From dave.burt at bbsrc.ac.uk Mon Oct 4 05:23:36 2004 From: dave.burt at bbsrc.ac.uk (dave burt (RI)) Date: Mon, 4 Oct 2004 10:23:36 +0100 Subject: [EMBOSS] building Emboss under cygwin Message-ID: <84DA9D8AC9B05F4B889E7C70238CB45101013F0E@rie2ksrv1.ri.bbsrc.ac.uk> Hi Alan et al I have finally re-installed cygwing etc as Alan suggested and all works well at the time I thought this was drastic (deleting cygwin, remove from registry, re-install cygwin etc) but is works fine on my PC running windows XP using latest version of cygwin and emboss v 2.9 Dave -----Original Message----- From: Alan Bleasby [mailto:ableasby at hgmp.mrc.ac.uk] Sent: 14 September 2004 16:26 To: augereau at bacchus.montp.inserm.fr; emboss at hgmp.mrc.ac.uk Subject: Re: [EMBOSS] building Emboss under cygwin Others may be able to give more specific help regarding individual packages that may need updating. If you completely delete cygwin and reinstall the latest version then it will work. The errors refer to changes made to both cygwin and EMBOSS to enable production of shared libraries on that system. If you want to experiment I'd look in the gcc/ld(bintools)/make area. HTH Alan Bleasby From aengus.stewart at cancer.org.uk Fri Oct 8 06:29:58 2004 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Fri, 08 Oct 2004 11:29:58 +0100 Subject: [EMBOSS] dbi* Message-ID: <41666C26.1020303@cancer.org.uk> Hi, I have just had a thought about the dbi programs..... Is it possible to get them to report how many records they have processed? I tried -verbose but it didnt help. Its just I would like to track the growth of the data libraries, sad I know. Regards Aengus -- ----------------------------------------------------------------------- Aengus Stewart Group Leader Bioinformatics at CGAL Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ----------------------------------------------------------------------- This electronic message contains information which may be privileged and confidential. The information is intended to be for the use of the individual(s) or entity named above. If you are not the intended recipient, be aware that any disclosure, copying, distribution or use of the contents of this information is prohibited. If you have received this electronic message in error, please notify me by telephone or email (to the number or address above) immediately. From sbassi at gmail.com Fri Oct 8 07:48:30 2004 From: sbassi at gmail.com (Sebastian Bassi) Date: Fri, 8 Oct 2004 08:48:30 -0300 Subject: [EMBOSS] Bioinformatics mailing list Message-ID: GenesDigitales presents 2 new bioinformatics mailing list. Bioinfo is the name of a new mailing list hosted at DNALinux.com. This will be a place to ask for help and give a helping hand regarding bioinformatics. Topics included are: sequence analisis, software, aligment, primer design, microarrays, and much more. If you work with bioinformatics tools you are invited to join Bioinfo mailing list. The other list is called BioinfoES has the same aims as above but it is for Spanish speaking people. English-only bioinformatics mailing list: Bionfo (http://dnalinux.com/mailman/listinfo/bioinfo_dnalinux.com) Spanish bioinformatics mailing list: BioinfoES (http://dnalinux.com/mailman/listinfo/bioinfoes_dnalinux.com) From augereau at u540.montp.inserm.fr Fri Oct 8 07:49:18 2004 From: augereau at u540.montp.inserm.fr (Patrick Augereau) Date: Fri, 08 Oct 2004 13:49:18 +0200 Subject: [EMBOSS] building Emboss under cygwin In-Reply-To: <84DA9D8AC9B05F4B889E7C70238CB45101013F0E@rie2ksrv1.ri.bbsrc.ac.uk> References: <84DA9D8AC9B05F4B889E7C70238CB45101013F0E@rie2ksrv1.ri.bbsrc.ac.uk> Message-ID: <41667EBE.70905@u540.montp.inserm.fr> dave burt (RI) a ?crit : > I have finally re-installed cygwing etc as Alan suggested and all works well > > at the time I thought this was drastic (deleting cygwin, remove from registry, re-install cygwin etc) > > but is works fine on my PC running windows XP using latest version of cygwin and emboss v 2.9 I succeeded as well; on reinstalling cygwin, I included all the library to be sure to have everything that was needed. I am running Win2k SP4, the latest cygwin version and emboss-2.9.0. Now, I will try having jemboss running. Is there any peculiarity in doing so ? Patrick. > > Dave > > -----Original Message----- > From: Alan Bleasby [mailto:ableasby at hgmp.mrc.ac.uk] > Sent: 14 September 2004 16:26 > To: augereau at bacchus.montp.inserm.fr; emboss at hgmp.mrc.ac.uk > Subject: Re: [EMBOSS] building Emboss under cygwin > > > Others may be able to give more specific help regarding > individual packages that may need updating. If you > completely delete cygwin and reinstall the latest version > then it will work. The errors refer to changes made to > both cygwin and EMBOSS to enable production of shared > libraries on that system. If you want to experiment I'd > look in the gcc/ld(bintools)/make area. > > HTH > > Alan Bleasby > -- Patrick Augereau Inserm U540 tel: 33 (0)4 67 04 37 13 fax: 33 (0)4 67 54 05 98 From smarkel at scitegic.com Mon Oct 11 18:59:27 2004 From: smarkel at scitegic.com (Scott Markel) Date: Mon, 11 Oct 2004 15:59:27 -0700 Subject: [EMBOSS] garnier core dumps if protein sequence is <= 10 amino acids long Message-ID: <416B104F.2080205@scitegic.com> I'm running EMBOSS 2.9.0 under cygwin on Windows XP. garnier core dumps if the protein sequence is less than 11 amino acids long. EMBOSSwin (2.7.1-Win-0.6) exhibits the same behavior. Is this known behavior? The web documentation page doesn't indicate either a length limit or an error message. Scott -- Scott Markel, Ph.D. Principal Bioinformatics Architect email: smarkel at scitegic.com SciTegic Inc. mobile: +1 858 205 3653 9665 Chesapeake Drive, Suite 401 voice: +1 858 279 8800, ext. 253 San Diego, CA 92123 fax: +1 858 279 8804 USA web: http://www.scitegic.com From francis at bii.a-star.edu.sg Mon Oct 25 05:59:07 2004 From: francis at bii.a-star.edu.sg (Francis Tang) Date: Mon, 25 Oct 2004 17:59:07 +0800 Subject: [EMBOSS] A bug in einverted? Message-ID: <417CCE6B.8080102@bii.a-star.edu.sg> Dear EMBOSS users, I believe I have found a bug in einverted - at least in the tfm documentation. In "tfm einverted", under section "Notes", there is the statement "(Anything can be considered to be a repeat if you set the score threshold low enough!)" I don't think that this is true. For example: Here's a sample sequence, stored as pkb00003.fasta : >pkb00003 Pseudobase #3 AAAAAACGGGAAGCAAGGGGCUCAAGGGAGGCCCCAGAAACAAACUUUCCCGAU Here's a transcript of a session where I choose a gap penalty of 3: $ einverted pkb00003.fasta -stdout -auto -gap 3 -mat 3 -mis -5 -thresh 10 Score 18: 8/8 (100%) matches, 2 gaps 6 a-cggg-aag 13 | |||| ||| 54 tagccctttc 45 However, when I set the gap penalty to 2, I seem to lose the previous palindrome: $ einverted pkb00003.fasta -stdout -auto -gap 2 -mat 3 -mis -5 -thresh 10 Score 19: 7/7 (100%) matches, 1 gaps 17 gggg-ctc 23 |||| ||| 35 ccccggag 28 Score 14: 8/8 (100%) matches, 5 gaps 14 -caa-gggg-ctc 23 | |||| ||| 38 ag--accccggag 28 The other palindrome should have been found because by reducing the gap penalty, it would only increase the