOSS/test/swiss' entry 'hba_human' acc >> 'hba_human' >> ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' >> Database 'tsw' : access method 'emblcd' failed >> >> _______________________________________________ >> EMBOSS mailing list >> EMBOSS at emboss.open-bio.org >> http://newportal.open-bio.org/mailman/listinfo/emboss >> > > From p.ulvskov at dias.kvl.dk Sat Nov 5 12:09:26 2005 From: p.ulvskov at dias.kvl.dk (Peter Ulvskov) Date: Sat, 5 Nov 2005 18:09:26 +0100 Subject: [EMBOSS] Jemboss Installation on OS X Message-ID: <7f69986799074cb1f4fb03e6c47eaae5@dias.kvl.dk> > Thanks Michael that is useful to the EMBOSS group as we are waiting > for a > copy of Tiger to test Jemboss/EMBOSS out on. So it is good to know that > you have it working. > > Also just a note that 1.3 is no longer supported, so the options are > 1.4.2 or 1.5. > > Regards > Tim Carver Dear Tim, I have tried to follow your instructions earlier on (Emboss 2.8.0) with regard to getting Jemboss installed on OS X, but gave up eventually (Emboss itself runs fine). I have just downloaded ebiotools with Emboss version 3.0 and thought that I should give it one more try. A little Googling reveals that a lot of people are struggling with the Jemboss installation and although some users actually succeed I have yet to find a consolidated, fool proof step 1 through n on how to do it. Jemboss has been around long enough for such a Quick-start guide to exist if only I could find it. Can you help? Thanks, and best regards, Peter Ulvskov -------------- next part -------------- A non-text attachment was scrubbed... Name: not available Type: text/enriched Size: 1030 bytes Desc: not available Url : http://lists.open-bio.org/pipermail/emboss/attachments/20051105/9d4be65c/attachment.bin From tjc at sanger.ac.uk Sun Nov 6 12:54:06 2005 From: tjc at sanger.ac.uk (Tim Carver) Date: Sun, 6 Nov 2005 17:54:06 +0000 (GMT) Subject: [EMBOSS] Jemboss Installation on OS X (fwd) Message-ID: Hi Peter The installation instructions are here, for the standalone: http://emboss.sourceforge.net/Jemboss/install/standalone.html for the client-server http://emboss.sourceforge.net/Jemboss/install/server.html The install script (install-jemboss-server.sh) is intended to guide you through as much as possible the installation process. This has been updated since I have had access to Tiger - so get the latest from (http://emboss.sourceforge.net/Jemboss/install/install-jemboss-server.sh). I have also just been through the server set up instructions and updated versions etc, hopefully to make it clearer. Please let me know if there is anything there that needs to be clarified. Also please email any problems you encounter during the installation. Important points I would emphasise: - get the latest install script from: http://emboss.sourceforge.net/Jemboss/install/install-jemboss-server.sh to replace the one in EMBOSS-3.x.x/jemboss/utils/ - ensure that libpng, zlib and libgd are installed in the same place (i.e. with the same prefix), e.g. /usr/local - ensure you start with fresh downloads and remove any old installations of tomcat, axis, EMBOSS. - use the current versions (Java 1.5, apache-tomcat-5.5.12, axis-1_3) - follow the instructions at: http://emboss.sourceforge.net/Jemboss/install/server.html Let me know how it goes, Tim On Sat, 5 Nov 2005, Peter Ulvskov wrote: > > Thanks Michael that is useful to the EMBOSS group as we are waiting > > for a > > copy of Tiger to test Jemboss/EMBOSS out on. So it is good to know that > > you have it working. > > > > Also just a note that 1.3 is no longer supported, so the options are > > 1.4.2 or 1.5. > > > > Regards > > Tim Carver > > Dear Tim, > I have tried to follow your instructions earlier on (Emboss 2.8.0) with > regard to getting Jemboss installed on OS X, but gave up eventually > (Emboss itself runs fine). I have just downloaded ebiotools with Emboss > version 3.0 and thought that I should give it one more try. A little > Googling reveals that a lot of people are struggling with the Jemboss > installation and although some users actually succeed I have yet to > find a consolidated, fool proof step 1 through n on how to do it. > Jemboss has been around long enough for such a Quick-start guide to > exist if only I could find it. > Can you help? > > Thanks, and best regards, > > Peter Ulvskov > The Wellcome Trust Sanger Institute Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK From bioflash at gmail.com Wed Nov 9 01:11:35 2005 From: bioflash at gmail.com (Vincent Deng) Date: Wed, 9 Nov 2005 14:11:35 +0800 Subject: [EMBOSS] Help with fdnadist Message-ID: <455343d90511082211u73ef385ya714e159e88f0d9b@mail.gmail.com> Hi, I'd read this postand run fdnadist with a bootstrapped dataset(boostrap for 100times). After running it, I could only find one data matrix in the output file of fdnadist. I guess that's because fdnadist only compute one set of the boostrapped data. Any help for this problem? Best Regards... From sas at belozersky.msu.ru Wed Nov 9 02:16:14 2005 From: sas at belozersky.msu.ru (Sergei Spirin) Date: Wed, 9 Nov 2005 10:16:14 +0300 Subject: [EMBOSS] Help with fdnadist References: <455343d90511082211u73ef385ya714e159e88f0d9b@mail.gmail.com> Message-ID: <009101c5e4fd$7b963eb0$8a3afa9e@class51> Just yesterday I had the same experience with fprotdist: fseqboot prepared a file containing 100 alignments, but fprotdist made only one matrix from that input. I could not find an option like "number of datasets". Sergei ----- Original Message ----- From: "Vincent Deng" To: Sent: Wednesday, November 09, 2005 9:11 AM Subject: [EMBOSS] Help with fdnadist > Hi, > > I'd read this > postand > run fdnadist with a bootstrapped dataset(boostrap for 100times). After > running it, I could only find one data matrix in the output file of > fdnadist. I guess that's because fdnadist only compute one set of the > boostrapped data. Any help for this problem? > > Best Regards... > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From pmr at ebi.ac.uk Wed Nov 9 03:12:59 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 09 Nov 2005 08:12:59 +0000 Subject: [EMBOSS] Help with fdnadist In-Reply-To: <455343d90511082211u73ef385ya714e159e88f0d9b@mail.gmail.com> References: <455343d90511082211u73ef385ya714e159e88f0d9b@mail.gmail.com> Message-ID: <4371AF8B.3040908@ebi.ac.uk> Vincent Deng wrote: > I'd read this postand > run fdnadist with a bootstrapped dataset(boostrap for 100times). After > running it, I could only find one data matrix in the output file of > fdnadist. I guess that's because fdnadist only compute one set of the > boostrapped data. Any help for this problem? Yes ... there is a bug in EMBOSS 3.0.0 in reading multiple set of ailgnments in phylip format. This only afects the phylipnew programs (no other program is trying to read more than one alignment as input). Removing the blank line between alignments fixes the problem. This will be fixed in the next release. f you ru this kind of analysis often we can provide a patch for EMBOSS 3.0.0 Hope that helps, Peter Rice From pmr at ebi.ac.uk Wed Nov 9 03:14:50 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 09 Nov 2005 08:14:50 +0000 Subject: [EMBOSS] Help with fdnadist In-Reply-To: <009101c5e4fd$7b963eb0$8a3afa9e@class51> References: <455343d90511082211u73ef385ya714e159e88f0d9b@mail.gmail.com> <009101c5e4fd$7b963eb0$8a3afa9e@class51> Message-ID: <4371AFFA.1010002@ebi.ac.uk> Sergei Spirin wrote: > Just yesterday I had the same experience with fprotdist: fseqboot prepared a > file containing 100 alignments, but fprotdist made only one matrix from that > input. I could not find an option like "number of datasets". The EMBOSS programs automatically read all the datasets so we do not need the PHYLIP "number of datasets" option - (but see my previous reply for a problem with reading the input file format). regards, Peter From bioflash at gmail.com Wed Nov 9 04:20:33 2005 From: bioflash at gmail.com (Vincent Deng) Date: Wed, 9 Nov 2005 17:20:33 +0800 Subject: [EMBOSS] Help with fdnapars Message-ID: <455343d90511090120h69745e7i2cc7c064fe7e2d7d@mail.gmail.com> Hi, I encountered "Segmentation fault" error when running fdnapars. However if I reduced the number of the sequences in input file, it ran well. Is there any sequence number consideration when running this program? p.s. My OS version is RedHat 9.0 Best Regards... From pmr at ebi.ac.uk Wed Nov 9 04:36:05 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 09 Nov 2005 09:36:05 +0000 Subject: [EMBOSS] Help with fdnapars In-Reply-To: <455343d90511090120h69745e7i2cc7c064fe7e2d7d@mail.gmail.com> References: <455343d90511090120h69745e7i2cc7c064fe7e2d7d@mail.gmail.com> Message-ID: <4371C305.2000007@ebi.ac.uk> Vincent Deng wrote: > I encountered "Segmentation fault" error when running fdnapars. However if I > reduced the number of the sequences in input file, it ran well. Is there any > sequence number consideration when running this program? There is no specific limit. Looks like a bug (though it may be in the EMBOSS or the PHYLIP code) Can you send me the input file and command line please? regards, Peter From Tim.Troup at ed.ac.uk Wed Nov 9 05:45:54 2005 From: Tim.Troup at ed.ac.uk (Tim Troup) Date: Wed, 9 Nov 2005 10:45:54 +0000 Subject: [EMBOSS] emboss on redhat enterprise linux 64-bit Message-ID: Hi, I am trying to install emboss version 2.8.0 on a dual 64-bit xeon processor machine running redhat enterprise linux. The reason I am installing version 2.8.0 is because I wish to make emboss available as a set of web services via soaplab (http://www.ebi.ac.uk/soaplab/) and currently soaplab is tied to version 2.8.0 (http://www.ebi.ac.uk/ soaplab/ServiceSets.html). I configured the install as follows: ./configure --prefix=/usr/local/emboss --without-x --enable-64 then did make and make install with no obvious error messages. However, when i try to run any of the apps from the command line I get: Segmentation fault Anyone got any tips as to how to get emboss running on this kind of set up? Thanks, Tim From rls at ebi.ac.uk Wed Nov 9 06:06:46 2005 From: rls at ebi.ac.uk (Rodrigo Lopez) Date: Wed, 9 Nov 2005 11:06:46 -0000 Subject: [EMBOSS] emboss on redhat enterprise linux 64-bit In-Reply-To: Message-ID: <001a01c5e51d$ae1dfba0$0132a8c0@windows.ebi.ac.uk> Hi, You should contact Alberto Labarga at the EBI (alabarga at ebi.ac.uk - Cc'd on this email) about using new supported SWS for EMBOSS and the future of SOAPLAB as we know it. R:) > -----Original Message----- > From: emboss-bounces at emboss.open-bio.org > [mailto:emboss-bounces at emboss.open-bio.org] On Behalf Of Tim Troup > Sent: 09 November 2005 10:46 > To: emboss at emboss.open-bio.org > Subject: [EMBOSS] emboss on redhat enterprise linux 64-bit > > > Hi, > > I am trying to install emboss version 2.8.0 on a dual 64-bit xeon > processor machine running redhat enterprise linux. The reason I am > installing version 2.8.0 is because I wish to make emboss available > as a set of web services via soaplab (http://www.ebi.ac.uk/soaplab/) > and currently soaplab is tied to version 2.8.0 (http://www.ebi.ac.uk/ > soaplab/ServiceSets.html). > > I configured the install as follows: > > ./configure --prefix=/usr/local/emboss --without-x --enable-64 > > then did make and make install with no obvious error messages. > > However, when i try to run any of the apps from the command > line I get: > > Segmentation fault > > Anyone got any tips as to how to get emboss running on this kind of > set up? > > Thanks, Tim > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From njoly at pasteur.fr Wed Nov 9 06:52:23 2005 From: njoly at pasteur.fr (Nicolas Joly) Date: Wed, 9 Nov 2005 12:52:23 +0100 Subject: [EMBOSS] emboss on redhat enterprise linux 64-bit In-Reply-To: References: Message-ID: <20051109115223.GB196054@medusa.sis.pasteur.fr> On Wed, Nov 09, 2005 at 10:45:54AM +0000, Tim Troup wrote: > Hi, > > I am trying to install emboss version 2.8.0 on a dual 64-bit xeon > processor machine running redhat enterprise linux. The reason I am > installing version 2.8.0 is because I wish to make emboss available > as a set of web services via soaplab (http://www.ebi.ac.uk/soaplab/) > and currently soaplab is tied to version 2.8.0 (http://www.ebi.ac.uk/ > soaplab/ServiceSets.html). > > I configured the install as follows: > > ./configure --prefix=/usr/local/emboss --without-x --enable-64 > > then did make and make install with no obvious error messages. > > However, when i try to run any of the apps from the command line I get: > > Segmentation fault > > Anyone got any tips as to how to get emboss running on this kind of > set up? We already saw this on our amd64 machine running CenOS 3.6 (RHEL clone). It looks like a compiler/glibc/... bug as it disappeared when we upgraded the machines to CentOS 4.2. -- Nicolas Joly Biological Software and Databanks. Institut Pasteur, Paris. From noutsos at lrz.uni-muenchen.de Thu Nov 10 09:13:26 2005 From: noutsos at lrz.uni-muenchen.de (christos noutsos) Date: Thu, 10 Nov 2005 15:13:26 +0100 Subject: [EMBOSS] installing EMBOSS to suse 9.3 Message-ID: <200511101513.26342.noutsos@lrz.uni-muenchen.de> I'm trying to install the EMBOSS 3.0.0 to a Suse 9.3 operating system as an administrator. I follow the instructions for a normal installation but at the end I can not get the wossname is not working and I can not get any other program also. Any suggestions? Thanks a lot. christos From andrespinzon at gmail.com Thu Nov 10 10:27:17 2005 From: andrespinzon at gmail.com (Andres Pinzon) Date: Thu, 10 Nov 2005 10:27:17 -0500 Subject: [EMBOSS] installing EMBOSS to suse 9.3 In-Reply-To: <200511101513.26342.noutsos@lrz.uni-muenchen.de> References: <200511101513.26342.noutsos@lrz.uni-muenchen.de> Message-ID: <8968fc7e0511100727tce8e308o@mail.gmail.com> 2005/11/10, christos noutsos : > I'm trying to install the EMBOSS 3.0.0 to a Suse 9.3 operating system as an > administrator. I follow the instructions for a normal installation but at the > end I can not get the wossname is not working and I can not get any other > program also. What is the system message? I mean what is the error that appears when you run wossname or whatever? -- --------- Andr?s Pinz?n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From andrespinzon at gmail.com Thu Nov 10 14:24:57 2005 From: andrespinzon at gmail.com (Andres Pinzon) Date: Thu, 10 Nov 2005 14:24:57 -0500 Subject: [EMBOSS] installing EMBOSS to suse 9.3 In-Reply-To: <200511101702.01513.noutsos@lrz.uni-muenchen.de> References: <200511101513.26342.noutsos@lrz.uni-muenchen.de> <8968fc7e0511100727tce8e308o@mail.gmail.com> <200511101702.01513.noutsos@lrz.uni-muenchen.de> Message-ID: <8968fc7e0511101124o69fbd4cfp@mail.gmail.com> 2005/11/10, christos noutsos : > On Thursday 10 November 2005 16:27, you wrote: > > this is the only thing that I get > so when I run ./wossname then I get > "bash: ./wossname: No such file or directory" > and when I run wossname then I get > bash: wossname: No such file or directory Ok! it seems that your problem is not a big one, is just that your EMBOSS/bin directory is not in the path. What you have to do is to tell your system where to find the emboss binaries. How can U do that? Is pretty easy. First of all where did you install emboss? Something like /usr/local/emboss? Lets guess that is your emboss directory, so what you have to do is: export PATH=/usr/local/emboss/bin:$PATH And if tyou want this changes to be permanent edit your /etc/profile. -- --------- Andr?s Pinz?n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From Andrew.Mather at dpi.vic.gov.au Thu Nov 10 18:10:04 2005 From: Andrew.Mather at dpi.vic.gov.au (Andrew.Mather at dpi.vic.gov.au) Date: Fri, 11 Nov 2005 10:10:04 +1100 Subject: [EMBOSS] emboss on redhat enterprise linux 64-bit Message-ID: Hi All, I can confirm that it's a compiler/glibc thing with RHEL on Opteron. We had the same experience. Compile without errors, but segfault on execution. We upgraded GCC to 4.0.1 and all went fine. Andrew Bioinformatics Advanced Scientific Computing, Animal Genetics and Genomics, PIRVic Attwood 475 Mickleham Road, Attwood, 3049 ph +61 3 92174342 mob 0413 009 761 ---------------- There are 10 kinds of people...those who understand binary and those who don't. |---------+----------------------------------> | | njoly at pasteur.fr | | | Sent by: | | | emboss-bounces at emboss.o| | | pen-bio.org | | | | | | | | | 09/11/2005 10:52 PM | | | | |---------+----------------------------------> >------------------------------------------------------------------------------------------------------------------------------| | | | To: Tim.Troup at ed.ac.uk | | cc: emboss at emboss.open-bio.org | | Subject: Re: [EMBOSS] emboss on redhat enterprise linux 64-bit | >------------------------------------------------------------------------------------------------------------------------------| On Wed, Nov 09, 2005 at 10:45:54AM +0000, Tim Troup wrote: > Hi, > > I am trying to install emboss version 2.8.0 on a dual 64-bit xeon > processor machine running redhat enterprise linux. The reason I am > installing version 2.8.0 is because I wish to make emboss available > as a set of web services via soaplab (http://www.ebi.ac.uk/soaplab/) > and currently soaplab is tied to version 2.8.0 (http://www.ebi.ac.uk/ > soaplab/ServiceSets.html). > > I configured the install as follows: > > ./configure --prefix=/usr/local/emboss --without-x --enable-64 > > then did make and make install with no obvious error messages. > > However, when i try to run any of the apps from the command line I get: > > Segmentation fault > > Anyone got any tips as to how to get emboss running on this kind of > set up? We already saw this on our amd64 machine running CenOS 3.6 (RHEL clone). It looks like a compiler/glibc/... bug as it disappeared when we upgraded the machines to CentOS 4.2. -- Nicolas Joly Biological Software and Databanks. Institut Pasteur, Paris. _______________________________________________ EMBOSS mailing list EMBOSS at emboss.open-bio.org http://newportal.open-bio.org/mailman/listinfo/emboss From Richard.Rothery at ualberta.ca Tue Nov 15 14:03:08 2005 From: Richard.Rothery at ualberta.ca (Richard Rothery) Date: Tue, 15 Nov 2005 12:03:08 -0700 Subject: [EMBOSS] Netblast search of swissprot and trembl...... Message-ID: <000601c5ea17$37598c10$5e068081@Nordegg> I am using blastcl3 to search NCBI using multiple bait sequences in fasta format. I can readily search swissprot using this program, but cannot search trembl. The NCBI accession numbers (ie just numbers) that blastcl3 returns require re-labelling of the sequences to make clustal outputs, phylogeny analyses etc. meaningful. Is there an easily-installed linux client that can search trembl? Can blastcl3 be forced to do it? What I would like to do is feed seqret a file containing the trembl accessions. This would generate a fasta file with more meaningful titles comprising the accession number followed by the swissprot organism abbreviation. Thanks, Richard ############################################### CIHR Membrane Protein Research Group, Department of Biochemistry, University of Alberta, Edmonton T6G 2H7 Ph. (780) 492-2229 Fax. (780) 492-0886 ############################################### From jison at ebi.ac.uk Wed Nov 16 07:25:11 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Wed, 16 Nov 2005 12:25:11 -0000 (GMT) Subject: [EMBOSS] Netblast search of swissprot and trembl...... In-Reply-To: <000601c5ea17$37598c10$5e068081@Nordegg> References: <000601c5ea17$37598c10$5e068081@Nordegg> Message-ID: <36587.172.31.8.12.1132143911.squirrel@webmail.ebi.ac.uk> Hi Richard seqret can read a "list file" which is a list of USAs (one per line). A USA (Uniform Sequence Address) is the EMBOSS method of specifying sequences from databases, files etc. You'll need the "@myfile" or "list::myfile" syntax where "myfile" is the file name of your list of sequences. You can output in all the common formats. Read the documentation : http://emboss.sourceforge.net/apps/seqret.html Cheers Jon > I am using blastcl3 to search NCBI using multiple bait sequences in > fasta format. I can readily search swissprot using this program, but > cannot search trembl. The NCBI accession numbers (ie just numbers) that > blastcl3 returns require re-labelling of the sequences to make clustal > outputs, phylogeny analyses