[EMBOSS] use water/matcher to find where RNA bybridizes
pmr at ebi.ac.uk
pmr at ebi.ac.uk
Thu Jun 2 13:23:13 EDT 2005
Guy Bottu writes:
> One of our users had a problem : how to find the location where a small
> molecule of RNA binds to a mRNA and so interferes with its functioning.
> Nothing in EMBOSS and nothing found on the WWW. We finally did the
> following : use revseq -nocomp to reverse the mRNA and then align the two
> sequences using as matrix :
> -------------------------------
> A T G C S W R Y K M B V H D N U
> A 0 5 0 0 0 5 5 0 0 5 0 5 5 5 5 0
> T 5 0 5 0 0 5 0 5 5 0 5 0 5 5 5 5
..........
> -------------------------------
> This gave a reasonable result. water made the following alignment :
> ------------------------------
.....
> mRNA 2892 AATGTTGTGTGAGGATAATAGTAATAGTAATAGTAATAATAATAATAAT
> 2940
> .. . . .... ... .. .. .. .. .. ................
> RNAi 1 TTTGACCCTGCTACTACTACTACTACTACTACGATTATTATTATTATTA 49
> --------------------------------
> The only thing which bothers me is that the base pairs (which do have a
> positive comparison score) are not labeled as "similar", they get a '.'
> instead of a ':'. Does someone know why this is ?
I believe this is simply because the bases are not identical. A user
matrix can have arbitrary values, so the results are marked as similar
(A=T scores 5) but identities are only scored at zero and so never appear
with ":".
You could try setting the scores to match the hydrogen bonds for this
experiment (G=C 3 A=T 2 G=T 1)
RNA folding is a missing area in EMBOSS. The Vienna package has been
suggested as a possible EMBASSY package. Does anyone have any experience
with it, or suggestions for alternative RNA packages we could use?
regards,
Peter
More information about the EMBOSS
mailing list