scores of existing palindromes. Has anyone else noticed this before? Should this be reported as a bug? BTW, I am using EMBOSS 2.8.0 distribution compiled from source on Fedora Core 2. Thanks. Francis. -- Francis TANG, Post-Doctoral Research Fellow Bioinformatics Institute, BMSI, A-STAR, Singapore. Tel: +65 64788282 Fax: +65 64789048 Email: francis at bii.a-star.edu.sg Add: Matrix L7, Biopolis WWW: http://www.bii.a-star.edu.sg/~francis/ From mad at biol.unlp.edu.ar Mon Oct 25 11:41:28 2004 From: mad at biol.unlp.edu.ar (Martin Sarachu) Date: Mon, 25 Oct 2004 12:41:28 -0300 Subject: [EMBOSS] wrappers4EMBOSS-1.0 released Message-ID: <1098718888.417d1ea8b3186@nahuel.biol.unlp.edu.ar> We are glad to announce the release of version 1.0 of wrappers4EMBOSS. wrappers4EMBOSS provides EMBOSS interfaces for fastA, BLAST, Clustal, bscan, psscan & pfmake. wrappers4EMBOSS is available at http://www.wemboss.org Download from http://www.wemboss.org/Folder.2003-09-11.4050/Folder.2003-09-11.4318C/wrappers4EMBOSS-1.0.tar.gz This is a joint effort between BEN and AR.EMBnet From cavallo at biochem.ucl.ac.uk Wed Oct 27 05:37:45 2004 From: cavallo at biochem.ucl.ac.uk (Antonio Cavallo) Date: Wed, 27 Oct 2004 09:37:45 +0000 Subject: [EMBOSS] dbiflat bug? Message-ID: Hi, I've been using embos dbiflat to index the EMBL data base. After creating the index with dbiflat using the following command: dbiflat -directory `pwd` -filenames '*.dat' -dbname 'embl' -release '80' -idformat EMBL -date '26/10/04' and setup the embossrc file I've used seqret to retrive an entry: entret -sequence embl:x08058 Unfortunately it returns another entry (cr197958) that has nothing to do with the entry I want. Am I doing anything worng here? Is that any known bug I should be aware of? best regards, antonio cavallo From dave.burt at bbsrc.ac.uk Mon Oct 4 09:23:36 2004 From: dave.burt at bbsrc.ac.uk (dave burt (RI)) Date: Mon, 4 Oct 2004 10:23:36 +0100 Subject: [EMBOSS] building Emboss under cygwin Message-ID: <84DA9D8AC9B05F4B889E7C70238CB45101013F0E@rie2ksrv1.ri.bbsrc.ac.uk> Hi Alan et al I have finally re-installed cygwing etc as Alan suggested and all works well at the time I thought this was drastic (deleting cygwin, remove from registry, re-install cygwin etc) but is works fine on my PC running windows XP using latest version of cygwin and emboss v 2.9 Dave -----Original Message----- From: Alan Bleasby [mailto:ableasby at hgmp.mrc.ac.uk] Sent: 14 September 2004 16:26 To: augereau at bacchus.montp.inserm.fr; emboss at hgmp.mrc.ac.uk Subject: Re: [EMBOSS] building Emboss under cygwin Others may be able to give more specific help regarding individual packages that may need updating. If you completely delete cygwin and reinstall the latest version then it will work. The errors refer to changes made to both cygwin and EMBOSS to enable production of shared libraries on that system. If you want to experiment I'd look in the gcc/ld(bintools)/make area. HTH Alan Bleasby From aengus.stewart at cancer.org.uk Fri Oct 8 10:29:58 2004 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Fri, 08 Oct 2004 11:29:58 +0100 Subject: [EMBOSS] dbi* Message-ID: <41666C26.1020303@cancer.org.uk> Hi, I have just had a thought about the dbi programs..... Is it possible to get them to report how many records they have processed? I tried -verbose but it didnt help. Its just I would like to track the growth of the data libraries, sad I know. Regards Aengus -- ----------------------------------------------------------------------- Aengus Stewart Group Leader Bioinformatics at CGAL Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ----------------------------------------------------------------------- This electronic message contains information which may be privileged and confidential. The information is intended to be for the use of the individual(s) or entity named above. If you are not the intended recipient, be aware that any disclosure, copying, distribution or use of the contents of this information is prohibited. If you have received this electronic message in error, please notify me by telephone or email (to the number or address above) immediately. From sbassi at gmail.com Fri Oct 8 11:48:30 2004 From: sbassi at gmail.com (Sebastian Bassi) Date: Fri, 8 Oct 2004 08:48:30 -0300 Subject: [EMBOSS] Bioinformatics mailing list Message-ID: GenesDigitales presents 2 new bioinformatics mailing list. Bioinfo is the name of a new mailing list hosted at DNALinux.com. This will be a place to ask for help and give a helping hand regarding bioinformatics. Topics included are: sequence analisis, software, aligment, primer design, microarrays, and much more. If you work with bioinformatics tools you are invited to join Bioinfo mailing list. The other list is called BioinfoES has the same aims as above but it is for Spanish speaking people. English-only bioinformatics mailing list: Bionfo (http://dnalinux.com/mailman/listinfo/bioinfo_dnalinux.com) Spanish bioinformatics mailing list: BioinfoES (http://dnalinux.com/mailman/listinfo/bioinfoes_dnalinux.com) From augereau at u540.montp.inserm.fr Fri Oct 8 11:49:18 2004 From: augereau at u540.montp.inserm.fr (Patrick Augereau) Date: Fri, 08 Oct 2004 13:49:18 +0200 Subject: [EMBOSS] building Emboss under cygwin In-Reply-To: <84DA9D8AC9B05F4B889E7C70238CB45101013F0E@rie2ksrv1.ri.bbsrc.ac.uk> References: <84DA9D8AC9B05F4B889E7C70238CB45101013F0E@rie2ksrv1.ri.bbsrc.ac.uk> Message-ID: <41667EBE.70905@u540.montp.inserm.fr> dave burt (RI) a ?crit : > I have finally re-installed cygwing etc as Alan suggested and all works well > > at the time I thought this was drastic (deleting cygwin, remove from registry, re-install cygwin etc) > > but is works fine on my PC running windows XP using latest version of cygwin and emboss v 2.9 I succeeded as well; on reinstalling cygwin, I included all the library to be sure to have everything that was needed. I am running Win2k SP4, the latest cygwin version and emboss-2.9.0. Now, I will try having jemboss running. Is there any peculiarity in doing so ? Patrick. > > Dave > > -----Original Message----- > From: Alan Bleasby [mailto:ableasby at hgmp.mrc.ac.uk] > Sent: 14 September 2004 16:26 > To: augereau at bacchus.montp.inserm.fr; emboss at hgmp.mrc.ac.uk > Subject: Re: [EMBOSS] building Emboss under cygwin > > > Others may be able to give more specific help regarding > individual packages that may need updating. If you > completely delete cygwin and reinstall the latest version > then it will work. The errors refer to changes made to > both cygwin and EMBOSS to enable production of shared > libraries on that system. If you want to experiment I'd > look in the gcc/ld(bintools)/make area. > > HTH > > Alan Bleasby > -- Patrick Augereau Inserm U540 tel: 33 (0)4 67 04 37 13 fax: 33 (0)4 67 54 05 98 From smarkel at scitegic.com Mon Oct 11 22:59:27 2004 From: smarkel at scitegic.com (Scott Markel) Date: Mon, 11 Oct 2004 15:59:27 -0700 Subject: [EMBOSS] garnier core dumps if protein sequence is <= 10 amino acids long Message-ID: <416B104F.2080205@scitegic.com> I'm running EMBOSS 2.9.0 under cygwin on Windows XP. garnier core dumps if the protein sequence is less than 11 amino acids long. EMBOSSwin (2.7.1-Win-0.6) exhibits the same behavior. Is this known behavior? The web documentation page doesn't indicate either a length limit or an error message. Scott -- Scott Markel, Ph.D. Principal Bioinformatics Architect email: smarkel at scitegic.com SciTegic Inc. mobile: +1 858 205 3653 9665 Chesapeake Drive, Suite 401 voice: +1 858 279 8800, ext. 253 San Diego, CA 92123 fax: +1 858 279 8804 USA web: http://www.scitegic.com From francis at bii.a-star.edu.sg Mon Oct 25 09:59:07 2004 From: francis at bii.a-star.edu.sg (Francis Tang) Date: Mon, 25 Oct 2004 17:59:07 +0800 Subject: [EMBOSS] A bug in einverted? Message-ID: <417CCE6B.8080102@bii.a-star.edu.sg> Dear EMBOSS users, I believe I have found a bug in einverted - at least in the tfm documentation. In "tfm einverted", under section "Notes", there is the statement "(Anything can be considered to be a repeat if you set the score threshold low enough!)" I don't think that this is true. For example: Here's a sample sequence, stored as pkb00003.fasta : >pkb00003 Pseudobase #3 AAAAAACGGGAAGCAAGGGGCUCAAGGGAGGCCCCAGAAACAAACUUUCCCGAU Here's a transcript of a session where I choose a gap penalty of 3: $ einverted pkb00003.fasta -stdout -auto -gap 3 -mat 3 -mis -5 -thresh 10 Score 18: 8/8 (100%) matches, 2 gaps 6 a-cggg-aag 13 | |||| ||| 54 tagccctttc 45 However, when I set the gap penalty to 2, I seem to lose the previous palindrome: $ einverted pkb00003.fasta -stdout -auto -gap 2 -mat 3 -mis -5 -thresh 10 Score 19: 7/7 (100%) matches, 1 gaps 17 gggg-ctc 23 |||| ||| 35 ccccggag 28 Score 14: 8/8 (100%) matches, 5 gaps 14 -caa-gggg-ctc 23 | |||| ||| 38 ag--accccggag 28 The other palindrome should have been found because by reducing the gap penalty, it would only increase the scores of existing palindromes. Has anyone else noticed this before? Should this be reported as a bug? BTW, I am using EMBOSS 2.8.0 distribution compiled from source on Fedora Core 2. Thanks. Francis. -- Francis TANG, Post-Doctoral Research Fellow Bioinformatics Institute, BMSI, A-STAR, Singapore. Tel: +65 64788282 Fax: +65 64789048 Email: francis at bii.a-star.edu.sg Add: Matrix L7, Biopolis WWW: http://www.bii.a-star.edu.sg/~francis/ From mad at biol.unlp.edu.ar Mon Oct 25 15:41:28 2004 From: mad at biol.unlp.edu.ar (Martin Sarachu) Date: Mon, 25 Oct 2004 12:41:28 -0300 Subject: [EMBOSS] wrappers4EMBOSS-1.0 released Message-ID: <1098718888.417d1ea8b3186@nahuel.biol.unlp.edu.ar> We are glad to announce the release of version 1.0 of wrappers4EMBOSS. wrappers4EMBOSS provides EMBOSS interfaces for fastA, BLAST, Clustal, bscan, psscan & pfmake. wrappers4EMBOSS is available at http://www.wemboss.org Download from http://www.wemboss.org/Folder.2003-09-11.4050/Folder.2003-09-11.4318C/wrappers4EMBOSS-1.0.tar.gz This is a joint effort between BEN and AR.EMBnet From cavallo at biochem.ucl.ac.uk Wed Oct 27 09:37:45 2004 From: cavallo at biochem.ucl.ac.uk (Antonio Cavallo) Date: Wed, 27 Oct 2004 09:37:45 +0000 Subject: [EMBOSS] dbiflat bug? Message-ID: Hi, I've been using embos dbiflat to index the EMBL data base. After creating the index with dbiflat using the following command: dbiflat -directory `pwd` -filenames '*.dat' -dbname 'embl' -release '80' -idformat EMBL -date '26/10/04' and setup the embossrc file I've used seqret to retrive an entry: entret -sequence embl:x08058 Unfortunately it returns another entry (cr197958) that has nothing to do with the entry I want. Am I doing anything worng here? Is that any known bug I should be aware of? best regards, antonio cavallo