etc. meaningful. > > > > Is there an easily-installed linux client that can search trembl? Can > blastcl3 be forced to do it? > > > > What I would like to do is feed seqret a file containing the trembl > accessions. This would generate a fasta file with more meaningful titles > comprising the accession number followed by the swissprot organism > abbreviation. > > > > Thanks, > > > > Richard > > > > ############################################### > > CIHR Membrane Protein Research Group, > > Department of Biochemistry, University of Alberta, > > Edmonton T6G 2H7 > > Ph. (780) 492-2229 Fax. (780) 492-0886 > > ############################################### > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From gbottu at ben.vub.ac.be Wed Nov 16 10:45:08 2005 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Wed, 16 Nov 2005 16:45:08 +0100 Subject: [EMBOSS] Netblast search of swissprot and trembl - Checked by AntiV In-Reply-To: <000601c5ea17$37598c10$5e068081@Nordegg> References: <000601c5ea17$37598c10$5e068081@Nordegg> Message-ID: <20051116154508.GA32468@bigben.ulb.ac.be> On Tue, Nov 15, 2005 at 12:03:08PM -0700, Richard Rothery wrote: > Is there an easily-installed linux client that can search trembl? Can > blastcl3 be forced to do it? The problem is that blastcl3 submits searches at the NCBI, where they do not offer trembl as such. There exists a program WSWUBlastClient.pl that submits searches at the EBI, where they have uniprot (swissprot + trembl). see http://www.ebi.ac.uk/Tools/webservices/index.html To make it work you need however to install a lot of Perl libraries. Guy Bottu, Belgian EMBnet Node From andrespinzon at gmail.com Wed Nov 16 11:00:18 2005 From: andrespinzon at gmail.com (Andres Pinzon) Date: Wed, 16 Nov 2005 11:00:18 -0500 Subject: [EMBOSS] OT: BLAST interfaces Message-ID: <8968fc7e0511160800r18b0c003n@mail.gmail.com> First of all I would like to apologize for this OT, but as i see you are talking about BLAST interfaces I would like to ask you for one BLAST HTML interface to query a local BLAST server and, of course, obtain the results. Im developing one by myself (prettyBLAST), because we are using a client/server version (databases are in a different machine from the one the queries are going to be run so I have to capture the server response in chunks and show the BLAST output) but before working more on it I would like to know your opinion about some BLAST interfaces out there and if this development worthwhile. Thanks in advance, -- --------- Andr?s Pinz?n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From sbassi at gmail.com Wed Nov 16 11:06:57 2005 From: sbassi at gmail.com (Sebastian Bassi) Date: Wed, 16 Nov 2005 13:06:57 -0300 Subject: [EMBOSS] OT: BLAST interfaces In-Reply-To: <8968fc7e0511160800r18b0c003n@mail.gmail.com> References: <8968fc7e0511160800r18b0c003n@mail.gmail.com> Message-ID: On 11/16/05, Andres Pinzon wrote: > First of all I would like to apologize for this OT, but as i see you > are talking about BLAST interfaces I would like to ask you for one > BLAST HTML interface to query a local BLAST server and, of course, > obtain the results. ... > on it I would like to know your opinion about some BLAST interfaces > out there and if this development worthwhile. > Thanks in advance, GUIBlast and YBlast. I am the mantainer of GUIBLast, but there is a lot it is not updated. So I recommend by now, yBlast. -- La web sin popups ni spyware: Usa Firefox en lugar de Internet Explorer From msarachu at biol.unlp.edu.ar Wed Nov 16 14:47:07 2005 From: msarachu at biol.unlp.edu.ar (=?windows-1252?B?TWFydO1uIFNhcmFjaHU=?=) Date: Wed, 16 Nov 2005 16:47:07 -0300 Subject: [EMBOSS] OT: BLAST interfaces In-Reply-To: <8968fc7e0511160800r18b0c003n@mail.gmail.com> References: <8968fc7e0511160800r18b0c003n@mail.gmail.com> Message-ID: <1132170427.437b8cbb69946@www.biol.unlp.edu.ar> did you try the one NCBI distributes (netblast I think)? Quoting Andres Pinzon : > First of all I would like to apologize for this OT, but as i see you > are talking about BLAST interfaces I would like to ask you for one > BLAST HTML interface to query a local BLAST server and, of course, > obtain the results. > Im developing one by myself (prettyBLAST), because we are using a > client/server version (databases are in a different machine from the > one the queries are going to be run so I have to capture the server > response in chunks and show the BLAST output) but before working more > on it I would like to know your opinion about some BLAST interfaces > out there and if this development worthwhile. > Thanks in advance, > > -- > --------- > Andr?s Pinz?n [http://www.andrespinzon.com] > Bioinformatics Center, Colombia EMBnet node > Biotechnology Institute - National University of Colombia > http://bioinf.ibun.unal.edu.co > Tel +57 3165000 ext 16961 Fax +571 3165415 > ---------- > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > -- Mart?n Sarachu msarachu at biol.unlp.edu.ar EMBnet Argentina http://www.ar.embnet.org From yezhiqiang at gmail.com Fri Nov 18 09:52:53 2005 From: yezhiqiang at gmail.com (Zhiqiang Ye) Date: Fri, 18 Nov 2005 22:52:53 +0800 Subject: [EMBOSS] Is there any way to use water or needle to do an all-to-all alignment? Message-ID: <34198fe40511180652v5cf3188ex@mail.gmail.com> Hi, all I want to do all-to-all pairwise comparison frequently. I have a fasta file "total.fasta" containing many sequences, I want to get the their pairwise comparison identities. I don't want to split it to single fasta files and then needle them to the "total.fasta" since I have to do this frequently. Could needle or water be used for all-to-all alignment directly? Just like blast. Thank you very much. -- Zhiqiang Ye PHD candidate College of Lifesciences, Center for Bioinformatics Peking University, Beijing. From zhangchn2004 at gmail.com Fri Nov 18 10:48:26 2005 From: zhangchn2004 at gmail.com (Zhang Chen) Date: Fri, 18 Nov 2005 23:48:26 +0800 Subject: [EMBOSS] Is there any way to use water or needle to do an all-to-all alignment? In-Reply-To: <34198fe40511180652v5cf3188ex@mail.gmail.com> References: <34198fe40511180652v5cf3188ex@mail.gmail.com> Message-ID: <24301eb00511180748j1aa9b15aj@mail.gmail.com> I think what you want is not difficult to implement with the help of Bioperl. A little work on scripts and Bio::Factory::EMBOSS may help you. 2005/11/18, Zhiqiang Ye : > Hi, all > I want to do all-to-all pairwise comparison frequently. I have a > fasta file "total.fasta" containing many sequences, I want to get the > their pairwise comparison identities. I don't want to split it to > single fasta files and then needle them to the "total.fasta" since I > have to do this frequently. Could needle or water be used for > all-to-all alignment directly? Just like blast. > > Thank you very much. > > -- > Zhiqiang Ye > PHD candidate > College of Lifesciences, Center for Bioinformatics > Peking University, Beijing. > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From pmr at ebi.ac.uk Fri Nov 18 11:21:18 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 18 Nov 2005 16:21:18 +0000 Subject: [EMBOSS] Is there any way to use water or needle to do an all-to-all alignment? In-Reply-To: <34198fe40511180652v5cf3188ex@mail.gmail.com> References: <34198fe40511180652v5cf3188ex@mail.gmail.com> Message-ID: <437DFF7E.6090908@ebi.ac.uk> Hi Ye, > I want to do all-to-all pairwise comparison frequently. I have a > fasta file "total.fasta" containing many sequences, I want to get the > their pairwise comparison identities. I don't want to split it to > single fasta files and then needle them to the "total.fasta" since I > have to do this frequently. Could needle or water be used for > all-to-all alignment directly? Just like blast. It is possible to modify water to do this - read seqall and seqset as input, instead of sequenec and seqall, and process each sequence from the seqall against all sequences in the seqset. It will be a new program (new input types). Not hard to do - you may want to try writing it. It needs a new name. How about "waterfall" :-) regards, Peter From jison at ebi.ac.uk Fri Nov 18 11:29:23 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Fri, 18 Nov 2005 16:29:23 -0000 (GMT) Subject: [EMBOSS] Is there any way to use water or needle to do an all-to-all alignment? In-Reply-To: <34198fe40511180652v5cf3188ex@mail.gmail.com> References: <34198fe40511180652v5cf3188ex@mail.gmail.com> Message-ID: <38691.172.31.8.12.1132331363.squirrel@webmail.ebi.ac.uk> Hi Zhiqiang Ye Have a look at the "allversusall" program in the EMBASSY "DOMALIGN" package: http://emboss.sourceforge.net/apps/allversusall.html It's beta software so go steady. If it doesn't do exactly what you want I'll gladly adapt it for you. Let us know how you get on. Cheers Jon > Hi, all > I want to do all-to-all pairwise comparison frequently. I have a > fasta file "total.fasta" containing many sequences, I want to get the > their pairwise comparison identities. I don't want to split it to > single fasta files and then needle them to the "total.fasta" since I > have to do this frequently. Could needle or water be used for > all-to-all alignment directly? Just like blast. > > Thank you very much. > > -- > Zhiqiang Ye > PHD candidate > College of Lifesciences, Center for Bioinformatics > Peking University, Beijing. > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From thomas.girke at ucr.edu Fri Nov 18 12:59:28 2005 From: thomas.girke at ucr.edu (Thomas Girke) Date: Fri, 18 Nov 2005 09:59:28 -0800 Subject: [EMBOSS] Is there any way to use water or needle to do an all-to-all alignment? In-Reply-To: <38691.172.31.8.12.1132331363.squirrel@webmail.ebi.ac.uk> References: <34198fe40511180652v5cf3188ex@mail.gmail.com> <38691.172.31.8.12.1132331363.squirrel@webmail.ebi.ac.uk> Message-ID: <20051118175928.GA26525@bioinfo.ucr.edu> Here is a simple shell loop to run needle or water in all-against-all mode. It expects the sequences in separate files which can easily be done with: seqret my_fasta fasta::test -ossingle The actual shell loop looks like this: for i in *.fasta; do for j in *.fasta; do needle $i $j stdout -gapopen 10.0 -gapextend 0.5 >> my_needle_file; done; done; This commands loops over all *.fasta files in the current directory and appends the results to the output file 'my_needle_file'. Thomas On Fri 11/18/05 16:29, Jon Ison wrote: > Hi Zhiqiang Ye > > Have a look at the "allversusall" program in the EMBASSY "DOMALIGN" package: > > http://emboss.sourceforge.net/apps/allversusall.html > > It's beta software so go steady. If it doesn't do exactly what you want > I'll gladly adapt it for you. Let us know how you get on. > > Cheers > > Jon > > > > Hi, all > > I want to do all-to-all pairwise comparison frequently. I have a > > fasta file "total.fasta" containing many sequences, I want to get the > > their pairwise comparison identities. I don't want to split it to > > single fasta files and then needle them to the "total.fasta" since I > > have to do this frequently. Could needle or water be used for > > all-to-all alignment directly? Just like blast. > > > > Thank you very much. > > > > -- > > Zhiqiang Ye > > PHD candidate > > College of Lifesciences, Center for Bioinformatics > > Peking University, Beijing. > > > > _______________________________________________ > > EMBOSS mailing list > > EMBOSS at emboss.open-bio.org > > http://newportal.open-bio.org/mailman/listinfo/emboss > > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > -- Thomas Girke 1008 Noel T. Keen Hall Center for Plant Cell Biology (CEPCEB) University of California Riverside, CA 92521 E-mail: thomas.girke at ucr.edu Ph: 951-827-2469 Fax: 951-827-4437 From thomasok at mail.nih.gov Fri Nov 18 13:56:11 2005 From: thomasok at mail.nih.gov (Dunn-Thomason, Kristen (NIH/CIT)) Date: Fri, 18 Nov 2005 13:56:11 -0500 Subject: [EMBOSS] Seeking instructors for EMBOSS training Message-ID: <4BDB66B394E7784F85ACA43EE36EED290BD99A02@NIHCESMLBX.nih.gov> I run a training program for the National Institutes of Health in Bethesda, MD, USA, and I'm trying to find a source of training for EMBOSS. We'd like a class to cover: - the range of Emboss programs - general info about how to use, how to get help, inputs/outputs etc. - details about use of some common programs - a couple of more complex problems Ideally, we'd like the course to focus on the command-line usage and Luke McCarthy's web interface, which is the one we implement here. But I understand that this latter part may be hard to get. If anyone teaches a class or knows of anyone who does, I'd very much like to talk with you. Thanks so much. Kristen Dunn-Thomason Chief, CIT Computer Training Section Division of Customer Support National Institutes of Health, HHS 301-594-2423 x283 http://training.cit.nih.gov From jison at ebi.ac.uk Mon Nov 21 06:18:42 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Mon, 21 Nov 2005 11:18:42 -0000 (GMT) Subject: [EMBOSS] Seeking instructors for EMBOSS training In-Reply-To: <4BDB66B394E7784F85ACA43EE36EED290BD99A02@NIHCESMLBX.nih.gov> References: <4BDB66B394E7784F85ACA43EE36EED290BD99A02@NIHCESMLBX.nih.gov> Message-ID: <43278.172.31.8.12.1132571922.squirrel@webmail.ebi.ac.uk> Hi Kristen Lisa Mullan (cc'd) was responsible for user-level training of EMBOSS when we were based at the RFCGR. She's now doing other things but should be able to advise on the practicalities of running a course. There's a tutorial that might be suitable: Introduction to Sequence Analysis using EMBOSS (tutorial) http://emboss.sourceforge.net/docs/emboss_tutorial/ See also: General info. on running programs, EMBOSS themes etc http://emboss.sourceforge.net/docs/ Lists of applications http://emboss.sourceforge.net/apps/ In case you use the on-line documentation to put a course together, our new website will be launched in the next few weeks with improved and easy-to-navigate content. Cheers Jon > I run a training program for the National Institutes of Health in > Bethesda, MD, USA, and I'm trying to find a source of training for > EMBOSS. We'd like a class to cover: > > - the range of Emboss programs > > - general info about how to use, how to get help, inputs/outputs etc. > > - details about use of some common programs > > - a couple of more complex problems > > > > Ideally, we'd like the course to focus on the command-line usage and > Luke McCarthy's web interface, which is the one we implement here. But I > understand that this latter part may be hard to get. > > > > If anyone teaches a class or knows of anyone who does, I'd very much > like to talk with you. > > > > Thanks so much. > > > > Kristen Dunn-Thomason > > Chief, CIT Computer Training Section > Division of Customer Support > National Institutes of Health, HHS > 301-594-2423 x283 > http://training.cit.nih.gov > > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From pmr at ebi.ac.uk Mon Nov 21 07:22:17 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 21 Nov 2005 12:22:17 +0000 Subject: [EMBOSS] Seeking instructors for EMBOSS training In-Reply-To: <4BDB66B394E7784F85ACA43EE36EED290BD99A02@NIHCESMLBX.nih.gov> References: <4BDB66B394E7784F85ACA43EE36EED290BD99A02@NIHCESMLBX.nih.gov> Message-ID: <4381BBF9.1060204@ebi.ac.uk> Hi Kristen, Dunn-Thomason, Kristen (NIH/CIT) wrote: > I run a training program for the National Institutes of Health in > Bethesda, MD, USA, and I'm trying to find a source of training for > EMBOSS. We'd like a class to cover: > > - the range of Emboss programs > > - general info about how to use, how to get help, inputs/outputs etc. > > - details about use of some common programs > > - a couple of more complex problems As Jon Ison says, we're very happy to help, and the improved website will be launched soon (same address as before). We welcome any suggestions of content to help anyone running courses. We can even be available to teach (particularly developer courses, but also for users) if someone funds our travel. Lisa and I were in the USA last year for a course. We can also help from afar - "more complex problems" are particularly interesting - we would like to see examples of problems used in courses so that we can try not to break them (for example, by providing a simple solution :-) Similarly, we can include the simple examples in our QA testing to provide notification if the inputs, options or results are changed in a new release. Hope that helps a few folk out there, Peter From lisa at ebi.ac.uk Mon Nov 21 12:37:58 2005 From: lisa at ebi.ac.uk (Lisa Mullan) Date: Mon, 21 Nov 2005 17:37:58 -0000 Subject: [EMBOSS] Seeking instructors for EMBOSS training In-Reply-To: <43278.172.31.8.12.1132571922.squirrel@webmail.ebi.ac.uk> Message-ID: <00d201c5eec2$54833c00$734416ac@windows.ebi.ac.uk> Ta Jon, Have emailed her offering my services - as long as she doesn't require them before Christmas! Lisa Lisa Mullan European Bioinformatics Institute Wellcome Trust Genome Campus Hinxton Cambridge CB10 1SD Tel: +44 (0)1223 494448 Fax: +44 (0)1223 494468 Email: lisa at ebi.ac.uk > -----Original Message----- > From: Jon Ison [mailto:jison at ebi.ac.uk] > Sent: 21 November 2005 11:19 > To: Dunn-Thomason, Kristen (NIH/CIT) > Cc: EMBOSS at emboss.open-bio.org; lisa at ebi.ac.uk > Subject: Re: [EMBOSS] Seeking instructors for EMBOSS training > > > Hi Kristen > > Lisa Mullan (cc'd) was responsible for user-level training of EMBOSS > when we were based at the RFCGR. She's now doing other things but > should be able to advise on the practicalities of running a course. > > There's a tutorial that might be suitable: > > Introduction to Sequence Analysis using EMBOSS (tutorial) > http://emboss.sourceforge.net/docs/emboss_tutorial/ > > > See also: > > General info. on running programs, EMBOSS themes etc > http://emboss.sourceforge.net/docs/ > > Lists of applications > http://emboss.sourceforge.net/apps/ > > > In case you use the on-line documentation to put a course together, > our new website will be launched in the next few weeks with improved > and easy-to-navigate content. > > Cheers > > Jon > > > > > > > I run a training program for the National Institutes of Health in > > Bethesda, MD, USA, and I'm trying to find a source of training for > > EMBOSS. We'd like a class to cover: > > > > - the range of Emboss programs > > > > - general info about how to use, how to get help, inputs/outputs etc. > > > > - details about use of some common programs > > > > - a couple of more complex problems > > > > > > > > Ideally, we'd like the course to focus on the command-line usage and > > Luke McCarthy's web interface, which is the one we implement here. But I > > understand that this latter part may be hard to get. > > > > > > > > If anyone teaches a class or knows of anyone who does, I'd very much > > like to talk with you. > > > > > > > > Thanks so much. > > > > > > > > Kristen Dunn-Thomason > > > > Chief, CIT Computer Training Section > > Division of Customer Support > > National Institutes of Health, HHS > > 301-594-2423 x283 > > http://training.cit.nih.gov > > > > > > > > > > _______________________________________________ > > EMBOSS mailing list > > EMBOSS at emboss.open-bio.org > > http://newportal.open-bio.org/mailman/listinfo/emboss > > > From maoj at mail.nih.gov Mon Nov 21 15:00:50 2005 From: maoj at mail.nih.gov (Mao, Jean (NIH/CIT)) Date: Mon, 21 Nov 2005 15:00:50 -0500 Subject: [EMBOSS] Problem with dbifasta Message-ID: <71B0C9CB1FF4EA43BB48C08DCFF1A1FF03D3FDEE@NIHCESMLBX.nih.gov> Hi, I have a problem and hopefully someone can help me solve the mistery. I have downloaded emboss 3.0 and create the emboss indexes of several FASTA formated databases downloaded from NCBI using 'dbifasta'. I found some entries can not be retrieved using seqret unless some 'trick' is used. For example, In the month.aa.fas file from NCBI, there is an entry called 'ABB51209.1'. After dbifasta, I ran 'seqret' and search for monthaa:ABB51209, then I got error. If I search for monthaa:ABB51209.1, then I found this entry. If I search 'ABB51209' at ncbi.nih.gov and specify protein database, then this entry came out with accession number ABB51209, with no '.1' at the tail. Thank you very much in advance. From jison at ebi.ac.uk Fri Nov 25 07:34:56 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Fri, 25 Nov 2005 12:34:56 -0000 (GMT) Subject: [EMBOSS] Problem with dbifasta In-Reply-To: <71B0C9CB1FF4EA43BB48C08DCFF1A1FF03D3FDEE@NIHCESMLBX.nih.gov> References: <71B0C9CB1FF4EA43BB48C08DCFF1A1FF03D3FDEE@NIHCESMLBX.nih.gov> Message-ID: <49789.172.31.70.94.1132922096.squirrel@webmail.ebi.ac.uk> Dear Jean "ABB51209.1" is the sequence version number. "ABB51209" is the sequence accession number. NCBI will retrieve sequences using either. dbifasta indexes the accession (and also ID) only by default. To index the sequence version (and also gi number), specify -fields "sv" when you run dbifasta and add the field: "sv" to the database definition. To index both you might need to use -fields "sv,acc" Please check what you did against the notes above and get back if you still have problems. Cheers Jon > Hi, I have a problem and hopefully someone can help me solve the > mistery. > > I have downloaded emboss 3.0 and create the emboss indexes of several > FASTA formated databases downloaded from NCBI using 'dbifasta'. > > I found some entries can not be retrieved using seqret unless some > 'trick' is used. For example, > > In the month.aa.fas file from NCBI, there is an entry called > 'ABB51209.1'. After dbifasta, I ran 'seqret' and search for > monthaa:ABB51209, then I got error. If I search for monthaa:ABB51209.1, > then I found this entry. If I search 'ABB51209' at ncbi.nih.gov and > specify protein database, then this entry came out with accession number > ABB51209, with no '.1' at the tail. > > Thank you very much in advance. > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From janenerz at web.de Tue Nov 29 07:42:24 2005 From: janenerz at web.de (Christiane Nerz) Date: Tue, 29 Nov 2005 13:42:24 +0100 Subject: [EMBOSS] error while loading shared libraries Message-ID: <438C4CB0.5090005@web.de> Hi all. I am new to EMBOSS. I have installed it and ./configure - make - make install were executed without problems. But if I want to start an EMBOSS programm I always got the same answer: "error while loading shared libraries: libnucleus.so.3: cannot open shared object file: No such file or directory" I'm a LINUX-newbie too, so maybe the question has nothing to do with EMBOSS itself? I'm working with Suse 10. I just googled to see if someone else have had the same problem - I found a message, but can't find any answers to it. Is it possible to search old mailing-list-threads for a given subject? Thanks in advance for help! regards Jane From ajb at ebi.ac.uk Tue Nov 29 08:04:40 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Tue, 29 Nov 2005 13:04:40 -0000 (GMT) Subject: [EMBOSS] error while loading shared libraries In-Reply-To: <438C4CB0.5090005@web.de> References: <438C4CB0.5090005@web.de> Message-ID: <36368.81.96.70.96.1133269480.squirrel@webmail.ebi.ac.uk> Dear Christiane, It ought to be able to find the libraries if you've set the PATH correctly. Let's say that you configured EMBOSS with: ./configure --prefix=/usr/local/emboss Then you will need to set your PATH to include /usr/local/emboss/bin a) bash: export PATH="$PATH /usr/local/emboss/bin" b) (t)csh set path=($path /usr/local/emboss/bin) rehash If that doesn't work then, with SuSE you could add the following line to /etc/ld.so.conf /usr/local/emboss/lib and then type "ldconfig" HTH Alan Bleasby EBI From ajb at ebi.ac.uk Tue Nov 29 08:18:33 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Tue, 29 Nov 2005 13:18:33 -0000 (GMT) Subject: [EMBOSS] error while loading shared libraries In-Reply-To: <36368.81.96.70.96.1133269480.squirrel@webmail.ebi.ac.uk> References: <438C4CB0.5090005@web.de> <36368.81.96.70.96.1133269480.squirrel@webmail.ebi.ac.uk> Message-ID: <40806.81.96.70.96.1133270313.squirrel@webmail.ebi.ac.uk> Typo: > a) bash: > export PATH="$PATH /usr/local/emboss/bin" It should, of course, have been: export PATH="$PATH:/usr/local/emboss/bin" Alan From jison at ebi.ac.uk Tue Nov 29 09:19:59 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Tue, 29 Nov 2005 14:19:59 -0000 (GMT) Subject: [EMBOSS] error while loading shared libraries In-Reply-To: <438C4CB0.5090005@web.de> References: <438C4CB0.5090005@web.de> Message-ID: <49346.172.31.70.94.1133273999.squirrel@webmail.ebi.ac.uk> > Is it possible to search old mailing-list-threads for a given subject? This will be possible in our new website which we'll be launching soon. Cheers Jon From golharam at umdnj.edu Tue Nov 29 10:23:08 2005 From: golharam at umdnj.edu (Ryan Golhar) Date: Tue, 29 Nov 2005 10:23:08 -0500 Subject: [EMBOSS] error while loading shared libraries In-Reply-To: <438C4CB0.5090005@web.de> Message-ID: <059001c5f4f8$cd49cdc0$5022db82@GOLHARMOBILE1> This is happening because libnucleus.so.3 cannot be found. The directory it is located in needs to be in your /etc/ld.so.conf, or you need to set your LD_LIBRARY_PATH to contain it. -----Original Message----- From: emboss-bounces at emboss.open-bio.org [mailto:emboss-bounces at emboss.open-bio.org] On Behalf Of Christiane Nerz Sent: Tuesday, November 29, 2005 7:42 AM To: emboss at emboss.open-bio.org Subject: [EMBOSS] error while loading shared libraries Hi all. I am new to EMBOSS. I have installed it and ./configure - make - make install were executed without problems. But if I want to start an EMBOSS programm I always got the same answer: "error while loading shared libraries: libnucleus.so.3: cannot open shared object file: No such file or directory" I'm a LINUX-newbie too, so maybe the question has nothing to do with EMBOSS itself? I'm working with Suse 10. I just googled to see if someone else have had the same problem - I found a message, but can't find any answers to it. Is it possible to search old mailing-list-threads for a given subject? Thanks in advance for help! regards Jane _______________________________________________ EMBOSS mailing list EMBOSS at emboss.open-bio.org http://newportal.open-bio.org/mailman/listinfo/emboss From golharam at umdnj.edu Tue Nov 29 11:31:17 2005 From: golharam at umdnj.edu (Ryan Golhar) Date: Tue, 29 Nov 2005 11:31:17 -0500 Subject: [EMBOSS] Opinions on Web Access to EMBOSS Message-ID: <059f01c5f502$52c132a0$5022db82@GOLHARMOBILE1> Hi all, We are in the process of migrating our users from GCG to EMBOSS, specifically from SeqWeb to EMBOSS-Explorer. I've noticed a lot of installations from Google for EMBOSS-Explorer. I also noticed some people leave their installations open for anyone to use, and others have restricted access. I'd like to ask people to comment on why they choose to restrict access to their installation. For those of you who haven't restricted access, have you noticed any overuse to of your installation? Ryan -- Ryan Golhar - golharam at umdnj.edu The Informatics Institute of UMDNJ From staylor at molbiol.ox.ac.uk Wed Nov 30 05:13:42 2005 From: staylor at molbiol.ox.ac.uk (Steve Taylor) Date: Wed, 30 Nov 2005 10:13:42 +0000 Subject: [EMBOSS] Opinions on Web Access to EMBOSS In-Reply-To: <059f01c5f502$52c132a0$5022db82@GOLHARMOBILE1> References: <059f01c5f502$52c132a0$5022db82@GOLHARMOBILE1> Message-ID: <438D7B56.9030903@molbiol.ox.ac.uk> Hi, > > We are in the process of migrating our users from GCG to EMBOSS, > specifically from SeqWeb to EMBOSS-Explorer. > > I've noticed a lot of installations from Google for EMBOSS-Explorer. I > also noticed some people leave their installations open for anyone to > use, and others have restricted access. > > I'd like to ask people to comment on why they choose to restrict access > to their installation. We used to run open web access several years ago and we did get some jobs that ran for a long time and took up a lot of CPU. In some cases these made our web server grind to a halt. So I guess this may happen with EMBOSS-Explorer if, for example, a large phylogeny job was run. These processes often get started by users not understanding the parameters and inputs they are using, rather than being malicious. Also we run a bioinformatics service and we need to track which users are using the system. We support hundreds of users and we can spot problems and advise them more easily by looking at the logs if we get them to log in with a username/password. Regards, Steve From mathog at mendel.bio.caltech.edu Wed Nov 30 16:59:36 2005 From: mathog at mendel.bio.caltech.edu (David Mathog) Date: Wed, 30 Nov 2005 13:59:36 -0800 Subject: [EMBOSS] libpng problems on Solaris 8, png.h version versus png.c version Message-ID: Built 3.0.0 today on solaris 8 with gcc 3.4.2. Near as I can tell the only libpng present is SMClpng from sunfreeware, version 1.2.4. Yet when the graphics applications run and try to create a PNG file it blows up with: libpng warning: Application was compiled with png.h from libpng-1.0.11 libpng warning: Appication is running with png.c from libpng-1.2.4 gd-png: fatal libpng error: Incompatible libpng version in application and library. The only png.h on the system in places where EMBOSS should find it is from the aforementioned package and I checked, they are all version 1.2.4. I checked that the binary wasn't left over from a previous EMBOSS build. I searched high and low for other png.h and found nothing. There was one other png.h in a GCG include directory but EMBOSS shouldn't see that (/opt/gcg/gcgsource/include/png.h), and in any case, it wasn't version 1.0.11. Any other ideas where the "wrong" png.h might be coming from? I'm guessing plplot. These were run with ./configure --with-png if that matters. Thanks, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From ajb at ebi.ac.uk Wed Nov 30 18:28:42 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Wed, 30 Nov 2005 23:28:42 -0000 (GMT) Subject: [EMBOSS] libpng problems on Solaris 8, png.h version versus png.c version In-Reply-To: References: Message-ID: <60718.81.96.70.96.1133393322.squirrel@webmail.ebi.ac.uk> That error usually suggests that your libgd was compiled using an older version of PNG i.e. your current PNG is up to date but your GD isn't. HTH Alan From mathog at mendel.bio.caltech.edu Wed Nov 30 18:50:14 2005 From: mathog at mendel.bio.caltech.edu (David Mathog) Date: Wed, 30 Nov 2005 15:50:14 -0800 Subject: [EMBOSS] libpng problems on Solaris 8, png.h version versus png.c version Message-ID: > That error usually suggests that your libgd was compiled using an older > version of PNG i.e. your current PNG is up to date but your GD isn't. Yeah, I finally tracked it down to that. Updated and rebuilt freetype (to 2.1.10) and then gd (to 2.0.33). Now trying to rebuild EMBOSS 3.0.0. Unfortunately make clean doesn't, leaving all sorts of .Plo and .Po files around. After deleting all of those manually it seemed to work and then blew up in the jemboss build on an html requirement, of all things. Also it seems not to have included any png stuff at all this time. png isn't present on the list of graphics devices and I didn't see any -lgd or -lpng flashing by. Other than downloading all of the source files from scratch how does one obtain a completely clean rebuild??? Thanks, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From mathog at mendel.bio.caltech.edu Wed Nov 30 19:10:17 2005 From: mathog at mendel.bio.caltech.edu (David Mathog) Date: Wed, 30 Nov 2005 16:10:17 -0800 Subject: [EMBOSS] libpng problems on Solaris 8, png.h version versus png.c version Message-ID: This is making me nuts. plplot (re)compiled gdpng to create gdpng.o in ..../plplot/.libs, yet it seems not to be putting it into the libraries. specify png as the output graphics type with polydot (for intance) results in it bailing out with: Devices allowed are:- postscript ps hpgl hp7470 hp7580 meta colourps cps xwindows x11 tektronics tekt tek4107t tek none null text data xterm Error: Invalid graph value 'png' Died: polydot terminated: Bad value for '-graph' with -auto defined Again, how does one do a CLEAN (completely clean) rebuild? Thanks, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From enrique.deandres at pcm.uam.es Wed Nov 2 10:29:35 2005 From: enrique.deandres at pcm.uam.es (Enrique de Andres Saiz) Date: Wed, 02 Nov 2005 11:29:35 +0100 Subject: [EMBOSS] Problems with Refseq Message-ID: <4368950F.6020706@pcm.uam.es> Hi, I have some problems working with Refseq database. I am using Emboss 3.0.0 and when I am indexing the database (.g?ff files) using dbiflat command I get many warnings as: Warning: Duplicate ID skipped: 'NP_857944' All hits will point to first ID found Another problem is that when I try to get an entry using seqret command, I get another sequence with the accession I have selected. When I try to get the entry using entret, I get several sequences. I have tried to index only one file of the database and then access it with seqret and entret. I get the same behaviour. For example, I have next definition in emboss.default file: DB rs_test [ type: N method: emblcd format: genbank dir: $emboss_data/refseq file: vertebrate_mammalian2.genomic.gbff indexdir: /usr/users/bioadmin/opt/prueba comment: "RefSeq test" ] If I edit file vertebrate_mammalian2.genomic.gbff, I can see next entry: LOCUS NW_113053 1059 bp DNA linear CON 09-NOV-2004 DEFINITION Pan troglodytes chromosome 10 genomic contig, whole genome shotgun sequence. ACCESSION NW_113053 VERSION NW_113053.1 GI:52318716 KEYWORDS WGS. SOURCE Pan troglodytes (chimpanzee) ORGANISM Pan troglodytes Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Pan. COMMENT GENOME ANNOTATION REFSEQ: Features on this sequence have been produced for build 1 version 1 of the NCBI's genome annotation [see documentation]. The DNA sequence for this assembly was produced by the Chimpanzee Genome Sequencing Consortium. This assembly was produced by the Arachne assembler and made available in Nov. 2003. FEATURES Location/Qualifiers source 1..1059 /organism="Pan troglodytes" /mol_type="genomic DNA" /isolate="Yerkes chimp pedigree #C0471 (Clint)" /db_xref="taxon:9598" /chromosome="10" CONTIG join(AADA01324841.1:1..1059) If I run: seqret rs_test:NW_113053, I get: $> seqret rs_test:NW_113053 Reads and writes (returns) sequences Output sequence [nw_113053.fasta]: stdout >NW_113053 NW_113053.1 Pan troglodytes olfactory receptor pseudogene PTOR3A5P (PTOR3A5P) onchromosome 17. ggaacgtactgcagcccatccgttttgctgtcttccgctttgcctacatcatcatagttg ggggcaacctcagcatcctggctgccatctttgtggaccccaaactccatactcccatgt attacttcctggggaacttgtctctgctggacatcgggtgcatcagtcactgttcctccg atgctggcgtgtctcctggcccaccagtgcagagttccctatgctgcctgcatttcacaa ctcttctttttccacctcctggctggggtggactgtcacctcttaatagccacggcctat gactgctacctggctatctgtcagcttctcaccaacagcactcgcatgagctgtgaagtc cagggtgccctggtgggaatttgctgcactgtctccttcatcaatgctctgactcacaca gtggctgtgtctgtgcttgacttctgtggccctaatgtggtcaaccacttctgctgtgac ctcccacctcttttccagctctcttgctccagcatccacctcaatgggcagctgctgctt gtgggggccaccttcataggagtgctccccatgatctttatctcagtgtcctatgcccac gtcacagccgcaatattacgaatccgctcagctgaggggaggaagaaggctttctccacg tgtggctcccacctcaccgtggtctgaatcttttatggaactggcttcttcagttacatg tgtctgggctcagtctcagcctcagacaaagataaggggattgggatcctcaacactatc ctcagtcccatgctgaacccagtcatttacagcctccagaaccctgatgtgcagggcacc ctgaaaagggtgctgacagggaagaggcccccagcttga If I run: entret rs_test:NW_113053, I get several entries (the first one is the correct one). Any idea about what happens and how can I solve it? Thanks in advance, Enrique. From michael.watson at bbsrc.ac.uk Wed Nov 2 12:33:38 2005 From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C)) Date: Wed, 2 Nov 2005 12:33:38 -0000 Subject: [EMBOSS] Help with stretcher Message-ID: <8975119BCD0AC5419D61A9CF1A923E95024C5337@iahce2knas1.iah.bbsrc.reserved> Hi I am using stretcher from emboss in a perl script. I am trying to globally align a relatively short sequence with quite a long one. Basically, the short one sits bang in the middle of the long one, with almost 100% identity. However, no matter how much I play with the gaplength and gappenalty options, stretcher insists that the the first base of the short sequence aligns with the first base of the long sequence, followed by a HUGE gap in the alignment, followed by the rest of the sequences, correctly aligned. It's doing my nut in. I'm using EMBOSS 2.9.0 on Suse Linux. Any help? Mick From cquijano at iib.uam.es Wed Nov 2 12:34:26 2005 From: cquijano at iib.uam.es (Carlos Quijano) Date: Wed, 02 Nov 2005 13:34:26 +0100 Subject: [EMBOSS] Problems with Refseq In-Reply-To: <4368950F.6020706@pcm.uam.es> References: <4368950F.6020706@pcm.uam.es> Message-ID: <1130934866.8717.15.camel@localhost.localdomain> El mi?, 02-11-2005 a las 11:29 +0100, Enrique de Andres Saiz escribi?: > Hi, > I have some problems working with Refseq database. > I am using Emboss 3.0.0 and when I am indexing the database (.g?ff > files) using dbiflat command I get many warnings as: > > Warning: Duplicate ID skipped: 'NP_857944' All hits will point to first > ID found > And this warning should point to the very problem. Try to fix the duplicates somehow. Probably there is a ID length trunkating method specific to dbiflat when dealing with your flat files, so the best solution is to modify your flat files if there is no way of forcing dbiflat to accept your IDs... The rest of symptoms are consistent with this observation. I hope it helps you in some way. > Another problem is that when I try to get an entry using seqret command, > I get another sequence with the accession I have selected. When I try > to get the entry using entret, I get several sequences. > > I have tried to index only one file of the database and then access it > with seqret and entret. I get the same behaviour. For example, I have > next definition in emboss.default file: > > DB rs_test [ > type: N > method: emblcd > format: genbank > dir: $emboss_data/refseq > file: vertebrate_mammalian2.genomic.gbff > indexdir: /usr/users/bioadmin/opt/prueba > comment: "RefSeq test" > ] > > If I edit file vertebrate_mammalian2.genomic.gbff, I can see next entry: > > LOCUS NW_113053 1059 bp DNA linear CON > 09-NOV-2004 > DEFINITION Pan troglodytes chromosome 10 genomic contig, whole genome > shotgun > sequence. > ACCESSION NW_113053 > VERSION NW_113053.1 GI:52318716 > KEYWORDS WGS. > SOURCE Pan troglodytes (chimpanzee) > ORGANISM Pan troglodytes > Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; > Euteleostomi; > Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; > Hominidae; Pan. > COMMENT GENOME ANNOTATION REFSEQ: Features on this sequence have been > produced for build 1 version 1 of the NCBI's genome > annotation [see > documentation]. > The DNA sequence for this assembly was produced by the > Chimpanzee > Genome Sequencing Consortium. This assembly was produced by the > Arachne assembler and made available in Nov. 2003. > FEATURES Location/Qualifiers > source 1..1059 > /organism="Pan troglodytes" > /mol_type="genomic DNA" > /isolate="Yerkes chimp pedigree #C0471 (Clint)" > /db_xref="taxon:9598" > /chromosome="10" > CONTIG join(AADA01324841.1:1..1059) > > If I run: seqret rs_test:NW_113053, I get: > > $> seqret rs_test:NW_113053 > Reads and writes (returns) sequences > Output sequence [nw_113053.fasta]: stdout > >NW_113053 NW_113053.1 Pan troglodytes olfactory receptor pseudogene > PTOR3A5P (PTOR3A5P) onchromosome 17. > ggaacgtactgcagcccatccgttttgctgtcttccgctttgcctacatcatcatagttg > ggggcaacctcagcatcctggctgccatctttgtggaccccaaactccatactcccatgt > attacttcctggggaacttgtctctgctggacatcgggtgcatcagtcactgttcctccg > atgctggcgtgtctcctggcccaccagtgcagagttccctatgctgcctgcatttcacaa > ctcttctttttccacctcctggctggggtggactgtcacctcttaatagccacggcctat > gactgctacctggctatctgtcagcttctcaccaacagcactcgcatgagctgtgaagtc > cagggtgccctggtgggaatttgctgcactgtctccttcatcaatgctctgactcacaca > gtggctgtgtctgtgcttgacttctgtggccctaatgtggtcaaccacttctgctgtgac > ctcccacctcttttccagctctcttgctccagcatccacctcaatgggcagctgctgctt > gtgggggccaccttcataggagtgctccccatgatctttatctcagtgtcctatgcccac > gtcacagccgcaatattacgaatccgctcagctgaggggaggaagaaggctttctccacg > tgtggctcccacctcaccgtggtctgaatcttttatggaactggcttcttcagttacatg > tgtctgggctcagtctcagcctcagacaaagataaggggattgggatcctcaacactatc > ctcagtcccatgctgaacccagtcatttacagcctccagaaccctgatgtgcagggcacc > ctgaaaagggtgctgacagggaagaggcccccagcttga > > If I run: entret rs_test:NW_113053, I get several entries (the first one > is the correct one). > > Any idea about what happens and how can I solve it? > > Thanks in advance, > Enrique. > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Wed Nov 2 13:25:53 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 02 Nov 2005 13:25:53 +0000 Subject: [EMBOSS] Help with stretcher In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E95024C5337@iahce2knas1.iah.bbsrc.reserved> References: <8975119BCD0AC5419D61A9CF1A923E95024C5337@iahce2knas1.iah.bbsrc.reserved> Message-ID: <4368BE61.9040609@ebi.ac.uk> michael watson (IAH-C) wrote: > Hi > > I am using stretcher from emboss in a perl script. I am trying to > globally align a relatively short sequence with quite a long one. > Basically, the short one sits bang in the middle of the long one, with > almost 100% identity. However, no matter how much I play with the > gaplength and gappenalty options, stretcher insists that the the first > base of the short sequence aligns with the first base of the long > sequence, followed by a HUGE gap in the alignment, followed by the rest > of the sequences, correctly aligned. It's doing my nut in. global alignemnts come ni two flavours - those that insist on aligning the entire length of both sequences (like stretcher) and those that allow gaps at the end without penalties (like needle). What you want depends on the sequences you are aligning (i.e. what the ends really mean) You can simply use the needle program instead to get the results you want. Stretcher was originally part of the FASTA package. We can look at adding an option for end weighting (and maybe making the default the same as for needle). Hope that helps, Peter From michael.watson at bbsrc.ac.uk Wed Nov 2 13:29:36 2005 From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C)) Date: Wed, 2 Nov 2005 13:29:36 -0000 Subject: [EMBOSS] Help with stretcher Message-ID: <8975119BCD0AC5419D61A9CF1A923E95024C533A@iahce2knas1.iah.bbsrc.reserved> Hi Peter The thing is, stretcher works fine for a lot of other examples (I'm running a whole pipeline here) of the same problem; and I tried needle but it complained the sequences were too long and that I should try stretcher... It would be good to remove this problem from stretcher given the size limit on needle... Many thanks Mick -----Original Message----- From: Peter Rice [mailto:pmr at ebi.ac.uk] Sent: 02 November 2005 13:26 To: michael watson (IAH-C) Cc: emboss at emboss.open-bio.org Subject: Re: [EMBOSS] Help with stretcher michael watson (IAH-C) wrote: > Hi > > I am using stretcher from emboss in a perl script. I am trying to > globally align a relatively short sequence with quite a long one. > Basically, the short one sits bang in the middle of the long one, with > almost 100% identity. However, no matter how much I play with the > gaplength and gappenalty options, stretcher insists that the the first > base of the short sequence aligns with the first base of the long > sequence, followed by a HUGE gap in the alignment, followed by the > rest of the sequences, correctly aligned. It's doing my nut in. global alignemnts come ni two flavours - those that insist on aligning the entire length of both sequences (like stretcher) and those that allow gaps at the end without penalties (like needle). What you want depends on the sequences you are aligning (i.e. what the ends really mean) You can simply use the needle program instead to get the results you want. Stretcher was originally part of the FASTA package. We can look at adding an option for end weighting (and maybe making the default the same as for needle). Hope that helps, Peter From pmr at ebi.ac.uk Wed Nov 2 13:36:50 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 02 Nov 2005 13:36:50 +0000 Subject: [EMBOSS] Help with stretcher In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E95024C533A@iahce2knas1.iah.bbsrc.reserved> References: <8975119BCD0AC5419D61A9CF1A923E95024C533A@iahce2knas1.iah.bbsrc.reserved> Message-ID: <4368C0F2.5070808@ebi.ac.uk> Hi Michael, > The thing is, stretcher works fine for a lot of other examples (I'm > running a whole pipeline here) of the same problem; and I tried needle > but it complained the sequences were too long and that I should try > stretcher... Ah ... that is because stretcher uses a more memory-efficient implementation of the Needleman-Wunsch algorithm. > It would be good to remove this problem from stretcher given the size > limit on needle... We will try. As we did not write stretcher we have some problems understanding the code, but we do know where to look. regards, Peter From golharam at umdnj.edu Wed Nov 2 15:07:12 2005 From: golharam at umdnj.edu (Ryan Golhar) Date: Wed, 02 Nov 2005 10:07:12 -0500 Subject: [EMBOSS] Help with stretcher In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E95024C5337@iahce2knas1.iah.bbsrc.reserved> Message-ID: <002401c5dfbf$1a97f100$e6028a0a@GOLHARMOBILE1> >From what you are describing, it sounds like you should use water or another local alignment program. -----Original Message----- From: emboss-bounces at emboss.open-bio.org [mailto:emboss-bounces at emboss.open-bio.org] On Behalf Of michael watson (IAH-C) Sent: Wednesday, November 02, 2005 7:34 AM To: emboss at emboss.open-bio.org Subject: [EMBOSS] Help with stretcher Hi I am using stretcher from emboss in a perl script. I am trying to globally align a relatively short sequence with quite a long one. Basically, the short one sits bang in the middle of the long one, with almost 100% identity. However, no matter how much I play with the gaplength and gappenalty options, stretcher insists that the the first base of the short sequence aligns with the first base of the long sequence, followed by a HUGE gap in the alignment, followed by the rest of the sequences, correctly aligned. It's doing my nut in. I'm using EMBOSS 2.9.0 on Suse Linux. Any help? Mick _______________________________________________ EMBOSS mailing list EMBOSS at emboss.open-bio.org http://newportal.open-bio.org/mailman/listinfo/emboss From michael.watson at bbsrc.ac.uk Wed Nov 2 15:11:44 2005 From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C)) Date: Wed, 2 Nov 2005 15:11:44 -0000 Subject: [EMBOSS] Help with stretcher Message-ID: <8975119BCD0AC5419D61A9CF1A923E95024C533E@iahce2knas1.iah.bbsrc.reserved> What I want to avoid is my smaller sequence being split up into multiple "HSPs" that I then have to process... -----Original Message----- From: Ryan Golhar [mailto:golharam at umdnj.edu] Sent: 02 November 2005 15:07 To: michael watson (IAH-C); emboss at emboss.open-bio.org Subject: RE: [EMBOSS] Help with stretcher >From what you are describing, it sounds like you should use water or another local alignment program. -----Original Message----- From: emboss-bounces at emboss.open-bio.org [mailto:emboss-bounces at emboss.open-bio.org] On Behalf Of michael watson (IAH-C) Sent: Wednesday, November 02, 2005 7:34 AM To: emboss at emboss.open-bio.org Subject: [EMBOSS] Help with stretcher Hi I am using stretcher from emboss in a perl script. I am trying to globally align a relatively short sequence with quite a long one. Basically, the short one sits bang in the middle of the long one, with almost 100% identity. However, no matter how much I play with the gaplength and gappenalty options, stretcher insists that the the first base of the short sequence aligns with the first base of the long sequence, followed by a HUGE gap in the alignment, followed by the rest of the sequences, correctly aligned. It's doing my nut in. I'm using EMBOSS 2.9.0 on Suse Linux. Any help? Mick _______________________________________________ EMBOSS mailing list EMBOSS at emboss.open-bio.org http://newportal.open-bio.org/mailman/listinfo/emboss From pmiguel at purdue.edu Wed Nov 2 21:22:53 2005 From: pmiguel at purdue.edu (Phillip San Miguel) Date: Wed, 02 Nov 2005 16:22:53 -0500 Subject: [EMBOSS] Gaps converted to "n's" in showalign consensus Message-ID: <43692E2D.7050602@purdue.edu> It would be great if showalign had a switch that would prevent it from converting "-" to "n" in the consensus it generates for an alignment. I frequently have long stretches of leading and trailing "n's" caused by this behavior. I would like to be able to turn this behavior off in consense as well. -- Phillip From golharam at umdnj.edu Thu Nov 3 00:15:06 2005 From: golharam at umdnj.edu (Ryan Golhar) Date: Wed, 02 Nov 2005 19:15:06 -0500 Subject: [EMBOSS] Parameter discrepency Message-ID: <007e01c5e00b$a5275e90$e6028a0a@GOLHARMOBILE1> I'm using needle to align sequences...I need the output in fasta format. Looking the the tfm for needle, under associated qualifers for -outfile, the parameter -aformat3 is listed. Further below is the section on Output file format which lists the parameter as -aformat. I tried -aformat and that seems to work, so does -aformat3. Is one of them not supposed to be there or just a carryover from an older version of emboss? The docs talk about one version but use the other in the example... Ryan From Marc.Logghe at DEVGEN.com Thu Nov 3 07:56:09 2005 From: Marc.Logghe at DEVGEN.com (Marc Logghe) Date: Thu, 3 Nov 2005 08:56:09 +0100 Subject: [EMBOSS] How to search the arhives ? Message-ID: <0C528E3670D8CE4B8E013F6749231AA62F56CB@ANTARESIA.be.devgen.com> Hi all, This is probably a stupid question but I did not find a way to search the emboss archives. I've found them, though, but only to access the chunks by date. Not very efficient if you don't know the date of the post anymore :-( I was actually looking for a post Peter once send about how to hardcode the clustalw option '-outorder=input' in emma. I think you had to set an environmental variable, but I don't recall which one that was. One thing I tried was to set 'clustalw -outorder=input' in the acd file, but that did not work out. Does anybody know how to dig out his answer ? Thanks, Marc From natalia.jimenez at pcm.uam.es Thu Nov 3 09:19:08 2005 From: natalia.jimenez at pcm.uam.es (Natalia Jimenez Lozano) Date: Thu, 03 Nov 2005 10:19:08 +0100 Subject: [EMBOSS] Parameter discrepency In-Reply-To: <007e01c5e00b$a5275e90$e6028a0a@GOLHARMOBILE1> References: <007e01c5e00b$a5275e90$e6028a0a@GOLHARMOBILE1> Message-ID: <4369D60C.8050001@pcm.uam.es> Hi, I'm trying to do a retrieval (entret -EMBOSS-) of CON-division of genbank database previously indexed through dbiflat but I don't obtain any result. Does anybody know how can I solve this problem? Thank you in advance, Natalia From natalia.jimenez at pcm.uam.es Thu Nov 3 09:23:55 2005 From: natalia.jimenez at pcm.uam.es (Natalia Jimenez Lozano) Date: Thu, 03 Nov 2005 10:23:55 +0100 Subject: [EMBOSS] genbank retrieval Message-ID: <4369D72B.9080507@pcm.uam.es> Hi, I'm trying to do a retrieval (entret -EMBOSS-) of CON-division of genbank database previously indexed through dbiflat but I don't obtain any result. Does anybody know how can I solve this problem? Thank you in advance, Natalia From pmr at ebi.ac.uk Thu Nov 3 09:42:32 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 09:42:32 -0000 (GMT) Subject: [EMBOSS] How to search the arhives ? In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA62F56CB@ANTARESIA.be.devgen.com> References: <0C528E3670D8CE4B8E013F6749231AA62F56CB@ANTARESIA.be.devgen.com> Message-ID: <1488.86.133.37.211.1131010952.squirrel@webmail.ebi.ac.uk> Hi Mark, > This is probably a stupid question but I did not find a way to search > the emboss archives. I've found them, though, but only to access the > chunks by date. Not very efficient if you don't know the date of the > post anymore :-( Hmmmm ... the archives have moved a couiple of times. I keep copies of the important mails, but I've moved twice too so they are hard to search. While I'm figuring out how to search, I'll try answering again to see if I give the same reply :-) > I was actually looking for a post Peter once send about how to hardcode > the clustalw option '-outorder=input' in emma. I think you had to set an > environmental variable, but I don't recall which one that was. > One thing I tried was to set 'clustalw -outorder=input' in the acd file, > but that did not work out. I suspect it was to define EMBOSS_CLUSTALW to be : setenv EMBOSS_CLUSTALW "clustalw -outorder=input" Works for me! (If you already define this variable to set the full path or executable name for clustalw, preserve that part in the new value) I suppose adding this as an option to emma would be reasonable. yet another emma option - maybe this was one added since emma was originally written (to test just how far we could stretch ACD :-) I will look for any other new clustalw options at the same time. regards, Peter From pmr at ebi.ac.uk Thu Nov 3 09:44:14 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 09:44:14 -0000 (GMT) Subject: [EMBOSS] Gaps converted to "n's" in showalign consensus In-Reply-To: <43692E2D.7050602@purdue.edu> References: <43692E2D.7050602@purdue.edu> Message-ID: <1493.86.133.37.211.1131011054.squirrel@webmail.ebi.ac.uk> Hi Phillip, > It would be great if showalign had a switch that would prevent it from > converting "-" to "n" in the consensus it generates for an alignment. I > frequently have long stretches of leading and trailing "n's" caused by > this behavior. I would like to be able to turn this behavior off in > consense as well. That's a bug (as '-' is clearly the consensus). I will look into it. Peter From David.Bauer at SCHERING.DE Thu Nov 3 09:55:53 2005 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Thu, 3 Nov 2005 10:55:53 +0100 Subject: [EMBOSS] Antwort: genbank retrieval In-Reply-To: <4369D72B.9080507@pcm.uam.es> Message-ID: Hi, I assume you mean gbcon.seq from the NCBI. This is a bit strange sequence database, with no sequence in it. It just contains instructions which part of which genbank file has to be used to create a non-overlapping contig. So this file can not be indexed with dbiflat. David. emboss-bounces at emboss.open-bio.org schrieb am 03/11/2005 10:23:55: > Hi, > > I'm trying to do a retrieval (entret -EMBOSS-) of CON-division of > genbank database previously indexed through dbiflat but I don't obtain > any result. > Does anybody know how can I solve this problem? > Thank you in advance, > Natalia > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Thu Nov 3 09:49:53 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 09:49:53 -0000 (GMT) Subject: [EMBOSS] genbank retrieval In-Reply-To: <4369D72B.9080507@pcm.uam.es> References: <4369D72B.9080507@pcm.uam.es> Message-ID: <1521.86.133.37.211.1131011393.squirrel@webmail.ebi.ac.uk> Hi Natalia, > I'm trying to do a retrieval (entret -EMBOSS-) of CON-division of > genbank database previously indexed through dbiflat but I don't obtain > any result. > Does anybody know how can I solve this problem? Ah, the CON division is on my "to do" list. It needs some effort to do the EMBL version (rebuild the sequence and features from the composite entries). I have not looked specifically at the GenBank version, but assume it is the same. So, you will need a server (or a script) that puts the CON entry together for you. Does anyone know where to find one? regards, Peter From natalia.jimenez at pcm.uam.es Thu Nov 3 10:23:37 2005 From: natalia.jimenez at pcm.uam.es (Natalia Jimenez Lozano) Date: Thu, 03 Nov 2005 11:23:37 +0100 Subject: [EMBOSS] genbank retrieval In-Reply-To: <1521.86.133.37.211.1131011393.squirrel@webmail.ebi.ac.uk> References: <4369D72B.9080507@pcm.uam.es> <1521.86.133.37.211.1131011393.squirrel@webmail.ebi.ac.uk> Message-ID: <4369E529.908@pcm.uam.es> Thank you very much for your answer >>I'm trying to do a retrieval (entret -EMBOSS-) of CON-division of >>genbank database previously indexed through dbiflat but I don't obtain >>any result. >>Does anybody know how can I solve this problem? >> >> > >Ah, the CON division is on my "to do" list. It needs some effort to do the >EMBL version (rebuild the sequence and features from the composite >entries). > > You know if this enhancement will be available in the next EMBOSS release? >I have not looked specifically at the GenBank version, but assume it is >the same. > > Yes exactly the same. >So, you will need a server (or a script) that puts the CON entry together >for you. Does anyone know where to find one? > > Suggestions will be welcome >regards, > >Peter > > Thank you very much, Regards, Natalia From pmr at ebi.ac.uk Thu Nov 3 10:24:57 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 10:24:57 -0000 (GMT) Subject: [EMBOSS] Parameter discrepency In-Reply-To: <007e01c5e00b$a5275e90$e6028a0a@GOLHARMOBILE1> References: <007e01c5e00b$a5275e90$e6028a0a@GOLHARMOBILE1> Message-ID: <1568.86.133.37.211.1131013497.squirrel@webmail.ebi.ac.uk> Hi Ryan, > I tried -aformat and that seems to work, so does -aformat3. Is one of > them not supposed to be there or just a carryover from an older version > of emboss? The docs talk about one version but use the other in the > example... For all current programs, -aformat is fine. To explain what is going on, consider the -osformat (output sequence format) qualifier for a program that writes two sequences. The more complex inputs and outputs have "associated qualifiers" in EMBOSS - sequences for input, sequences, alignments, reports for output. We usually make these parameters, as it is useful in scripts to simply put the sequence "USA" or output filename on the commandline. Simply using -osformat could apply to one or both sequences. There are ways to specify one or both. -osformat3 would apply to the third parameter (maybe one input sequence and two output sequences - we try to insist on inputs first and outputs last in the parameter order). The number is not recommended - as it would change if we add or remove other qualifiers. However, the output of "needle -help -verbose" is too long-winded if we use the full name (see below) so we shorten it to -aformat3, -sformat1, -sformat2 for your needle example) Global settings: -osformat at the start of the command line (strictly, before the first parameter) applies to all. Positional qualilfiers (an idea borrows from the VMS operating system): -osformat after a parameter/qualifier that it is associated with applies specifically to that parameter/qualifier Full names: -osformat_outseq refers to the -outseq parameter (all parameters also have qualifier names). For needle, this would be aformat_outfile and is safer than -aformat3 Normal users will use -aformat. Wrappers and scripts should use -aformat_outfile (but can safely use -aformat before specifying the output file) Hope that helps to make things clearer. Peter From j.abbott at imperial.ac.uk Thu Nov 3 10:45:11 2005 From: j.abbott at imperial.ac.uk (Abbott, James) Date: Thu, 3 Nov 2005 10:45:11 -0000 Subject: [EMBOSS] How to search the arhives ? Message-ID: Hi Guys, pmr at ebi.ac.uk wrote: >>This is probably a stupid question but I did not find a way to search >>the emboss archives. > > >Hmmmm ... the archives have moved a couiple of times. I keep copies of the >important mails, but I've moved twice too so they are hard to search. > Google to the rescue! It is possible to restrict google to searching within a particular site, which can be very handy for list archives. You just need to enter 'site:www.url.org' as one of your query terms, so to search the EMBOSS archives for 'clustal' and 'outorder', google for the terms 'site:http://emboss.open-bio.org/pipermail/emboss/ clustal outorder' which returns one hit: http://www.google.co.uk/search?hl=en&q=+site%3Ahttp%3A%2F%2Femboss.open-bio.org%2Fpipermail%2Femboss%2F+clustal+outorder&btnG=Search&meta= which unfortunately does not seem to answer your question... Oh well...It's not a perfect solution, but very useful for (mainly pipermail) list archives which don't have a search capabililty. James -- Dr. James Abbott Bioinformatics Software Developer, Bioinformatics Support Service Imperial College, London From Marc.Logghe at DEVGEN.com Thu Nov 3 11:15:40 2005 From: Marc.Logghe at DEVGEN.com (Marc Logghe) Date: Thu, 3 Nov 2005 12:15:40 +0100 Subject: [EMBOSS] How to search the arhives ? Message-ID: <0C528E3670D8CE4B8E013F6749231AA62F56CC@ANTARESIA.be.devgen.com> > -----Original Message----- > From: pmr at ebi.ac.uk [mailto:pmr at ebi.ac.uk] > Sent: Thursday, November 03, 2005 10:43 AM > To: Marc Logghe > Cc: emboss at emboss.open-bio.org > Subject: Re: [EMBOSS] How to search the arhives ? > > Hi Mark, > > > This is probably a stupid question but I did not find a way > to search > > the emboss archives. I've found them, though, but only to > access the > > chunks by date. Not very efficient if you don't know the > date of the > > post anymore :-( > > Hmmmm ... the archives have moved a couiple of times. I keep > copies of the important mails, but I've moved twice too so > they are hard to search. > > While I'm figuring out how to search, I'll try answering > again to see if I give the same reply :-) You seem to be pretty consistent in your answers :-) Thanks a lot, that was it ! > > I suspect it was to define EMBOSS_CLUSTALW to be : > > setenv EMBOSS_CLUSTALW "clustalw -outorder=input" > > Works for me! (If you already define this variable to set the > full path or executable name for clustalw, preserve that part > in the new value) > Regards, Marc From pmr at ebi.ac.uk Thu Nov 3 12:06:37 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 12:06:37 -0000 (GMT) Subject: [EMBOSS] genbank retrieval In-Reply-To: <4369E529.908@pcm.uam.es> References: <4369D72B.9080507@pcm.uam.es> <1521.86.133.37.211.1131011393.squirrel@webmail.ebi.ac.uk> <4369E529.908@pcm.uam.es> Message-ID: <1669.86.133.37.211.1131019597.squirrel@webmail.ebi.ac.uk> Hi Natalia, >>Ah, the CON division is on my "to do" list. It needs some effort to do >> the >>EMBL version (rebuild the sequence and features from the composite >>entries). >> >> > You know if this enhancement will be available in the next EMBOSS release? Maybe some time next summer. We have a list of urgent tasks until the end of April and then I can have time to think about it. regards, Peter From rls at ebi.ac.uk Thu Nov 3 12:25:35 2005 From: rls at ebi.ac.uk (Rodrigo Lopez) Date: Thu, 03 Nov 2005 12:25:35 +0000 Subject: [EMBOSS] Antwort: genbank retrieval In-Reply-To: References: Message-ID: <436A01BF.9060705@ebi.ac.uk> CON entries do not have sequences as described in the EMBL/NCBI/DDBJ guidelines. Please see: http://www.ebi.ac.uk/embl/Documentation/Release_notes/current/relnotes.html#1_2_9 1.2.9 CON Database File CON files include construct information for building contig sequences of chromosomes, genomes and other long DNA sequences. CON entries in file 'embl.con' do not contain sequence data per se. However, EMBL-EBI make EMBLCONEXP available. These do have the sequences and are available from: ftp://ftp.ebi.ac.uk/pub/databases/embl/expanded_con/ I have not tested these with the EMBOSS dbiflat/dbxflat - but in principle they should work. R:) David.Bauer at schering.de wrote: > > Hi, > > I assume you mean gbcon.seq from the NCBI. > This is a bit strange sequence database, with no sequence in it. > It just contains instructions which part of which genbank file has to be > used to create a non-overlapping contig. > So this file can not be indexed with dbiflat. > > David. > emboss-bounces at emboss.open-bio.org schrieb am 03/11/2005 10:23:55: > > >>Hi, >> >>I'm trying to do a retrieval (entret -EMBOSS-) of CON-division of >>genbank database previously indexed through dbiflat but I don't obtain >>any result. >>Does anybody know how can I solve this problem? >>Thank you in advance, >>Natalia >>_______________________________________________ >>EMBOSS mailing list >>EMBOSS at emboss.open-bio.org >>http://newportal.open-bio.org/mailman/listinfo/emboss > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss From Tim.Troup at ed.ac.uk Thu Nov 3 14:22:24 2005 From: Tim.Troup at ed.ac.uk (Tim Troup) Date: Thu, 3 Nov 2005 14:22:24 +0000 Subject: [EMBOSS] Cannot open division file Message-ID: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> Hi, I have just installed emboss and was running a few programs over the test databases to ensure everything was working properly. When I run seqret for example i get the following error: wilkie226:~ troup$ seqret Reads and writes (returns) sequences Input sequence(s): tsw:hba_human Warning: Cannot open division file '' for database 'tsw' Warning: seqCdQry failed Error: Unable to read sequence 'tsw:hba_human' Or if i run whichdb i get: wilkie226:~ troup$ whichdb Search all databases for an entry ID or Accession number: hsfau Output file [outfile.whichdb]: Warning: Cannot open division file '' for database 'twp' Warning: seqCdQry failed Warning: Cannot open division file '' for database 'tsw' Warning: seqCdQry failed Warning: Cannot open division file '' for database 'tgenbank' Warning: seqCdQry failed Warning: Cannot open division file '' for database 'tpir' EMBOSS An error in ajseqdb.c at line 2597: seqCdQryOpen failed Having trawled through the mailing list archives I see others have experienced this problem in the past. Unfortunately I could not see any replies suggesting solutions. Any suggestions as to how i can remedy this situation would be greatly appreciated. Thanks, Tim From golharam at umdnj.edu Thu Nov 3 15:14:28 2005 From: golharam at umdnj.edu (Ryan Golhar) Date: Thu, 03 Nov 2005 10:14:28 -0500 Subject: [EMBOSS] Parameter discrepency In-Reply-To: <1568.86.133.37.211.1131013497.squirrel@webmail.ebi.ac.uk> Message-ID: <00c401c5e089$4980b400$e6028a0a@GOLHARMOBILE1> Yes it does clear things up. This should be added to the help docs -----Original Message----- From: pmr at ebi.ac.uk [mailto:pmr at ebi.ac.uk] Sent: Thursday, November 03, 2005 5:25 AM To: golharam at umdnj.edu Cc: emboss at emboss.open-bio.org Subject: Re: [EMBOSS] Parameter discrepency Hi Ryan, > I tried -aformat and that seems to work, so does -aformat3. Is one of > them not supposed to be there or just a carryover from an older > version of emboss? The docs talk about one version but use the other > in the example... For all current programs, -aformat is fine. To explain what is going on, consider the -osformat (output sequence format) qualifier for a program that writes two sequences. The more complex inputs and outputs have "associated qualifiers" in EMBOSS - sequences for input, sequences, alignments, reports for output. We usually make these parameters, as it is useful in scripts to simply put the sequence "USA" or output filename on the commandline. Simply using -osformat could apply to one or both sequences. There are ways to specify one or both. -osformat3 would apply to the third parameter (maybe one input sequence and two output sequences - we try to insist on inputs first and outputs last in the parameter order). The number is not recommended - as it would change if we add or remove other qualifiers. However, the output of "needle -help -verbose" is too long-winded if we use the full name (see below) so we shorten it to -aformat3, -sformat1, -sformat2 for your needle example) Global settings: -osformat at the start of the command line (strictly, before the first parameter) applies to all. Positional qualilfiers (an idea borrows from the VMS operating system): -osformat after a parameter/qualifier that it is associated with applies specifically to that parameter/qualifier Full names: -osformat_outseq refers to the -outseq parameter (all parameters also have qualifier names). For needle, this would be aformat_outfile and is safer than -aformat3 Normal users will use -aformat. Wrappers and scripts should use -aformat_outfile (but can safely use -aformat before specifying the output file) Hope that helps to make things clearer. Peter From pmr at ebi.ac.uk Thu Nov 3 16:21:23 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 16:21:23 -0000 (GMT) Subject: [EMBOSS] Cannot open division file In-Reply-To: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> Message-ID: <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> Hi Tim, > I have just installed emboss and was running a few programs over the > test databases to ensure everything was working properly. When I run > seqret for example i get the following error: > > wilkie226:~ troup$ seqret > Reads and writes (returns) sequences > Input sequence(s): tsw:hba_human > Warning: Cannot open division file '' for database 'tsw' > Warning: seqCdQry failed > Error: Unable to read sequence 'tsw:hba_human' If you look in the emboss.defaults file you will see, near the top, a line like this: # SET emboss_tempdata /homes/pmr/local/share/EMBOSS/test You need to uncomment this, and set the directory (the /homes/pmr/local part) to be wherever you installed EMBOSS. If you look further down to the database definition of tsw you will see emboss_tempdata is used ... and also for the other test databases we use for the progam manual examples and for our QA testing .... but you can of course use the real databases (locally indexed, or pointing to - for example - the EBI's SRS server). # swissprot (Puffer fish entries) # ========= DB tsw [ type: P dir: $emboss_tempdata/swiss method: emblcd format: swiss release: 36 fields: "sv des org key" comment: "Swissprot native format with EMBL CD-ROM index" ] Hope that clears things up Peter From gbottu at ben.vub.ac.be Thu Nov 3 16:21:32 2005 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Thu, 3 Nov 2005 17:21:32 +0100 Subject: [EMBOSS] CON division - Checked by AntiVir DEMO version - Message-ID: <20051103162132.GA19503@bigben.ulb.ac.be> Dear colleagues, Maybe interesting to mention that there is already a preliminary solution for retrieving entries from the EMBL or GenBank CON division, provided SRS (version 7.1 or 8) is used as access mechanism : DB emblcontigs [ type: N comment: 'EMBL contig sequences' format: embl methodquery: app app: "....../getz -e '[emblcontigs:%s]>[emblcontigs-ftk:contig]'" ] Regards, Guy Bottu, Belgian EMBnet Node From Tim.Troup at ed.ac.uk Thu Nov 3 16:42:27 2005 From: Tim.Troup at ed.ac.uk (Tim Troup) Date: Thu, 3 Nov 2005 16:42:27 +0000 Subject: [EMBOSS] Cannot open division file In-Reply-To: <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> Message-ID: <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> Hi, Thanks for replying so quickly. I have installed emboss locally under /usr/local/emboss. I uncommented the SET emboss_tempdata line within the emboss.default file stored at /usr/local/emboss/share/EMBOSS so it now reads: SET emboss_tempdata /usr/local/emboss/share/EMBOSS/test/ I restarted my machine. Unfortunately i still get the same error messages as before. Any further suggestions would greatly appreciated. Thanks, Tim On 3 Nov 2005, at 16:21, pmr at ebi.ac.uk wrote: > Hi Tim, > >> I have just installed emboss and was running a few programs over the >> test databases to ensure everything was working properly. When I run >> seqret for example i get the following error: >> >> wilkie226:~ troup$ seqret >> Reads and writes (returns) sequences >> Input sequence(s): tsw:hba_human >> Warning: Cannot open division file '' for database 'tsw' >> Warning: seqCdQry failed >> Error: Unable to read sequence 'tsw:hba_human' > > If you look in the emboss.defaults file you will see, near the top, > a line > like this: > > > # SET emboss_tempdata /homes/pmr/local/share/EMBOSS/test > > > You need to uncomment this, and set the directory (the /homes/pmr/ > local > part) to be wherever you installed EMBOSS. > > If you look further down to the database definition of tsw you will > see > emboss_tempdata is used ... and also for the other test databases > we use > for the progam manual examples and for our QA testing .... but you > can of > course use the real databases (locally indexed, or pointing to - for > example - the EBI's SRS server). > > > # swissprot (Puffer fish entries) > # ========= > > DB tsw [ type: P dir: $emboss_tempdata/swiss > method: emblcd format: swiss release: 36 > fields: "sv des org key" > comment: "Swissprot native format with EMBL CD-ROM index" ] > > > Hope that clears things up > > Peter > > From golharam at umdnj.edu Thu Nov 3 17:05:12 2005 From: golharam at umdnj.edu (Ryan Golhar) Date: Thu, 03 Nov 2005 12:05:12 -0500 Subject: [EMBOSS] Needle Message-ID: <010b01c5e098$c16f39f0$e6028a0a@GOLHARMOBILE1> I have a bunch of protein sequences that are fairly short. I'm using needle to align them. Occassionally, needle will give me that error "Sequence is not nucleic". I suspect needle is interpreting the sequence as DNA because of its content, however they are both protein sequences. Is there a way I can force needle to interpret them as protein sequences? Ryan From pmr at ebi.ac.uk Thu Nov 3 17:50:54 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 17:50:54 -0000 (GMT) Subject: [EMBOSS] Needle In-Reply-To: <010b01c5e098$c16f39f0$e6028a0a@GOLHARMOBILE1> References: <010b01c5e098$c16f39f0$e6028a0a@GOLHARMOBILE1> Message-ID: <3758.86.133.37.211.1131040254.squirrel@webmail.ebi.ac.uk> Hi Ryan, > I have a bunch of protein sequences that are fairly short. I'm using > needle to align them. Occassionally, needle will give me that error > "Sequence is not nucleic". > > I suspect needle is interpreting the sequence as DNA because of its > content, however they are both protein sequences. Is there a way I can > force needle to interpret them as protein sequences? Yes ... for any sequence input in any program you can use the command line qualifiers: -sprotein if it is protein -snucleotide (or -snuc) if it is DNA regards, Peter From pmr at ebi.ac.uk Thu Nov 3 17:54:45 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 17:54:45 -0000 (GMT) Subject: [EMBOSS] Cannot open division file In-Reply-To: <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> Message-ID: <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> Hi Tim, > I have installed emboss locally under /usr/local/emboss. > > I uncommented the SET emboss_tempdata line within the emboss.default > file stored at /usr/local/emboss/share/EMBOSS so it now reads: > > SET emboss_tempdata /usr/local/emboss/share/EMBOSS/test/ > > I restarted my machine. > > Unfortunately i still get the same error messages as before. Do you find the database directories under /usr/local/emboss/share/EMBOSS/test/ and can you read, for example, the swiss/seq.dat file (for tsw) from the account where you are running the applications? You can also run with -debug on the command line ... the *.dbg file it writes will tell you where is is looking for the files (or, if you send it to me, I can find the appropriate lines) Hope that helps ... we'll get there soon Peter From pmr at ebi.ac.uk Thu Nov 3 19:11:27 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 3 Nov 2005 19:11:27 -0000 (GMT) Subject: [EMBOSS] Antwort: genbank retrieval In-Reply-To: <436A01BF.9060705@ebi.ac.uk> References: <436A01BF.9060705@ebi.ac.uk> Message-ID: <4738.86.133.37.211.1131045087.squirrel@webmail.ebi.ac.uk> Rodrigo Lopez wrote: > However, EMBL-EBI make EMBLCONEXP available. These do have the sequences > and are available from: > > ftp://ftp.ebi.ac.uk/pub/databases/embl/expanded_con/ > > I have not tested these with the EMBOSS dbiflat/dbxflat - but in > principle they should work. They worked for me with the current CVS code for dbiflat. They are frozen at the time of the EMBL release, which is fine for most purposes (all other EMBL entries are frozen in the same way). If I can make the CON entries work - reading the list of entries and building the expanded_con entry on the fly - EMBOSS will also be able to use the latest versions. Does anyone have a GenBank expanded CON division (as that was the original request - although the data in EMBL and GenBank should be identical). regards, Peter From Tim.Troup at ed.ac.uk Fri Nov 4 13:07:09 2005 From: Tim.Troup at ed.ac.uk (Tim Troup) Date: Fri, 4 Nov 2005 13:07:09 +0000 Subject: [EMBOSS] Cannot open division file In-Reply-To: <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> Message-ID: <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> Hi, > Do you find the database directories under > /usr/local/emboss/share/EMBOSS/test/ and can you read, for example, > the > swiss/seq.dat file (for tsw) from the account where you are running > the > applications? > The database directories are under /usr/local/emboss/share/EMBOSS/ test and the files within these directories can be read no problem. > You can also run with -debug on the command line ... the *.dbg file it > writes will tell you where is is looking for the files (or, if you > send it > to me, I can find the appropriate lines) > I ran seqret again from the command line with the -debug switch as follows: wilkie226:/usr/local/emboss/share/EMBOSS/test troup$ seqret -debug Reads and writes (returns) sequences Input sequence(s): tsw:hba_human Warning: Cannot open division file '' for database 'tsw' Warning: seqCdQry failed Error: Unable to read sequence 'tsw:hba_human' Input sequence(s): tsw:hba_human Warning: Cannot open division file '' for database 'tsw' Warning: seqCdQry failed Error: Unable to read sequence 'tsw:hba_human' Died: seqret terminated: Bad value for '-sequence' and no more retries The seqret.dbg file generated is pasted below. Thanks, Tim Debug file seqret.dbg buffered:No ajFileNewIn '/usr/local/emboss/share/EMBOSS/acd/seqret.acd' EOF ajFileGetsL file /usr/local/emboss/share/EMBOSS/acd/seqret.acd closing file '/usr/local/emboss/share/EMBOSS/acd/seqret.acd' Set acdprotein value '$(sequence.protein)' ajFeatTabInNew 50ba40 ajUserGet buffer len: 0 res: 2048 ptr: 1800a00 ajSeqinClear called ajFeattabInClear called ++seqUsaProcess 'tsw:hba_human' 0..0(N) '' 0 USA to test: 'tsw:hba_human' format regexp: No list:No no format specified in USA ...input format not set dbname dbexp: Yes found dbname 'tsw' level: '' qry->QryString: 'hba_human' namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' seqQueryFieldC usa 'sv' fields 'sv des org key' seqQueryField test 'sv' seqQueryField match 'sv' ajSeqQueryWild id 'hba_human' acc 'hba_human' sv 'hba_human' des '' org '' key '' wild (has) query Sv 'hba_human' database type: 'P' format 'swiss' use access method 'emblcd' Matched seqAccess[0] 'emblcd' seqAccessEmblcd type 2 directory '/usr/local/share/EMBOSS/test/swiss' entry 'hba_human' acc 'hba_human' ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' Database 'tsw' : access method 'emblcd' failed ajUserGet buffer len: 0 res: 2048 ptr: 1800a00 ajSeqinClear called ajFeattabInClear called ++seqUsaProcess 'tsw:hba_human' 0..0(N) '' 0 USA to test: 'tsw:hba_human' format regexp: No list:No no format specified in USA ...input format not set dbname dbexp: Yes found dbname 'tsw' level: '' qry->QryString: 'hba_human' namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' seqQueryFieldC usa 'sv' fields 'sv des org key' seqQueryField test 'sv' seqQueryField match 'sv' ajSeqQueryWild id 'hba_human' acc 'hba_human' sv 'hba_human' des '' org '' key '' wild (has) query Sv 'hba_human' database type: 'P' format 'swiss' use access method 'emblcd' Matched seqAccess[0] 'emblcd' seqAccessEmblcd type 2 directory '/usr/local/share/EMBOSS/test/swiss' entry 'hba_human' acc 'hba_human' ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' Database 'tsw' : access method 'emblcd' failed From pmr at ebi.ac.uk Fri Nov 4 13:54:29 2005 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Fri, 4 Nov 2005 13:54:29 -0000 (GMT) Subject: [EMBOSS] Cannot open division file In-Reply-To: <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> Message-ID: <1083.86.133.37.211.1131112469.squirrel@webmail.ebi.ac.uk> Hi Tim, >> Do you find the database directories under >> /usr/local/emboss/share/EMBOSS/test/ and can you read, for example, >> the >> swiss/seq.dat file (for tsw) from the account where you are running >> the >> applications? >> > > The database directories are under /usr/local/emboss/share/EMBOSS/ > test and the files within these directories can be read no problem. >From the seqret.dbg file: ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' This is the division file - and should be correct. Can you check it has read permissions (it is a binary file) regards, Peter From Tim.Troup at ed.ac.uk Fri Nov 4 14:00:15 2005 From: Tim.Troup at ed.ac.uk (Tim Troup) Date: Fri, 4 Nov 2005 14:00:15 +0000 Subject: [EMBOSS] Cannot open division file In-Reply-To: <1083.86.133.37.211.1131112469.squirrel@webmail.ebi.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> <1083.86.133.37.211.1131112469.squirrel@webmail.ebi.ac.uk> Message-ID: > > From the seqret.dbg file: > > ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' > > This is the division file - and should be correct. Can you check it > has > read permissions (it is a binary file) > > /usr/local/share/EMBOSS/test/swiss/division.lkp permissions are set to 644. So everyone should have read permission. wilkie226:/usr/local/emboss/share/EMBOSS/test/swiss troup$ ls -al total 880 drwxr-xr-x 15 troup wheel 510 Nov 3 13:37 . drwxr-xr-x 11 troup wheel 374 Nov 4 12:54 .. -rw-r--r-- 1 troup wheel 732 Nov 3 13:37 acnum.hit -rw-r--r-- 1 troup wheel 1812 Nov 3 13:37 acnum.trg -rw-r--r-- 1 troup wheel 1704 Nov 3 13:37 des.hit -rw-r--r-- 1 troup wheel 4225 Nov 3 13:37 des.trg -rw-r--r-- 1 troup wheel 322 Nov 3 13:37 division.lkp -rw-r--r-- 1 troup wheel 2020 Nov 3 13:37 entrynam.idx -rw-r--r-- 1 troup wheel 1880 Nov 3 13:37 keyword.hit -rw-r--r-- 1 troup wheel 3540 Nov 3 13:37 keyword.trg -rw-r--r-- 1 troup wheel 386698 Nov 3 13:37 seq.dat -rw-r--r-- 1 troup wheel 644 Nov 3 13:37 seqvn.hit -rw-r--r-- 1 troup wheel 1676 Nov 3 13:37 seqvn.trg -rw-r--r-- 1 troup wheel 3980 Nov 3 13:37 taxon.hit -rw-r--r-- 1 troup wheel 8884 Nov 3 13:37 taxon.trg Thanks again for your time. Tim From ajb at ebi.ac.uk Fri Nov 4 14:02:37 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 4 Nov 2005 14:02:37 -0000 (GMT) Subject: [EMBOSS] Cannot open division file In-Reply-To: <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> Message-ID: <60806.81.96.70.96.1131112957.squirrel@webmail.ebi.ac.uk> Hi, The line in the debug output: namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' implies that you've set emboss_tempdata incorrectly in emboss.default. It should be /usr/local/emboss/share/EMBOSS/test according to the rest of the information you give. HTH Alan > Hi, > >> Do you find the database directories under >> /usr/local/emboss/share/EMBOSS/test/ and can you read, for example, >> the >> swiss/seq.dat file (for tsw) from the account where you are running >> the >> applications? >> > > The database directories are under /usr/local/emboss/share/EMBOSS/ > test and the files within these directories can be read no problem. > > > >> You can also run with -debug on the command line ... the *.dbg file it >> writes will tell you where is is looking for the files (or, if you >> send it >> to me, I can find the appropriate lines) >> > > I ran seqret again from the command line with the -debug switch as > follows: > > wilkie226:/usr/local/emboss/share/EMBOSS/test troup$ seqret -debug > Reads and writes (returns) sequences > Input sequence(s): tsw:hba_human > Warning: Cannot open division file '' for database 'tsw' > Warning: seqCdQry failed > Error: Unable to read sequence 'tsw:hba_human' > Input sequence(s): tsw:hba_human > Warning: Cannot open division file '' for database 'tsw' > Warning: seqCdQry failed > Error: Unable to read sequence 'tsw:hba_human' > Died: seqret terminated: Bad value for '-sequence' and no more retries > > The seqret.dbg file generated is pasted below. > > Thanks, Tim > > > > Debug file seqret.dbg buffered:No > ajFileNewIn '/usr/local/emboss/share/EMBOSS/acd/seqret.acd' > EOF ajFileGetsL file /usr/local/emboss/share/EMBOSS/acd/seqret.acd > closing file '/usr/local/emboss/share/EMBOSS/acd/seqret.acd' > Set acdprotein value '$(sequence.protein)' > ajFeatTabInNew 50ba40 > ajUserGet buffer len: 0 res: 2048 ptr: 1800a00 > ajSeqinClear called > ajFeattabInClear called > ++seqUsaProcess 'tsw:hba_human' 0..0(N) '' 0 > USA to test: 'tsw:hba_human' > > format regexp: No list:No > no format specified in USA > > ...input format not set > dbname dbexp: Yes > found dbname 'tsw' level: '' qry->QryString: 'hba_human' > namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' > namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' > seqQueryFieldC usa 'sv' fields 'sv des org key' > seqQueryField test 'sv' > seqQueryField match 'sv' > ajSeqQueryWild id 'hba_human' acc 'hba_human' sv 'hba_human' des '' > org '' key '' > wild (has) query Sv 'hba_human' > database type: 'P' format 'swiss' > use access method 'emblcd' > Matched seqAccess[0] 'emblcd' > seqAccessEmblcd type 2 > directory '/usr/local/share/EMBOSS/test/swiss' entry 'hba_human' acc > 'hba_human' > ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' > Database 'tsw' : access method 'emblcd' failed > ajUserGet buffer len: 0 res: 2048 ptr: 1800a00 > ajSeqinClear called > ajFeattabInClear called > ++seqUsaProcess 'tsw:hba_human' 0..0(N) '' 0 > USA to test: 'tsw:hba_human' > > format regexp: No list:No > no format specified in USA > > ...input format not set > dbname dbexp: Yes > found dbname 'tsw' level: '' qry->QryString: 'hba_human' > namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' > namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' > seqQueryFieldC usa 'sv' fields 'sv des org key' > seqQueryField test 'sv' > seqQueryField match 'sv' > ajSeqQueryWild id 'hba_human' acc 'hba_human' sv 'hba_human' des '' > org '' key '' > wild (has) query Sv 'hba_human' > database type: 'P' format 'swiss' > use access method 'emblcd' > Matched seqAccess[0] 'emblcd' > seqAccessEmblcd type 2 > directory '/usr/local/share/EMBOSS/test/swiss' entry 'hba_human' acc > 'hba_human' > ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' > Database 'tsw' : access method 'emblcd' failed > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From Tim.Troup at ed.ac.uk Fri Nov 4 14:10:16 2005 From: Tim.Troup at ed.ac.uk (Tim Troup) Date: Fri, 4 Nov 2005 14:10:16 +0000 Subject: [EMBOSS] Cannot open division file In-Reply-To: <60806.81.96.70.96.1131112957.squirrel@webmail.ebi.ac.uk> References: <0B99B628-1535-49C8-9818-8EBBF0C755A8@ed.ac.uk> <1753.86.133.37.211.1131034883.squirrel@webmail.ebi.ac.uk> <133D5EA8-6F45-4855-AC0C-510ECF00D851@ed.ac.uk> <3761.86.133.37.211.1131040485.squirrel@webmail.ebi.ac.uk> <82AC0633-8985-43F1-A1E1-41DABB32CA6D@ed.ac.uk> <60806.81.96.70.96.1131112957.squirrel@webmail.ebi.ac.uk> Message-ID: Hi, I corrected the path emboss_tempdata variable in the emboss.default file and all now works smoothly. Thanks, Tim On 4 Nov 2005, at 14:02, ajb at ebi.ac.uk wrote: > Hi, > > The line in the debug output: > > namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' > > implies that you've set emboss_tempdata incorrectly in emboss.default. > It should be /usr/local/emboss/share/EMBOSS/test according to > the rest of the information you give. > > HTH > > Alan > >> Hi, >> >>> Do you find the database directories under >>> /usr/local/emboss/share/EMBOSS/test/ and can you read, for example, >>> the >>> swiss/seq.dat file (for tsw) from the account where you are running >>> the >>> applications? >>> >> >> The database directories are under /usr/local/emboss/share/EMBOSS/ >> test and the files within these directories can be read no problem. >> >> >> >>> You can also run with -debug on the command line ... the *.dbg >>> file it >>> writes will tell you where is is looking for the files (or, if you >>> send it >>> to me, I can find the appropriate lines) >>> >> >> I ran seqret again from the command line with the -debug switch as >> follows: >> >> wilkie226:/usr/local/emboss/share/EMBOSS/test troup$ seqret -debug >> Reads and writes (returns) sequences >> Input sequence(s): tsw:hba_human >> Warning: Cannot open division file '' for database 'tsw' >> Warning: seqCdQry failed >> Error: Unable to read sequence 'tsw:hba_human' >> Input sequence(s): tsw:hba_human >> Warning: Cannot open division file '' for database 'tsw' >> Warning: seqCdQry failed >> Error: Unable to read sequence 'tsw:hba_human' >> Died: seqret terminated: Bad value for '-sequence' and no more >> retries >> >> The seqret.dbg file generated is pasted below. >> >> Thanks, Tim >> >> >> >> Debug file seqret.dbg buffered:No >> ajFileNewIn '/usr/local/emboss/share/EMBOSS/acd/seqret.acd' >> EOF ajFileGetsL file /usr/local/emboss/share/EMBOSS/acd/seqret.acd >> closing file '/usr/local/emboss/share/EMBOSS/acd/seqret.acd' >> Set acdprotein value '$(sequence.protein)' >> ajFeatTabInNew 50ba40 >> ajUserGet buffer len: 0 res: 2048 ptr: 1800a00 >> ajSeqinClear called >> ajFeattabInClear called >> ++seqUsaProcess 'tsw:hba_human' 0..0(N) '' 0 >> USA to test: 'tsw:hba_human' >> >> format regexp: No list:No >> no format specified in USA >> >> ...input format not set >> dbname dbexp: Yes >> found dbname 'tsw' level: '' qry->QryString: 'hba_human' >> namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' >> namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' >> seqQueryFieldC usa 'sv' fields 'sv des org key' >> seqQueryField test 'sv' >> seqQueryField match 'sv' >> ajSeqQueryWild id 'hba_human' acc 'hba_human' sv 'hba_human' des '' >> org '' key '' >> wild (has) query Sv 'hba_human' >> database type: 'P' format 'swiss' >> use access method 'emblcd' >> Matched seqAccess[0] 'emblcd' >> seqAccessEmblcd type 2 >> directory '/usr/local/share/EMBOSS/test/swiss' entry 'hba_human' acc >> 'hba_human' >> ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' >> Database 'tsw' : access method 'emblcd' failed >> ajUserGet buffer len: 0 res: 2048 ptr: 1800a00 >> ajSeqinClear called >> ajFeattabInClear called >> ++seqUsaProcess 'tsw:hba_human' 0..0(N) '' 0 >> USA to test: 'tsw:hba_human' >> >> format regexp: No list:No >> no format specified in USA >> >> ...input format not set >> dbname dbexp: Yes >> found dbname 'tsw' level: '' qry->QryString: 'hba_human' >> namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' >> namVarResolve 'emboss_tempdata' = '/usr/local/share/EMBOSS/test' >> seqQueryFieldC usa 'sv' fields 'sv des org key' >> seqQueryField test 'sv' >> seqQueryField match 'sv' >> ajSeqQueryWild id 'hba_human' acc 'hba_human' sv 'hba_human' des '' >> org '' key '' >> wild (has) query Sv 'hba_human' >> database type: 'P' format 'swiss' >> use access method 'emblcd' >> Matched seqAccess[0] 'emblcd' >> seqAccessEmblcd type 2 >> directory '/usr/local/share/EMBOSS/test/swiss' entry 'hba_human' acc >> 'hba_human' >> ajFileNewIn '/usr/local/share/EMBOSS/test/swiss/division.lkp' >> Database 'tsw' : access method 'emblcd' failed >> >> _______________________________________________ >> EMBOSS mailing list >> EMBOSS at emboss.open-bio.org >> http://newportal.open-bio.org/mailman/listinfo/emboss >> > > From p.ulvskov at dias.kvl.dk Sat Nov 5 17:09:26 2005 From: p.ulvskov at dias.kvl.dk (Peter Ulvskov) Date: Sat, 5 Nov 2005 18:09:26 +0100 Subject: [EMBOSS] Jemboss Installation on OS X Message-ID: <7f69986799074cb1f4fb03e6c47eaae5@dias.kvl.dk> > Thanks Michael that is useful to the EMBOSS group as we are waiting > for a > copy of Tiger to test Jemboss/EMBOSS out on. So it is good to know that > you have it working. > > Also just a note that 1.3 is no longer supported, so the options are > 1.4.2 or 1.5. > > Regards > Tim Carver Dear Tim, I have tried to follow your instructions earlier on (Emboss 2.8.0) with regard to getting Jemboss installed on OS X, but gave up eventually (Emboss itself runs fine). I have just downloaded ebiotools with Emboss version 3.0 and thought that I should give it one more try. A little Googling reveals that a lot of people are struggling with the Jemboss installation and although some users actually succeed I have yet to find a consolidated, fool proof step 1 through n on how to do it. Jemboss has been around long enough for such a Quick-start guide to exist if only I could find it. Can you help? Thanks, and best regards, Peter Ulvskov -------------- next part -------------- A non-text attachment was scrubbed... Name: not available Type: text/enriched Size: 1030 bytes Desc: not available URL: From tjc at sanger.ac.uk Sun Nov 6 17:54:06 2005 From: tjc at sanger.ac.uk (Tim Carver) Date: Sun, 6 Nov 2005 17:54:06 +0000 (GMT) Subject: [EMBOSS] Jemboss Installation on OS X (fwd) Message-ID: Hi Peter The installation instructions are here, for the standalone: http://emboss.sourceforge.net/Jemboss/install/standalone.html for the client-server http://emboss.sourceforge.net/Jemboss/install/server.html The install script (install-jemboss-server.sh) is intended to guide you through as much as possible the installation process. This has been updated since I have had access to Tiger - so get the latest from (http://emboss.sourceforge.net/Jemboss/install/install-jemboss-server.sh). I have also just been through the server set up instructions and updated versions etc, hopefully to make it clearer. Please let me know if there is anything there that needs to be clarified. Also please email any problems you encounter during the installation. Important points I would emphasise: - get the latest install script from: http://emboss.sourceforge.net/Jemboss/install/install-jemboss-server.sh to replace the one in EMBOSS-3.x.x/jemboss/utils/ - ensure that libpng, zlib and libgd are installed in the same place (i.e. with the same prefix), e.g. /usr/local - ensure you start with fresh downloads and remove any old installations of tomcat, axis, EMBOSS. - use the current versions (Java 1.5, apache-tomcat-5.5.12, axis-1_3) - follow the instructions at: http://emboss.sourceforge.net/Jemboss/install/server.html Let me know how it goes, Tim On Sat, 5 Nov 2005, Peter Ulvskov wrote: > > Thanks Michael that is useful to the EMBOSS group as we are waiting > > for a > > copy of Tiger to test Jemboss/EMBOSS out on. So it is good to know that > > you have it working. > > > > Also just a note that 1.3 is no longer supported, so the options are > > 1.4.2 or 1.5. > > > > Regards > > Tim Carver > > Dear Tim, > I have tried to follow your instructions earlier on (Emboss 2.8.0) with > regard to getting Jemboss installed on OS X, but gave up eventually > (Emboss itself runs fine). I have just downloaded ebiotools with Emboss > version 3.0 and thought that I should give it one more try. A little > Googling reveals that a lot of people are struggling with the Jemboss > installation and although some users actually succeed I have yet to > find a consolidated, fool proof step 1 through n on how to do it. > Jemboss has been around long enough for such a Quick-start guide to > exist if only I could find it. > Can you help? > > Thanks, and best regards, > > Peter Ulvskov > The Wellcome Trust Sanger Institute Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK From bioflash at gmail.com Wed Nov 9 06:11:35 2005 From: bioflash at gmail.com (Vincent Deng) Date: Wed, 9 Nov 2005 14:11:35 +0800 Subject: [EMBOSS] Help with fdnadist Message-ID: <455343d90511082211u73ef385ya714e159e88f0d9b@mail.gmail.com> Hi, I'd read this postand run fdnadist with a bootstrapped dataset(boostrap for 100times). After running it, I could only find one data matrix in the output file of fdnadist. I guess that's because fdnadist only compute one set of the boostrapped data. Any help for this problem? Best Regards... From sas at belozersky.msu.ru Wed Nov 9 07:16:14 2005 From: sas at belozersky.msu.ru (Sergei Spirin) Date: Wed, 9 Nov 2005 10:16:14 +0300 Subject: [EMBOSS] Help with fdnadist References: <455343d90511082211u73ef385ya714e159e88f0d9b@mail.gmail.com> Message-ID: <009101c5e4fd$7b963eb0$8a3afa9e@class51> Just yesterday I had the same experience with fprotdist: fseqboot prepared a file containing 100 alignments, but fprotdist made only one matrix from that input. I could not find an option like "number of datasets". Sergei ----- Original Message ----- From: "Vincent Deng" To: Sent: Wednesday, November 09, 2005 9:11 AM Subject: [EMBOSS] Help with fdnadist > Hi, > > I'd read this > postand > run fdnadist with a bootstrapped dataset(boostrap for 100times). After > running it, I could only find one data matrix in the output file of > fdnadist. I guess that's because fdnadist only compute one set of the > boostrapped data. Any help for this problem? > > Best Regards... > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From pmr at ebi.ac.uk Wed Nov 9 08:12:59 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 09 Nov 2005 08:12:59 +0000 Subject: [EMBOSS] Help with fdnadist In-Reply-To: <455343d90511082211u73ef385ya714e159e88f0d9b@mail.gmail.com> References: <455343d90511082211u73ef385ya714e159e88f0d9b@mail.gmail.com> Message-ID: <4371AF8B.3040908@ebi.ac.uk> Vincent Deng wrote: > I'd read this postand > run fdnadist with a bootstrapped dataset(boostrap for 100times). After > running it, I could only find one data matrix in the output file of > fdnadist. I guess that's because fdnadist only compute one set of the > boostrapped data. Any help for this problem? Yes ... there is a bug in EMBOSS 3.0.0 in reading multiple set of ailgnments in phylip format. This only afects the phylipnew programs (no other program is trying to read more than one alignment as input). Removing the blank line between alignments fixes the problem. This will be fixed in the next release. f you ru this kind of analysis often we can provide a patch for EMBOSS 3.0.0 Hope that helps, Peter Rice From pmr at ebi.ac.uk Wed Nov 9 08:14:50 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 09 Nov 2005 08:14:50 +0000 Subject: [EMBOSS] Help with fdnadist In-Reply-To: <009101c5e4fd$7b963eb0$8a3afa9e@class51> References: <455343d90511082211u73ef385ya714e159e88f0d9b@mail.gmail.com> <009101c5e4fd$7b963eb0$8a3afa9e@class51> Message-ID: <4371AFFA.1010002@ebi.ac.uk> Sergei Spirin wrote: > Just yesterday I had the same experience with fprotdist: fseqboot prepared a > file containing 100 alignments, but fprotdist made only one matrix from that > input. I could not find an option like "number of datasets". The EMBOSS programs automatically read all the datasets so we do not need the PHYLIP "number of datasets" option - (but see my previous reply for a problem with reading the input file format). regards, Peter From bioflash at gmail.com Wed Nov 9 09:20:33 2005 From: bioflash at gmail.com (Vincent Deng) Date: Wed, 9 Nov 2005 17:20:33 +0800 Subject: [EMBOSS] Help with fdnapars Message-ID: <455343d90511090120h69745e7i2cc7c064fe7e2d7d@mail.gmail.com> Hi, I encountered "Segmentation fault" error when running fdnapars. However if I reduced the number of the sequences in input file, it ran well. Is there any sequence number consideration when running this program? p.s. My OS version is RedHat 9.0 Best Regards... From pmr at ebi.ac.uk Wed Nov 9 09:36:05 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 09 Nov 2005 09:36:05 +0000 Subject: [EMBOSS] Help with fdnapars In-Reply-To: <455343d90511090120h69745e7i2cc7c064fe7e2d7d@mail.gmail.com> References: <455343d90511090120h69745e7i2cc7c064fe7e2d7d@mail.gmail.com> Message-ID: <4371C305.2000007@ebi.ac.uk> Vincent Deng wrote: > I encountered "Segmentation fault" error when running fdnapars. However if I > reduced the number of the sequences in input file, it ran well. Is there any > sequence number consideration when running this program? There is no specific limit. Looks like a bug (though it may be in the EMBOSS or the PHYLIP code) Can you send me the input file and command line please? regards, Peter From Tim.Troup at ed.ac.uk Wed Nov 9 10:45:54 2005 From: Tim.Troup at ed.ac.uk (Tim Troup) Date: Wed, 9 Nov 2005 10:45:54 +0000 Subject: [EMBOSS] emboss on redhat enterprise linux 64-bit Message-ID: Hi, I am trying to install emboss version 2.8.0 on a dual 64-bit xeon processor machine running redhat enterprise linux. The reason I am installing version 2.8.0 is because I wish to make emboss available as a set of web services via soaplab (http://www.ebi.ac.uk/soaplab/) and currently soaplab is tied to version 2.8.0 (http://www.ebi.ac.uk/ soaplab/ServiceSets.html). I configured the install as follows: ./configure --prefix=/usr/local/emboss --without-x --enable-64 then did make and make install with no obvious error messages. However, when i try to run any of the apps from the command line I get: Segmentation fault Anyone got any tips as to how to get emboss running on this kind of set up? Thanks, Tim From rls at ebi.ac.uk Wed Nov 9 11:06:46 2005 From: rls at ebi.ac.uk (Rodrigo Lopez) Date: Wed, 9 Nov 2005 11:06:46 -0000 Subject: [EMBOSS] emboss on redhat enterprise linux 64-bit In-Reply-To: Message-ID: <001a01c5e51d$ae1dfba0$0132a8c0@windows.ebi.ac.uk> Hi, You should contact Alberto Labarga at the EBI (alabarga at ebi.ac.uk - Cc'd on this email) about using new supported SWS for EMBOSS and the future of SOAPLAB as we know it. R:) > -----Original Message----- > From: emboss-bounces at emboss.open-bio.org > [mailto:emboss-bounces at emboss.open-bio.org] On Behalf Of Tim Troup > Sent: 09 November 2005 10:46 > To: emboss at emboss.open-bio.org > Subject: [EMBOSS] emboss on redhat enterprise linux 64-bit > > > Hi, > > I am trying to install emboss version 2.8.0 on a dual 64-bit xeon > processor machine running redhat enterprise linux. The reason I am > installing version 2.8.0 is because I wish to make emboss available > as a set of web services via soaplab (http://www.ebi.ac.uk/soaplab/) > and currently soaplab is tied to version 2.8.0 (http://www.ebi.ac.uk/ > soaplab/ServiceSets.html). > > I configured the install as follows: > > ./configure --prefix=/usr/local/emboss --without-x --enable-64 > > then did make and make install with no obvious error messages. > > However, when i try to run any of the apps from the command > line I get: > > Segmentation fault > > Anyone got any tips as to how to get emboss running on this kind of > set up? > > Thanks, Tim > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From njoly at pasteur.fr Wed Nov 9 11:52:23 2005 From: njoly at pasteur.fr (Nicolas Joly) Date: Wed, 9 Nov 2005 12:52:23 +0100 Subject: [EMBOSS] emboss on redhat enterprise linux 64-bit In-Reply-To: References: Message-ID: <20051109115223.GB196054@medusa.sis.pasteur.fr> On Wed, Nov 09, 2005 at 10:45:54AM +0000, Tim Troup wrote: > Hi, > > I am trying to install emboss version 2.8.0 on a dual 64-bit xeon > processor machine running redhat enterprise linux. The reason I am > installing version 2.8.0 is because I wish to make emboss available > as a set of web services via soaplab (http://www.ebi.ac.uk/soaplab/) > and currently soaplab is tied to version 2.8.0 (http://www.ebi.ac.uk/ > soaplab/ServiceSets.html). > > I configured the install as follows: > > ./configure --prefix=/usr/local/emboss --without-x --enable-64 > > then did make and make install with no obvious error messages. > > However, when i try to run any of the apps from the command line I get: > > Segmentation fault > > Anyone got any tips as to how to get emboss running on this kind of > set up? We already saw this on our amd64 machine running CenOS 3.6 (RHEL clone). It looks like a compiler/glibc/... bug as it disappeared when we upgraded the machines to CentOS 4.2. -- Nicolas Joly Biological Software and Databanks. Institut Pasteur, Paris. From noutsos at lrz.uni-muenchen.de Thu Nov 10 14:13:26 2005 From: noutsos at lrz.uni-muenchen.de (christos noutsos) Date: Thu, 10 Nov 2005 15:13:26 +0100 Subject: [EMBOSS] installing EMBOSS to suse 9.3 Message-ID: <200511101513.26342.noutsos@lrz.uni-muenchen.de> I'm trying to install the EMBOSS 3.0.0 to a Suse 9.3 operating system as an administrator. I follow the instructions for a normal installation but at the end I can not get the wossname is not working and I can not get any other program also. Any suggestions? Thanks a lot. christos From andrespinzon at gmail.com Thu Nov 10 15:27:17 2005 From: andrespinzon at gmail.com (Andres Pinzon) Date: Thu, 10 Nov 2005 10:27:17 -0500 Subject: [EMBOSS] installing EMBOSS to suse 9.3 In-Reply-To: <200511101513.26342.noutsos@lrz.uni-muenchen.de> References: <200511101513.26342.noutsos@lrz.uni-muenchen.de> Message-ID: <8968fc7e0511100727tce8e308o@mail.gmail.com> 2005/11/10, christos noutsos : > I'm trying to install the EMBOSS 3.0.0 to a Suse 9.3 operating system as an > administrator. I follow the instructions for a normal installation but at the > end I can not get the wossname is not working and I can not get any other > program also. What is the system message? I mean what is the error that appears when you run wossname or whatever? -- --------- Andr?s Pinz?n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From andrespinzon at gmail.com Thu Nov 10 19:24:57 2005 From: andrespinzon at gmail.com (Andres Pinzon) Date: Thu, 10 Nov 2005 14:24:57 -0500 Subject: [EMBOSS] installing EMBOSS to suse 9.3 In-Reply-To: <200511101702.01513.noutsos@lrz.uni-muenchen.de> References: <200511101513.26342.noutsos@lrz.uni-muenchen.de> <8968fc7e0511100727tce8e308o@mail.gmail.com> <200511101702.01513.noutsos@lrz.uni-muenchen.de> Message-ID: <8968fc7e0511101124o69fbd4cfp@mail.gmail.com> 2005/11/10, christos noutsos : > On Thursday 10 November 2005 16:27, you wrote: > > this is the only thing that I get > so when I run ./wossname then I get > "bash: ./wossname: No such file or directory" > and when I run wossname then I get > bash: wossname: No such file or directory Ok! it seems that your problem is not a big one, is just that your EMBOSS/bin directory is not in the path. What you have to do is to tell your system where to find the emboss binaries. How can U do that? Is pretty easy. First of all where did you install emboss? Something like /usr/local/emboss? Lets guess that is your emboss directory, so what you have to do is: export PATH=/usr/local/emboss/bin:$PATH And if tyou want this changes to be permanent edit your /etc/profile. -- --------- Andr?s Pinz?n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From Andrew.Mather at dpi.vic.gov.au Thu Nov 10 23:10:04 2005 From: Andrew.Mather at dpi.vic.gov.au (Andrew.Mather at dpi.vic.gov.au) Date: Fri, 11 Nov 2005 10:10:04 +1100 Subject: [EMBOSS] emboss on redhat enterprise linux 64-bit Message-ID: Hi All, I can confirm that it's a compiler/glibc thing with RHEL on Opteron. We had the same experience. Compile without errors, but segfault on execution. We upgraded GCC to 4.0.1 and all went fine. Andrew Bioinformatics Advanced Scientific Computing, Animal Genetics and Genomics, PIRVic Attwood 475 Mickleham Road, Attwood, 3049 ph +61 3 92174342 mob 0413 009 761 ---------------- There are 10 kinds of people...those who understand binary and those who don't. |---------+----------------------------------> | | njoly at pasteur.fr | | | Sent by: | | | emboss-bounces at emboss.o| | | pen-bio.org | | | | | | | | | 09/11/2005 10:52 PM | | | | |---------+----------------------------------> >------------------------------------------------------------------------------------------------------------------------------| | | | To: Tim.Troup at ed.ac.uk | | cc: emboss at emboss.open-bio.org | | Subject: Re: [EMBOSS] emboss on redhat enterprise linux 64-bit | >------------------------------------------------------------------------------------------------------------------------------| On Wed, Nov 09, 2005 at 10:45:54AM +0000, Tim Troup wrote: > Hi, > > I am trying to install emboss version 2.8.0 on a dual 64-bit xeon > processor machine running redhat enterprise linux. The reason I am > installing version 2.8.0 is because I wish to make emboss available > as a set of web services via soaplab (http://www.ebi.ac.uk/soaplab/) > and currently soaplab is tied to version 2.8.0 (http://www.ebi.ac.uk/ > soaplab/ServiceSets.html). > > I configured the install as follows: > > ./configure --prefix=/usr/local/emboss --without-x --enable-64 > > then did make and make install with no obvious error messages. > > However, when i try to run any of the apps from the command line I get: > > Segmentation fault > > Anyone got any tips as to how to get emboss running on this kind of > set up? We already saw this on our amd64 machine running CenOS 3.6 (RHEL clone). It looks like a compiler/glibc/... bug as it disappeared when we upgraded the machines to CentOS 4.2. -- Nicolas Joly Biological Software and Databanks. Institut Pasteur, Paris. _______________________________________________ EMBOSS mailing list EMBOSS at emboss.open-bio.org http://newportal.open-bio.org/mailman/listinfo/emboss From Richard.Rothery at ualberta.ca Tue Nov 15 19:03:08 2005 From: Richard.Rothery at ualberta.ca (Richard Rothery) Date: Tue, 15 Nov 2005 12:03:08 -0700 Subject: [EMBOSS] Netblast search of swissprot and trembl...... Message-ID: <000601c5ea17$37598c10$5e068081@Nordegg> I am using blastcl3 to search NCBI using multiple bait sequences in fasta format. I can readily search swissprot using this program, but cannot search trembl. The NCBI accession numbers (ie just numbers) that blastcl3 returns require re-labelling of the sequences to make clustal outputs, phylogeny analyses etc. meaningful. Is there an easily-installed linux client that can search trembl? Can blastcl3 be forced to do it? What I would like to do is feed seqret a file containing the trembl accessions. This would generate a fasta file with more meaningful titles comprising the accession number followed by the swissprot organism abbreviation. Thanks, Richard ############################################### CIHR Membrane Protein Research Group, Department of Biochemistry, University of Alberta, Edmonton T6G 2H7 Ph. (780) 492-2229 Fax. (780) 492-0886 ############################################### From jison at ebi.ac.uk Wed Nov 16 12:25:11 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Wed, 16 Nov 2005 12:25:11 -0000 (GMT) Subject: [EMBOSS] Netblast search of swissprot and trembl...... In-Reply-To: <000601c5ea17$37598c10$5e068081@Nordegg> References: <000601c5ea17$37598c10$5e068081@Nordegg> Message-ID: <36587.172.31.8.12.1132143911.squirrel@webmail.ebi.ac.uk> Hi Richard seqret can read a "list file" which is a list of USAs (one per line). A USA (Uniform Sequence Address) is the EMBOSS method of specifying sequences from databases, files etc. You'll need the "@myfile" or "list::myfile" syntax where "myfile" is the file name of your list of sequences. You can output in all the common formats. Read the documentation : http://emboss.sourceforge.net/apps/seqret.html Cheers Jon > I am using blastcl3 to search NCBI using multiple bait sequences in > fasta format. I can readily search swissprot using this program, but > cannot search trembl. The NCBI accession numbers (ie just numbers) that > blastcl3 returns require re-labelling of the sequences to make clustal > outputs, phylogeny analyses etc. meaningful. > > > > Is there an easily-installed linux client that can search trembl? Can > blastcl3 be forced to do it? > > > > What I would like to do is feed seqret a file containing the trembl > accessions. This would generate a fasta file with more meaningful titles > comprising the accession number followed by the swissprot organism > abbreviation. > > > > Thanks, > > > > Richard > > > > ############################################### > > CIHR Membrane Protein Research Group, > > Department of Biochemistry, University of Alberta, > > Edmonton T6G 2H7 > > Ph. (780) 492-2229 Fax. (780) 492-0886 > > ############################################### > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From gbottu at ben.vub.ac.be Wed Nov 16 15:45:08 2005 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Wed, 16 Nov 2005 16:45:08 +0100 Subject: [EMBOSS] Netblast search of swissprot and trembl - Checked by AntiV In-Reply-To: <000601c5ea17$37598c10$5e068081@Nordegg> References: <000601c5ea17$37598c10$5e068081@Nordegg> Message-ID: <20051116154508.GA32468@bigben.ulb.ac.be> On Tue, Nov 15, 2005 at 12:03:08PM -0700, Richard Rothery wrote: > Is there an easily-installed linux client that can search trembl? Can > blastcl3 be forced to do it? The problem is that blastcl3 submits searches at the NCBI, where they do not offer trembl as such. There exists a program WSWUBlastClient.pl that submits searches at the EBI, where they have uniprot (swissprot + trembl). see http://www.ebi.ac.uk/Tools/webservices/index.html To make it work you need however to install a lot of Perl libraries. Guy Bottu, Belgian EMBnet Node From andrespinzon at gmail.com Wed Nov 16 16:00:18 2005 From: andrespinzon at gmail.com (Andres Pinzon) Date: Wed, 16 Nov 2005 11:00:18 -0500 Subject: [EMBOSS] OT: BLAST interfaces Message-ID: <8968fc7e0511160800r18b0c003n@mail.gmail.com> First of all I would like to apologize for this OT, but as i see you are talking about BLAST interfaces I would like to ask you for one BLAST HTML interface to query a local BLAST server and, of course, obtain the results. Im developing one by myself (prettyBLAST), because we are using a client/server version (databases are in a different machine from the one the queries are going to be run so I have to capture the server response in chunks and show the BLAST output) but before working more on it I would like to know your opinion about some BLAST interfaces out there and if this development worthwhile. Thanks in advance, -- --------- Andr?s Pinz?n [http://www.andrespinzon.com] Bioinformatics Center, Colombia EMBnet node Biotechnology Institute - National University of Colombia http://bioinf.ibun.unal.edu.co Tel +57 3165000 ext 16961 Fax +571 3165415 ---------- From sbassi at gmail.com Wed Nov 16 16:06:57 2005 From: sbassi at gmail.com (Sebastian Bassi) Date: Wed, 16 Nov 2005 13:06:57 -0300 Subject: [EMBOSS] OT: BLAST interfaces In-Reply-To: <8968fc7e0511160800r18b0c003n@mail.gmail.com> References: <8968fc7e0511160800r18b0c003n@mail.gmail.com> Message-ID: On 11/16/05, Andres Pinzon wrote: > First of all I would like to apologize for this OT, but as i see you > are talking about BLAST interfaces I would like to ask you for one > BLAST HTML interface to query a local BLAST server and, of course, > obtain the results. ... > on it I would like to know your opinion about some BLAST interfaces > out there and if this development worthwhile. > Thanks in advance, GUIBlast and YBlast. I am the mantainer of GUIBLast, but there is a lot it is not updated. So I recommend by now, yBlast. -- La web sin popups ni spyware: Usa Firefox en lugar de Internet Explorer From msarachu at biol.unlp.edu.ar Wed Nov 16 19:47:07 2005 From: msarachu at biol.unlp.edu.ar (=?windows-1252?B?TWFydO1uIFNhcmFjaHU=?=) Date: Wed, 16 Nov 2005 16:47:07 -0300 Subject: [EMBOSS] OT: BLAST interfaces In-Reply-To: <8968fc7e0511160800r18b0c003n@mail.gmail.com> References: <8968fc7e0511160800r18b0c003n@mail.gmail.com> Message-ID: <1132170427.437b8cbb69946@www.biol.unlp.edu.ar> did you try the one NCBI distributes (netblast I think)? Quoting Andres Pinzon : > First of all I would like to apologize for this OT, but as i see you > are talking about BLAST interfaces I would like to ask you for one > BLAST HTML interface to query a local BLAST server and, of course, > obtain the results. > Im developing one by myself (prettyBLAST), because we are using a > client/server version (databases are in a different machine from the > one the queries are going to be run so I have to capture the server > response in chunks and show the BLAST output) but before working more > on it I would like to know your opinion about some BLAST interfaces > out there and if this development worthwhile. > Thanks in advance, > > -- > --------- > Andr?s Pinz?n [http://www.andrespinzon.com] > Bioinformatics Center, Colombia EMBnet node > Biotechnology Institute - National University of Colombia > http://bioinf.ibun.unal.edu.co > Tel +57 3165000 ext 16961 Fax +571 3165415 > ---------- > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > -- Mart?n Sarachu msarachu at biol.unlp.edu.ar EMBnet Argentina http://www.ar.embnet.org From yezhiqiang at gmail.com Fri Nov 18 14:52:53 2005 From: yezhiqiang at gmail.com (Zhiqiang Ye) Date: Fri, 18 Nov 2005 22:52:53 +0800 Subject: [EMBOSS] Is there any way to use water or needle to do an all-to-all alignment? Message-ID: <34198fe40511180652v5cf3188ex@mail.gmail.com> Hi, all I want to do all-to-all pairwise comparison frequently. I have a fasta file "total.fasta" containing many sequences, I want to get the their pairwise comparison identities. I don't want to split it to single fasta files and then needle them to the "total.fasta" since I have to do this frequently. Could needle or water be used for all-to-all alignment directly? Just like blast. Thank you very much. -- Zhiqiang Ye PHD candidate College of Lifesciences, Center for Bioinformatics Peking University, Beijing. From zhangchn2004 at gmail.com Fri Nov 18 15:48:26 2005 From: zhangchn2004 at gmail.com (Zhang Chen) Date: Fri, 18 Nov 2005 23:48:26 +0800 Subject: [EMBOSS] Is there any way to use water or needle to do an all-to-all alignment? In-Reply-To: <34198fe40511180652v5cf3188ex@mail.gmail.com> References: <34198fe40511180652v5cf3188ex@mail.gmail.com> Message-ID: <24301eb00511180748j1aa9b15aj@mail.gmail.com> I think what you want is not difficult to implement with the help of Bioperl. A little work on scripts and Bio::Factory::EMBOSS may help you. 2005/11/18, Zhiqiang Ye : > Hi, all > I want to do all-to-all pairwise comparison frequently. I have a > fasta file "total.fasta" containing many sequences, I want to get the > their pairwise comparison identities. I don't want to split it to > single fasta files and then needle them to the "total.fasta" since I > have to do this frequently. Could needle or water be used for > all-to-all alignment directly? Just like blast. > > Thank you very much. > > -- > Zhiqiang Ye > PHD candidate > College of Lifesciences, Center for Bioinformatics > Peking University, Beijing. > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From pmr at ebi.ac.uk Fri Nov 18 16:21:18 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 18 Nov 2005 16:21:18 +0000 Subject: [EMBOSS] Is there any way to use water or needle to do an all-to-all alignment? In-Reply-To: <34198fe40511180652v5cf3188ex@mail.gmail.com> References: <34198fe40511180652v5cf3188ex@mail.gmail.com> Message-ID: <437DFF7E.6090908@ebi.ac.uk> Hi Ye, > I want to do all-to-all pairwise comparison frequently. I have a > fasta file "total.fasta" containing many sequences, I want to get the > their pairwise comparison identities. I don't want to split it to > single fasta files and then needle them to the "total.fasta" since I > have to do this frequently. Could needle or water be used for > all-to-all alignment directly? Just like blast. It is possible to modify water to do this - read seqall and seqset as input, instead of sequenec and seqall, and process each sequence from the seqall against all sequences in the seqset. It will be a new program (new input types). Not hard to do - you may want to try writing it. It needs a new name. How about "waterfall" :-) regards, Peter From jison at ebi.ac.uk Fri Nov 18 16:29:23 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Fri, 18 Nov 2005 16:29:23 -0000 (GMT) Subject: [EMBOSS] Is there any way to use water or needle to do an all-to-all alignment? In-Reply-To: <34198fe40511180652v5cf3188ex@mail.gmail.com> References: <34198fe40511180652v5cf3188ex@mail.gmail.com> Message-ID: <38691.172.31.8.12.1132331363.squirrel@webmail.ebi.ac.uk> Hi Zhiqiang Ye Have a look at the "allversusall" program in the EMBASSY "DOMALIGN" package: http://emboss.sourceforge.net/apps/allversusall.html It's beta software so go steady. If it doesn't do exactly what you want I'll gladly adapt it for you. Let us know how you get on. Cheers Jon > Hi, all > I want to do all-to-all pairwise comparison frequently. I have a > fasta file "total.fasta" containing many sequences, I want to get the > their pairwise comparison identities. I don't want to split it to > single fasta files and then needle them to the "total.fasta" since I > have to do this frequently. Could needle or water be used for > all-to-all alignment directly? Just like blast. > > Thank you very much. > > -- > Zhiqiang Ye > PHD candidate > College of Lifesciences, Center for Bioinformatics > Peking University, Beijing. > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From thomas.girke at ucr.edu Fri Nov 18 17:59:28 2005 From: thomas.girke at ucr.edu (Thomas Girke) Date: Fri, 18 Nov 2005 09:59:28 -0800 Subject: [EMBOSS] Is there any way to use water or needle to do an all-to-all alignment? In-Reply-To: <38691.172.31.8.12.1132331363.squirrel@webmail.ebi.ac.uk> References: <34198fe40511180652v5cf3188ex@mail.gmail.com> <38691.172.31.8.12.1132331363.squirrel@webmail.ebi.ac.uk> Message-ID: <20051118175928.GA26525@bioinfo.ucr.edu> Here is a simple shell loop to run needle or water in all-against-all mode. It expects the sequences in separate files which can easily be done with: seqret my_fasta fasta::test -ossingle The actual shell loop looks like this: for i in *.fasta; do for j in *.fasta; do needle $i $j stdout -gapopen 10.0 -gapextend 0.5 >> my_needle_file; done; done; This commands loops over all *.fasta files in the current directory and appends the results to the output file 'my_needle_file'. Thomas On Fri 11/18/05 16:29, Jon Ison wrote: > Hi Zhiqiang Ye > > Have a look at the "allversusall" program in the EMBASSY "DOMALIGN" package: > > http://emboss.sourceforge.net/apps/allversusall.html > > It's beta software so go steady. If it doesn't do exactly what you want > I'll gladly adapt it for you. Let us know how you get on. > > Cheers > > Jon > > > > Hi, all > > I want to do all-to-all pairwise comparison frequently. I have a > > fasta file "total.fasta" containing many sequences, I want to get the > > their pairwise comparison identities. I don't want to split it to > > single fasta files and then needle them to the "total.fasta" since I > > have to do this frequently. Could needle or water be used for > > all-to-all alignment directly? Just like blast. > > > > Thank you very much. > > > > -- > > Zhiqiang Ye > > PHD candidate > > College of Lifesciences, Center for Bioinformatics > > Peking University, Beijing. > > > > _______________________________________________ > > EMBOSS mailing list > > EMBOSS at emboss.open-bio.org > > http://newportal.open-bio.org/mailman/listinfo/emboss > > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > -- Thomas Girke 1008 Noel T. Keen Hall Center for Plant Cell Biology (CEPCEB) University of California Riverside, CA 92521 E-mail: thomas.girke at ucr.edu Ph: 951-827-2469 Fax: 951-827-4437 From thomasok at mail.nih.gov Fri Nov 18 18:56:11 2005 From: thomasok at mail.nih.gov (Dunn-Thomason, Kristen (NIH/CIT)) Date: Fri, 18 Nov 2005 13:56:11 -0500 Subject: [EMBOSS] Seeking instructors for EMBOSS training Message-ID: <4BDB66B394E7784F85ACA43EE36EED290BD99A02@NIHCESMLBX.nih.gov> I run a training program for the National Institutes of Health in Bethesda, MD, USA, and I'm trying to find a source of training for EMBOSS. We'd like a class to cover: - the range of Emboss programs - general info about how to use, how to get help, inputs/outputs etc. - details about use of some common programs - a couple of more complex problems Ideally, we'd like the course to focus on the command-line usage and Luke McCarthy's web interface, which is the one we implement here. But I understand that this latter part may be hard to get. If anyone teaches a class or knows of anyone who does, I'd very much like to talk with you. Thanks so much. Kristen Dunn-Thomason Chief, CIT Computer Training Section Division of Customer Support National Institutes of Health, HHS 301-594-2423 x283 http://training.cit.nih.gov From jison at ebi.ac.uk Mon Nov 21 11:18:42 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Mon, 21 Nov 2005 11:18:42 -0000 (GMT) Subject: [EMBOSS] Seeking instructors for EMBOSS training In-Reply-To: <4BDB66B394E7784F85ACA43EE36EED290BD99A02@NIHCESMLBX.nih.gov> References: <4BDB66B394E7784F85ACA43EE36EED290BD99A02@NIHCESMLBX.nih.gov> Message-ID: <43278.172.31.8.12.1132571922.squirrel@webmail.ebi.ac.uk> Hi Kristen Lisa Mullan (cc'd) was responsible for user-level training of EMBOSS when we were based at the RFCGR. She's now doing other things but should be able to advise on the practicalities of running a course. There's a tutorial that might be suitable: Introduction to Sequence Analysis using EMBOSS (tutorial) http://emboss.sourceforge.net/docs/emboss_tutorial/ See also: General info. on running programs, EMBOSS themes etc http://emboss.sourceforge.net/docs/ Lists of applications http://emboss.sourceforge.net/apps/ In case you use the on-line documentation to put a course together, our new website will be launched in the next few weeks with improved and easy-to-navigate content. Cheers Jon > I run a training program for the National Institutes of Health in > Bethesda, MD, USA, and I'm trying to find a source of training for > EMBOSS. We'd like a class to cover: > > - the range of Emboss programs > > - general info about how to use, how to get help, inputs/outputs etc. > > - details about use of some common programs > > - a couple of more complex problems > > > > Ideally, we'd like the course to focus on the command-line usage and > Luke McCarthy's web interface, which is the one we implement here. But I > understand that this latter part may be hard to get. > > > > If anyone teaches a class or knows of anyone who does, I'd very much > like to talk with you. > > > > Thanks so much. > > > > Kristen Dunn-Thomason > > Chief, CIT Computer Training Section > Division of Customer Support > National Institutes of Health, HHS > 301-594-2423 x283 > http://training.cit.nih.gov > > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From pmr at ebi.ac.uk Mon Nov 21 12:22:17 2005 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 21 Nov 2005 12:22:17 +0000 Subject: [EMBOSS] Seeking instructors for EMBOSS training In-Reply-To: <4BDB66B394E7784F85ACA43EE36EED290BD99A02@NIHCESMLBX.nih.gov> References: <4BDB66B394E7784F85ACA43EE36EED290BD99A02@NIHCESMLBX.nih.gov> Message-ID: <4381BBF9.1060204@ebi.ac.uk> Hi Kristen, Dunn-Thomason, Kristen (NIH/CIT) wrote: > I run a training program for the National Institutes of Health in > Bethesda, MD, USA, and I'm trying to find a source of training for > EMBOSS. We'd like a class to cover: > > - the range of Emboss programs > > - general info about how to use, how to get help, inputs/outputs etc. > > - details about use of some common programs > > - a couple of more complex problems As Jon Ison says, we're very happy to help, and the improved website will be launched soon (same address as before). We welcome any suggestions of content to help anyone running courses. We can even be available to teach (particularly developer courses, but also for users) if someone funds our travel. Lisa and I were in the USA last year for a course. We can also help from afar - "more complex problems" are particularly interesting - we would like to see examples of problems used in courses so that we can try not to break them (for example, by providing a simple solution :-) Similarly, we can include the simple examples in our QA testing to provide notification if the inputs, options or results are changed in a new release. Hope that helps a few folk out there, Peter From lisa at ebi.ac.uk Mon Nov 21 17:37:58 2005 From: lisa at ebi.ac.uk (Lisa Mullan) Date: Mon, 21 Nov 2005 17:37:58 -0000 Subject: [EMBOSS] Seeking instructors for EMBOSS training In-Reply-To: <43278.172.31.8.12.1132571922.squirrel@webmail.ebi.ac.uk> Message-ID: <00d201c5eec2$54833c00$734416ac@windows.ebi.ac.uk> Ta Jon, Have emailed her offering my services - as long as she doesn't require them before Christmas! Lisa Lisa Mullan European Bioinformatics Institute Wellcome Trust Genome Campus Hinxton Cambridge CB10 1SD Tel: +44 (0)1223 494448 Fax: +44 (0)1223 494468 Email: lisa at ebi.ac.uk > -----Original Message----- > From: Jon Ison [mailto:jison at ebi.ac.uk] > Sent: 21 November 2005 11:19 > To: Dunn-Thomason, Kristen (NIH/CIT) > Cc: EMBOSS at emboss.open-bio.org; lisa at ebi.ac.uk > Subject: Re: [EMBOSS] Seeking instructors for EMBOSS training > > > Hi Kristen > > Lisa Mullan (cc'd) was responsible for user-level training of EMBOSS > when we were based at the RFCGR. She's now doing other things but > should be able to advise on the practicalities of running a course. > > There's a tutorial that might be suitable: > > Introduction to Sequence Analysis using EMBOSS (tutorial) > http://emboss.sourceforge.net/docs/emboss_tutorial/ > > > See also: > > General info. on running programs, EMBOSS themes etc > http://emboss.sourceforge.net/docs/ > > Lists of applications > http://emboss.sourceforge.net/apps/ > > > In case you use the on-line documentation to put a course together, > our new website will be launched in the next few weeks with improved > and easy-to-navigate content. > > Cheers > > Jon > > > > > > > I run a training program for the National Institutes of Health in > > Bethesda, MD, USA, and I'm trying to find a source of training for > > EMBOSS. We'd like a class to cover: > > > > - the range of Emboss programs > > > > - general info about how to use, how to get help, inputs/outputs etc. > > > > - details about use of some common programs > > > > - a couple of more complex problems > > > > > > > > Ideally, we'd like the course to focus on the command-line usage and > > Luke McCarthy's web interface, which is the one we implement here. But I > > understand that this latter part may be hard to get. > > > > > > > > If anyone teaches a class or knows of anyone who does, I'd very much > > like to talk with you. > > > > > > > > Thanks so much. > > > > > > > > Kristen Dunn-Thomason > > > > Chief, CIT Computer Training Section > > Division of Customer Support > > National Institutes of Health, HHS > > 301-594-2423 x283 > > http://training.cit.nih.gov > > > > > > > > > > _______________________________________________ > > EMBOSS mailing list > > EMBOSS at emboss.open-bio.org > > http://newportal.open-bio.org/mailman/listinfo/emboss > > > From maoj at mail.nih.gov Mon Nov 21 20:00:50 2005 From: maoj at mail.nih.gov (Mao, Jean (NIH/CIT)) Date: Mon, 21 Nov 2005 15:00:50 -0500 Subject: [EMBOSS] Problem with dbifasta Message-ID: <71B0C9CB1FF4EA43BB48C08DCFF1A1FF03D3FDEE@NIHCESMLBX.nih.gov> Hi, I have a problem and hopefully someone can help me solve the mistery. I have downloaded emboss 3.0 and create the emboss indexes of several FASTA formated databases downloaded from NCBI using 'dbifasta'. I found some entries can not be retrieved using seqret unless some 'trick' is used. For example, In the month.aa.fas file from NCBI, there is an entry called 'ABB51209.1'. After dbifasta, I ran 'seqret' and search for monthaa:ABB51209, then I got error. If I search for monthaa:ABB51209.1, then I found this entry. If I search 'ABB51209' at ncbi.nih.gov and specify protein database, then this entry came out with accession number ABB51209, with no '.1' at the tail. Thank you very much in advance. From jison at ebi.ac.uk Fri Nov 25 12:34:56 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Fri, 25 Nov 2005 12:34:56 -0000 (GMT) Subject: [EMBOSS] Problem with dbifasta In-Reply-To: <71B0C9CB1FF4EA43BB48C08DCFF1A1FF03D3FDEE@NIHCESMLBX.nih.gov> References: <71B0C9CB1FF4EA43BB48C08DCFF1A1FF03D3FDEE@NIHCESMLBX.nih.gov> Message-ID: <49789.172.31.70.94.1132922096.squirrel@webmail.ebi.ac.uk> Dear Jean "ABB51209.1" is the sequence version number. "ABB51209" is the sequence accession number. NCBI will retrieve sequences using either. dbifasta indexes the accession (and also ID) only by default. To index the sequence version (and also gi number), specify -fields "sv" when you run dbifasta and add the field: "sv" to the database definition. To index both you might need to use -fields "sv,acc" Please check what you did against the notes above and get back if you still have problems. Cheers Jon > Hi, I have a problem and hopefully someone can help me solve the > mistery. > > I have downloaded emboss 3.0 and create the emboss indexes of several > FASTA formated databases downloaded from NCBI using 'dbifasta'. > > I found some entries can not be retrieved using seqret unless some > 'trick' is used. For example, > > In the month.aa.fas file from NCBI, there is an entry called > 'ABB51209.1'. After dbifasta, I ran 'seqret' and search for > monthaa:ABB51209, then I got error. If I search for monthaa:ABB51209.1, > then I found this entry. If I search 'ABB51209' at ncbi.nih.gov and > specify protein database, then this entry came out with accession number > ABB51209, with no '.1' at the tail. > > Thank you very much in advance. > > _______________________________________________ > EMBOSS mailing list > EMBOSS at emboss.open-bio.org > http://newportal.open-bio.org/mailman/listinfo/emboss > From janenerz at web.de Tue Nov 29 12:42:24 2005 From: janenerz at web.de (Christiane Nerz) Date: Tue, 29 Nov 2005 13:42:24 +0100 Subject: [EMBOSS] error while loading shared libraries Message-ID: <438C4CB0.5090005@web.de> Hi all. I am new to EMBOSS. I have installed it and ./configure - make - make install were executed without problems. But if I want to start an EMBOSS programm I always got the same answer: "error while loading shared libraries: libnucleus.so.3: cannot open shared object file: No such file or directory" I'm a LINUX-newbie too, so maybe the question has nothing to do with EMBOSS itself? I'm working with Suse 10. I just googled to see if someone else have had the same problem - I found a message, but can't find any answers to it. Is it possible to search old mailing-list-threads for a given subject? Thanks in advance for help! regards Jane From ajb at ebi.ac.uk Tue Nov 29 13:04:40 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Tue, 29 Nov 2005 13:04:40 -0000 (GMT) Subject: [EMBOSS] error while loading shared libraries In-Reply-To: <438C4CB0.5090005@web.de> References: <438C4CB0.5090005@web.de> Message-ID: <36368.81.96.70.96.1133269480.squirrel@webmail.ebi.ac.uk> Dear Christiane, It ought to be able to find the libraries if you've set the PATH correctly. Let's say that you configured EMBOSS with: ./configure --prefix=/usr/local/emboss Then you will need to set your PATH to include /usr/local/emboss/bin a) bash: export PATH="$PATH /usr/local/emboss/bin" b) (t)csh set path=($path /usr/local/emboss/bin) rehash If that doesn't work then, with SuSE you could add the following line to /etc/ld.so.conf /usr/local/emboss/lib and then type "ldconfig" HTH Alan Bleasby EBI From ajb at ebi.ac.uk Tue Nov 29 13:18:33 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Tue, 29 Nov 2005 13:18:33 -0000 (GMT) Subject: [EMBOSS] error while loading shared libraries In-Reply-To: <36368.81.96.70.96.1133269480.squirrel@webmail.ebi.ac.uk> References: <438C4CB0.5090005@web.de> <36368.81.96.70.96.1133269480.squirrel@webmail.ebi.ac.uk> Message-ID: <40806.81.96.70.96.1133270313.squirrel@webmail.ebi.ac.uk> Typo: > a) bash: > export PATH="$PATH /usr/local/emboss/bin" It should, of course, have been: export PATH="$PATH:/usr/local/emboss/bin" Alan From jison at ebi.ac.uk Tue Nov 29 14:19:59 2005 From: jison at ebi.ac.uk (Jon Ison) Date: Tue, 29 Nov 2005 14:19:59 -0000 (GMT) Subject: [EMBOSS] error while loading shared libraries In-Reply-To: <438C4CB0.5090005@web.de> References: <438C4CB0.5090005@web.de> Message-ID: <49346.172.31.70.94.1133273999.squirrel@webmail.ebi.ac.uk> > Is it possible to search old mailing-list-threads for a given subject? This will be possible in our new website which we'll be launching soon. Cheers Jon From golharam at umdnj.edu Tue Nov 29 15:23:08 2005 From: golharam at umdnj.edu (Ryan Golhar) Date: Tue, 29 Nov 2005 10:23:08 -0500 Subject: [EMBOSS] error while loading shared libraries In-Reply-To: <438C4CB0.5090005@web.de> Message-ID: <059001c5f4f8$cd49cdc0$5022db82@GOLHARMOBILE1> This is happening because libnucleus.so.3 cannot be found. The directory it is located in needs to be in your /etc/ld.so.conf, or you need to set your LD_LIBRARY_PATH to contain it. -----Original Message----- From: emboss-bounces at emboss.open-bio.org [mailto:emboss-bounces at emboss.open-bio.org] On Behalf Of Christiane Nerz Sent: Tuesday, November 29, 2005 7:42 AM To: emboss at emboss.open-bio.org Subject: [EMBOSS] error while loading shared libraries Hi all. I am new to EMBOSS. I have installed it and ./configure - make - make install were executed without problems. But if I want to start an EMBOSS programm I always got the same answer: "error while loading shared libraries: libnucleus.so.3: cannot open shared object file: No such file or directory" I'm a LINUX-newbie too, so maybe the question has nothing to do with EMBOSS itself? I'm working with Suse 10. I just googled to see if someone else have had the same problem - I found a message, but can't find any answers to it. Is it possible to search old mailing-list-threads for a given subject? Thanks in advance for help! regards Jane _______________________________________________ EMBOSS mailing list EMBOSS at emboss.open-bio.org http://newportal.open-bio.org/mailman/listinfo/emboss From golharam at umdnj.edu Tue Nov 29 16:31:17 2005 From: golharam at umdnj.edu (Ryan Golhar) Date: Tue, 29 Nov 2005 11:31:17 -0500 Subject: [EMBOSS] Opinions on Web Access to EMBOSS Message-ID: <059f01c5f502$52c132a0$5022db82@GOLHARMOBILE1> Hi all, We are in the process of migrating our users from GCG to EMBOSS, specifically from SeqWeb to EMBOSS-Explorer. I've noticed a lot of installations from Google for EMBOSS-Explorer. I also noticed some people leave their installations open for anyone to use, and others have restricted access. I'd like to ask people to comment on why they choose to restrict access to their installation. For those of you who haven't restricted access, have you noticed any overuse to of your installation? Ryan -- Ryan Golhar - golharam at umdnj.edu The Informatics Institute of UMDNJ From staylor at molbiol.ox.ac.uk Wed Nov 30 10:13:42 2005 From: staylor at molbiol.ox.ac.uk (Steve Taylor) Date: Wed, 30 Nov 2005 10:13:42 +0000 Subject: [EMBOSS] Opinions on Web Access to EMBOSS In-Reply-To: <059f01c5f502$52c132a0$5022db82@GOLHARMOBILE1> References: <059f01c5f502$52c132a0$5022db82@GOLHARMOBILE1> Message-ID: <438D7B56.9030903@molbiol.ox.ac.uk> Hi, > > We are in the process of migrating our users from GCG to EMBOSS, > specifically from SeqWeb to EMBOSS-Explorer. > > I've noticed a lot of installations from Google for EMBOSS-Explorer. I > also noticed some people leave their installations open for anyone to > use, and others have restricted access. > > I'd like to ask people to comment on why they choose to restrict access > to their installation. We used to run open web access several years ago and we did get some jobs that ran for a long time and took up a lot of CPU. In some cases these made our web server grind to a halt. So I guess this may happen with EMBOSS-Explorer if, for example, a large phylogeny job was run. These processes often get started by users not understanding the parameters and inputs they are using, rather than being malicious. Also we run a bioinformatics service and we need to track which users are using the system. We support hundreds of users and we can spot problems and advise them more easily by looking at the logs if we get them to log in with a username/password. Regards, Steve From mathog at mendel.bio.caltech.edu Wed Nov 30 21:59:36 2005 From: mathog at mendel.bio.caltech.edu (David Mathog) Date: Wed, 30 Nov 2005 13:59:36 -0800 Subject: [EMBOSS] libpng problems on Solaris 8, png.h version versus png.c version Message-ID: Built 3.0.0 today on solaris 8 with gcc 3.4.2. Near as I can tell the only libpng present is SMClpng from sunfreeware, version 1.2.4. Yet when the graphics applications run and try to create a PNG file it blows up with: libpng warning: Application was compiled with png.h from libpng-1.0.11 libpng warning: Appication is running with png.c from libpng-1.2.4 gd-png: fatal libpng error: Incompatible libpng version in application and library. The only png.h on the system in places where EMBOSS should find it is from the aforementioned package and I checked, they are all version 1.2.4. I checked that the binary wasn't left over from a previous EMBOSS build. I searched high and low for other png.h and found nothing. There was one other png.h in a GCG include directory but EMBOSS shouldn't see that (/opt/gcg/gcgsource/include/png.h), and in any case, it wasn't version 1.0.11. Any other ideas where the "wrong" png.h might be coming from? I'm guessing plplot. These were run with ./configure --with-png if that matters. Thanks, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From ajb at ebi.ac.uk Wed Nov 30 23:28:42 2005 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Wed, 30 Nov 2005 23:28:42 -0000 (GMT) Subject: [EMBOSS] libpng problems on Solaris 8, png.h version versus png.c version In-Reply-To: References: Message-ID: <60718.81.96.70.96.1133393322.squirrel@webmail.ebi.ac.uk> That error usually suggests that your libgd was compiled using an older version of PNG i.e. your current PNG is up to date but your GD isn't. HTH Alan From mathog at mendel.bio.caltech.edu Wed Nov 30 23:50:14 2005 From: mathog at mendel.bio.caltech.edu (David Mathog) Date: Wed, 30 Nov 2005 15:50:14 -0800 Subject: [EMBOSS] libpng problems on Solaris 8, png.h version versus png.c version Message-ID: > That error usually suggests that your libgd was compiled using an older > version of PNG i.e. your current PNG is up to date but your GD isn't. Yeah, I finally tracked it down to that. Updated and rebuilt freetype (to 2.1.10) and then gd (to 2.0.33). Now trying to rebuild EMBOSS 3.0.0. Unfortunately make clean doesn't, leaving all sorts of .Plo and .Po files around. After deleting all of those manually it seemed to work and then blew up in the jemboss build on an html requirement, of all things. Also it seems not to have included any png stuff at all this time. png isn't present on the list of graphics devices and I didn't see any -lgd or -lpng flashing by. Other than downloading all of the source files from scratch how does one obtain a completely clean rebuild??? Thanks, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech