From jison at hgmp.mrc.ac.uk Mon Sep 1 06:33:16 2003 From: jison at hgmp.mrc.ac.uk (Dr J.C. Ison) Date: Mon, 01 Sep 2003 11:33:16 +0100 Subject: [EMBOSS] Where did the protein structure programs go? References: Message-ID: <3F53206C.C41B98B0@hgmp.mrc.ac.uk> Hi David Sorry - just back from hols ! They're in the EMBASSY package "domainatrix". Please note the caveat below. I'm in the process of making things more generic though and the new versions *will* be available as part of EMBOSS Cheers J. ** This program is part of a suite of EMBOSS applications that directly or ** indirectly make use of the protein structure databases pdb and scop. ** This program is part of an experimental analysis pipeline described in an ** accompanying document. We provide the software in the hope that it will ** be useful. The applications were designed for specific research purposes ** and may not be useful or reliable in contexts other than the described ** pipeline. The development of the suite was coordinated by Jon Ison to ** whom enquiries and bug reports should be sent (email jison at hgmp.mrc.ac.uk). David Martin wrote: > EMBOSS had some protein structure stuff in it. This all seems to have > disappeared? > > ..d > -- > David Martin PhD > Bioinformatics Scientific Officer > Post-Genomics and Molecular Interactions Centre > University of Dundee -- Jon C. Ison, PhD Bioinformatics Applications Group UK MRC Human Genome Mapping Project Resource Centre Hinxton, Cambridge, CB10 1SB, UK E-mail : jison at hgmp.mrc.ac.uk Tel : 01223 49-4548 HGMP-RC: http://www.hgmp.mrc.ac.uk/ EMBOSS : http://www.hgmp.mrc.ac.uk/Software/EMBOSS/ From David.Bauer at SCHERING.DE Mon Sep 1 07:20:08 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Mon, 1 Sep 2003 13:20:08 +0200 Subject: [EMBOSS] infoseq sequence type Message-ID: Hello, infoseq seems to have a problem if it reads a fasta file containing NA and Protein sequences. I originally wanted to use this program to differentiate between the sequence types. But it seems that infoseq only checks the first sequence in the fasta files and assumes the same type for all other sequences. So if first sequence is protein, all other are declared as protein even if they are nucl. and vice versa. Would it be possible to change infoseq so it would do the type check for each sequence in a multiple sequence file ? Thanks, David. From gwilliam at hgmp.mrc.ac.uk Mon Sep 1 08:15:44 2003 From: gwilliam at hgmp.mrc.ac.uk (Gary Williams, Tel 01223 494522) Date: Mon, 01 Sep 2003 13:15:44 +0100 Subject: [EMBOSS] infoseq sequence type References: Message-ID: <3F533870.8FC0D7E7@hgmp.mrc.ac.uk> David, It has now been changed so that it checks the type of every input sequence. Gary David.Bauer at SCHERING.DE wrote: > > Hello, > > infoseq seems to have a problem if it reads a fasta file containing NA and > Protein sequences. > I originally wanted to use this program to differentiate between the > sequence types. > But it seems that infoseq only checks the first sequence in the fasta files > and assumes the same type for all other sequences. > So if first sequence is protein, all other are declared as protein even if > they are nucl. and vice versa. > Would it be possible to change infoseq so it would do the type check for > each sequence in a multiple sequence file ? > > Thanks, > David. -- Gary Williams Tel: +44 1223 494522 Fax: +44 1223 494512 mailto:G.Williams at hgmp.mrc.ac.uk http://www.hgmp.mrc.ac.uk/ Bioinformatics, MRC HGMP, Hinxton, Cambridge, CB10 1SB, UK From bianji at jincao.com Tue Sep 2 00:00:14 2003 From: bianji at jincao.com (bianji at jincao.com) Date: Tue, 2 Sep 2003 12:00:14 +0800 Subject: [EMBOSS] =?GB2312?B?1tC5+s341b7Az9fWusUgIMj9xOrU9rOkyNXI1dDC?= Message-ID: <20030902035842.60D237D0E7@mercury.hgmp.mrc.ac.uk> ?????????????????????????????????????????????? www.jincao.com ???????????????????????????????????????????????????? www.jincao.com/t1.htm ???????????????????????? msm at jincao.com 2003??9??2?? From kmr at sanger.ac.uk Tue Sep 2 13:18:20 2003 From: kmr at sanger.ac.uk (Kim Rutherford) Date: Tue, 2 Sep 2003 18:18:20 +0100 Subject: [EMBOSS] union and splitter changes Message-ID: <16212.53468.133004.394922@pcs2b.internal.sanger.ac.uk> Hi. We've modified union and splitter to cope with features (using the standard -feature flag). Feature coordinates are changed to the appropriate coordinates on the joined sequence. We've also made changes to both programs so that splitter is (somewhat) able to reverse the action of union. union was changed to add a source feature to the joined sequence to record the ID, length and position of the original sequence. splitter uses the source feature to extract the original sequence position. We have made these changes because it's sometimes useful for us to be able to be merge an ordered and oriented stream of embl entries into one entry for analysis (such as running gene finders and similarity searches). It also allows all the sequence and features from an unfinished genome to be view and edited simultaneously in Artemis and ACT. One further change to union is the -findoverlap option which searches pairs of sequences for exact base overlaps and will join the sequence using the overlap information. Our group uses this option for cosmid based sequencing projects. Pairs of cosmids in the tiling path are sequenced with an overlap, annotated and then joined together for submission to EMBL. I've put the modified files on the web in case they are of use to someone else: http://www.sanger.ac.uk/Users/kmr/emboss/union.c http://www.sanger.ac.uk/Users/kmr/emboss/union.acd http://www.sanger.ac.uk/Users/kmr/emboss/splitter.c http://www.sanger.ac.uk/Users/kmr/emboss/splitter.acd The programs should be drop-in replacements for the standard programs if the new options aren't used. We've been using the latest CVS version of EMBOSS for development, so you'll probably need a CVS check-out to compile them. Kim. Here is an example using an EMBL format file: ID entry1 standard; DNA; UNC; 120 BP. FH Key Location/Qualifiers FH FT CDS join(5..100,102..103) SQ Sequence 120 BP; 40 A; 27 C; 18 G; 35 T; 0 other; gatctgcttt atttgcaaca catattgagg acttacacaa catcacaagc aatcaactgt 60 atgaaactta tcgaactgaa aagctttcaa cctcacagtt gcttttagac agtactgtcg 120 // ID entry2 standard; DNA; UNC; 120 BP. FH Key Location/Qualifiers FH FT CDS 10..20 FT CDS 110..120 SQ Sequence 120 BP; 33 A; 25 C; 11 G; 51 T; 0 other; attgtatgtt tctttttttt aaatttcaac ttcatctgct tactctacag atcccccaat 60 ttttgtaaaa attgtcgatg tatcccttaa aattttattc aactgggacc tatccaacat 120 // ID entry3 standard; DNA; UNC; 120 BP. FH Key Location/Qualifiers FH FT CDS complement(1..110) FT CDS 10..20 SQ Sequence 120 BP; 35 A; 22 C; 18 G; 45 T; 0 other; tttcaatagg ctcacttgaa agttcgttat ttacgaaaga taaagcttcc tctgcttttc 60 tttgatcaat taatgagctt tctgaattta tgctgtatat gcaatcggaa ctcaaaccat 120 // Using union -feature -source -osf embl gives: ID entry1 standard; DNA; UNC; 360 BP. FH Key Location/Qualifiers FH FT source 1..120 FT /origid="entry1" FT source 121..240 FT /origid="entry2" FT source 241..360 FT /origid="entry3" FT CDS join(5..100,102..103) FT CDS 130..140 FT CDS 230..240 FT CDS complement(241..350) FT CDS 250..260 SQ Sequence 360 BP; 108 A; 74 C; 47 G; 131 T; 0 other; gatctgcttt atttgcaaca catattgagg acttacacaa catcacaagc aatcaactgt 60 atgaaactta tcgaactgaa aagctttcaa cctcacagtt gcttttagac agtactgtcg 120 attgtatgtt tctttttttt aaatttcaac ttcatctgct tactctacag atcccccaat 180 ttttgtaaaa attgtcgatg tatcccttaa aattttattc aactgggacc tatccaacat 240 tttcaatagg ctcacttgaa agttcgttat ttacgaaaga taaagcttcc tctgcttttc 300 tttgatcaat taatgagctt tctgaattta tgctgtatat gcaatcggaa ctcaaaccat 360 // Then splitter -feature -source -osf embl gives: ID entry1 standard; DNA; UNC; 120 BP. FH Key Location/Qualifiers FH FT source 1..120 FT /origid="entry1" FT CDS join(5..100,102..103) SQ Sequence 120 BP; 40 A; 27 C; 18 G; 35 T; 0 other; gatctgcttt atttgcaaca catattgagg acttacacaa catcacaagc aatcaactgt 60 atgaaactta tcgaactgaa aagctttcaa cctcacagtt gcttttagac agtactgtcg 120 // ID entry2 standard; DNA; UNC; 120 BP. FH Key Location/Qualifiers FH FT source 1..120 FT /origid="entry2" FT CDS 10..20 FT CDS 110..120 SQ Sequence 120 BP; 33 A; 25 C; 11 G; 51 T; 0 other; attgtatgtt tctttttttt aaatttcaac ttcatctgct tactctacag atcccccaat 60 ttttgtaaaa attgtcgatg tatcccttaa aattttattc aactgggacc tatccaacat 120 // ID entry3 standard; DNA; UNC; 120 BP. FH Key Location/Qualifiers FH FT source 1..120 FT /origid="entry3" FT CDS complement(1..110) FT CDS 10..20 SQ Sequence 120 BP; 35 A; 22 C; 18 G; 45 T; 0 other; tttcaatagg ctcacttgaa agttcgttat ttacgaaaga taaagcttcc tctgcttttc 60 tttgatcaat taatgagctt tctgaattta tgctgtatat gcaatcggaa ctcaaaccat 120 // From Wei at agencourt.com Tue Sep 2 14:43:13 2003 From: Wei at agencourt.com (Wei Tao) Date: Tue, 2 Sep 2003 14:43:13 -0400 Subject: [EMBOSS] RE: prima Message-ID: <5F8E78418725B34995C3DBF115A805B31336BB@saturn.agencourt.com> Hi Sinead, Thanks a lot for your quick response. I found a copy of prima in an older version of EMBOSS download. My intention is to use prima for sequencing primer selection. However, after I tried a few sequences, from which I picked primers before, prima picked no forward sequencing primer at all. An example: INPUT SUMMARY ************* Prima of from positions 50 to 600 bps PRIMER CONSTRAINTS: PRIMA DOES NOT ALLOW PRIMER SEQUENCE AMBIGUITY OR DUPLICATE PRIMER ENDPOINTS Primer size range is 18-22 Primer GC content range is 0.40-0.55 Primer melting Temp range is 53.00 - 75.00 C PRODUCT CONSTRAINTS: Product GC content range is 0.40-0.55 Salt concentration is 50.00 (mM) DNA concentration is 50.00 (nM) Targeted range to amplify is from 50 to 600 PRIMER/PRODUCT PAIR CALCULATIONS & OUTPUT Sequence is: CCTATAGGGCGGCCGCGAATTCGGCACGAGGCTGCAACAGCAGACCAAGCACCGCGGCGGACCCAGGCAAGCACGGAACAAGCTGAGACGGATGATAATATGGATACAAAATCTATTCTAGAAGAACTTCTTCTCAAAAGATCACAGCAAAAG AAGAAAATGTCACCAAATAATTACAAAGAACGGCTTTTTGTTTTGACCAAAACAAACCTTTCCTACTATGAATATGACAAAATGAAAAGGGGCAGCAGAAAAGGATCCATTGAAATTAAGAAAATCAGATGTGTGGAGAAAGTAAATCTCGAG GAGCAGACGCCTGTAGAGAGACAGTACCCATTTCAGATTGTCTATAAAGATGGGCTTCTCTATGTCTATGCATCAAATGAAGAGAGCCGAAGTCAGTGGTTGAAAGCATTACAAAAAGAGATAAGGGGTAACCCCCACCTGCTGGTCAAGTAC CATAGTGGGTTCTTCGTGGACGGGAAGTTCCTGTGTTGCCAGCAGAGCTGTAAAGCAGCCCCAGGATGTACCCTCTGGGAAGCATATGCTAATCTGCATACTGCAGTCAATGAAGAGAAACACAGAGTTCCCACCTTCCCAGACAGAGTGCTG AAGATACCTCGGGCAGTTCCTGTTCTCAAAATGGATGCACCATCTTCAAGTACCACTCTAGCCCAATATGACAACGAATCAAAGAAAAACTATGGCTCCCAGCCACCATCTTCAAGTACCAGTCTAGCGCAATATGACAGCAACTCAAAGAAA ATCTATGGCTCCCAGCCAAACTTCAACATGCAGTATATTCCAAGGGAAGACTTCCCTGACTGGTGGCAAGTAAGAAAA Did you miss something in parameters? Any idea? Thanks again for your help. Cheers, -Wei -----Original Message----- From: Sin?ad O'Leary [mailto:oleary at genome.wi.mit.edu] Sent: Tuesday, September 02, 2003 1:39 PM To: Wei Tao Subject: Re: prima Hi - I no longer work on the EMBOSS project but you can find any information and the latest downloads from the website below. I'm not sure if the prima program is still in the package, but there are another primer related programs called 'primers' and 'primersearch'. Version 2.7.0 is available from: http://www.uk.embnet.org/Software/EMBOSS ftp://ftp.uk.embnet.org/pub/EMBOSS There is an emboss mailing list where questions on any of the programs or installations are answered: This may also be useful to you. hope this helps, Sin?ad. Wei Tao wrote: Hi Sinead, I wonder where can I find a copy of prima for download? Your help is deeply appreciated. Thanks! -Wei -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030902/9cb15c00/attachment.html From jison at hgmp.mrc.ac.uk Mon Sep 1 06:33:16 2003 From: jison at hgmp.mrc.ac.uk (Dr J.C. Ison) Date: Mon, 01 Sep 2003 11:33:16 +0100 Subject: [EMBOSS] Where did the protein structure programs go? References: Message-ID: <3F53206C.C41B98B0@hgmp.mrc.ac.uk> From David.Bauer at SCHERING.DE Mon Sep 1 07:20:08 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Mon, 1 Sep 2003 13:20:08 +0200 Subject: [EMBOSS] infoseq sequence type Message-ID: From gwilliam at hgmp.mrc.ac.uk Mon Sep 1 08:15:44 2003 From: gwilliam at hgmp.mrc.ac.uk (Gary Williams, Tel 01223 494522) Date: Mon, 01 Sep 2003 13:15:44 +0100 Subject: [EMBOSS] infoseq sequence type References: Message-ID: <3F533870.8FC0D7E7@hgmp.mrc.ac.uk> From owner-emboss at hgmp.mrc.ac.uk Mon Sep 1 07:20:08 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Mon, 1 Sep 2003 13:20:08 +0200 Subject: [EMBOSS] infoseq sequence type Message-ID: Hello, infoseq seems to have a problem if it reads a fasta file containing NA and Protein sequences. I originally wanted to use this program to differentiate between the sequence types. But it seems that infoseq only checks the first sequence in the fasta files and assumes the same type for all other sequences. So if first sequence is protein, all other are declared as protein even if they are nucl. and vice versa. Would it be possible to change infoseq so it would do the type check for each sequence in a multiple sequence file ? Thanks, David. From owner-emboss at hgmp.mrc.ac.uk Mon Sep 1 08:15:44 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Mon, 01 Sep 2003 13:15:44 +0100 Subject: [EMBOSS] infoseq sequence type References: Message-ID: <3F533870.8FC0D7E7@hgmp.mrc.ac.uk> David, It has now been changed so that it checks the type of every input sequence. Gary David.Bauer at SCHERING.DE wrote: > > Hello, > > infoseq seems to have a problem if it reads a fasta file containing NA and > Protein sequences. > I originally wanted to use this program to differentiate between the > sequence types. > But it seems that infoseq only checks the first sequence in the fasta files > and assumes the same type for all other sequences. > So if first sequence is protein, all other are declared as protein even if > they are nucl. and vice versa. > Would it be possible to change infoseq so it would do the type check for > each sequence in a multiple sequence file ? > > Thanks, > David. -- Gary Williams Tel: +44 1223 494522 Fax: +44 1223 494512 mailto:G.Williams at hgmp.mrc.ac.uk http://www.hgmp.mrc.ac.uk/ Bioinformatics, MRC HGMP, Hinxton, Cambridge, CB10 1SB, UK From owner-emboss at hgmp.mrc.ac.uk Mon Sep 1 06:33:16 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Mon, 01 Sep 2003 11:33:16 +0100 Subject: [EMBOSS] Where did the protein structure programs go? References: Message-ID: <3F53206C.C41B98B0@hgmp.mrc.ac.uk> Hi David Sorry - just back from hols ! They're in the EMBASSY package "domainatrix". Please note the caveat below. I'm in the process of making things more generic though and the new versions *will* be available as part of EMBOSS Cheers J. ** This program is part of a suite of EMBOSS applications that directly or ** indirectly make use of the protein structure databases pdb and scop. ** This program is part of an experimental analysis pipeline described in an ** accompanying document. We provide the software in the hope that it will ** be useful. The applications were designed for specific research purposes ** and may not be useful or reliable in contexts other than the described ** pipeline. The development of the suite was coordinated by Jon Ison to ** whom enquiries and bug reports should be sent (email jison at hgmp.mrc.ac.uk). David Martin wrote: > EMBOSS had some protein structure stuff in it. This all seems to have > disappeared? > > ..d > -- > David Martin PhD > Bioinformatics Scientific Officer > Post-Genomics and Molecular Interactions Centre > University of Dundee -- Jon C. Ison, PhD Bioinformatics Applications Group UK MRC Human Genome Mapping Project Resource Centre Hinxton, Cambridge, CB10 1SB, UK E-mail : jison at hgmp.mrc.ac.uk Tel : 01223 49-4548 HGMP-RC: http://www.hgmp.mrc.ac.uk/ EMBOSS : http://www.hgmp.mrc.ac.uk/Software/EMBOSS/ From stefanielager at fastmail.ca Wed Sep 3 12:09:51 2003 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Wed, 3 Sep 2003 12:09:51 -0400 (EDT) Subject: [EMBOSS] EMBOSS and SRS Message-ID: <3F56124F.00011B.98842@ns.interchange.ca> I have some problem to set up SRS indexed databases and to make them available in EMBOSS. It's OK when I run EMBOSS on commandline and the user have SRS set up so getz is in the users path. But for users who don't have SRS set up or through web-interface I get problems. In the (fairly) new SRS 7.1.1 I have to have SRS setup to run getz, previously I only had to have the full path to getz to run it. Is it possible to have the SRS setup in the emboss.default file, so SRS is set up automatically? Stefanie _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From owner-emboss at hgmp.mrc.ac.uk Mon Sep 1 06:33:16 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Mon, 01 Sep 2003 11:33:16 +0100 Subject: [EMBOSS] Where did the protein structure programs go? References: Message-ID: <3F53206C.C41B98B0@hgmp.mrc.ac.uk> Hi David Sorry - just back from hols ! They're in the EMBASSY package "domainatrix". Please note the caveat below. I'm in the process of making things more generic though and the new versions *will* be available as part of EMBOSS Cheers J. ** This program is part of a suite of EMBOSS applications that directly or ** indirectly make use of the protein structure databases pdb and scop. ** This program is part of an experimental analysis pipeline described in an ** accompanying document. We provide the software in the hope that it will ** be useful. The applications were designed for specific research purposes ** and may not be useful or reliable in contexts other than the described ** pipeline. The development of the suite was coordinated by Jon Ison to ** whom enquiries and bug reports should be sent (email jison at hgmp.mrc.ac.uk). David Martin wrote: > EMBOSS had some protein structure stuff in it. This all seems to have > disappeared? > > ..d > -- > David Martin PhD > Bioinformatics Scientific Officer > Post-Genomics and Molecular Interactions Centre > University of Dundee -- Jon C. Ison, PhD Bioinformatics Applications Group UK MRC Human Genome Mapping Project Resource Centre Hinxton, Cambridge, CB10 1SB, UK E-mail : jison at hgmp.mrc.ac.uk Tel : 01223 49-4548 HGMP-RC: http://www.hgmp.mrc.ac.uk/ EMBOSS : http://www.hgmp.mrc.ac.uk/Software/EMBOSS/ From owner-emboss at hgmp.mrc.ac.uk Mon Sep 1 07:20:08 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Mon, 1 Sep 2003 13:20:08 +0200 Subject: [EMBOSS] infoseq sequence type Message-ID: Hello, infoseq seems to have a problem if it reads a fasta file containing NA and Protein sequences. I originally wanted to use this program to differentiate between the sequence types. But it seems that infoseq only checks the first sequence in the fasta files and assumes the same type for all other sequences. So if first sequence is protein, all other are declared as protein even if they are nucl. and vice versa. Would it be possible to change infoseq so it would do the type check for each sequence in a multiple sequence file ? Thanks, David. From owner-emboss at hgmp.mrc.ac.uk Mon Sep 1 08:15:44 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Mon, 01 Sep 2003 13:15:44 +0100 Subject: [EMBOSS] infoseq sequence type References: Message-ID: <3F533870.8FC0D7E7@hgmp.mrc.ac.uk> David, It has now been changed so that it checks the type of every input sequence. Gary David.Bauer at SCHERING.DE wrote: > > Hello, > > infoseq seems to have a problem if it reads a fasta file containing NA and > Protein sequences. > I originally wanted to use this program to differentiate between the > sequence types. > But it seems that infoseq only checks the first sequence in the fasta files > and assumes the same type for all other sequences. > So if first sequence is protein, all other are declared as protein even if > they are nucl. and vice versa. > Would it be possible to change infoseq so it would do the type check for > each sequence in a multiple sequence file ? > > Thanks, > David. -- Gary Williams Tel: +44 1223 494522 Fax: +44 1223 494512 mailto:G.Williams at hgmp.mrc.ac.uk http://www.hgmp.mrc.ac.uk/ Bioinformatics, MRC HGMP, Hinxton, Cambridge, CB10 1SB, UK From David.Bauer at SCHERING.DE Thu Sep 4 01:49:57 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Thu, 4 Sep 2003 07:49:57 +0200 Subject: Antwort: [EMBOSS] EMBOSS and SRS Message-ID: Hi Stefanie, we just updated to 711. For historical reasons I'm using method: app for srs access. The application is a simple script using LWP::UserAgent. And this still works with the new 711. But I just made a quick test with method: url and this does no longer work with 711. The debug file contains an error message from the SRS server but I didn't look through this in detail yet. David. I have some problem to set up SRS indexed databases and to make them available in EMBOSS. It's OK when I run EMBOSS on commandline and the user have SRS set up so getz is in the users path. But for users who don't have SRS set up or through web-interface I get problems. In the (fairly) new SRS 7.1.1 I have to have SRS setup to run getz, previously I only had to have the full path to getz to run it. Is it possible to have the SRS setup in the emboss.default file, so SRS is set up automatically? Stefanie _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From stefanielager at fastmail.ca Thu Sep 4 05:29:21 2003 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Thu, 4 Sep 2003 05:29:21 -0400 (EDT) Subject: Antwort: [EMBOSS] EMBOSS and SRS Message-ID: <3F5705F1.000011.22576@ns.interchange.ca> Thank you David, I think I can solve it, calling an external script as you suggests. Stefanie > Stefanie, > > in emboss.default I have: > ################################################## > DB gb [ type: N method: app format: genbank > app: "/usr/local/bin/cgdb_getz_n %s" > comment: "GenBank, RefSeq, RefSeqP" ] > ################################################## > And the script contains: > ################################################### > #!/usr/local/bin/perl > use LWP::UserAgent; > use URI::URL; > > $id=$ARGV[0]; > $id=~s/\.\d+//; > $url=new > URI::URL("http://bes270.schering.de:7777/srs7bin/cgi-bin/wgetz? > -ascii+- > e+[{GENBANK%20REFSEQ%20REFSEQP}-id:$id]|[{GENBANK%20REFSEQ%20REFSE > QP} -acc:$id]"); $req=new HTTP::Request(GET,$url); > $ua=new LWP::UserAgent; > $resp=$ua->request($req); > $seq=$resp->content; > print $seq; > ########################################################### > > Hope this helps. > > Cheers, > David. > > > > > "Stefanie Lager" > stmail.ca> An: emboss at embnet.org > Gesendet von: Kopie: > owner-emboss at hgmp Thema: [EMBOSS] EMBOSS and SRS > .mrc.ac.uk > > > 03.09.03 18:09 > > > > > > > I have some problem to set up SRS indexed databases and to make > them available in EMBOSS. It's OK when I run EMBOSS on commandline > and the user have SRS set up so getz is in the users path. But for > users who don't have SRS set up or through web-interface I get > problems. In the (fairly) new SRS 7.1.1 I have to have SRS setup > to run getz, previously I only had to have the full path to getz > to run it. Is it possible to have the SRS setup in the > emboss.default file, so SRS is set up automatically? > > Stefanie > _________________________________________________________________ > http://fastmail.ca/ - Fast Secure Web Email for Canadians > > _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From gvasudevan at medarex.com Thu Sep 4 17:06:50 2003 From: gvasudevan at medarex.com (Vasudevan, Geetha) Date: Thu, 4 Sep 2003 14:06:50 -0700 Subject: [EMBOSS] EmbossWin.... Message-ID: <8249C3256E593D4FB066BB9998D9F7E41CF2ED@ca2-fs03.ca2.2k.medarex.com> Hello Emboss Users, I am having trouble making some of the executables work in the windows version of EMBOSSWIN. The exe sigcleave accepts the dir path for i/p as well as o/p files on the command line when executed from a cmd on win2k. Whereas, transeq does not accept the dir path for o/p. Example, sigcleave C:\Temp\myseq.txt -outfile C:\Temp\myseq.sig -minweight=3.5 works but transeq -sequence C:\Temp\nt.txt -outseq C:\Temp\pep.txt -frame=2 does not work. Error: Unable to write sequence to 'C:\Temp\pep.txt' Died: transeq terminated: Bad value for option [outseq] and no prompt Is there a work around for this? Thanks for your time. -Geetha Vasudevan. -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030904/2b32cb55/attachment.html From rpg at mrc-lmb.cam.ac.uk Fri Sep 5 12:54:01 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Fri, 5 Sep 2003 17:54:01 +0100 (BST) Subject: [EMBOSS] srs/www madness Message-ID: <200309051654.h85Gs1k69234@alf1.lmb.internal> So I decided to install EMBOSS on my Mac, and went the fink route (2.6.0). I have a emboss.default file that is being read, I've put in some database definitions, e.g. DB embl [ type: N method: srswww format: embl release: EBI dbalias: embl comment: "EMBL from EBI" url: "http://srs.ebi.ac.uk/srs7bin/cgi-bin/wgetz?-e+[embl-id:'%s']" ] (- and in another iteration DB embl [ type: N format: embl method: url dbalias: embl url: "http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id:'%s']" comment: "EMBL. Allegedly." ] ) and showdb gives # Name Type ID Qry All Comment # ==== ==== == === === ======= tpir P OK OK OK PIR using NBRF access for 4 files tsw P OK OK OK Swissprot native format with EMBL CD-ROM index tswnew P OK OK OK Swissnew as 3 files in native format with EMBL CD-ROM index twp P OK OK OK EMBL new in native format with EMBL CD-ROM index embl N OK - - EMBL from EBI I can construct a query and type it into a browser e.g. http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id:'AB07888'] and get an answer. BUT seqret does not want to play: % seqret Reads and writes (returns) sequences Input sequence(s): embl:AB078884 Error: Unable to read sequence 'embl:AB078884' So, what am I missing? I went through the mailing list archives and found a couple of people had similar trouble, but as far as I can tell I've covered all the bases covered there (emboss.default is being read, for example). I know I don't need a proxy to get out, and as far as I can tell the request is being made to the server, but either the correct magic is not being uttered or the server is returning something that seqret does not like. David Martin kindly pointed me at embl-alltext and that does not return anything either. In fact, using the alltext database with a very short string results in a very long delay, so I suspect the problem is in retrieving the answers. And before you ask, ports 80 and 427 are open on my machine. Thanks for any help, Richard -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From rpg at mrc-lmb.cam.ac.uk Sat Sep 6 06:15:56 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Sat, 6 Sep 2003 11:15:56 +0100 (BST) Subject: [EMBOSS] seqret continued Message-ID: <200309061015.h86AFua240645@alf1.lmb.internal> All right, I slapped a network analyser on and found not only is seqret making the request, the sequence data is being received by my machine. I can see the packets, and the packets contain sequence data. So it's breaking down somewhere between the sequence being loaded into memory and seqret writing it to a file. The only thing I can think of is that because I used fink to install it, EMBOSS is in /sw/bin rather than /usr/... Everything else seems to be fine, but maybe there's a setting - a default directory or a permission - somewhere I've missed? -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From ableasby at hgmp.mrc.ac.uk Sat Sep 6 06:29:55 2003 From: ableasby at hgmp.mrc.ac.uk (Alan Bleasby) Date: Sat, 6 Sep 2003 11:29:55 +0100 (BST) Subject: [EMBOSS] seqret continued Message-ID: <200309061029.h86ATtgP022486@bromine.hgmp.mrc.ac.uk> I can reproduce this problem on non-MacOSX platforms for large sequences (smaller ones retrieve OK). We'll look into it. Thanks for the information. Alan From alta_bowman_cp at gfk.se Mon Sep 8 18:23:27 2003 From: alta_bowman_cp at gfk.se (Alta Bowman) Date: Mon, 08 Sep 2003 22:23:27 +0000 Subject: [EMBOSS] =?ISO-8859-1?b?UmU6Q2hlYXAgU2lsZGVuYWZpbCBDaXRyYXRlICBMaW5r?= Message-ID: <2.2.32.2003090822232700b8c312@gfk.se> An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030908/038622fe/attachment.html From Poster-Kit at club-internet.fr Mon Sep 8 17:22:26 2003 From: Poster-Kit at club-internet.fr (Didacticiel PowerPoint) Date: Mon, 8 sep 2003 23:22:26 +0200 Subject: [EMBOSS] Faites votre poster avec PowerpPoint Message-ID: <20030909001204.08A1440FA6@kraid.nerim.net> poster de conf?rence - Poster scientifique - panneau marketing - Organigrammes .... Voici 4 solutions pour faire votre poster vous m?me sur PowerPoint !... ? decouvrir sur le site www.poster-kit.com Basic :Directement de vos diapositives PowerPoint vous allez cr?er un poster automatiquement gr?ce ? une macro gratuite. Simple : A partir de 12 mod?les pr?s ? l'emploi. T?l?chargement gratuit. Pro : Prenez 5 minutes pour lire nos guides gratuits . Vous prendrez le bon d?part S?r?nit? : Gagnez imm?diatement en temps et en qualit?... Confiez vos ?l?ments ? un professionnel. Ils utilisent ce site : CEA - IRSN - INRA - JUSSIEU - PFIZER - INSERM - APHP - EDF - CEGOS - CNRS - INT - SUPELEC - ORSAY - IGR - CURIE - ESPCI - MEDECINE - PARIS 6... ------------------------------------------------------------------------------------------------------------------- le site didacticiel gratuit du poster ? r?aliser soi-m?me : www.poster-kit.com ------------------------------------------------------------------------------------------------------------------- Vous d?sirez des informations : chronoimages at club-internet.fr Vous d?sirez ne plus recevoir d'informations taper simplement non : poster-kit at club-internet.fr Windows 95, Windows 98, Microsoft PowerPoint sont des marques d?pos?es de Microsoft Corp -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030908/b4312625/attachment.html -------------- next part -------------- A non-text attachment was scrubbed... Name: not available Type: image/gif Size: 9938 bytes Desc: not available Url : http://lists.open-bio.org/pipermail/emboss/attachments/20030908/b4312625/attachment.gif -------------- next part -------------- A non-text attachment was scrubbed... Name: not available Type: image/gif Size: 5012 bytes Desc: not available Url : http://lists.open-bio.org/pipermail/emboss/attachments/20030908/b4312625/attachment-0001.gif From osmart at pugh.bip.bham.ac.uk Tue Sep 9 08:24:24 2003 From: osmart at pugh.bip.bham.ac.uk (Oliver S. Smart) Date: Tue, 9 Sep 2003 13:24:24 +0100 Subject: [EMBOSS] sort from dbiflat - problem solved. Message-ID: My colleague Tony Pemberton reported a problem with dbiflat to the list on 6 August. We thought it would be worth posting the solution. The exact problem was produced when indexing EMBL release 75.0 using the dbiflat command on a dual athlon running redhat 9.0. The sort command launched: $ sort -o embl.acnum_sort2 -T . -k 1,1 embl.acnum_id2 never finished (>3 weeks) and produced no output. Interestingly the command works fine under redhat 8.0, suse7.2 and 8.0 and irix. Also indexing smaller databases works fine as the same sort command will work on smaller files. The solution is to set the LC_ALL environment variable (mentioned in the sort man page) by: # for tcsh, csh,... $ setenv LC_ALL C # OR for bash, ksh,... $ export LC_ALL=C The command then runs fine in around 80 seconds. Consequently dbiflat also runs without a problem. (Note that setting LC_COLLATE does not work), Hope this may save someone else a big headache! Oliver Smart (o.s.smart at bham.ac.uk) & Tony Pemberton (A.J.Pemberton at bham.ac.uk) The University of Birmingham From rpg at mrc-lmb.cam.ac.uk Wed Sep 10 04:40:05 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Wed, 10 Sep 2003 09:40:05 +0100 (BST) Subject: [EMBOSS] X11 graphics on OS X Message-ID: <200309100840.h8A8e6T408413@alf1.lmb.internal> Emboss 2.7.1 installed from fink. IThe mail archives hint a problem with Apple's X11, but I have not had trouble with other X apps using it, and fink actually forces you to install the X11 SDK before installing EMBOSS, so I'm not convinced there are missing files. I get the following error with, e.g. pepinfo: Graph type [x11]: Output file [pepinfo.out]: Error in XCreatePixmap: BadDrawable (invalid Pixmap or Window parameter). and I need to ctrl-c to escape. works fine with .ps and PNG as the output. EMBOSS is in /sw/bin/ . Here's my envs: % env HOME=/Users/XXXX SHELL=/bin/tcsh USER=XXXX LANG=en_GB PATH=/sw/bin:/sw/sbin:/bin:/sbin:/usr/bin:/usr/sbin:/usr/X11R6/bin __CF_USER_TEXT_ENCODING=0x1F5:0:2 TERM=vt100 TERMCAP=o?=o?=o?= TERM_PROGRAM=Apple_Terminal TERM_PROGRAM_VERSION=81 LOGNAME=XXXX HOSTTYPE=macintosh VENDOR=apple OSTYPE=darwin MACHTYPE=powerpc SHLVL=1 PWD=/XXXXXX/XXXX/XXXX/XXXX/XXXX GROUP=staff HOST=XXXX.XXXX.XXXX.XXXX PLPLOT_LIB=/sw/share/EMBOSS/ MANPATH=/sw/share/man:/usr/share/man:/usr/X11R6/man INFOPATH=/sw/share/info:/sw/info:/usr/share/info PERL5LIB=/sw/lib/perl5 DISPLAY=:0.0 and /etc/csh.cshrc # System-wide .cshrc file for csh(1). if ($?prompt) then set promptchars = "%#" if ($?tcsh) then set prompt = "[%m:%c3] %n%# " else set prompt = "[%m:%c3] `id -nu`%# " endif endif setenv PLPLOT_LIB /sw/lib/ -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From kvddrift at earthlink.net Wed Sep 10 06:31:30 2003 From: kvddrift at earthlink.net (Koen van der Drift) Date: Wed, 10 Sep 2003 06:31:30 -0400 Subject: [EMBOSS] X11 graphics on OS X In-Reply-To: <200309100840.h8A8e6T408413@alf1.lmb.internal> Message-ID: On Wednesday, September 10, 2003, at 04:40 AM, wrote: > Emboss 2.7.1 installed from fink. > > IThe mail archives hint a problem with Apple's X11, but I have not had > trouble with other X apps using it, and fink actually forces you to > install the X11 SDK before installing EMBOSS, so I'm not convinced > there > are missing files. > Richard, Graphics currently do not work with the current beta version of Apple's X11. You can either install x11 (version 4.3) through fink, or wait until 'Panther' is released which comes with a much improved X11 (also 4.3). - Koen. From luqiang at scbit.org Mon Sep 15 09:09:09 2003 From: luqiang at scbit.org (luqiang) Date: Mon, 15 Sep 2003 21:09:09 +0800 Subject: [EMBOSS] How to install and run a single application of EMBOSS? Message-ID: <20030915130909.1426.qmail@scbit.org> Hi, Guys, 1) I installed the EMBOSS-2.7.1 in path of "/export/home/luqiang/downloads/emboss/EMBOSS-2.7.1" (Red hat 8); 2) I copied the excutable program "garnier" into another path; 3) I removed the path of "/export/home/luqiang/downloads/emboss/EMBOSS-2.7.1"; 4) When I executed the ./garnier, error message came out as following: ./garnier: line 1: cd: /export/home/luqiang/downloads/emboss/EMBOSS-2.7.1/emboss: No such file or directory gcc: garnier.o: No such file or directory gcc: ../nucleus/.libs/libnucleus.so: No such file or directory gcc: ../ajax/.libs/libajaxg.so: No such file or directory gcc: ../ajax/.libs/libajax.so: No such file or directory gcc: ../plplot/.libs/libplplot.so: No such file or directory If I don't want to the whole cumbersome EMBOSS package, while only single application, for example "gariner", is needed, how can I do? Thanks a lot Lu Qiang From pmr at ebi.ac.uk Mon Sep 15 10:41:09 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 15 Sep 2003 15:41:09 +0100 Subject: [EMBOSS] How to install and run a single application of EMBOSS? References: <20030915130909.1426.qmail@scbit.org> Message-ID: <3F65CF85.7000709@ebi.ac.uk> luqiang wrote: > 4) When I executed the ./garnier, error message came out as following: > ./garnier: line 1: cd: > /export/home/luqiang/downloads/emboss/EMBOSS-2.7.1/emboss: No such file > or directory > gcc: garnier.o: No such file or directory > gcc: ../nucleus/.libs/libnucleus.so: No such file or directory > If I don't want to the whole cumbersome EMBOSS package, while only > single application, for example "gariner", is needed, how can I do? Yes, you can build single applications... but there are a few tricks. By default EMBOSS builds with shared libraries using GNU LibTool. The way LibTool works is to build a script when you run "make" and to create the true binary file when you run "make install". This is why it looks for garnier.o Two things you need to do: 1. Build static binaries: ./configure --disable-shared then "make clean", and "make" 2. Watch out for shared libraries in building gd for the graphics applications (no need for garnier - it has no graphics) You can build gd as static libraries, with a little care. To export the binary files to another system, I have usually found you need to disable X11 graphics too (./configure --without-x) because the system usually has shared X11 libraries. Hope this helps, Peter From pmr at ebi.ac.uk Mon Sep 15 10:47:58 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 15 Sep 2003 15:47:58 +0100 Subject: [EMBOSS] How to install and run a single application of EMBOSS? References: <20030915130909.1426.qmail@scbit.org> Message-ID: <3F65D11E.4020701@ebi.ac.uk> luqiang wrote: > If I don't want to the whole cumbersome EMBOSS package, while only > single application, for example "gariner", is needed, how can I do? Oops ... I forgot one more detail. EMBOSS will need to find the ACD file (emboss/garnier.acd in the sources, acd/garnier.acd when it is installed) and possibly comparison matrix files. It will look in the source and install directories. There are two environment variables to redirect the programs to some other location: setenv EMBOSS_ACDROOT /site/prog/emboss/share/EMBOSS/acd setenv EMBOSS_ROOT /site/prog/emboss/share/EMBOSS/ Hope this helps, Peter From gtps5 at gtptech.com Thu Sep 18 11:38:29 2003 From: gtps5 at gtptech.com (Carole Louis) Date: 18 Sep 2003 17:38:29 +0200 Subject: [EMBOSS] Add a program in Jemboss Message-ID: <1063899511.11099.44.camel@thym> Hi, I have just implemented somes programs in Emboss. I can run it with a shell but not with Jemboss. However, I compiled Jemboss (Jemboss server) with my programs included in Emboss. I think that I have to modify somes programs in Java but I do not know which. How can I do that ? Thanks, Sincerecely, Carole Louis -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030918/7b1ee521/attachment.html From tcarver at hgmp.mrc.ac.uk Thu Sep 18 11:46:14 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Thu, 18 Sep 2003 16:46:14 +0100 (BST) Subject: [EMBOSS] Add a program in Jemboss In-Reply-To: <1063899511.11099.44.camel@thym> Message-ID: Hi Carole Once you have installed your programs, you will need to follow the same guidelines for installing embassy after the Jemboss server has already been set up: http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Jemboss/install/embassy.html This should explain why you do not see your applications and how to get them into the interface. Regards Tim Carver HGMP-RC On 18 Sep 2003, Carole Louis wrote: > Hi, > > I have just implemented somes programs in Emboss. I can run it with a > shell but not with Jemboss. However, I compiled Jemboss (Jemboss server) > with my programs included in Emboss. I think that I have to modify somes > programs in Java but I do not know which. How can I do that ? > > Thanks, > Sincerecely, > Carole Louis > > > > From owner-emboss at hgmp.mrc.ac.uk Thu Sep 18 15:46:08 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Thu, 18 Sep 2003 15:46:08 -0400 Subject: [EMBOSS] From: Thomas A Isenbarger Message-ID: is there a discussion of plotcon anywhere? is there a good explanation of the calculation and algorithm anywhere, or a reference? thank-you, tom isenbarger From tcarver at hgmp.mrc.ac.uk Fri Sep 19 03:37:44 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Fri, 19 Sep 2003 08:37:44 +0100 (BST) Subject: [EMBOSS] From: Thomas A Isenbarger In-Reply-To: Message-ID: Hi Tom You can find the documentation for this at: http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Apps/plotcon.html I hope this helps, Regards Tim Carver HGMP-RC On Thu, 18 Sep 2003 owner-emboss at hgmp.mrc.ac.uk wrote: > is there a discussion of plotcon anywhere? is there a good explanation > of the calculation and algorithm anywhere, or a reference? > > thank-you, > > tom isenbarger > From kawaji at plala.to Sat Sep 20 07:23:55 2003 From: kawaji at plala.to (KAWAJI Hideya) Date: Sat, 20 Sep 2003 20:23:55 +0900 (JST) Subject: [EMBOSS] license of EMBOSS tutorial Message-ID: <20030920.202355.730556337.kawaji@plala.to> Hi, I'm interested in EMBOSS tutorial (http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Tutorial/emboss_tutorial/) as well as EMBOSS itself. It is very helpful to understand EMBOSS applications, but some people that are not good at English can't utilize it. My colleague has a plan to translate it into Japanese, and I agree with him. We consider that our result also should be open publicly. Although all programs in EMBOSS is clearly described as "they are released under GPL" and I believe that the spirit is the same to the tutorial, I can't find any license of the tutorial. Could you let me know about the following points? - Is there any description about license of EMBOSS tutorial, such as GNU FDL(http://www.gnu.org/licenses/fdl.html)? - If not, can we open and distribute our translation, publicly? best, Hideya --- Hideya KAWAJI From ksvk_2000 at yahoo.com Mon Sep 22 06:11:54 2003 From: ksvk_2000 at yahoo.com (Vinay Kumar) Date: Mon, 22 Sep 2003 03:11:54 -0700 (PDT) Subject: [EMBOSS] Plplot Message-ID: <20030922101154.67974.qmail@web10906.mail.yahoo.com> Hello, I am installing EMBOSS on a RHL 9.0 box. It was installed very neatly. But when i tried to see a output on PLPLOT. There was an error message. something like Set PLPLOT_LIB to plplot/lib under Emboss directory What does this mean? and how am i to rectify the problem?? plz help. Regards and thanks in advance Vinay. --------------------------------- Do you Yahoo!? Yahoo! SiteBuilder - Free, easy-to-use web site design software -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030922/8582cb60/attachment.html From henrikki.almusa at helsinki.fi Mon Sep 22 07:02:26 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Mon, 22 Sep 2003 14:02:26 +0300 Subject: [EMBOSS] Plplot In-Reply-To: <20030922101154.67974.qmail@web10906.mail.yahoo.com> References: <20030922101154.67974.qmail@web10906.mail.yahoo.com> Message-ID: <200309221402.26279.henrikki.almusa@helsinki.fi> On Monday 22 September 2003 13:11, Vinay Kumar wrote: > Hello, > I am installing EMBOSS on a RHL 9.0 box. It was installed very neatly. But > when i tried to see a output on PLPLOT. There was an error message. > > something like > > Set PLPLOT_LIB to plplot/lib under Emboss directory > > What does this mean? and how am i to rectify the problem?? plz help. If you mean that it wants to use "plstnd5.fnt" or "plxtnd5.fnt", then they are in your "source_dir/plplot/lib" (source dur being the directory, where you unpacked emboss-x.y.z.tar.gz). You can set the enviromental variable by 'export PLPLOT_DIR="directory"'-command. Question to list. Is there a reason why the 'make install' doesn't copy these to emboss library dir as well as other libraries? -- Henrikki Almusa From rpg at mrc-lmb.cam.ac.uk Mon Sep 22 08:19:15 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Mon, 22 Sep 2003 13:19:15 +0100 (BST) Subject: [EMBOSS] Qualifier '-fields' not found Message-ID: <200309221219.h8MCJHX212155@alf1.lmb.internal> I've persuaded my friendly admin to set up EMBOSS on our Tru64 Alpha cluster. I know Tru64 isn't officially supported, and he doesn't really have time to troubleshoot, so I'm lending a hand. We're getting this error: % showdb Displays information on the currently available databases Died: Qualifier '-fields' not found Ideas? Thanks -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From d.gatherer at vir.gla.ac.uk Mon Sep 22 10:13:15 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Mon, 22 Sep 2003 15:13:15 +0100 Subject: [EMBOSS] Plplot In-Reply-To: <200309221402.26279.henrikki.almusa@helsinki.fi> References: <20030922101154.67974.qmail@web10906.mail.yahoo.com> <20030922101154.67974.qmail@web10906.mail.yahoo.com> Message-ID: <5.2.1.1.1.20030922150217.00b16f18@udcf.gla.ac.uk> Hi I have a very similar problem, but I suspect that the problem is not with EMBOSS, but possibly with X. I have: > printenv | grep LD_LIB LD_LIBRARY_PATH=/$SOFTWARE/emboss/share/EMBOSS : /$SOFTWARE/lib >printenv | grep PLP PLPLOT_LIB=/$SOFTWARE/emboss/share/EMBOSS ($SOFTWARE is of course an abbreviation of my actual thing...) >ls /$SOFTWARE/emboss/share/EMBOSS acd/ emboss.default.template plstnd5.fnt bin/ include/ plxtnd5.fnt data/ jemboss/ test/ doc/ lib/ >ls /$SOFTWARE/lib libckit.so@ libnucleus.a libajax.a libckit.so.0@ libnucleus.la* libajax.la* libckit.so.1.1.0* libnucleus.so@ libajax.so@ libhmmer.a libnucleus.so.0@ libajax.so.0@ libhmmer.la* libnucleus.so.1.1.0* libajax.so.1.1.0* libhmmer.so@ libplplot.a libajaxg.a libhmmer.so.1@ libplplot.la* libajaxg.la* libhmmer.so.2.1.1* libplplot.so@ libajaxg.so@ libmeme.a libplplot.so.5@ libajaxg.so.0@ libmeme.la* libplplot.so.5.0.0* libajaxg.so.1.1.0* libmeme.so@ libwrap.a* libckit.a libmeme.so.1@ libckit.la* libmeme.so.2.1.3* so this looks okay... but...... > banana Bending and curvature plot in B-DNA Input sequence: sequences/testdna1.fa Graph type [x11]: Error in XCreatePixmap: BadDrawable (invalid Pixmap or Window parameter). The outfile (banana.profile) is fine, as a text file, so the algorithmic part of banana is fine. If I enter xterm at the Graph type prompt, I get the plot in the Xterm window. Am I failing to point correctly at something, or are the x11 libraries the problem? All suggestions gratefully received. Cheers Derek At 14:02 22/09/2003 +0300, Henrikki Almusa wrote: >On Monday 22 September 2003 13:11, Vinay Kumar wrote: > > Hello, > > I am installing EMBOSS on a RHL 9.0 box. It was installed very neatly. But > > when i tried to see a output on PLPLOT. There was an error message. > > > > something like > > > > Set PLPLOT_LIB to plplot/lib under Emboss directory > > > > What does this mean? and how am i to rectify the problem?? plz help. > >If you mean that it wants to use "plstnd5.fnt" or "plxtnd5.fnt", then they >are >in your "source_dir/plplot/lib" (source dur being the directory, where you >unpacked emboss-x.y.z.tar.gz). You can set the enviromental variable by >'export PLPLOT_DIR="directory"'-command. > >Question to list. Is there a reason why the 'make install' doesn't copy these >to emboss library dir as well as other libraries? > >-- >Henrikki Almusa From rpg at mrc-lmb.cam.ac.uk Mon Sep 22 10:16:14 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Mon, 22 Sep 2003 15:16:14 +0100 (BST) Subject: [EMBOSS] Plplot In-Reply-To: <5.2.1.1.1.20030922150217.00b16f18@udcf.gla.ac.uk> from Derek Gatherer at "Sep 22, 2003 03:13:15 pm" Message-ID: <200309221416.h8MEGFw487633@alf1.lmb.internal> Hi Derek - X11 on MacOsX is effectively broken w.r.t. EMBOSS. You could try installing Xfree86 4.3, or waiting for Panther ;) r -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From d.gatherer at vir.gla.ac.uk Mon Sep 22 10:39:55 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Mon, 22 Sep 2003 15:39:55 +0100 Subject: [EMBOSS] Plplot In-Reply-To: <200309221416.h8MEGFw487633@alf1.lmb.internal> References: <5.2.1.1.1.20030922150217.00b16f18@udcf.gla.ac.uk> Message-ID: <5.2.1.1.1.20030922153330.036d2270@udcf.gla.ac.uk> I'm actually using a Windows 2000 PC running Hummingbird/Exceed to log into a Tru64 server. Maybe the problem extends to Windows as well? Since my last post, I saw there was one line in the manual: "You may need to specify the location of your X-windows library with the configuration options: -x-includes=DIR (X include files are in DIR) -x-libraries=DIR (X library files are in DIR)" Perhaps this is what is wrong. Does anybody have any example settings for this? I thought perhaps 'usr/lib/X11' and '/usr/include/X11'?? Cheers and thanks again Derek At 15:16 22/09/2003 +0100, rpg at mrc-lmb.cam.ac.uk wrote: >Hi Derek - X11 on MacOsX is effectively broken w.r.t. EMBOSS. You could >try installing Xfree86 4.3, or waiting for Panther ;) > >r > >-- >Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ >MRC-LMB, Cambridge, UK >PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From kkmattil at csc.fi Mon Sep 22 10:58:50 2003 From: kkmattil at csc.fi (Kimmo Mattila) Date: Mon, 22 Sep 2003 17:58:50 +0300 (EEST) Subject: [EMBOSS] Plplot In-Reply-To: <5.2.1.1.1.20030922153330.036d2270@udcf.gla.ac.uk> References: <5.2.1.1.1.20030922150217.00b16f18@udcf.gla.ac.uk> <5.2.1.1.1.20030922153330.036d2270@udcf.gla.ac.uk> Message-ID: On Mon, 22 Sep 2003, Derek Gatherer wrote: Hi We had this problem once too and our Windows support managed to solve this by changing the colour settings of Hummingbird/Exceed server program in windows 2000. If I remember correctly, the trick was to use "pseudocolour" in stead of the default value. Regards, Kimmo Mattila > I'm actually using a Windows 2000 PC running Hummingbird/Exceed to log into > a Tru64 server. Maybe the problem extends to Windows as well? > > Since my last post, I saw there was one line in the manual: > > "You may need to specify the location of your X-windows library with the > configuration options: -x-includes=DIR (X include files are in DIR) > -x-libraries=DIR (X library files are in DIR)" > > Perhaps this is what is wrong. Does anybody have any example settings for > this? I thought perhaps 'usr/lib/X11' and '/usr/include/X11'?? > > Cheers and thanks again > Derek > > > At 15:16 22/09/2003 +0100, rpg at mrc-lmb.cam.ac.uk wrote: > >Hi Derek - X11 on MacOsX is effectively broken w.r.t. EMBOSS. You could > >try installing Xfree86 4.3, or waiting for Panther ;) > > > >r > > > >-- > >Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ > >MRC-LMB, Cambridge, UK > >PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ > ----------------------------------------------------------------- Kimmo Mattila, tutkija, Biol??ketieteen laitos / Biokemia PL 63, 00014 Helsingin yliopisto. Puh. 09 191 25409 Kimmo Mattila, researcher, Institute of Biomedicine, Biochemistry P.O. BOX 63, 00014 University of Helsinki. Finland Tel. +358 9 191 25409 ----------------------------------------------------------------- From gbottu at ben.vub.ac.be Mon Sep 22 11:18:30 2003 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Mon, 22 Sep 2003 17:18:30 +0200 (CEST) Subject: [EMBOSS] Note about restrict -alphabetic Message-ID: <200309221518.h8MFIUiX1125967@black.vub.ac.be> from : BEN Dear colleagues, I just tried something with restrict under EMBOSS 2.7.1. The program sorts by default the cut sites from begin to end. With parameter -alphabetic it sorts instead the output line according to the name of the restriction enzyme. All well, but if there are several cut sites for one enzyme, these are apparently output randomly. Cf. this example for the command restrict vec:puc18 -enzymes=haeiii,mboi -alphabetic ------------------- ######################################## # Program: restrict # Rundate: Mon Sep 22 17:11:15 2003 # Report_format: table # Report_file: puc18.restrict ######################################## #======================================= # # Sequence: PUC18 from: 1 to: 2686 # HitCount: 26 # # Minimum cuts per enzyme: 1 # Maximum cuts per enzyme: 2000000000 # Minimum length of recognition site: 4 # Blunt ends allowed # Sticky ends allowed # DNA is linear # Ambiguities allowed # #======================================= Start End Enzyme_name Restriction_site 5prime 3prime 5primerev 3primerev 2675 2678 HaeIII GGCC 2676 2676 . . 1741 1744 HaeIII GGCC 1742 1742 . . 1821 1824 HaeIII GGCC 1822 1822 . . 389 392 HaeIII GGCC 390 390 . . 287 290 HaeIII GGCC 288 288 . . 646 649 HaeIII GGCC 647 647 . . 2088 2091 HaeIII GGCC 2089 2089 . . 820 823 HaeIII GGCC 821 821 . . 831 834 HaeIII GGCC 832 832 . . 849 852 HaeIII GGCC 850 850 . . 1283 1286 HaeIII GGCC 1284 1284 . . 2067 2070 MboI GATC 2066 2070 . . 2325 2328 MboI GATC 2324 2328 . . 2342 2345 MboI GATC 2341 2345 . . 2378 2381 MboI GATC 2377 2381 . . 1545 1548 MboI GATC 1544 1548 . . 430 433 MboI GATC 429 433 . . 1373 1376 MboI GATC 1372 1376 . . 1448 1451 MboI GATC 1447 1451 . . 1459 1462 MboI GATC 1458 1462 . . 1467 1470 MboI GATC 1466 1470 . . 277 280 MboI GATC 276 280 . . 1557 1560 MboI GATC 1556 1560 . . 1662 1665 MboI GATC 1661 1665 . . 2003 2006 MboI GATC 2002 2006 . . 2021 2024 MboI GATC 2020 2024 . . #--------------------------------------- #--------------------------------------- ------------------------------------------------------------------------------ IMHO it would be better if the lines were sorted by enzyme name AND for each enzyme by position from begin to end. Is this also your opinion ? Sinceely, Guy Bottu From kellert at ohsu.edu Mon Sep 22 14:35:33 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Mon, 22 Sep 2003 11:35:33 -0700 Subject: [EMBOSS] X11 display Message-ID: <8CCDCAA1-ED2B-11D7-B513-0003930405E2@ohsu.edu> Greetings, I'm using EMBOSS over an ssh connection to a Sun box, I'm on a Mac OS X machine running X11. I get the folllowing error with abiview. ~/data/dseq% 79->abiview Reads ABI file and display the trace Input file: test.abi Output sequence [test.fasta]: Graph type [x11]: Error in XCreatePixmap: BadDrawable (invalid Pixmap or Window parameter). Suggestions appreciated. Thanks, Tom K. Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From kellert at ohsu.edu Mon Sep 22 14:42:07 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Mon, 22 Sep 2003 11:42:07 -0700 Subject: [EMBOSS] X11 display In-Reply-To: <8CCDCAA1-ED2B-11D7-B513-0003930405E2@ohsu.edu> Message-ID: <77C8398B-ED2C-11D7-B513-0003930405E2@ohsu.edu> I'll bet Richard Grant's not to Derek is apropos! ;-) - X11 on MacOsX is effectively broken w.r.t. EMBOSS. You could try installing Xfree86 4.3, or waiting for Panther ;) Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ On Monday, September 22, 2003, at 11:35 AM, Thomas Keller wrote: > Greetings, > I'm using EMBOSS over an ssh connection to a Sun box, I'm on a Mac OS > X machine running X11. > I get the folllowing error with abiview. > ~/data/dseq% 79->abiview > Reads ABI file and display the trace > Input file: test.abi > Output sequence [test.fasta]: > Graph type [x11]: > Error in XCreatePixmap: BadDrawable (invalid Pixmap or Window > parameter). > > Suggestions appreciated. > Thanks, > Tom K. > Tom Keller, Ph.D. > http://www.ohsu.edu/core > kellert at ohsu.edu > 503-494-2442 > > From kellert at ohsu.edu Mon Sep 22 18:16:43 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Mon, 22 Sep 2003 15:16:43 -0700 Subject: [EMBOSS] dbigcg question Message-ID: <72B4BAE6-ED4A-11D7-B513-0003930405E2@ohsu.edu> I have the GCG format databases mounted on a read only volume on my machine. To use these with Embos I made the following entry in my .embossrc file: # define dna2.ohsu.edu/gcgdata1 database for EMBOSS set emboss_db_dir /Volumes/dna2.ohsu.edu # set location of indices set emboss_indices /Users/kellert/Emboss_indices DB myembl [ type: N format: embl method: gcg fields: "id acc sv des org key" directory: $emboss_db_dir/gcgembl indexdir: $emboss_indices/gcgembl comment: "GCG embl db from dna2.ohsu.edu:/gcgdata1 mounted locally" ] and created an index directory and tried to run dbigcg as follows: kellert% dbigcg -indexdirectory /Users/kellert/Emboss_indices/gcgembl Index a GCG formatted database EMBL : EMBL SWISS : Swiss-Prot, SpTrEMBL, TrEMBLnew GENBANK : Genbank, DDBJ PIR : NBRF Entry format [EMBL]: Database directory [.]: Wildcard database filename [*.seq]: Database name: myembl Release number [0.0]: Index date [00/00/00]: EMBOSS An error in embdbi.c at line 568: Cannot open myembl001.list for writing I don't understand why this isn't working. Can someone explain this to me? Thanks, Tom K. Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From sirbooli at comcast.net Mon Sep 22 21:05:41 2003 From: sirbooli at comcast.net (sirbooli at comcast.net) Date: Tue, 23 Sep 2003 01:05:41 +0000 Subject: [EMBOSS] REMOVE ME Message-ID: <20030923010543.2328E7D45F@mercury.hgmp.mrc.ac.uk> PLEASE TAKE ME OFF THIS LIST > I can reproduce this problem on non-MacOSX platforms for large > sequences (smaller ones retrieve OK). We'll look into it. > Thanks for the information. > > Alan From d.gatherer at vir.gla.ac.uk Tue Sep 23 04:12:13 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Tue, 23 Sep 2003 09:12:13 +0100 Subject: [EMBOSS] X11 display In-Reply-To: <8CCDCAA1-ED2B-11D7-B513-0003930405E2@ohsu.edu> Message-ID: <5.2.1.1.1.20030923090021.035bf068@udcf.gla.ac.uk> further to Thomas: Yep, exactly what I've got. Try again and this time where it says Graph type [x11]: type xterm. You'll get a graph of sorts. If you don't, type '?' and you'll get a list of possible output formats. x11 will be one of them, and it seems to be the only one that doesn't work. For instance: >abiview Reads ABI file and display the trace ABI trace file: B135-F Output sequence [b135-f.fasta]: Graph type [x11]: ps Created abiview.ps So postscript works, and so does png. Last night, I tried reinstalling with a configure flag specifically set to look for x11 ./configure --prefix=/$SOFTWARE/emboss --exec-prefix=/$SOFTWARE --with-pngpdriver=/$SOFTWARE/emboss/share/EMBOSS --x-includes=/usr/include/X11 --x-libraries=/usr/lib/X11 (where $SOFTWARE abbreviates my actual path), but even with x-includes it doesn't work. In my config.log I have: ac_x_includes=/usr/include/X11 ac_x_libraries=/usr/lib/X11' CXXFLAGS='-g -I/usr/include/X11' XLIB=' -L/usr/lib/X11 -lX11 ' X_CFLAGS=' -I/usr/include/X11' X_LIBS=' -L/usr/lib/X11' which I didn't before I specified --x-includes at configure. So I'm more or less stumped here. Either I'm making an elementary mistake with my paths or there is a problem on Windows as well as Mac. Cheers Derek At 11:35 22/09/2003 -0700, you wrote: >Greetings, >I'm using EMBOSS over an ssh connection to a Sun box, I'm on a Mac OS X >machine running X11. >I get the folllowing error with abiview. >~/data/dseq% 79->abiview >Reads ABI file and display the trace >Input file: test.abi >Output sequence [test.fasta]: >Graph type [x11]: >Error in XCreatePixmap: BadDrawable (invalid Pixmap or Window parameter). > >Suggestions appreciated. >Thanks, >Tom K. >Tom Keller, Ph.D. >http://www.ohsu.edu/core >kellert at ohsu.edu >503-494-2442 From ame at esbs.u-strasbg.fr Tue Sep 23 04:46:17 2003 From: ame at esbs.u-strasbg.fr (Jean-Christophe AME) Date: Tue, 23 Sep 2003 10:46:17 +0200 Subject: [EMBOSS] X11 display In-Reply-To: <77C8398B-ED2C-11D7-B513-0003930405E2@ohsu.edu> Message-ID: <65954BF8-EDA2-11D7-9E69-0005024329A7@esbs.u-strasbg.fr> Hello, Developer release 2 of X11 for mac OSX works well. However, it seems strange that the EMBOSS package is the only program that doesn't work with X11 DR3. All the other softwares that required X11 worked very well. Jean-Christophe Le lundi, 22 sep 2003, ? 20:42 Europe/Paris, Thomas Keller a ?crit : > I'll bet Richard Grant's not to Derek is apropos! ;-) > - X11 on MacOsX is effectively broken w.r.t. EMBOSS. You could > try installing Xfree86 4.3, or waiting for Panther ;) > Richard P. Grant > http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ > > On Monday, September 22, 2003, at 11:35 AM, Thomas Keller wrote: > >> Greetings, >> I'm using EMBOSS over an ssh connection to a Sun box, I'm on a Mac OS >> X machine running X11. >> I get the folllowing error with abiview. >> ~/data/dseq% 79->abiview >> Reads ABI file and display the trace >> Input file: test.abi >> Output sequence [test.fasta]: >> Graph type [x11]: >> Error in XCreatePixmap: BadDrawable (invalid Pixmap or Window >> parameter). >> >> Suggestions appreciated. >> Thanks, >> Tom K. >> Tom Keller, Ph.D. >> http://www.ohsu.edu/core >> kellert at ohsu.edu >> 503-494-2442 >> >> > > ________________________ Jean-Christophe Am?, PhD U.P.R. 9003 du CNRS - Canc?rog?n?se et Mutag?n?se Mol?culaire et Structurale ?cole Sup?rieure de Biotechnologie de Strasbourg P?le API Parc d'innovation, Boulevard S?bastien Brant BP 10413 67412 ILLKIRCH CEDEX France tel.: 33 3 90 24 47 05 Fax.: 33 3 90 24 46 86 http://parplink.u-strasbg.fr http://www-esbs.u-strasbg.fr/centrerech/upr9003/upr9003.html -------------- next part -------------- A non-text attachment was scrubbed... Name: not available Type: text/enriched Size: 1709 bytes Desc: not available Url : http://lists.open-bio.org/pipermail/emboss/attachments/20030923/c2b374f8/attachment.bin From rpg at mrc-lmb.cam.ac.uk Tue Sep 23 04:49:16 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Tue, 23 Sep 2003 09:49:16 +0100 (BST) Subject: [EMBOSS] X11 display In-Reply-To: <65954BF8-EDA2-11D7-9E69-0005024329A7@esbs.u-strasbg.fr> from Jean-Christophe AME at "Sep 23, 2003 10:46:17 am" Message-ID: <200309230849.h8N8nGq204954@alf1.lmb.internal> Jean-Christophe AME wrote: >Developer release 2 of X11 for mac OSX works well. However, it seems with EMBOSS? >strange that the EMBOSS package is the only program that doesn't work >with X11 DR3. All the other softwares that required X11 worked very >well. Yes, I found that strange. With the SDK installed and everything. r -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From d.gatherer at vir.gla.ac.uk Tue Sep 23 04:57:19 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Tue, 23 Sep 2003 09:57:19 +0100 Subject: [EMBOSS] Plplot and X11 In-Reply-To: References: <5.2.1.1.1.20030922153330.036d2270@udcf.gla.ac.uk> <5.2.1.1.1.20030922150217.00b16f18@udcf.gla.ac.uk> <5.2.1.1.1.20030922153330.036d2270@udcf.gla.ac.uk> Message-ID: <5.2.1.1.1.20030923094953.00af3188@udcf.gla.ac.uk> In fact, Kimmo has the/a right answer. The instructions are here: http://www.oucs.ox.ac.uk/windows/exceed/index.xml?style=printable Cheers Derek At 17:58 22/09/2003 +0300, Kimmo Mattila wrote: >On Mon, 22 Sep 2003, Derek Gatherer wrote: > >Hi > >We had this problem once too and our Windows support managed to solve >this by changing the colour settings of Hummingbird/Exceed server program >in windows 2000. If I remember correctly, the trick was to use >"pseudocolour" in stead of the default value. > >Regards, > >Kimmo Mattila > > > > I'm actually using a Windows 2000 PC running Hummingbird/Exceed to log into > > a Tru64 server. Maybe the problem extends to Windows as well? > > > > Since my last post, I saw there was one line in the manual: > > > > "You may need to specify the location of your X-windows library with the > > configuration options: -x-includes=DIR (X include files are in DIR) > > -x-libraries=DIR (X library files are in DIR)" > > > > Perhaps this is what is wrong. Does anybody have any example settings for > > this? I thought perhaps 'usr/lib/X11' and '/usr/include/X11'?? > > > > Cheers and thanks again > > Derek > > > > > > At 15:16 22/09/2003 +0100, rpg at mrc-lmb.cam.ac.uk wrote: > > >Hi Derek - X11 on MacOsX is effectively broken w.r.t. EMBOSS. You could > > >try installing Xfree86 4.3, or waiting for Panther ;) > > > > > >r > > > > > >-- > > >Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ > > >MRC-LMB, Cambridge, UK > > >PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ > > > >----------------------------------------------------------------- >Kimmo Mattila, tutkija, Biol??ketieteen laitos / Biokemia >PL 63, 00014 Helsingin yliopisto. >Puh. 09 191 25409 > >Kimmo Mattila, researcher, Institute of Biomedicine, Biochemistry >P.O. BOX 63, 00014 University of Helsinki. Finland >Tel. +358 9 191 25409 >----------------------------------------------------------------- From lmullan at hgmp.mrc.ac.uk Tue Sep 23 05:21:41 2003 From: lmullan at hgmp.mrc.ac.uk (Lisa Mullan) Date: Tue, 23 Sep 2003 10:21:41 +0100 (BST) Subject: [EMBOSS] EMBOSS tutorial In-Reply-To: <200309230902.h8N92xrr007095@bromine.hgmp.mrc.ac.uk> Message-ID: Dear Hideya, In the spirit of the Open Source agreement, you may indeed translate the tutorial into Japanese, as long as you make it available to others. We would also appreciate a copy ourselves to possibly put up on the EMBOSS site as it may encourage others to do the same. Regards, Lisa Mullan HGMP Resource Centre Hinxton, Cambridge, CB10 1SB Tel: 01223 494526 Email: lmullan at hgmp.mrc.ac.uk > Content-Type: Text/Plain; charset=us-ascii > Content-Transfer-Encoding: 7bit > Sender: owner-emboss at hgmp.mrc.ac.uk > Precedence: bulk > Status: RO > Content-Length: 872 > > Hi, > > > I'm interested in EMBOSS tutorial > (http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Tutorial/emboss_tutorial/) > as well as EMBOSS itself. > It is very helpful to understand EMBOSS applications, > but some people that are not good at English can't utilize it. > My colleague has a plan to translate it into Japanese, and > I agree with him. We consider that our result also should be open publicly. > > Although all programs in EMBOSS is clearly described > as "they are released under GPL" and I believe that the spirit > is the same to the tutorial, I can't find any license of the tutorial. > > Could you let me know about the following points? > > - Is there any description about license of EMBOSS tutorial, > such as GNU FDL(http://www.gnu.org/licenses/fdl.html)? > > - If not, can we open and distribute our translation, publicly? > > best, > > Hideya > --- > Hideya KAWAJI > From rimmasters6912811rinrinrin55 at yahoo.com Tue Sep 23 10:44:11 2003 From: rimmasters6912811rinrinrin55 at yahoo.com (Betty) Date: Tue, 23 Sep 2003 07:44:11 -0700 Subject: [EMBOSS] I will do all you want ! Message-ID: <2003096715.12167.qmail@yahoo.com> Hi Eric ! I am doing something I never thought I would do. Because I need some money (you know that I'am a student ;-) ) I will start my own nude livecam next week. The webcam is already online and it would be great if you could test the performane of my cam: http://betty.my-free-website.com There is also a chat - please test this too. Of course I will do all you want..... Just tell me via chat what you want to see: http://betty.my-free-website.com Your test should be something like a "real customer simulation" ;-) What are you doing this summer ? Yours, Betty http://betty.my-free-website.com From kellert at ohsu.edu Tue Sep 23 14:15:37 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Tue, 23 Sep 2003 11:15:37 -0700 Subject: [EMBOSS] how to set path to plstnd5.fnt Message-ID: Greetings, I can't seem to find my notes on how to tell emboss and/or my xterm app where the ../share/EMBOSS/plstnd5.fnt fonts file is located. It seems like the xterm app that needs to know this path, correct? Could someone remind me? Thanks, Tom K Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From kellert at ohsu.edu Tue Sep 23 15:51:28 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Tue, 23 Sep 2003 12:51:28 -0700 Subject: [EMBOSS] how to set path to plstnd5.fnt In-Reply-To: Message-ID: <52474032-EDFF-11D7-9AF4-0003930405E2@ohsu.edu> Damn, I'll answer my own question: read tfm at http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Admin_guide/adminguide/ node3.html#SECTION00330000000000000000 Also don't forget to setenv the DISPLAY if you on an x11 window. On Tuesday, September 23, 2003, at 11:15 AM, Thomas Keller wrote: > Greetings, > I can't seem to find my notes on how to tell emboss and/or my xterm > app where the ../share/EMBOSS/plstnd5.fnt fonts file is located. It > seems like the xterm app that needs to know this path, correct? > Could someone remind me? > Thanks, > Tom K > Tom Keller, Ph.D. > http://www.ohsu.edu/core > kellert at ohsu.edu > 503-494-2442 > > From kawaji at plala.to Wed Sep 24 12:37:30 2003 From: kawaji at plala.to (KAWAJI Hideya) Date: Thu, 25 Sep 2003 01:37:30 +0900 (JST) Subject: [EMBOSS] EMBOSS tutorial In-Reply-To: References: <200309230902.h8N92xrr007095@bromine.hgmp.mrc.ac.uk> Message-ID: <20030925.013730.730555716.kawaji@plala.to> Dear David and Lisa, Thank you very much for permission to our translation. (I received the permission from David, directly) I'm going to promote our project, while I contact the original author, Val Curwen. From: Lisa Mullan Subject: [EMBOSS] EMBOSS tutorial Date: Tue, 23 Sep 2003 10:21:41 +0100 (BST) ...snip > We would also appreciate a copy ourselves to possibly put up on the EMBOSS > site as it may encourage others to do the same. It is very honor to put up our translation on the EMBOSS site. Yes! I'll post its URL or itself when we complete it. Best regards, Hideya --- Hideya KAWAJI From kellert at ohsu.edu Wed Sep 24 20:26:05 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Wed, 24 Sep 2003 17:26:05 -0700 Subject: [EMBOSS] genbank mirror via srswww Message-ID: Hi all, Can't seem to be able to get a genbank connection via methodquery: srswww kellert% infoseq genbank:AY243029 Displays some simple information about sequences Error: Failed to find host 'cbr-nrc.cnrc.gc.ca' for database 'genbank' Error: Unable to read sequence 'genbank:AY243029' Died: infoseq terminated: Bad value for '-sequence' and no prompt Here's my definition: DB genbank [ type: N methodquery: srswww format: genbank url: "http://cbr-nrc.cnrc.gc.ca/srs6bin/cgi-bin/wgetz" release: GenBank dbalias: genbank comment: "GenBank from the Cananadian srs server" ] Thanks for any help. Tom K. Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From R-1-721447-16268191-2-47031-US2-A8DE9744 at xmr3.com Thu Sep 25 00:56:58 2003 From: R-1-721447-16268191-2-47031-US2-A8DE9744 at xmr3.com (International Scientific Communications, Inc.) Date: Thu, 25 Sep 2003 00:56:58 -0400 Subject: [EMBOSS] Laboratory Instrumentation News - September 2003 Message-ID: An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030925/bba0ed78/attachment.html From rpg at mrc-lmb.cam.ac.uk Thu Sep 25 02:54:24 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Thu, 25 Sep 2003 07:54:24 +0100 (BST) Subject: [EMBOSS] genbank mirror via srswww In-Reply-To: from Thomas Keller at "Sep 24, 2003 05:26:05 pm" Message-ID: <200309250654.h8P6sOE375963@alf1.lmb.internal> Hi Tom, >kellert% infoseq genbank:AY243029 >Displays some simple information about sequences >Error: Failed to find host 'cbr-nrc.cnrc.gc.ca' for database 'genbank' >Error: Unable to read sequence 'genbank:AY243029' >Died: infoseq terminated: Bad value for '-sequence' and no prompt I pasted http://cbr-nrc.cnrc.gc.ca/srs6bin/cgi-bin/wgetz into a browser and got Unknown Host Description: Unable to locate the server named "cbr-nrc.cnrc.gc.ca" --- the server does not have a DNS entry. Perhaps there is a misspelling in the server name, or the server no longer exists. Double-check the name and try again Either the server's down or the name is wrong. r -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From vac at sanger.ac.uk Thu Sep 25 03:54:43 2003 From: vac at sanger.ac.uk (Val Curwen) Date: Thu, 25 Sep 2003 08:54:43 +0100 Subject: [EMBOSS] EMBOSS tutorial In-Reply-To: <20030925.013730.730555716.kawaji@plala.to> References: <200309230902.h8N92xrr007095@bromine.hgmp.mrc.ac.uk> <20030925.013730.730555716.kawaji@plala.to> Message-ID: <3F729F43.3010006@sanger.ac.uk> Hi all, KAWAJI Hideya wrote: > Dear David and Lisa, > > > Thank you very much for permission to our translation. > (I received the permission from David, directly) > I'm going to promote our project, while I contact the original author, > Val Curwen. > Here I am! As far as I'm concerned you're welcome to translate and promote it as you wish. Best wishes, Val > From: Lisa Mullan > Subject: [EMBOSS] EMBOSS tutorial > Date: Tue, 23 Sep 2003 10:21:41 +0100 (BST) > > ...snip > >>We would also appreciate a copy ourselves to possibly put up on the EMBOSS >>site as it may encourage others to do the same. > > > It is very honor to put up our translation on the EMBOSS site. > Yes! I'll post its URL or itself when we complete it. > > > Best regards, > > Hideya > --- > Hideya KAWAJI > > -- Val Curwen, Ensembl Project Leader, The Sanger Centre, Wellcome Trust Genome Campus, Hinxton, Cambridge, UK. CB10 1SA From pmr at ebi.ac.uk Thu Sep 25 05:28:09 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 25 Sep 2003 10:28:09 +0100 Subject: [EMBOSS] genbank mirror via srswww References: Message-ID: <3F72B529.8030704@ebi.ac.uk> Thomas Keller wrote: > Hi all, > Can't seem to be able to get a genbank connection via methodquery: srswww > > Here's my definition: > DB genbank [ > type: N > methodquery: srswww > format: genbank > url: "http://cbr-nrc.cnrc.gc.ca/srs6bin/cgi-bin/wgetz" The URL is incorrect. Did it work before? Being Canadian, they have English and French now for two parts of the host address. The nrc goes with the second part. http://cbr-rbc.nrc-cnrc.gc.ca/srs6bin/cgi-bin/wgetz Hope this helps, Peter Rice From kawaji at plala.to Thu Sep 25 09:29:01 2003 From: kawaji at plala.to (KAWAJI Hideya) Date: Thu, 25 Sep 2003 22:29:01 +0900 (JST) Subject: [EMBOSS] EMBOSS tutorial In-Reply-To: <3F729F43.3010006@sanger.ac.uk> References: <20030925.013730.730555716.kawaji@plala.to> <3F729F43.3010006@sanger.ac.uk> Message-ID: <20030925.222901.730553957.kawaji@plala.to> Dear Val and all, From: Val Curwen Subject: Re: [EMBOSS] EMBOSS tutorial Date: Thu, 25 Sep 2003 08:54:43 +0100 ...snip > Here I am! As far as I'm concerned you're welcome to translate and > promote it as you wish. Thank you very much! I appreciate all of the authors' permission to our translation. We are working on Wiki at: http://transgenic.cats.st/jambo/index.php?%5B%5BEMBOSS%CB%DD%CC%F5%A5%D7%A5%ED%A5%B8%A5%A7%A5%AF%A5%C8%5D%5D We are welcome to your comments or direct modification, if you can read them. Of course, I'll announce again when we finish it. Best regards, Hideya --- Hideya KAWAJI From reply-647674adcd-emboss=embnet.org at o.vresp.com Thu Sep 25 15:23:59 2003 From: reply-647674adcd-emboss=embnet.org at o.vresp.com (iList) Date: Thu, 25 Sep 2003 19:23:59 +0000 Subject: [EMBOSS] Fill out Surveys and Win Cash! Message-ID: <20030925192359.5E39C7D46F@mercury.hgmp.mrc.ac.uk> It?s for real! The NPD Group, a top ten market research company, is making winners of people just like you. In August 2003, NPD Online Research gave away 63,900.00 to panelists just for sharing their opinions on products and services. In fact, just for joining you are entered for the chance to win $1,000! Surprisingly, despite all the cash being won, our panelists recently told us the #1 reason they continually participate in our surveys is NOT Cash! What could be better than CASH??? To find out the #1 reason panelists participate with NPD Online Research and to become a panelist yourself click on the link below! http://r.vresp.com/?iListInc./b8df0f0ac9/123710/e0d7580310 It only takes a few minutes to join the NPD Online Research Panel. Just click on the link above, sign up and complete your Member Profile Survey. Upon completion of your profile, you will be entered into your first NPDOR Sweepstakes for the chance to win $1,000! Don?t waste time. You could be our next sweepstakes winner!!! ______________________________________________________________________ You are receiving this email because you requested to receive info and updates via email. To unsubscribe, reply to this email with "unsubscribe" in the subject or simply click on the following link: http://unsub.vresp.com/u.html?647674adcd/e0d7580310 _____________________________________________________________________ This message was sent by iList using VerticalResponse's iBuilder (TM) Read the VerticalResponse marketing policy: http://www.verticalresponse.com/content/pm_policy.html -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030925/8862f946/attachment.html From kellert at ohsu.edu Thu Sep 25 15:26:01 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Thu, 25 Sep 2003 12:26:01 -0700 Subject: [EMBOSS] dbigcg warning Message-ID: <190398A1-EF8E-11D7-9AF4-0003930405E2@ohsu.edu> Greetings, I'm trying to create an emboss index in a directory owned by me of a gcggenbank database that I have read only permission on. when I run dbigcg from within my index dir I get the following: Warning: ajStrFixI called with length 2048 for string with size 2048 and the program seems to stall. Any suggestions? Thanks, Tom K. Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From asen.nenov at metalife.de Fri Sep 26 09:40:00 2003 From: asen.nenov at metalife.de (Asen Nenov) Date: Fri, 26 Sep 2003 16:40:00 +0300 Subject: [EMBOSS] EMBOSS qualifiers that doesn't work Message-ID: <3F7441B0.1010801@metalife.de> From laxman at CGR.Harvard.edu Fri Sep 26 11:35:04 2003 From: laxman at CGR.Harvard.edu (Lakshmanan Iyer) Date: Fri, 26 Sep 2003 11:35:04 -0400 Subject: [EMBOSS] GCG: FRAMEALIGN- align protein-6 frames of DNA Message-ID: <339D68B133EAD311971E009027DC4797880231@montecarlo.cgr.harvard.edu> Hello, Is there an EMBOSS equivalent of GCG:FrameAlign? It creates an optimal alignment of the best segment of similarity (local alignment) between a protein sequence and the codons in all possible reading frames on a single strand of a nucleotide sequence. Optimal alignments may include reading frame shifts. This is a very crucial tool for the evolutionary biologists. -thanks -laxman Lakshmanan Iyer, Ph. D. Computational Biologist Manager of Collaboration and Training Computational Biology Group Bauer Center for Genomics Research Bauer Laboratory 7 Divinity Ave. Cambridge, MA 02138 www.cgr.harvard.edu Phone:617-384-7647 Fax: 617-495-2196 -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030926/0c9f3c82/attachment.html From jason at cgt.duhs.duke.edu Fri Sep 26 11:43:29 2003 From: jason at cgt.duhs.duke.edu (Jason Stajich) Date: Fri, 26 Sep 2003 11:43:29 -0400 (EDT) Subject: [EMBOSS] GCG: FRAMEALIGN- align protein-6 frames of DNA In-Reply-To: <339D68B133EAD311971E009027DC4797880231@montecarlo.cgr.harvard.edu> References: <339D68B133EAD311971E009027DC4797880231@montecarlo.cgr.harvard.edu> Message-ID: What is wrong with using tfasty/tfastx (FASTA package)? fastx3/ fasty3 Compare a DNA sequence to a protein sequence database, by comparing the translated DNA sequence in three frames and allowing gaps and frameshifts. fastx3 uses a simpler, faster algorithm for alignments that allows frameshifts only between codons; fasty3 is slower but produces better align- ments with poor quality sequences because frameshifts are allowed within codons. tfastx3/ tfasty3 Compare a protein sequence to a DNA sequence database, calculating similarities with frameshifts to the forward and reverse orientations. tfasta3 Compare a protein sequence to a DNA sequence database, calculating similarities (without frameshifts) to the 3 forward and three reverse reading frames. tfastx3 and tfasty3 are preferred because they calculate similarity over frameshifts. -jason On Fri, 26 Sep 2003, Lakshmanan Iyer wrote: > Hello, > > Is there an EMBOSS equivalent of GCG:FrameAlign? > > It creates an optimal alignment of the best segment of similarity (local > alignment) between a protein sequence and the codons in all possible reading > frames on a single strand of a nucleotide sequence. Optimal alignments may > include reading frame shifts. > > This is a very crucial tool for the evolutionary biologists. > > -thanks > > -laxman > > > > > > Lakshmanan Iyer, Ph. D. > > Computational Biologist > > Manager of Collaboration and Training > > Computational Biology Group > > Bauer Center for Genomics Research > > Bauer Laboratory > > 7 Divinity Ave. > > Cambridge, MA 02138 > > www.cgr.harvard.edu > > Phone:617-384-7647 > > Fax: 617-495-2196 > > > > -- Jason Stajich Duke University jason at cgt.mc.duke.edu From kellert at ohsu.edu Fri Sep 26 14:14:29 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Fri, 26 Sep 2003 11:14:29 -0700 Subject: [EMBOSS] biomirror-gcg Message-ID: <454E4C28-F04D-11D7-9AF4-0003930405E2@ohsu.edu> Hi all, the biomirror-gcg directory at ftp://iubio.bio.indiana.edu/ contains an emboss-default file, but no indexed (dbigcg) databases. The directory above that contains lots of dbs, but I can't tell which if any are pre-indexed. Has anyone used these with emboss, what db's are the pre-indexed ones? [I'm still having trouble running dbigcg on my installation. So these pre-indexed dbs would be useful.] Thanks, Tom K. Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From stefanielager at fastmail.ca Mon Sep 29 01:14:45 2003 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Mon, 29 Sep 2003 01:14:45 -0400 (EDT) Subject: Fwd: [EMBOSS] GCG: FRAMEALIGN- align protein-6 frames of DNA Message-ID: <3F77BFC5.000071.81208@ns.interchange.ca> I think wise2 (the estwise and estwisedb programs) does this . http://www.ebi.ac.uk/Wise2/ Stefanie > Hello, > > Is there an EMBOSS equivalent of GCG:FrameAlign? > > It creates an optimal alignment of the best segment of similarity > (local alignment) between a protein sequence and the codons in all > possible reading frames on a single strand of a nucleotide > sequence. Optimal alignments may include reading frame shifts. > > This is a very crucial tool for the evolutionary biologists. > > -thanks > > -laxman > > > > > > Lakshmanan Iyer, Ph. D. > > Computational Biologist > > Manager of Collaboration and Training > > Computational Biology Group > > Bauer Center for Genomics Research > > Bauer Laboratory > > 7 Divinity Ave. > > Cambridge, MA 02138 > > www.cgr.harvard.edu > > Phone:617-384-7647 > > Fax: 617-495-2196 > > _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From stefanielager at fastmail.ca Mon Sep 29 01:21:32 2003 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Mon, 29 Sep 2003 01:21:32 -0400 (EDT) Subject: Fwd: [EMBOSS] GCG: FRAMEALIGN- align protein-6 frames of DNA Message-ID: <3F77C15C.000073.81208@ns.interchange.ca> Also the programs protal2dna: http://bioweb.pasteur.fr/docs/softgen.html#PROTAL2DNA and RevTrans: http://www.cbs.dtu.dk/services/RevTrans/ Might be useful Stefanie > I think wise2 (the estwise and estwisedb programs) does this . > > http://www.ebi.ac.uk/Wise2/ > > Stefanie > >> Hello, >> >> Is there an EMBOSS equivalent of GCG:FrameAlign? >> >> It creates an optimal alignment of the best segment of similarity >> (local alignment) between a protein sequence and the codons in >> all possible reading frames on a single strand of a nucleotide >> sequence. Optimal alignments may include reading frame shifts. >> >> This is a very crucial tool for the evolutionary biologists. >> >> -thanks >> >> -laxman >> >> >> >> >> >> Lakshmanan Iyer, Ph. D. >> >> Computational Biologist >> >> Manager of Collaboration and Training >> >> Computational Biology Group >> >> Bauer Center for Genomics Research >> >> Bauer Laboratory >> >> 7 Divinity Ave. >> >> Cambridge, MA 02138 >> >> www.cgr.harvard.edu >> >> Phone:617-384-7647 >> >> Fax: 617-495-2196 >> >> > _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians -------------- next part -------------- An embedded and charset-unspecified text was scrubbed... Name: attachment Url: http://lists.open-bio.org/pipermail/emboss/attachments/20030929/94b9d9bd/attachment.pl From nancyyu at imb.sinica.edu.tw Mon Sep 29 05:52:15 2003 From: nancyyu at imb.sinica.edu.tw (Nancy Yu) Date: Mon, 29 Sep 2003 17:52:15 +0800 Subject: [EMBOSS] Using Mirror and SynCron to update databases In-Reply-To: <20030929023858.M41138@imb.sinica.edu.tw> References: <20030929023858.M41138@imb.sinica.edu.tw> Message-ID: <20030929095215.M80771@imb.sinica.edu.tw> Hi, I'm having problems with Mirror and I don't know where else to get help. I installed Mirror according to instructions in SynCron (after reading README from ftp.ebi.ac.uk/pub/databases/embl/new), and tested it with the "mirror -n" option. I find that with some ftp sites it connects just fine; for other sites Mirror cannot get a list of the target remote directory content and times out; and other times it lists the target directory as empty, when that directory actually has files in it. Does this have to do with the setting of my mirror.defaults file or with the different ftp sites?? Do people use other scripts/programs to keep their local databases updated? Any suggestions would be greatly appreciated. Nancy Yu -- Institute of Molecular Biology Academia Sinica R.O.C. IMBCC WebMail From henrikki.almusa at helsinki.fi Mon Sep 29 06:19:17 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Mon, 29 Sep 2003 13:19:17 +0300 Subject: [EMBOSS] Using Mirror and SynCron to update databases In-Reply-To: <20030929095215.M80771@imb.sinica.edu.tw> References: <20030929023858.M41138@imb.sinica.edu.tw> <20030929095215.M80771@imb.sinica.edu.tw> Message-ID: <200309291319.17304.henrikki.almusa@helsinki.fi> On Monday 29 September 2003 12:52, Nancy Yu wrote: > I'm having problems with Mirror and I don't know where else to get help. I > installed Mirror according to instructions in SynCron (after reading README > from ftp.ebi.ac.uk/pub/databases/embl/new), and tested it with the "mirror > -n" option. I find that with some ftp sites it connects just fine; for > other sites Mirror cannot get a list of the target remote directory content > and times out; and other times it lists the target directory as empty, when > that directory actually has files in it. Home page for mirror is "http://sunsite.org.uk/packages/mirror/" There is a patch for ftp.pl, which fixes this kind of bug. I had similar problems and they were fixed with this. It also has a kind of security fix. And a lot of info on options in mirror (lke the html pages that comes with mirror). > Does this have to do with the setting of my mirror.defaults file or with > the different ftp sites?? Do people use other scripts/programs to keep > their local databases updated? Any suggestions would be greatly > appreciated. I have my own perl script which uses mirror for downloading some databases (wget has some negative sides for my situation). I did this simply to automatically do indexes for emboss and others (and to save some space on hard drive as well). Hope this helps -- Henrikki Almusa From d.gatherer at vir.gla.ac.uk Tue Sep 30 06:14:12 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Tue, 30 Sep 2003 11:14:12 +0100 Subject: [EMBOSS] ajCodCalcNc in chips Message-ID: <5.2.1.1.1.20030930111106.00b14960@udcf.gla.ac.uk> Hi Chips has the following line: Nc=ajCodCalcNc(&codon); Is the source for this function available? It might be useful for adapting to generate other codon bias measures. Cheers Derek _________________________ Derek Gatherer Ph.D. Cert.Ed. Computer Officer Institute of Virology Church St. Glasgow G11 5JR Phone: +44 141 330 6268 Fax: +44 141 337 2236 Email: d.gatherer at vir.gla.ac.uk Website: http://www.vir.gla.ac.uk From henrikki.almusa at helsinki.fi Tue Sep 30 08:15:39 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Tue, 30 Sep 2003 15:15:39 +0300 Subject: [EMBOSS] ajCodCalcNc in chips In-Reply-To: <5.2.1.1.1.20030930111106.00b14960@udcf.gla.ac.uk> References: <5.2.1.1.1.20030930111106.00b14960@udcf.gla.ac.uk> Message-ID: <200309301515.39768.henrikki.almusa@helsinki.fi> On Tuesday 30 September 2003 13:14, Derek Gatherer wrote: > Hi > > Chips has the following line: > > Nc=ajCodCalcNc(&codon); > > Is the source for this function available? It might be useful for adapting > to generate other codon bias measures. Srs at ebi (http://srs6.ebi.ac.uk/) can search for emboss functions, commands and so forth. Here "http://srs6.ebi.ac.uk/srsbin/cgi-bin/wgetz?-id+15hD01MACCC+-e+[EFUNC:'ajCodCalcNc']+-qnum+1+-enum+1" is the result for ajCodCalcNc. Hope this helps -- Henrikki Almusa From jison at hgmp.mrc.ac.uk Mon Sep 1 10:33:16 2003 From: jison at hgmp.mrc.ac.uk (Dr J.C. Ison) Date: Mon, 01 Sep 2003 11:33:16 +0100 Subject: [EMBOSS] Where did the protein structure programs go? References: Message-ID: <3F53206C.C41B98B0@hgmp.mrc.ac.uk> Hi David Sorry - just back from hols ! They're in the EMBASSY package "domainatrix". Please note the caveat below. I'm in the process of making things more generic though and the new versions *will* be available as part of EMBOSS Cheers J. ** This program is part of a suite of EMBOSS applications that directly or ** indirectly make use of the protein structure databases pdb and scop. ** This program is part of an experimental analysis pipeline described in an ** accompanying document. We provide the software in the hope that it will ** be useful. The applications were designed for specific research purposes ** and may not be useful or reliable in contexts other than the described ** pipeline. The development of the suite was coordinated by Jon Ison to ** whom enquiries and bug reports should be sent (email jison at hgmp.mrc.ac.uk). David Martin wrote: > EMBOSS had some protein structure stuff in it. This all seems to have > disappeared? > > ..d > -- > David Martin PhD > Bioinformatics Scientific Officer > Post-Genomics and Molecular Interactions Centre > University of Dundee -- Jon C. Ison, PhD Bioinformatics Applications Group UK MRC Human Genome Mapping Project Resource Centre Hinxton, Cambridge, CB10 1SB, UK E-mail : jison at hgmp.mrc.ac.uk Tel : 01223 49-4548 HGMP-RC: http://www.hgmp.mrc.ac.uk/ EMBOSS : http://www.hgmp.mrc.ac.uk/Software/EMBOSS/ From David.Bauer at SCHERING.DE Mon Sep 1 11:20:08 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Mon, 1 Sep 2003 13:20:08 +0200 Subject: [EMBOSS] infoseq sequence type Message-ID: Hello, infoseq seems to have a problem if it reads a fasta file containing NA and Protein sequences. I originally wanted to use this program to differentiate between the sequence types. But it seems that infoseq only checks the first sequence in the fasta files and assumes the same type for all other sequences. So if first sequence is protein, all other are declared as protein even if they are nucl. and vice versa. Would it be possible to change infoseq so it would do the type check for each sequence in a multiple sequence file ? Thanks, David. From gwilliam at hgmp.mrc.ac.uk Mon Sep 1 12:15:44 2003 From: gwilliam at hgmp.mrc.ac.uk (Gary Williams, Tel 01223 494522) Date: Mon, 01 Sep 2003 13:15:44 +0100 Subject: [EMBOSS] infoseq sequence type References: Message-ID: <3F533870.8FC0D7E7@hgmp.mrc.ac.uk> David, It has now been changed so that it checks the type of every input sequence. Gary David.Bauer at SCHERING.DE wrote: > > Hello, > > infoseq seems to have a problem if it reads a fasta file containing NA and > Protein sequences. > I originally wanted to use this program to differentiate between the > sequence types. > But it seems that infoseq only checks the first sequence in the fasta files > and assumes the same type for all other sequences. > So if first sequence is protein, all other are declared as protein even if > they are nucl. and vice versa. > Would it be possible to change infoseq so it would do the type check for > each sequence in a multiple sequence file ? > > Thanks, > David. -- Gary Williams Tel: +44 1223 494522 Fax: +44 1223 494512 mailto:G.Williams at hgmp.mrc.ac.uk http://www.hgmp.mrc.ac.uk/ Bioinformatics, MRC HGMP, Hinxton, Cambridge, CB10 1SB, UK From bianji at jincao.com Tue Sep 2 04:00:14 2003 From: bianji at jincao.com (bianji at jincao.com) Date: Tue, 2 Sep 2003 12:00:14 +0800 Subject: [EMBOSS] =?GB2312?B?1tC5+s341b7Az9fWusUgIMj9xOrU9rOkyNXI1dDC?= Message-ID: <20030902035842.60D237D0E7@mercury.hgmp.mrc.ac.uk> ??????????????????????? www.jincao.com ?????????????????????????? www.jincao.com/t1.htm ???????????? msm at jincao.com 2003?9?2? From kmr at sanger.ac.uk Tue Sep 2 17:18:20 2003 From: kmr at sanger.ac.uk (Kim Rutherford) Date: Tue, 2 Sep 2003 18:18:20 +0100 Subject: [EMBOSS] union and splitter changes Message-ID: <16212.53468.133004.394922@pcs2b.internal.sanger.ac.uk> Hi. We've modified union and splitter to cope with features (using the standard -feature flag). Feature coordinates are changed to the appropriate coordinates on the joined sequence. We've also made changes to both programs so that splitter is (somewhat) able to reverse the action of union. union was changed to add a source feature to the joined sequence to record the ID, length and position of the original sequence. splitter uses the source feature to extract the original sequence position. We have made these changes because it's sometimes useful for us to be able to be merge an ordered and oriented stream of embl entries into one entry for analysis (such as running gene finders and similarity searches). It also allows all the sequence and features from an unfinished genome to be view and edited simultaneously in Artemis and ACT. One further change to union is the -findoverlap option which searches pairs of sequences for exact base overlaps and will join the sequence using the overlap information. Our group uses this option for cosmid based sequencing projects. Pairs of cosmids in the tiling path are sequenced with an overlap, annotated and then joined together for submission to EMBL. I've put the modified files on the web in case they are of use to someone else: http://www.sanger.ac.uk/Users/kmr/emboss/union.c http://www.sanger.ac.uk/Users/kmr/emboss/union.acd http://www.sanger.ac.uk/Users/kmr/emboss/splitter.c http://www.sanger.ac.uk/Users/kmr/emboss/splitter.acd The programs should be drop-in replacements for the standard programs if the new options aren't used. We've been using the latest CVS version of EMBOSS for development, so you'll probably need a CVS check-out to compile them. Kim. Here is an example using an EMBL format file: ID entry1 standard; DNA; UNC; 120 BP. FH Key Location/Qualifiers FH FT CDS join(5..100,102..103) SQ Sequence 120 BP; 40 A; 27 C; 18 G; 35 T; 0 other; gatctgcttt atttgcaaca catattgagg acttacacaa catcacaagc aatcaactgt 60 atgaaactta tcgaactgaa aagctttcaa cctcacagtt gcttttagac agtactgtcg 120 // ID entry2 standard; DNA; UNC; 120 BP. FH Key Location/Qualifiers FH FT CDS 10..20 FT CDS 110..120 SQ Sequence 120 BP; 33 A; 25 C; 11 G; 51 T; 0 other; attgtatgtt tctttttttt aaatttcaac ttcatctgct tactctacag atcccccaat 60 ttttgtaaaa attgtcgatg tatcccttaa aattttattc aactgggacc tatccaacat 120 // ID entry3 standard; DNA; UNC; 120 BP. FH Key Location/Qualifiers FH FT CDS complement(1..110) FT CDS 10..20 SQ Sequence 120 BP; 35 A; 22 C; 18 G; 45 T; 0 other; tttcaatagg ctcacttgaa agttcgttat ttacgaaaga taaagcttcc tctgcttttc 60 tttgatcaat taatgagctt tctgaattta tgctgtatat gcaatcggaa ctcaaaccat 120 // Using union -feature -source -osf embl gives: ID entry1 standard; DNA; UNC; 360 BP. FH Key Location/Qualifiers FH FT source 1..120 FT /origid="entry1" FT source 121..240 FT /origid="entry2" FT source 241..360 FT /origid="entry3" FT CDS join(5..100,102..103) FT CDS 130..140 FT CDS 230..240 FT CDS complement(241..350) FT CDS 250..260 SQ Sequence 360 BP; 108 A; 74 C; 47 G; 131 T; 0 other; gatctgcttt atttgcaaca catattgagg acttacacaa catcacaagc aatcaactgt 60 atgaaactta tcgaactgaa aagctttcaa cctcacagtt gcttttagac agtactgtcg 120 attgtatgtt tctttttttt aaatttcaac ttcatctgct tactctacag atcccccaat 180 ttttgtaaaa attgtcgatg tatcccttaa aattttattc aactgggacc tatccaacat 240 tttcaatagg ctcacttgaa agttcgttat ttacgaaaga taaagcttcc tctgcttttc 300 tttgatcaat taatgagctt tctgaattta tgctgtatat gcaatcggaa ctcaaaccat 360 // Then splitter -feature -source -osf embl gives: ID entry1 standard; DNA; UNC; 120 BP. FH Key Location/Qualifiers FH FT source 1..120 FT /origid="entry1" FT CDS join(5..100,102..103) SQ Sequence 120 BP; 40 A; 27 C; 18 G; 35 T; 0 other; gatctgcttt atttgcaaca catattgagg acttacacaa catcacaagc aatcaactgt 60 atgaaactta tcgaactgaa aagctttcaa cctcacagtt gcttttagac agtactgtcg 120 // ID entry2 standard; DNA; UNC; 120 BP. FH Key Location/Qualifiers FH FT source 1..120 FT /origid="entry2" FT CDS 10..20 FT CDS 110..120 SQ Sequence 120 BP; 33 A; 25 C; 11 G; 51 T; 0 other; attgtatgtt tctttttttt aaatttcaac ttcatctgct tactctacag atcccccaat 60 ttttgtaaaa attgtcgatg tatcccttaa aattttattc aactgggacc tatccaacat 120 // ID entry3 standard; DNA; UNC; 120 BP. FH Key Location/Qualifiers FH FT source 1..120 FT /origid="entry3" FT CDS complement(1..110) FT CDS 10..20 SQ Sequence 120 BP; 35 A; 22 C; 18 G; 45 T; 0 other; tttcaatagg ctcacttgaa agttcgttat ttacgaaaga taaagcttcc tctgcttttc 60 tttgatcaat taatgagctt tctgaattta tgctgtatat gcaatcggaa ctcaaaccat 120 // From Wei at agencourt.com Tue Sep 2 18:43:13 2003 From: Wei at agencourt.com (Wei Tao) Date: Tue, 2 Sep 2003 14:43:13 -0400 Subject: [EMBOSS] RE: prima Message-ID: <5F8E78418725B34995C3DBF115A805B31336BB@saturn.agencourt.com> Hi Sinead, Thanks a lot for your quick response. I found a copy of prima in an older version of EMBOSS download. My intention is to use prima for sequencing primer selection. However, after I tried a few sequences, from which I picked primers before, prima picked no forward sequencing primer at all. An example: INPUT SUMMARY ************* Prima of from positions 50 to 600 bps PRIMER CONSTRAINTS: PRIMA DOES NOT ALLOW PRIMER SEQUENCE AMBIGUITY OR DUPLICATE PRIMER ENDPOINTS Primer size range is 18-22 Primer GC content range is 0.40-0.55 Primer melting Temp range is 53.00 - 75.00 C PRODUCT CONSTRAINTS: Product GC content range is 0.40-0.55 Salt concentration is 50.00 (mM) DNA concentration is 50.00 (nM) Targeted range to amplify is from 50 to 600 PRIMER/PRODUCT PAIR CALCULATIONS & OUTPUT Sequence is: CCTATAGGGCGGCCGCGAATTCGGCACGAGGCTGCAACAGCAGACCAAGCACCGCGGCGGACCCAGGCAAGCACGGAACAAGCTGAGACGGATGATAATATGGATACAAAATCTATTCTAGAAGAACTTCTTCTCAAAAGATCACAGCAAAAG AAGAAAATGTCACCAAATAATTACAAAGAACGGCTTTTTGTTTTGACCAAAACAAACCTTTCCTACTATGAATATGACAAAATGAAAAGGGGCAGCAGAAAAGGATCCATTGAAATTAAGAAAATCAGATGTGTGGAGAAAGTAAATCTCGAG GAGCAGACGCCTGTAGAGAGACAGTACCCATTTCAGATTGTCTATAAAGATGGGCTTCTCTATGTCTATGCATCAAATGAAGAGAGCCGAAGTCAGTGGTTGAAAGCATTACAAAAAGAGATAAGGGGTAACCCCCACCTGCTGGTCAAGTAC CATAGTGGGTTCTTCGTGGACGGGAAGTTCCTGTGTTGCCAGCAGAGCTGTAAAGCAGCCCCAGGATGTACCCTCTGGGAAGCATATGCTAATCTGCATACTGCAGTCAATGAAGAGAAACACAGAGTTCCCACCTTCCCAGACAGAGTGCTG AAGATACCTCGGGCAGTTCCTGTTCTCAAAATGGATGCACCATCTTCAAGTACCACTCTAGCCCAATATGACAACGAATCAAAGAAAAACTATGGCTCCCAGCCACCATCTTCAAGTACCAGTCTAGCGCAATATGACAGCAACTCAAAGAAA ATCTATGGCTCCCAGCCAAACTTCAACATGCAGTATATTCCAAGGGAAGACTTCCCTGACTGGTGGCAAGTAAGAAAA Did you miss something in parameters? Any idea? Thanks again for your help. Cheers, -Wei -----Original Message----- From: Sin?ad O'Leary [mailto:oleary at genome.wi.mit.edu] Sent: Tuesday, September 02, 2003 1:39 PM To: Wei Tao Subject: Re: prima Hi - I no longer work on the EMBOSS project but you can find any information and the latest downloads from the website below. I'm not sure if the prima program is still in the package, but there are another primer related programs called 'primers' and 'primersearch'. Version 2.7.0 is available from: http://www.uk.embnet.org/Software/EMBOSS ftp://ftp.uk.embnet.org/pub/EMBOSS There is an emboss mailing list where questions on any of the programs or installations are answered: This may also be useful to you. hope this helps, Sin?ad. Wei Tao wrote: Hi Sinead, I wonder where can I find a copy of prima for download? Your help is deeply appreciated. Thanks! -Wei -------------- next part -------------- An HTML attachment was scrubbed... URL: From jison at hgmp.mrc.ac.uk Mon Sep 1 10:33:16 2003 From: jison at hgmp.mrc.ac.uk (Dr J.C. Ison) Date: Mon, 01 Sep 2003 11:33:16 +0100 Subject: [EMBOSS] Where did the protein structure programs go? References: Message-ID: <3F53206C.C41B98B0@hgmp.mrc.ac.uk> From David.Bauer at SCHERING.DE Mon Sep 1 11:20:08 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Mon, 1 Sep 2003 13:20:08 +0200 Subject: [EMBOSS] infoseq sequence type Message-ID: From gwilliam at hgmp.mrc.ac.uk Mon Sep 1 12:15:44 2003 From: gwilliam at hgmp.mrc.ac.uk (Gary Williams, Tel 01223 494522) Date: Mon, 01 Sep 2003 13:15:44 +0100 Subject: [EMBOSS] infoseq sequence type References: Message-ID: <3F533870.8FC0D7E7@hgmp.mrc.ac.uk> From owner-emboss at hgmp.mrc.ac.uk Mon Sep 1 11:20:08 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Mon, 1 Sep 2003 13:20:08 +0200 Subject: [EMBOSS] infoseq sequence type Message-ID: Hello, infoseq seems to have a problem if it reads a fasta file containing NA and Protein sequences. I originally wanted to use this program to differentiate between the sequence types. But it seems that infoseq only checks the first sequence in the fasta files and assumes the same type for all other sequences. So if first sequence is protein, all other are declared as protein even if they are nucl. and vice versa. Would it be possible to change infoseq so it would do the type check for each sequence in a multiple sequence file ? Thanks, David. From owner-emboss at hgmp.mrc.ac.uk Mon Sep 1 12:15:44 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Mon, 01 Sep 2003 13:15:44 +0100 Subject: [EMBOSS] infoseq sequence type References: Message-ID: <3F533870.8FC0D7E7@hgmp.mrc.ac.uk> David, It has now been changed so that it checks the type of every input sequence. Gary David.Bauer at SCHERING.DE wrote: > > Hello, > > infoseq seems to have a problem if it reads a fasta file containing NA and > Protein sequences. > I originally wanted to use this program to differentiate between the > sequence types. > But it seems that infoseq only checks the first sequence in the fasta files > and assumes the same type for all other sequences. > So if first sequence is protein, all other are declared as protein even if > they are nucl. and vice versa. > Would it be possible to change infoseq so it would do the type check for > each sequence in a multiple sequence file ? > > Thanks, > David. -- Gary Williams Tel: +44 1223 494522 Fax: +44 1223 494512 mailto:G.Williams at hgmp.mrc.ac.uk http://www.hgmp.mrc.ac.uk/ Bioinformatics, MRC HGMP, Hinxton, Cambridge, CB10 1SB, UK From owner-emboss at hgmp.mrc.ac.uk Mon Sep 1 10:33:16 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Mon, 01 Sep 2003 11:33:16 +0100 Subject: [EMBOSS] Where did the protein structure programs go? References: Message-ID: <3F53206C.C41B98B0@hgmp.mrc.ac.uk> Hi David Sorry - just back from hols ! They're in the EMBASSY package "domainatrix". Please note the caveat below. I'm in the process of making things more generic though and the new versions *will* be available as part of EMBOSS Cheers J. ** This program is part of a suite of EMBOSS applications that directly or ** indirectly make use of the protein structure databases pdb and scop. ** This program is part of an experimental analysis pipeline described in an ** accompanying document. We provide the software in the hope that it will ** be useful. The applications were designed for specific research purposes ** and may not be useful or reliable in contexts other than the described ** pipeline. The development of the suite was coordinated by Jon Ison to ** whom enquiries and bug reports should be sent (email jison at hgmp.mrc.ac.uk). David Martin wrote: > EMBOSS had some protein structure stuff in it. This all seems to have > disappeared? > > ..d > -- > David Martin PhD > Bioinformatics Scientific Officer > Post-Genomics and Molecular Interactions Centre > University of Dundee -- Jon C. Ison, PhD Bioinformatics Applications Group UK MRC Human Genome Mapping Project Resource Centre Hinxton, Cambridge, CB10 1SB, UK E-mail : jison at hgmp.mrc.ac.uk Tel : 01223 49-4548 HGMP-RC: http://www.hgmp.mrc.ac.uk/ EMBOSS : http://www.hgmp.mrc.ac.uk/Software/EMBOSS/ From stefanielager at fastmail.ca Wed Sep 3 16:09:51 2003 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Wed, 3 Sep 2003 12:09:51 -0400 (EDT) Subject: [EMBOSS] EMBOSS and SRS Message-ID: <3F56124F.00011B.98842@ns.interchange.ca> I have some problem to set up SRS indexed databases and to make them available in EMBOSS. It's OK when I run EMBOSS on commandline and the user have SRS set up so getz is in the users path. But for users who don't have SRS set up or through web-interface I get problems. In the (fairly) new SRS 7.1.1 I have to have SRS setup to run getz, previously I only had to have the full path to getz to run it. Is it possible to have the SRS setup in the emboss.default file, so SRS is set up automatically? Stefanie _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From owner-emboss at hgmp.mrc.ac.uk Mon Sep 1 10:33:16 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Mon, 01 Sep 2003 11:33:16 +0100 Subject: [EMBOSS] Where did the protein structure programs go? References: Message-ID: <3F53206C.C41B98B0@hgmp.mrc.ac.uk> Hi David Sorry - just back from hols ! They're in the EMBASSY package "domainatrix". Please note the caveat below. I'm in the process of making things more generic though and the new versions *will* be available as part of EMBOSS Cheers J. ** This program is part of a suite of EMBOSS applications that directly or ** indirectly make use of the protein structure databases pdb and scop. ** This program is part of an experimental analysis pipeline described in an ** accompanying document. We provide the software in the hope that it will ** be useful. The applications were designed for specific research purposes ** and may not be useful or reliable in contexts other than the described ** pipeline. The development of the suite was coordinated by Jon Ison to ** whom enquiries and bug reports should be sent (email jison at hgmp.mrc.ac.uk). David Martin wrote: > EMBOSS had some protein structure stuff in it. This all seems to have > disappeared? > > ..d > -- > David Martin PhD > Bioinformatics Scientific Officer > Post-Genomics and Molecular Interactions Centre > University of Dundee -- Jon C. Ison, PhD Bioinformatics Applications Group UK MRC Human Genome Mapping Project Resource Centre Hinxton, Cambridge, CB10 1SB, UK E-mail : jison at hgmp.mrc.ac.uk Tel : 01223 49-4548 HGMP-RC: http://www.hgmp.mrc.ac.uk/ EMBOSS : http://www.hgmp.mrc.ac.uk/Software/EMBOSS/ From owner-emboss at hgmp.mrc.ac.uk Mon Sep 1 11:20:08 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Mon, 1 Sep 2003 13:20:08 +0200 Subject: [EMBOSS] infoseq sequence type Message-ID: Hello, infoseq seems to have a problem if it reads a fasta file containing NA and Protein sequences. I originally wanted to use this program to differentiate between the sequence types. But it seems that infoseq only checks the first sequence in the fasta files and assumes the same type for all other sequences. So if first sequence is protein, all other are declared as protein even if they are nucl. and vice versa. Would it be possible to change infoseq so it would do the type check for each sequence in a multiple sequence file ? Thanks, David. From owner-emboss at hgmp.mrc.ac.uk Mon Sep 1 12:15:44 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Mon, 01 Sep 2003 13:15:44 +0100 Subject: [EMBOSS] infoseq sequence type References: Message-ID: <3F533870.8FC0D7E7@hgmp.mrc.ac.uk> David, It has now been changed so that it checks the type of every input sequence. Gary David.Bauer at SCHERING.DE wrote: > > Hello, > > infoseq seems to have a problem if it reads a fasta file containing NA and > Protein sequences. > I originally wanted to use this program to differentiate between the > sequence types. > But it seems that infoseq only checks the first sequence in the fasta files > and assumes the same type for all other sequences. > So if first sequence is protein, all other are declared as protein even if > they are nucl. and vice versa. > Would it be possible to change infoseq so it would do the type check for > each sequence in a multiple sequence file ? > > Thanks, > David. -- Gary Williams Tel: +44 1223 494522 Fax: +44 1223 494512 mailto:G.Williams at hgmp.mrc.ac.uk http://www.hgmp.mrc.ac.uk/ Bioinformatics, MRC HGMP, Hinxton, Cambridge, CB10 1SB, UK From David.Bauer at SCHERING.DE Thu Sep 4 05:49:57 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Thu, 4 Sep 2003 07:49:57 +0200 Subject: Antwort: [EMBOSS] EMBOSS and SRS Message-ID: Hi Stefanie, we just updated to 711. For historical reasons I'm using method: app for srs access. The application is a simple script using LWP::UserAgent. And this still works with the new 711. But I just made a quick test with method: url and this does no longer work with 711. The debug file contains an error message from the SRS server but I didn't look through this in detail yet. David. I have some problem to set up SRS indexed databases and to make them available in EMBOSS. It's OK when I run EMBOSS on commandline and the user have SRS set up so getz is in the users path. But for users who don't have SRS set up or through web-interface I get problems. In the (fairly) new SRS 7.1.1 I have to have SRS setup to run getz, previously I only had to have the full path to getz to run it. Is it possible to have the SRS setup in the emboss.default file, so SRS is set up automatically? Stefanie _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From stefanielager at fastmail.ca Thu Sep 4 09:29:21 2003 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Thu, 4 Sep 2003 05:29:21 -0400 (EDT) Subject: Antwort: [EMBOSS] EMBOSS and SRS Message-ID: <3F5705F1.000011.22576@ns.interchange.ca> Thank you David, I think I can solve it, calling an external script as you suggests. Stefanie > Stefanie, > > in emboss.default I have: > ################################################## > DB gb [ type: N method: app format: genbank > app: "/usr/local/bin/cgdb_getz_n %s" > comment: "GenBank, RefSeq, RefSeqP" ] > ################################################## > And the script contains: > ################################################### > #!/usr/local/bin/perl > use LWP::UserAgent; > use URI::URL; > > $id=$ARGV[0]; > $id=~s/\.\d+//; > $url=new > URI::URL("http://bes270.schering.de:7777/srs7bin/cgi-bin/wgetz? > -ascii+- > e+[{GENBANK%20REFSEQ%20REFSEQP}-id:$id]|[{GENBANK%20REFSEQ%20REFSE > QP} -acc:$id]"); $req=new HTTP::Request(GET,$url); > $ua=new LWP::UserAgent; > $resp=$ua->request($req); > $seq=$resp->content; > print $seq; > ########################################################### > > Hope this helps. > > Cheers, > David. > > > > > "Stefanie Lager" > stmail.ca> An: emboss at embnet.org > Gesendet von: Kopie: > owner-emboss at hgmp Thema: [EMBOSS] EMBOSS and SRS > .mrc.ac.uk > > > 03.09.03 18:09 > > > > > > > I have some problem to set up SRS indexed databases and to make > them available in EMBOSS. It's OK when I run EMBOSS on commandline > and the user have SRS set up so getz is in the users path. But for > users who don't have SRS set up or through web-interface I get > problems. In the (fairly) new SRS 7.1.1 I have to have SRS setup > to run getz, previously I only had to have the full path to getz > to run it. Is it possible to have the SRS setup in the > emboss.default file, so SRS is set up automatically? > > Stefanie > _________________________________________________________________ > http://fastmail.ca/ - Fast Secure Web Email for Canadians > > _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From gvasudevan at medarex.com Thu Sep 4 21:06:50 2003 From: gvasudevan at medarex.com (Vasudevan, Geetha) Date: Thu, 4 Sep 2003 14:06:50 -0700 Subject: [EMBOSS] EmbossWin.... Message-ID: <8249C3256E593D4FB066BB9998D9F7E41CF2ED@ca2-fs03.ca2.2k.medarex.com> Hello Emboss Users, I am having trouble making some of the executables work in the windows version of EMBOSSWIN. The exe sigcleave accepts the dir path for i/p as well as o/p files on the command line when executed from a cmd on win2k. Whereas, transeq does not accept the dir path for o/p. Example, sigcleave C:\Temp\myseq.txt -outfile C:\Temp\myseq.sig -minweight=3.5 works but transeq -sequence C:\Temp\nt.txt -outseq C:\Temp\pep.txt -frame=2 does not work. Error: Unable to write sequence to 'C:\Temp\pep.txt' Died: transeq terminated: Bad value for option [outseq] and no prompt Is there a work around for this? Thanks for your time. -Geetha Vasudevan. -------------- next part -------------- An HTML attachment was scrubbed... URL: From rpg at mrc-lmb.cam.ac.uk Fri Sep 5 16:54:01 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Fri, 5 Sep 2003 17:54:01 +0100 (BST) Subject: [EMBOSS] srs/www madness Message-ID: <200309051654.h85Gs1k69234@alf1.lmb.internal> So I decided to install EMBOSS on my Mac, and went the fink route (2.6.0). I have a emboss.default file that is being read, I've put in some database definitions, e.g. DB embl [ type: N method: srswww format: embl release: EBI dbalias: embl comment: "EMBL from EBI" url: "http://srs.ebi.ac.uk/srs7bin/cgi-bin/wgetz?-e+[embl-id:'%s']" ] (- and in another iteration DB embl [ type: N format: embl method: url dbalias: embl url: "http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id:'%s']" comment: "EMBL. Allegedly." ] ) and showdb gives # Name Type ID Qry All Comment # ==== ==== == === === ======= tpir P OK OK OK PIR using NBRF access for 4 files tsw P OK OK OK Swissprot native format with EMBL CD-ROM index tswnew P OK OK OK Swissnew as 3 files in native format with EMBL CD-ROM index twp P OK OK OK EMBL new in native format with EMBL CD-ROM index embl N OK - - EMBL from EBI I can construct a query and type it into a browser e.g. http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id:'AB07888'] and get an answer. BUT seqret does not want to play: % seqret Reads and writes (returns) sequences Input sequence(s): embl:AB078884 Error: Unable to read sequence 'embl:AB078884' So, what am I missing? I went through the mailing list archives and found a couple of people had similar trouble, but as far as I can tell I've covered all the bases covered there (emboss.default is being read, for example). I know I don't need a proxy to get out, and as far as I can tell the request is being made to the server, but either the correct magic is not being uttered or the server is returning something that seqret does not like. David Martin kindly pointed me at embl-alltext and that does not return anything either. In fact, using the alltext database with a very short string results in a very long delay, so I suspect the problem is in retrieving the answers. And before you ask, ports 80 and 427 are open on my machine. Thanks for any help, Richard -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From rpg at mrc-lmb.cam.ac.uk Sat Sep 6 10:15:56 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Sat, 6 Sep 2003 11:15:56 +0100 (BST) Subject: [EMBOSS] seqret continued Message-ID: <200309061015.h86AFua240645@alf1.lmb.internal> All right, I slapped a network analyser on and found not only is seqret making the request, the sequence data is being received by my machine. I can see the packets, and the packets contain sequence data. So it's breaking down somewhere between the sequence being loaded into memory and seqret writing it to a file. The only thing I can think of is that because I used fink to install it, EMBOSS is in /sw/bin rather than /usr/... Everything else seems to be fine, but maybe there's a setting - a default directory or a permission - somewhere I've missed? -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From ableasby at hgmp.mrc.ac.uk Sat Sep 6 10:29:55 2003 From: ableasby at hgmp.mrc.ac.uk (Alan Bleasby) Date: Sat, 6 Sep 2003 11:29:55 +0100 (BST) Subject: [EMBOSS] seqret continued Message-ID: <200309061029.h86ATtgP022486@bromine.hgmp.mrc.ac.uk> I can reproduce this problem on non-MacOSX platforms for large sequences (smaller ones retrieve OK). We'll look into it. Thanks for the information. Alan From alta_bowman_cp at gfk.se Mon Sep 8 22:23:27 2003 From: alta_bowman_cp at gfk.se (Alta Bowman) Date: Mon, 08 Sep 2003 22:23:27 +0000 Subject: [EMBOSS] =?ISO-8859-1?b?UmU6Q2hlYXAgU2lsZGVuYWZpbCBDaXRyYXRlICBMaW5r?= Message-ID: <2.2.32.2003090822232700b8c312@gfk.se> An HTML attachment was scrubbed... URL: From Poster-Kit at club-internet.fr Mon Sep 8 21:22:26 2003 From: Poster-Kit at club-internet.fr (Didacticiel PowerPoint) Date: Mon, 8 sep 2003 23:22:26 +0200 Subject: [EMBOSS] Faites votre poster avec PowerpPoint Message-ID: <20030909001204.08A1440FA6@kraid.nerim.net> poster de conf?rence - Poster scientifique - panneau marketing - Organigrammes .... Voici 4 solutions pour faire votre poster vous m?me sur PowerPoint !... ? decouvrir sur le site www.poster-kit.com Basic :Directement de vos diapositives PowerPoint vous allez cr?er un poster automatiquement gr?ce ? une macro gratuite. Simple : A partir de 12 mod?les pr?s ? l'emploi. T?l?chargement gratuit. Pro : Prenez 5 minutes pour lire nos guides gratuits . Vous prendrez le bon d?part S?r?nit? : Gagnez imm?diatement en temps et en qualit?... Confiez vos ?l?ments ? un professionnel. Ils utilisent ce site : CEA - IRSN - INRA - JUSSIEU - PFIZER - INSERM - APHP - EDF - CEGOS - CNRS - INT - SUPELEC - ORSAY - IGR - CURIE - ESPCI - MEDECINE - PARIS 6... ------------------------------------------------------------------------------------------------------------------- le site didacticiel gratuit du poster ? r?aliser soi-m?me : www.poster-kit.com ------------------------------------------------------------------------------------------------------------------- Vous d?sirez des informations : chronoimages at club-internet.fr Vous d?sirez ne plus recevoir d'informations taper simplement non : poster-kit at club-internet.fr Windows 95, Windows 98, Microsoft PowerPoint sont des marques d?pos?es de Microsoft Corp -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: e-mail.gif Type: image/gif Size: 9938 bytes Desc: not available URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: graphique.gif Type: image/gif Size: 5012 bytes Desc: not available URL: From osmart at pugh.bip.bham.ac.uk Tue Sep 9 12:24:24 2003 From: osmart at pugh.bip.bham.ac.uk (Oliver S. Smart) Date: Tue, 9 Sep 2003 13:24:24 +0100 Subject: [EMBOSS] sort from dbiflat - problem solved. Message-ID: My colleague Tony Pemberton reported a problem with dbiflat to the list on 6 August. We thought it would be worth posting the solution. The exact problem was produced when indexing EMBL release 75.0 using the dbiflat command on a dual athlon running redhat 9.0. The sort command launched: $ sort -o embl.acnum_sort2 -T . -k 1,1 embl.acnum_id2 never finished (>3 weeks) and produced no output. Interestingly the command works fine under redhat 8.0, suse7.2 and 8.0 and irix. Also indexing smaller databases works fine as the same sort command will work on smaller files. The solution is to set the LC_ALL environment variable (mentioned in the sort man page) by: # for tcsh, csh,... $ setenv LC_ALL C # OR for bash, ksh,... $ export LC_ALL=C The command then runs fine in around 80 seconds. Consequently dbiflat also runs without a problem. (Note that setting LC_COLLATE does not work), Hope this may save someone else a big headache! Oliver Smart (o.s.smart at bham.ac.uk) & Tony Pemberton (A.J.Pemberton at bham.ac.uk) The University of Birmingham From rpg at mrc-lmb.cam.ac.uk Wed Sep 10 08:40:05 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Wed, 10 Sep 2003 09:40:05 +0100 (BST) Subject: [EMBOSS] X11 graphics on OS X Message-ID: <200309100840.h8A8e6T408413@alf1.lmb.internal> Emboss 2.7.1 installed from fink. IThe mail archives hint a problem with Apple's X11, but I have not had trouble with other X apps using it, and fink actually forces you to install the X11 SDK before installing EMBOSS, so I'm not convinced there are missing files. I get the following error with, e.g. pepinfo: Graph type [x11]: Output file [pepinfo.out]: Error in XCreatePixmap: BadDrawable (invalid Pixmap or Window parameter). and I need to ctrl-c to escape. works fine with .ps and PNG as the output. EMBOSS is in /sw/bin/ . Here's my envs: % env HOME=/Users/XXXX SHELL=/bin/tcsh USER=XXXX LANG=en_GB PATH=/sw/bin:/sw/sbin:/bin:/sbin:/usr/bin:/usr/sbin:/usr/X11R6/bin __CF_USER_TEXT_ENCODING=0x1F5:0:2 TERM=vt100 TERMCAP=o?=o?=o?= TERM_PROGRAM=Apple_Terminal TERM_PROGRAM_VERSION=81 LOGNAME=XXXX HOSTTYPE=macintosh VENDOR=apple OSTYPE=darwin MACHTYPE=powerpc SHLVL=1 PWD=/XXXXXX/XXXX/XXXX/XXXX/XXXX GROUP=staff HOST=XXXX.XXXX.XXXX.XXXX PLPLOT_LIB=/sw/share/EMBOSS/ MANPATH=/sw/share/man:/usr/share/man:/usr/X11R6/man INFOPATH=/sw/share/info:/sw/info:/usr/share/info PERL5LIB=/sw/lib/perl5 DISPLAY=:0.0 and /etc/csh.cshrc # System-wide .cshrc file for csh(1). if ($?prompt) then set promptchars = "%#" if ($?tcsh) then set prompt = "[%m:%c3] %n%# " else set prompt = "[%m:%c3] `id -nu`%# " endif endif setenv PLPLOT_LIB /sw/lib/ -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From kvddrift at earthlink.net Wed Sep 10 10:31:30 2003 From: kvddrift at earthlink.net (Koen van der Drift) Date: Wed, 10 Sep 2003 06:31:30 -0400 Subject: [EMBOSS] X11 graphics on OS X In-Reply-To: <200309100840.h8A8e6T408413@alf1.lmb.internal> Message-ID: On Wednesday, September 10, 2003, at 04:40 AM, wrote: > Emboss 2.7.1 installed from fink. > > IThe mail archives hint a problem with Apple's X11, but I have not had > trouble with other X apps using it, and fink actually forces you to > install the X11 SDK before installing EMBOSS, so I'm not convinced > there > are missing files. > Richard, Graphics currently do not work with the current beta version of Apple's X11. You can either install x11 (version 4.3) through fink, or wait until 'Panther' is released which comes with a much improved X11 (also 4.3). - Koen. From luqiang at scbit.org Mon Sep 15 13:09:09 2003 From: luqiang at scbit.org (luqiang) Date: Mon, 15 Sep 2003 21:09:09 +0800 Subject: [EMBOSS] How to install and run a single application of EMBOSS? Message-ID: <20030915130909.1426.qmail@scbit.org> Hi, Guys, 1) I installed the EMBOSS-2.7.1 in path of "/export/home/luqiang/downloads/emboss/EMBOSS-2.7.1" (Red hat 8); 2) I copied the excutable program "garnier" into another path; 3) I removed the path of "/export/home/luqiang/downloads/emboss/EMBOSS-2.7.1"; 4) When I executed the ./garnier, error message came out as following: ./garnier: line 1: cd: /export/home/luqiang/downloads/emboss/EMBOSS-2.7.1/emboss: No such file or directory gcc: garnier.o: No such file or directory gcc: ../nucleus/.libs/libnucleus.so: No such file or directory gcc: ../ajax/.libs/libajaxg.so: No such file or directory gcc: ../ajax/.libs/libajax.so: No such file or directory gcc: ../plplot/.libs/libplplot.so: No such file or directory If I don't want to the whole cumbersome EMBOSS package, while only single application, for example "gariner", is needed, how can I do? Thanks a lot Lu Qiang From pmr at ebi.ac.uk Mon Sep 15 14:41:09 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 15 Sep 2003 15:41:09 +0100 Subject: [EMBOSS] How to install and run a single application of EMBOSS? References: <20030915130909.1426.qmail@scbit.org> Message-ID: <3F65CF85.7000709@ebi.ac.uk> luqiang wrote: > 4) When I executed the ./garnier, error message came out as following: > ./garnier: line 1: cd: > /export/home/luqiang/downloads/emboss/EMBOSS-2.7.1/emboss: No such file > or directory > gcc: garnier.o: No such file or directory > gcc: ../nucleus/.libs/libnucleus.so: No such file or directory > If I don't want to the whole cumbersome EMBOSS package, while only > single application, for example "gariner", is needed, how can I do? Yes, you can build single applications... but there are a few tricks. By default EMBOSS builds with shared libraries using GNU LibTool. The way LibTool works is to build a script when you run "make" and to create the true binary file when you run "make install". This is why it looks for garnier.o Two things you need to do: 1. Build static binaries: ./configure --disable-shared then "make clean", and "make" 2. Watch out for shared libraries in building gd for the graphics applications (no need for garnier - it has no graphics) You can build gd as static libraries, with a little care. To export the binary files to another system, I have usually found you need to disable X11 graphics too (./configure --without-x) because the system usually has shared X11 libraries. Hope this helps, Peter From pmr at ebi.ac.uk Mon Sep 15 14:47:58 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 15 Sep 2003 15:47:58 +0100 Subject: [EMBOSS] How to install and run a single application of EMBOSS? References: <20030915130909.1426.qmail@scbit.org> Message-ID: <3F65D11E.4020701@ebi.ac.uk> luqiang wrote: > If I don't want to the whole cumbersome EMBOSS package, while only > single application, for example "gariner", is needed, how can I do? Oops ... I forgot one more detail. EMBOSS will need to find the ACD file (emboss/garnier.acd in the sources, acd/garnier.acd when it is installed) and possibly comparison matrix files. It will look in the source and install directories. There are two environment variables to redirect the programs to some other location: setenv EMBOSS_ACDROOT /site/prog/emboss/share/EMBOSS/acd setenv EMBOSS_ROOT /site/prog/emboss/share/EMBOSS/ Hope this helps, Peter From gtps5 at gtptech.com Thu Sep 18 15:38:29 2003 From: gtps5 at gtptech.com (Carole Louis) Date: 18 Sep 2003 17:38:29 +0200 Subject: [EMBOSS] Add a program in Jemboss Message-ID: <1063899511.11099.44.camel@thym> Hi, I have just implemented somes programs in Emboss. I can run it with a shell but not with Jemboss. However, I compiled Jemboss (Jemboss server) with my programs included in Emboss. I think that I have to modify somes programs in Java but I do not know which. How can I do that ? Thanks, Sincerecely, Carole Louis -------------- next part -------------- An HTML attachment was scrubbed... URL: From tcarver at hgmp.mrc.ac.uk Thu Sep 18 15:46:14 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Thu, 18 Sep 2003 16:46:14 +0100 (BST) Subject: [EMBOSS] Add a program in Jemboss In-Reply-To: <1063899511.11099.44.camel@thym> Message-ID: Hi Carole Once you have installed your programs, you will need to follow the same guidelines for installing embassy after the Jemboss server has already been set up: http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Jemboss/install/embassy.html This should explain why you do not see your applications and how to get them into the interface. Regards Tim Carver HGMP-RC On 18 Sep 2003, Carole Louis wrote: > Hi, > > I have just implemented somes programs in Emboss. I can run it with a > shell but not with Jemboss. However, I compiled Jemboss (Jemboss server) > with my programs included in Emboss. I think that I have to modify somes > programs in Java but I do not know which. How can I do that ? > > Thanks, > Sincerecely, > Carole Louis > > > > From owner-emboss at hgmp.mrc.ac.uk Thu Sep 18 19:46:08 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Thu, 18 Sep 2003 15:46:08 -0400 Subject: [EMBOSS] From: Thomas A Isenbarger Message-ID: is there a discussion of plotcon anywhere? is there a good explanation of the calculation and algorithm anywhere, or a reference? thank-you, tom isenbarger From tcarver at hgmp.mrc.ac.uk Fri Sep 19 07:37:44 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Fri, 19 Sep 2003 08:37:44 +0100 (BST) Subject: [EMBOSS] From: Thomas A Isenbarger In-Reply-To: Message-ID: Hi Tom You can find the documentation for this at: http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Apps/plotcon.html I hope this helps, Regards Tim Carver HGMP-RC On Thu, 18 Sep 2003 owner-emboss at hgmp.mrc.ac.uk wrote: > is there a discussion of plotcon anywhere? is there a good explanation > of the calculation and algorithm anywhere, or a reference? > > thank-you, > > tom isenbarger > From kawaji at plala.to Sat Sep 20 11:23:55 2003 From: kawaji at plala.to (KAWAJI Hideya) Date: Sat, 20 Sep 2003 20:23:55 +0900 (JST) Subject: [EMBOSS] license of EMBOSS tutorial Message-ID: <20030920.202355.730556337.kawaji@plala.to> Hi, I'm interested in EMBOSS tutorial (http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Tutorial/emboss_tutorial/) as well as EMBOSS itself. It is very helpful to understand EMBOSS applications, but some people that are not good at English can't utilize it. My colleague has a plan to translate it into Japanese, and I agree with him. We consider that our result also should be open publicly. Although all programs in EMBOSS is clearly described as "they are released under GPL" and I believe that the spirit is the same to the tutorial, I can't find any license of the tutorial. Could you let me know about the following points? - Is there any description about license of EMBOSS tutorial, such as GNU FDL(http://www.gnu.org/licenses/fdl.html)? - If not, can we open and distribute our translation, publicly? best, Hideya --- Hideya KAWAJI From ksvk_2000 at yahoo.com Mon Sep 22 10:11:54 2003 From: ksvk_2000 at yahoo.com (Vinay Kumar) Date: Mon, 22 Sep 2003 03:11:54 -0700 (PDT) Subject: [EMBOSS] Plplot Message-ID: <20030922101154.67974.qmail@web10906.mail.yahoo.com> Hello, I am installing EMBOSS on a RHL 9.0 box. It was installed very neatly. But when i tried to see a output on PLPLOT. There was an error message. something like Set PLPLOT_LIB to plplot/lib under Emboss directory What does this mean? and how am i to rectify the problem?? plz help. Regards and thanks in advance Vinay. --------------------------------- Do you Yahoo!? Yahoo! SiteBuilder - Free, easy-to-use web site design software -------------- next part -------------- An HTML attachment was scrubbed... URL: From henrikki.almusa at helsinki.fi Mon Sep 22 11:02:26 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Mon, 22 Sep 2003 14:02:26 +0300 Subject: [EMBOSS] Plplot In-Reply-To: <20030922101154.67974.qmail@web10906.mail.yahoo.com> References: <20030922101154.67974.qmail@web10906.mail.yahoo.com> Message-ID: <200309221402.26279.henrikki.almusa@helsinki.fi> On Monday 22 September 2003 13:11, Vinay Kumar wrote: > Hello, > I am installing EMBOSS on a RHL 9.0 box. It was installed very neatly. But > when i tried to see a output on PLPLOT. There was an error message. > > something like > > Set PLPLOT_LIB to plplot/lib under Emboss directory > > What does this mean? and how am i to rectify the problem?? plz help. If you mean that it wants to use "plstnd5.fnt" or "plxtnd5.fnt", then they are in your "source_dir/plplot/lib" (source dur being the directory, where you unpacked emboss-x.y.z.tar.gz). You can set the enviromental variable by 'export PLPLOT_DIR="directory"'-command. Question to list. Is there a reason why the 'make install' doesn't copy these to emboss library dir as well as other libraries? -- Henrikki Almusa From rpg at mrc-lmb.cam.ac.uk Mon Sep 22 12:19:15 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Mon, 22 Sep 2003 13:19:15 +0100 (BST) Subject: [EMBOSS] Qualifier '-fields' not found Message-ID: <200309221219.h8MCJHX212155@alf1.lmb.internal> I've persuaded my friendly admin to set up EMBOSS on our Tru64 Alpha cluster. I know Tru64 isn't officially supported, and he doesn't really have time to troubleshoot, so I'm lending a hand. We're getting this error: % showdb Displays information on the currently available databases Died: Qualifier '-fields' not found Ideas? Thanks -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From d.gatherer at vir.gla.ac.uk Mon Sep 22 14:13:15 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Mon, 22 Sep 2003 15:13:15 +0100 Subject: [EMBOSS] Plplot In-Reply-To: <200309221402.26279.henrikki.almusa@helsinki.fi> References: <20030922101154.67974.qmail@web10906.mail.yahoo.com> <20030922101154.67974.qmail@web10906.mail.yahoo.com> Message-ID: <5.2.1.1.1.20030922150217.00b16f18@udcf.gla.ac.uk> Hi I have a very similar problem, but I suspect that the problem is not with EMBOSS, but possibly with X. I have: > printenv | grep LD_LIB LD_LIBRARY_PATH=/$SOFTWARE/emboss/share/EMBOSS : /$SOFTWARE/lib >printenv | grep PLP PLPLOT_LIB=/$SOFTWARE/emboss/share/EMBOSS ($SOFTWARE is of course an abbreviation of my actual thing...) >ls /$SOFTWARE/emboss/share/EMBOSS acd/ emboss.default.template plstnd5.fnt bin/ include/ plxtnd5.fnt data/ jemboss/ test/ doc/ lib/ >ls /$SOFTWARE/lib libckit.so@ libnucleus.a libajax.a libckit.so.0@ libnucleus.la* libajax.la* libckit.so.1.1.0* libnucleus.so@ libajax.so@ libhmmer.a libnucleus.so.0@ libajax.so.0@ libhmmer.la* libnucleus.so.1.1.0* libajax.so.1.1.0* libhmmer.so@ libplplot.a libajaxg.a libhmmer.so.1@ libplplot.la* libajaxg.la* libhmmer.so.2.1.1* libplplot.so@ libajaxg.so@ libmeme.a libplplot.so.5@ libajaxg.so.0@ libmeme.la* libplplot.so.5.0.0* libajaxg.so.1.1.0* libmeme.so@ libwrap.a* libckit.a libmeme.so.1@ libckit.la* libmeme.so.2.1.3* so this looks okay... but...... > banana Bending and curvature plot in B-DNA Input sequence: sequences/testdna1.fa Graph type [x11]: Error in XCreatePixmap: BadDrawable (invalid Pixmap or Window parameter). The outfile (banana.profile) is fine, as a text file, so the algorithmic part of banana is fine. If I enter xterm at the Graph type prompt, I get the plot in the Xterm window. Am I failing to point correctly at something, or are the x11 libraries the problem? All suggestions gratefully received. Cheers Derek At 14:02 22/09/2003 +0300, Henrikki Almusa wrote: >On Monday 22 September 2003 13:11, Vinay Kumar wrote: > > Hello, > > I am installing EMBOSS on a RHL 9.0 box. It was installed very neatly. But > > when i tried to see a output on PLPLOT. There was an error message. > > > > something like > > > > Set PLPLOT_LIB to plplot/lib under Emboss directory > > > > What does this mean? and how am i to rectify the problem?? plz help. > >If you mean that it wants to use "plstnd5.fnt" or "plxtnd5.fnt", then they >are >in your "source_dir/plplot/lib" (source dur being the directory, where you >unpacked emboss-x.y.z.tar.gz). You can set the enviromental variable by >'export PLPLOT_DIR="directory"'-command. > >Question to list. Is there a reason why the 'make install' doesn't copy these >to emboss library dir as well as other libraries? > >-- >Henrikki Almusa From rpg at mrc-lmb.cam.ac.uk Mon Sep 22 14:16:14 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Mon, 22 Sep 2003 15:16:14 +0100 (BST) Subject: [EMBOSS] Plplot In-Reply-To: <5.2.1.1.1.20030922150217.00b16f18@udcf.gla.ac.uk> from Derek Gatherer at "Sep 22, 2003 03:13:15 pm" Message-ID: <200309221416.h8MEGFw487633@alf1.lmb.internal> Hi Derek - X11 on MacOsX is effectively broken w.r.t. EMBOSS. You could try installing Xfree86 4.3, or waiting for Panther ;) r -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From d.gatherer at vir.gla.ac.uk Mon Sep 22 14:39:55 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Mon, 22 Sep 2003 15:39:55 +0100 Subject: [EMBOSS] Plplot In-Reply-To: <200309221416.h8MEGFw487633@alf1.lmb.internal> References: <5.2.1.1.1.20030922150217.00b16f18@udcf.gla.ac.uk> Message-ID: <5.2.1.1.1.20030922153330.036d2270@udcf.gla.ac.uk> I'm actually using a Windows 2000 PC running Hummingbird/Exceed to log into a Tru64 server. Maybe the problem extends to Windows as well? Since my last post, I saw there was one line in the manual: "You may need to specify the location of your X-windows library with the configuration options: -x-includes=DIR (X include files are in DIR) -x-libraries=DIR (X library files are in DIR)" Perhaps this is what is wrong. Does anybody have any example settings for this? I thought perhaps 'usr/lib/X11' and '/usr/include/X11'?? Cheers and thanks again Derek At 15:16 22/09/2003 +0100, rpg at mrc-lmb.cam.ac.uk wrote: >Hi Derek - X11 on MacOsX is effectively broken w.r.t. EMBOSS. You could >try installing Xfree86 4.3, or waiting for Panther ;) > >r > >-- >Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ >MRC-LMB, Cambridge, UK >PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From kkmattil at csc.fi Mon Sep 22 14:58:50 2003 From: kkmattil at csc.fi (Kimmo Mattila) Date: Mon, 22 Sep 2003 17:58:50 +0300 (EEST) Subject: [EMBOSS] Plplot In-Reply-To: <5.2.1.1.1.20030922153330.036d2270@udcf.gla.ac.uk> References: <5.2.1.1.1.20030922150217.00b16f18@udcf.gla.ac.uk> <5.2.1.1.1.20030922153330.036d2270@udcf.gla.ac.uk> Message-ID: On Mon, 22 Sep 2003, Derek Gatherer wrote: Hi We had this problem once too and our Windows support managed to solve this by changing the colour settings of Hummingbird/Exceed server program in windows 2000. If I remember correctly, the trick was to use "pseudocolour" in stead of the default value. Regards, Kimmo Mattila > I'm actually using a Windows 2000 PC running Hummingbird/Exceed to log into > a Tru64 server. Maybe the problem extends to Windows as well? > > Since my last post, I saw there was one line in the manual: > > "You may need to specify the location of your X-windows library with the > configuration options: -x-includes=DIR (X include files are in DIR) > -x-libraries=DIR (X library files are in DIR)" > > Perhaps this is what is wrong. Does anybody have any example settings for > this? I thought perhaps 'usr/lib/X11' and '/usr/include/X11'?? > > Cheers and thanks again > Derek > > > At 15:16 22/09/2003 +0100, rpg at mrc-lmb.cam.ac.uk wrote: > >Hi Derek - X11 on MacOsX is effectively broken w.r.t. EMBOSS. You could > >try installing Xfree86 4.3, or waiting for Panther ;) > > > >r > > > >-- > >Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ > >MRC-LMB, Cambridge, UK > >PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ > ----------------------------------------------------------------- Kimmo Mattila, tutkija, Biol??ketieteen laitos / Biokemia PL 63, 00014 Helsingin yliopisto. Puh. 09 191 25409 Kimmo Mattila, researcher, Institute of Biomedicine, Biochemistry P.O. BOX 63, 00014 University of Helsinki. Finland Tel. +358 9 191 25409 ----------------------------------------------------------------- From gbottu at ben.vub.ac.be Mon Sep 22 15:18:30 2003 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Mon, 22 Sep 2003 17:18:30 +0200 (CEST) Subject: [EMBOSS] Note about restrict -alphabetic Message-ID: <200309221518.h8MFIUiX1125967@black.vub.ac.be> from : BEN Dear colleagues, I just tried something with restrict under EMBOSS 2.7.1. The program sorts by default the cut sites from begin to end. With parameter -alphabetic it sorts instead the output line according to the name of the restriction enzyme. All well, but if there are several cut sites for one enzyme, these are apparently output randomly. Cf. this example for the command restrict vec:puc18 -enzymes=haeiii,mboi -alphabetic ------------------- ######################################## # Program: restrict # Rundate: Mon Sep 22 17:11:15 2003 # Report_format: table # Report_file: puc18.restrict ######################################## #======================================= # # Sequence: PUC18 from: 1 to: 2686 # HitCount: 26 # # Minimum cuts per enzyme: 1 # Maximum cuts per enzyme: 2000000000 # Minimum length of recognition site: 4 # Blunt ends allowed # Sticky ends allowed # DNA is linear # Ambiguities allowed # #======================================= Start End Enzyme_name Restriction_site 5prime 3prime 5primerev 3primerev 2675 2678 HaeIII GGCC 2676 2676 . . 1741 1744 HaeIII GGCC 1742 1742 . . 1821 1824 HaeIII GGCC 1822 1822 . . 389 392 HaeIII GGCC 390 390 . . 287 290 HaeIII GGCC 288 288 . . 646 649 HaeIII GGCC 647 647 . . 2088 2091 HaeIII GGCC 2089 2089 . . 820 823 HaeIII GGCC 821 821 . . 831 834 HaeIII GGCC 832 832 . . 849 852 HaeIII GGCC 850 850 . . 1283 1286 HaeIII GGCC 1284 1284 . . 2067 2070 MboI GATC 2066 2070 . . 2325 2328 MboI GATC 2324 2328 . . 2342 2345 MboI GATC 2341 2345 . . 2378 2381 MboI GATC 2377 2381 . . 1545 1548 MboI GATC 1544 1548 . . 430 433 MboI GATC 429 433 . . 1373 1376 MboI GATC 1372 1376 . . 1448 1451 MboI GATC 1447 1451 . . 1459 1462 MboI GATC 1458 1462 . . 1467 1470 MboI GATC 1466 1470 . . 277 280 MboI GATC 276 280 . . 1557 1560 MboI GATC 1556 1560 . . 1662 1665 MboI GATC 1661 1665 . . 2003 2006 MboI GATC 2002 2006 . . 2021 2024 MboI GATC 2020 2024 . . #--------------------------------------- #--------------------------------------- ------------------------------------------------------------------------------ IMHO it would be better if the lines were sorted by enzyme name AND for each enzyme by position from begin to end. Is this also your opinion ? Sinceely, Guy Bottu From kellert at ohsu.edu Mon Sep 22 18:35:33 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Mon, 22 Sep 2003 11:35:33 -0700 Subject: [EMBOSS] X11 display Message-ID: <8CCDCAA1-ED2B-11D7-B513-0003930405E2@ohsu.edu> Greetings, I'm using EMBOSS over an ssh connection to a Sun box, I'm on a Mac OS X machine running X11. I get the folllowing error with abiview. ~/data/dseq% 79->abiview Reads ABI file and display the trace Input file: test.abi Output sequence [test.fasta]: Graph type [x11]: Error in XCreatePixmap: BadDrawable (invalid Pixmap or Window parameter). Suggestions appreciated. Thanks, Tom K. Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From kellert at ohsu.edu Mon Sep 22 18:42:07 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Mon, 22 Sep 2003 11:42:07 -0700 Subject: [EMBOSS] X11 display In-Reply-To: <8CCDCAA1-ED2B-11D7-B513-0003930405E2@ohsu.edu> Message-ID: <77C8398B-ED2C-11D7-B513-0003930405E2@ohsu.edu> I'll bet Richard Grant's not to Derek is apropos! ;-) - X11 on MacOsX is effectively broken w.r.t. EMBOSS. You could try installing Xfree86 4.3, or waiting for Panther ;) Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ On Monday, September 22, 2003, at 11:35 AM, Thomas Keller wrote: > Greetings, > I'm using EMBOSS over an ssh connection to a Sun box, I'm on a Mac OS > X machine running X11. > I get the folllowing error with abiview. > ~/data/dseq% 79->abiview > Reads ABI file and display the trace > Input file: test.abi > Output sequence [test.fasta]: > Graph type [x11]: > Error in XCreatePixmap: BadDrawable (invalid Pixmap or Window > parameter). > > Suggestions appreciated. > Thanks, > Tom K. > Tom Keller, Ph.D. > http://www.ohsu.edu/core > kellert at ohsu.edu > 503-494-2442 > > From kellert at ohsu.edu Mon Sep 22 22:16:43 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Mon, 22 Sep 2003 15:16:43 -0700 Subject: [EMBOSS] dbigcg question Message-ID: <72B4BAE6-ED4A-11D7-B513-0003930405E2@ohsu.edu> I have the GCG format databases mounted on a read only volume on my machine. To use these with Embos I made the following entry in my .embossrc file: # define dna2.ohsu.edu/gcgdata1 database for EMBOSS set emboss_db_dir /Volumes/dna2.ohsu.edu # set location of indices set emboss_indices /Users/kellert/Emboss_indices DB myembl [ type: N format: embl method: gcg fields: "id acc sv des org key" directory: $emboss_db_dir/gcgembl indexdir: $emboss_indices/gcgembl comment: "GCG embl db from dna2.ohsu.edu:/gcgdata1 mounted locally" ] and created an index directory and tried to run dbigcg as follows: kellert% dbigcg -indexdirectory /Users/kellert/Emboss_indices/gcgembl Index a GCG formatted database EMBL : EMBL SWISS : Swiss-Prot, SpTrEMBL, TrEMBLnew GENBANK : Genbank, DDBJ PIR : NBRF Entry format [EMBL]: Database directory [.]: Wildcard database filename [*.seq]: Database name: myembl Release number [0.0]: Index date [00/00/00]: EMBOSS An error in embdbi.c at line 568: Cannot open myembl001.list for writing I don't understand why this isn't working. Can someone explain this to me? Thanks, Tom K. Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From sirbooli at comcast.net Tue Sep 23 01:05:41 2003 From: sirbooli at comcast.net (sirbooli at comcast.net) Date: Tue, 23 Sep 2003 01:05:41 +0000 Subject: [EMBOSS] REMOVE ME Message-ID: <20030923010543.2328E7D45F@mercury.hgmp.mrc.ac.uk> PLEASE TAKE ME OFF THIS LIST > I can reproduce this problem on non-MacOSX platforms for large > sequences (smaller ones retrieve OK). We'll look into it. > Thanks for the information. > > Alan From d.gatherer at vir.gla.ac.uk Tue Sep 23 08:12:13 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Tue, 23 Sep 2003 09:12:13 +0100 Subject: [EMBOSS] X11 display In-Reply-To: <8CCDCAA1-ED2B-11D7-B513-0003930405E2@ohsu.edu> Message-ID: <5.2.1.1.1.20030923090021.035bf068@udcf.gla.ac.uk> further to Thomas: Yep, exactly what I've got. Try again and this time where it says Graph type [x11]: type xterm. You'll get a graph of sorts. If you don't, type '?' and you'll get a list of possible output formats. x11 will be one of them, and it seems to be the only one that doesn't work. For instance: >abiview Reads ABI file and display the trace ABI trace file: B135-F Output sequence [b135-f.fasta]: Graph type [x11]: ps Created abiview.ps So postscript works, and so does png. Last night, I tried reinstalling with a configure flag specifically set to look for x11 ./configure --prefix=/$SOFTWARE/emboss --exec-prefix=/$SOFTWARE --with-pngpdriver=/$SOFTWARE/emboss/share/EMBOSS --x-includes=/usr/include/X11 --x-libraries=/usr/lib/X11 (where $SOFTWARE abbreviates my actual path), but even with x-includes it doesn't work. In my config.log I have: ac_x_includes=/usr/include/X11 ac_x_libraries=/usr/lib/X11' CXXFLAGS='-g -I/usr/include/X11' XLIB=' -L/usr/lib/X11 -lX11 ' X_CFLAGS=' -I/usr/include/X11' X_LIBS=' -L/usr/lib/X11' which I didn't before I specified --x-includes at configure. So I'm more or less stumped here. Either I'm making an elementary mistake with my paths or there is a problem on Windows as well as Mac. Cheers Derek At 11:35 22/09/2003 -0700, you wrote: >Greetings, >I'm using EMBOSS over an ssh connection to a Sun box, I'm on a Mac OS X >machine running X11. >I get the folllowing error with abiview. >~/data/dseq% 79->abiview >Reads ABI file and display the trace >Input file: test.abi >Output sequence [test.fasta]: >Graph type [x11]: >Error in XCreatePixmap: BadDrawable (invalid Pixmap or Window parameter). > >Suggestions appreciated. >Thanks, >Tom K. >Tom Keller, Ph.D. >http://www.ohsu.edu/core >kellert at ohsu.edu >503-494-2442 From ame at esbs.u-strasbg.fr Tue Sep 23 08:46:17 2003 From: ame at esbs.u-strasbg.fr (Jean-Christophe AME) Date: Tue, 23 Sep 2003 10:46:17 +0200 Subject: [EMBOSS] X11 display In-Reply-To: <77C8398B-ED2C-11D7-B513-0003930405E2@ohsu.edu> Message-ID: <65954BF8-EDA2-11D7-9E69-0005024329A7@esbs.u-strasbg.fr> Hello, Developer release 2 of X11 for mac OSX works well. However, it seems strange that the EMBOSS package is the only program that doesn't work with X11 DR3. All the other softwares that required X11 worked very well. Jean-Christophe Le lundi, 22 sep 2003, ? 20:42 Europe/Paris, Thomas Keller a ?crit : > I'll bet Richard Grant's not to Derek is apropos! ;-) > - X11 on MacOsX is effectively broken w.r.t. EMBOSS. You could > try installing Xfree86 4.3, or waiting for Panther ;) > Richard P. Grant > http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ > > On Monday, September 22, 2003, at 11:35 AM, Thomas Keller wrote: > >> Greetings, >> I'm using EMBOSS over an ssh connection to a Sun box, I'm on a Mac OS >> X machine running X11. >> I get the folllowing error with abiview. >> ~/data/dseq% 79->abiview >> Reads ABI file and display the trace >> Input file: test.abi >> Output sequence [test.fasta]: >> Graph type [x11]: >> Error in XCreatePixmap: BadDrawable (invalid Pixmap or Window >> parameter). >> >> Suggestions appreciated. >> Thanks, >> Tom K. >> Tom Keller, Ph.D. >> http://www.ohsu.edu/core >> kellert at ohsu.edu >> 503-494-2442 >> >> > > ________________________ Jean-Christophe Am?, PhD U.P.R. 9003 du CNRS - Canc?rog?n?se et Mutag?n?se Mol?culaire et Structurale ?cole Sup?rieure de Biotechnologie de Strasbourg P?le API Parc d'innovation, Boulevard S?bastien Brant BP 10413 67412 ILLKIRCH CEDEX France tel.: 33 3 90 24 47 05 Fax.: 33 3 90 24 46 86 http://parplink.u-strasbg.fr http://www-esbs.u-strasbg.fr/centrerech/upr9003/upr9003.html -------------- next part -------------- A non-text attachment was scrubbed... Name: not available Type: text/enriched Size: 1709 bytes Desc: not available URL: From rpg at mrc-lmb.cam.ac.uk Tue Sep 23 08:49:16 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Tue, 23 Sep 2003 09:49:16 +0100 (BST) Subject: [EMBOSS] X11 display In-Reply-To: <65954BF8-EDA2-11D7-9E69-0005024329A7@esbs.u-strasbg.fr> from Jean-Christophe AME at "Sep 23, 2003 10:46:17 am" Message-ID: <200309230849.h8N8nGq204954@alf1.lmb.internal> Jean-Christophe AME wrote: >Developer release 2 of X11 for mac OSX works well. However, it seems with EMBOSS? >strange that the EMBOSS package is the only program that doesn't work >with X11 DR3. All the other softwares that required X11 worked very >well. Yes, I found that strange. With the SDK installed and everything. r -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From d.gatherer at vir.gla.ac.uk Tue Sep 23 08:57:19 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Tue, 23 Sep 2003 09:57:19 +0100 Subject: [EMBOSS] Plplot and X11 In-Reply-To: References: <5.2.1.1.1.20030922153330.036d2270@udcf.gla.ac.uk> <5.2.1.1.1.20030922150217.00b16f18@udcf.gla.ac.uk> <5.2.1.1.1.20030922153330.036d2270@udcf.gla.ac.uk> Message-ID: <5.2.1.1.1.20030923094953.00af3188@udcf.gla.ac.uk> In fact, Kimmo has the/a right answer. The instructions are here: http://www.oucs.ox.ac.uk/windows/exceed/index.xml?style=printable Cheers Derek At 17:58 22/09/2003 +0300, Kimmo Mattila wrote: >On Mon, 22 Sep 2003, Derek Gatherer wrote: > >Hi > >We had this problem once too and our Windows support managed to solve >this by changing the colour settings of Hummingbird/Exceed server program >in windows 2000. If I remember correctly, the trick was to use >"pseudocolour" in stead of the default value. > >Regards, > >Kimmo Mattila > > > > I'm actually using a Windows 2000 PC running Hummingbird/Exceed to log into > > a Tru64 server. Maybe the problem extends to Windows as well? > > > > Since my last post, I saw there was one line in the manual: > > > > "You may need to specify the location of your X-windows library with the > > configuration options: -x-includes=DIR (X include files are in DIR) > > -x-libraries=DIR (X library files are in DIR)" > > > > Perhaps this is what is wrong. Does anybody have any example settings for > > this? I thought perhaps 'usr/lib/X11' and '/usr/include/X11'?? > > > > Cheers and thanks again > > Derek > > > > > > At 15:16 22/09/2003 +0100, rpg at mrc-lmb.cam.ac.uk wrote: > > >Hi Derek - X11 on MacOsX is effectively broken w.r.t. EMBOSS. You could > > >try installing Xfree86 4.3, or waiting for Panther ;) > > > > > >r > > > > > >-- > > >Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ > > >MRC-LMB, Cambridge, UK > > >PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ > > > >----------------------------------------------------------------- >Kimmo Mattila, tutkija, Biol??ketieteen laitos / Biokemia >PL 63, 00014 Helsingin yliopisto. >Puh. 09 191 25409 > >Kimmo Mattila, researcher, Institute of Biomedicine, Biochemistry >P.O. BOX 63, 00014 University of Helsinki. Finland >Tel. +358 9 191 25409 >----------------------------------------------------------------- From lmullan at hgmp.mrc.ac.uk Tue Sep 23 09:21:41 2003 From: lmullan at hgmp.mrc.ac.uk (Lisa Mullan) Date: Tue, 23 Sep 2003 10:21:41 +0100 (BST) Subject: [EMBOSS] EMBOSS tutorial In-Reply-To: <200309230902.h8N92xrr007095@bromine.hgmp.mrc.ac.uk> Message-ID: Dear Hideya, In the spirit of the Open Source agreement, you may indeed translate the tutorial into Japanese, as long as you make it available to others. We would also appreciate a copy ourselves to possibly put up on the EMBOSS site as it may encourage others to do the same. Regards, Lisa Mullan HGMP Resource Centre Hinxton, Cambridge, CB10 1SB Tel: 01223 494526 Email: lmullan at hgmp.mrc.ac.uk > Content-Type: Text/Plain; charset=us-ascii > Content-Transfer-Encoding: 7bit > Sender: owner-emboss at hgmp.mrc.ac.uk > Precedence: bulk > Status: RO > Content-Length: 872 > > Hi, > > > I'm interested in EMBOSS tutorial > (http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Tutorial/emboss_tutorial/) > as well as EMBOSS itself. > It is very helpful to understand EMBOSS applications, > but some people that are not good at English can't utilize it. > My colleague has a plan to translate it into Japanese, and > I agree with him. We consider that our result also should be open publicly. > > Although all programs in EMBOSS is clearly described > as "they are released under GPL" and I believe that the spirit > is the same to the tutorial, I can't find any license of the tutorial. > > Could you let me know about the following points? > > - Is there any description about license of EMBOSS tutorial, > such as GNU FDL(http://www.gnu.org/licenses/fdl.html)? > > - If not, can we open and distribute our translation, publicly? > > best, > > Hideya > --- > Hideya KAWAJI > From rimmasters6912811rinrinrin55 at yahoo.com Tue Sep 23 14:44:11 2003 From: rimmasters6912811rinrinrin55 at yahoo.com (Betty) Date: Tue, 23 Sep 2003 07:44:11 -0700 Subject: [EMBOSS] I will do all you want ! Message-ID: <2003096715.12167.qmail@yahoo.com> Hi Eric ! I am doing something I never thought I would do. Because I need some money (you know that I'am a student ;-) ) I will start my own nude livecam next week. The webcam is already online and it would be great if you could test the performane of my cam: http://betty.my-free-website.com There is also a chat - please test this too. Of course I will do all you want..... Just tell me via chat what you want to see: http://betty.my-free-website.com Your test should be something like a "real customer simulation" ;-) What are you doing this summer ? Yours, Betty http://betty.my-free-website.com From kellert at ohsu.edu Tue Sep 23 18:15:37 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Tue, 23 Sep 2003 11:15:37 -0700 Subject: [EMBOSS] how to set path to plstnd5.fnt Message-ID: Greetings, I can't seem to find my notes on how to tell emboss and/or my xterm app where the ../share/EMBOSS/plstnd5.fnt fonts file is located. It seems like the xterm app that needs to know this path, correct? Could someone remind me? Thanks, Tom K Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From kellert at ohsu.edu Tue Sep 23 19:51:28 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Tue, 23 Sep 2003 12:51:28 -0700 Subject: [EMBOSS] how to set path to plstnd5.fnt In-Reply-To: Message-ID: <52474032-EDFF-11D7-9AF4-0003930405E2@ohsu.edu> Damn, I'll answer my own question: read tfm at http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Admin_guide/adminguide/ node3.html#SECTION00330000000000000000 Also don't forget to setenv the DISPLAY if you on an x11 window. On Tuesday, September 23, 2003, at 11:15 AM, Thomas Keller wrote: > Greetings, > I can't seem to find my notes on how to tell emboss and/or my xterm > app where the ../share/EMBOSS/plstnd5.fnt fonts file is located. It > seems like the xterm app that needs to know this path, correct? > Could someone remind me? > Thanks, > Tom K > Tom Keller, Ph.D. > http://www.ohsu.edu/core > kellert at ohsu.edu > 503-494-2442 > > From kawaji at plala.to Wed Sep 24 16:37:30 2003 From: kawaji at plala.to (KAWAJI Hideya) Date: Thu, 25 Sep 2003 01:37:30 +0900 (JST) Subject: [EMBOSS] EMBOSS tutorial In-Reply-To: References: <200309230902.h8N92xrr007095@bromine.hgmp.mrc.ac.uk> Message-ID: <20030925.013730.730555716.kawaji@plala.to> Dear David and Lisa, Thank you very much for permission to our translation. (I received the permission from David, directly) I'm going to promote our project, while I contact the original author, Val Curwen. From: Lisa Mullan Subject: [EMBOSS] EMBOSS tutorial Date: Tue, 23 Sep 2003 10:21:41 +0100 (BST) ...snip > We would also appreciate a copy ourselves to possibly put up on the EMBOSS > site as it may encourage others to do the same. It is very honor to put up our translation on the EMBOSS site. Yes! I'll post its URL or itself when we complete it. Best regards, Hideya --- Hideya KAWAJI From kellert at ohsu.edu Thu Sep 25 00:26:05 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Wed, 24 Sep 2003 17:26:05 -0700 Subject: [EMBOSS] genbank mirror via srswww Message-ID: Hi all, Can't seem to be able to get a genbank connection via methodquery: srswww kellert% infoseq genbank:AY243029 Displays some simple information about sequences Error: Failed to find host 'cbr-nrc.cnrc.gc.ca' for database 'genbank' Error: Unable to read sequence 'genbank:AY243029' Died: infoseq terminated: Bad value for '-sequence' and no prompt Here's my definition: DB genbank [ type: N methodquery: srswww format: genbank url: "http://cbr-nrc.cnrc.gc.ca/srs6bin/cgi-bin/wgetz" release: GenBank dbalias: genbank comment: "GenBank from the Cananadian srs server" ] Thanks for any help. Tom K. Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From R-1-721447-16268191-2-47031-US2-A8DE9744 at xmr3.com Thu Sep 25 04:56:58 2003 From: R-1-721447-16268191-2-47031-US2-A8DE9744 at xmr3.com (International Scientific Communications, Inc.) Date: Thu, 25 Sep 2003 00:56:58 -0400 Subject: [EMBOSS] Laboratory Instrumentation News - September 2003 Message-ID: An HTML attachment was scrubbed... URL: From rpg at mrc-lmb.cam.ac.uk Thu Sep 25 06:54:24 2003 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Thu, 25 Sep 2003 07:54:24 +0100 (BST) Subject: [EMBOSS] genbank mirror via srswww In-Reply-To: from Thomas Keller at "Sep 24, 2003 05:26:05 pm" Message-ID: <200309250654.h8P6sOE375963@alf1.lmb.internal> Hi Tom, >kellert% infoseq genbank:AY243029 >Displays some simple information about sequences >Error: Failed to find host 'cbr-nrc.cnrc.gc.ca' for database 'genbank' >Error: Unable to read sequence 'genbank:AY243029' >Died: infoseq terminated: Bad value for '-sequence' and no prompt I pasted http://cbr-nrc.cnrc.gc.ca/srs6bin/cgi-bin/wgetz into a browser and got Unknown Host Description: Unable to locate the server named "cbr-nrc.cnrc.gc.ca" --- the server does not have a DNS entry. Perhaps there is a misspelling in the server name, or the server no longer exists. Double-check the name and try again Either the server's down or the name is wrong. r -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From vac at sanger.ac.uk Thu Sep 25 07:54:43 2003 From: vac at sanger.ac.uk (Val Curwen) Date: Thu, 25 Sep 2003 08:54:43 +0100 Subject: [EMBOSS] EMBOSS tutorial In-Reply-To: <20030925.013730.730555716.kawaji@plala.to> References: <200309230902.h8N92xrr007095@bromine.hgmp.mrc.ac.uk> <20030925.013730.730555716.kawaji@plala.to> Message-ID: <3F729F43.3010006@sanger.ac.uk> Hi all, KAWAJI Hideya wrote: > Dear David and Lisa, > > > Thank you very much for permission to our translation. > (I received the permission from David, directly) > I'm going to promote our project, while I contact the original author, > Val Curwen. > Here I am! As far as I'm concerned you're welcome to translate and promote it as you wish. Best wishes, Val > From: Lisa Mullan > Subject: [EMBOSS] EMBOSS tutorial > Date: Tue, 23 Sep 2003 10:21:41 +0100 (BST) > > ...snip > >>We would also appreciate a copy ourselves to possibly put up on the EMBOSS >>site as it may encourage others to do the same. > > > It is very honor to put up our translation on the EMBOSS site. > Yes! I'll post its URL or itself when we complete it. > > > Best regards, > > Hideya > --- > Hideya KAWAJI > > -- Val Curwen, Ensembl Project Leader, The Sanger Centre, Wellcome Trust Genome Campus, Hinxton, Cambridge, UK. CB10 1SA From pmr at ebi.ac.uk Thu Sep 25 09:28:09 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 25 Sep 2003 10:28:09 +0100 Subject: [EMBOSS] genbank mirror via srswww References: Message-ID: <3F72B529.8030704@ebi.ac.uk> Thomas Keller wrote: > Hi all, > Can't seem to be able to get a genbank connection via methodquery: srswww > > Here's my definition: > DB genbank [ > type: N > methodquery: srswww > format: genbank > url: "http://cbr-nrc.cnrc.gc.ca/srs6bin/cgi-bin/wgetz" The URL is incorrect. Did it work before? Being Canadian, they have English and French now for two parts of the host address. The nrc goes with the second part. http://cbr-rbc.nrc-cnrc.gc.ca/srs6bin/cgi-bin/wgetz Hope this helps, Peter Rice From kawaji at plala.to Thu Sep 25 13:29:01 2003 From: kawaji at plala.to (KAWAJI Hideya) Date: Thu, 25 Sep 2003 22:29:01 +0900 (JST) Subject: [EMBOSS] EMBOSS tutorial In-Reply-To: <3F729F43.3010006@sanger.ac.uk> References: <20030925.013730.730555716.kawaji@plala.to> <3F729F43.3010006@sanger.ac.uk> Message-ID: <20030925.222901.730553957.kawaji@plala.to> Dear Val and all, From: Val Curwen Subject: Re: [EMBOSS] EMBOSS tutorial Date: Thu, 25 Sep 2003 08:54:43 +0100 ...snip > Here I am! As far as I'm concerned you're welcome to translate and > promote it as you wish. Thank you very much! I appreciate all of the authors' permission to our translation. We are working on Wiki at: http://transgenic.cats.st/jambo/index.php?%5B%5BEMBOSS%CB%DD%CC%F5%A5%D7%A5%ED%A5%B8%A5%A7%A5%AF%A5%C8%5D%5D We are welcome to your comments or direct modification, if you can read them. Of course, I'll announce again when we finish it. Best regards, Hideya --- Hideya KAWAJI From reply-647674adcd-emboss=embnet.org at o.vresp.com Thu Sep 25 19:23:59 2003 From: reply-647674adcd-emboss=embnet.org at o.vresp.com (iList) Date: Thu, 25 Sep 2003 19:23:59 +0000 Subject: [EMBOSS] Fill out Surveys and Win Cash! Message-ID: <20030925192359.5E39C7D46F@mercury.hgmp.mrc.ac.uk> It?s for real! The NPD Group, a top ten market research company, is making winners of people just like you. In August 2003, NPD Online Research gave away 63,900.00 to panelists just for sharing their opinions on products and services. In fact, just for joining you are entered for the chance to win $1,000! Surprisingly, despite all the cash being won, our panelists recently told us the #1 reason they continually participate in our surveys is NOT Cash! What could be better than CASH??? To find out the #1 reason panelists participate with NPD Online Research and to become a panelist yourself click on the link below! http://r.vresp.com/?iListInc./b8df0f0ac9/123710/e0d7580310 It only takes a few minutes to join the NPD Online Research Panel. Just click on the link above, sign up and complete your Member Profile Survey. Upon completion of your profile, you will be entered into your first NPDOR Sweepstakes for the chance to win $1,000! Don?t waste time. You could be our next sweepstakes winner!!! ______________________________________________________________________ You are receiving this email because you requested to receive info and updates via email. To unsubscribe, reply to this email with "unsubscribe" in the subject or simply click on the following link: http://unsub.vresp.com/u.html?647674adcd/e0d7580310 _____________________________________________________________________ This message was sent by iList using VerticalResponse's iBuilder (TM) Read the VerticalResponse marketing policy: http://www.verticalresponse.com/content/pm_policy.html -------------- next part -------------- An HTML attachment was scrubbed... URL: From kellert at ohsu.edu Thu Sep 25 19:26:01 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Thu, 25 Sep 2003 12:26:01 -0700 Subject: [EMBOSS] dbigcg warning Message-ID: <190398A1-EF8E-11D7-9AF4-0003930405E2@ohsu.edu> Greetings, I'm trying to create an emboss index in a directory owned by me of a gcggenbank database that I have read only permission on. when I run dbigcg from within my index dir I get the following: Warning: ajStrFixI called with length 2048 for string with size 2048 and the program seems to stall. Any suggestions? Thanks, Tom K. Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From asen.nenov at metalife.de Fri Sep 26 13:40:00 2003 From: asen.nenov at metalife.de (Asen Nenov) Date: Fri, 26 Sep 2003 16:40:00 +0300 Subject: [EMBOSS] EMBOSS qualifiers that doesn't work Message-ID: <3F7441B0.1010801@metalife.de> From laxman at CGR.Harvard.edu Fri Sep 26 15:35:04 2003 From: laxman at CGR.Harvard.edu (Lakshmanan Iyer) Date: Fri, 26 Sep 2003 11:35:04 -0400 Subject: [EMBOSS] GCG: FRAMEALIGN- align protein-6 frames of DNA Message-ID: <339D68B133EAD311971E009027DC4797880231@montecarlo.cgr.harvard.edu> Hello, Is there an EMBOSS equivalent of GCG:FrameAlign? It creates an optimal alignment of the best segment of similarity (local alignment) between a protein sequence and the codons in all possible reading frames on a single strand of a nucleotide sequence. Optimal alignments may include reading frame shifts. This is a very crucial tool for the evolutionary biologists. -thanks -laxman Lakshmanan Iyer, Ph. D. Computational Biologist Manager of Collaboration and Training Computational Biology Group Bauer Center for Genomics Research Bauer Laboratory 7 Divinity Ave. Cambridge, MA 02138 www.cgr.harvard.edu Phone:617-384-7647 Fax: 617-495-2196 -------------- next part -------------- An HTML attachment was scrubbed... URL: From jason at cgt.duhs.duke.edu Fri Sep 26 15:43:29 2003 From: jason at cgt.duhs.duke.edu (Jason Stajich) Date: Fri, 26 Sep 2003 11:43:29 -0400 (EDT) Subject: [EMBOSS] GCG: FRAMEALIGN- align protein-6 frames of DNA In-Reply-To: <339D68B133EAD311971E009027DC4797880231@montecarlo.cgr.harvard.edu> References: <339D68B133EAD311971E009027DC4797880231@montecarlo.cgr.harvard.edu> Message-ID: What is wrong with using tfasty/tfastx (FASTA package)? fastx3/ fasty3 Compare a DNA sequence to a protein sequence database, by comparing the translated DNA sequence in three frames and allowing gaps and frameshifts. fastx3 uses a simpler, faster algorithm for alignments that allows frameshifts only between codons; fasty3 is slower but produces better align- ments with poor quality sequences because frameshifts are allowed within codons. tfastx3/ tfasty3 Compare a protein sequence to a DNA sequence database, calculating similarities with frameshifts to the forward and reverse orientations. tfasta3 Compare a protein sequence to a DNA sequence database, calculating similarities (without frameshifts) to the 3 forward and three reverse reading frames. tfastx3 and tfasty3 are preferred because they calculate similarity over frameshifts. -jason On Fri, 26 Sep 2003, Lakshmanan Iyer wrote: > Hello, > > Is there an EMBOSS equivalent of GCG:FrameAlign? > > It creates an optimal alignment of the best segment of similarity (local > alignment) between a protein sequence and the codons in all possible reading > frames on a single strand of a nucleotide sequence. Optimal alignments may > include reading frame shifts. > > This is a very crucial tool for the evolutionary biologists. > > -thanks > > -laxman > > > > > > Lakshmanan Iyer, Ph. D. > > Computational Biologist > > Manager of Collaboration and Training > > Computational Biology Group > > Bauer Center for Genomics Research > > Bauer Laboratory > > 7 Divinity Ave. > > Cambridge, MA 02138 > > www.cgr.harvard.edu > > Phone:617-384-7647 > > Fax: 617-495-2196 > > > > -- Jason Stajich Duke University jason at cgt.mc.duke.edu From kellert at ohsu.edu Fri Sep 26 18:14:29 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Fri, 26 Sep 2003 11:14:29 -0700 Subject: [EMBOSS] biomirror-gcg Message-ID: <454E4C28-F04D-11D7-9AF4-0003930405E2@ohsu.edu> Hi all, the biomirror-gcg directory at ftp://iubio.bio.indiana.edu/ contains an emboss-default file, but no indexed (dbigcg) databases. The directory above that contains lots of dbs, but I can't tell which if any are pre-indexed. Has anyone used these with emboss, what db's are the pre-indexed ones? [I'm still having trouble running dbigcg on my installation. So these pre-indexed dbs would be useful.] Thanks, Tom K. Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From stefanielager at fastmail.ca Mon Sep 29 05:14:45 2003 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Mon, 29 Sep 2003 01:14:45 -0400 (EDT) Subject: Fwd: [EMBOSS] GCG: FRAMEALIGN- align protein-6 frames of DNA Message-ID: <3F77BFC5.000071.81208@ns.interchange.ca> I think wise2 (the estwise and estwisedb programs) does this . http://www.ebi.ac.uk/Wise2/ Stefanie > Hello, > > Is there an EMBOSS equivalent of GCG:FrameAlign? > > It creates an optimal alignment of the best segment of similarity > (local alignment) between a protein sequence and the codons in all > possible reading frames on a single strand of a nucleotide > sequence. Optimal alignments may include reading frame shifts. > > This is a very crucial tool for the evolutionary biologists. > > -thanks > > -laxman > > > > > > Lakshmanan Iyer, Ph. D. > > Computational Biologist > > Manager of Collaboration and Training > > Computational Biology Group > > Bauer Center for Genomics Research > > Bauer Laboratory > > 7 Divinity Ave. > > Cambridge, MA 02138 > > www.cgr.harvard.edu > > Phone:617-384-7647 > > Fax: 617-495-2196 > > _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From stefanielager at fastmail.ca Mon Sep 29 05:21:32 2003 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Mon, 29 Sep 2003 01:21:32 -0400 (EDT) Subject: Fwd: [EMBOSS] GCG: FRAMEALIGN- align protein-6 frames of DNA Message-ID: <3F77C15C.000073.81208@ns.interchange.ca> Also the programs protal2dna: http://bioweb.pasteur.fr/docs/softgen.html#PROTAL2DNA and RevTrans: http://www.cbs.dtu.dk/services/RevTrans/ Might be useful Stefanie > I think wise2 (the estwise and estwisedb programs) does this . > > http://www.ebi.ac.uk/Wise2/ > > Stefanie > >> Hello, >> >> Is there an EMBOSS equivalent of GCG:FrameAlign? >> >> It creates an optimal alignment of the best segment of similarity >> (local alignment) between a protein sequence and the codons in >> all possible reading frames on a single strand of a nucleotide >> sequence. Optimal alignments may include reading frame shifts. >> >> This is a very crucial tool for the evolutionary biologists. >> >> -thanks >> >> -laxman >> >> >> >> >> >> Lakshmanan Iyer, Ph. D. >> >> Computational Biologist >> >> Manager of Collaboration and Training >> >> Computational Biology Group >> >> Bauer Center for Genomics Research >> >> Bauer Laboratory >> >> 7 Divinity Ave. >> >> Cambridge, MA 02138 >> >> www.cgr.harvard.edu >> >> Phone:617-384-7647 >> >> Fax: 617-495-2196 >> >> > _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians -------------- next part -------------- An embedded and charset-unspecified text was scrubbed... Name: attachment URL: From nancyyu at imb.sinica.edu.tw Mon Sep 29 09:52:15 2003 From: nancyyu at imb.sinica.edu.tw (Nancy Yu) Date: Mon, 29 Sep 2003 17:52:15 +0800 Subject: [EMBOSS] Using Mirror and SynCron to update databases In-Reply-To: <20030929023858.M41138@imb.sinica.edu.tw> References: <20030929023858.M41138@imb.sinica.edu.tw> Message-ID: <20030929095215.M80771@imb.sinica.edu.tw> Hi, I'm having problems with Mirror and I don't know where else to get help. I installed Mirror according to instructions in SynCron (after reading README from ftp.ebi.ac.uk/pub/databases/embl/new), and tested it with the "mirror -n" option. I find that with some ftp sites it connects just fine; for other sites Mirror cannot get a list of the target remote directory content and times out; and other times it lists the target directory as empty, when that directory actually has files in it. Does this have to do with the setting of my mirror.defaults file or with the different ftp sites?? Do people use other scripts/programs to keep their local databases updated? Any suggestions would be greatly appreciated. Nancy Yu -- Institute of Molecular Biology Academia Sinica R.O.C. IMBCC WebMail From henrikki.almusa at helsinki.fi Mon Sep 29 10:19:17 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Mon, 29 Sep 2003 13:19:17 +0300 Subject: [EMBOSS] Using Mirror and SynCron to update databases In-Reply-To: <20030929095215.M80771@imb.sinica.edu.tw> References: <20030929023858.M41138@imb.sinica.edu.tw> <20030929095215.M80771@imb.sinica.edu.tw> Message-ID: <200309291319.17304.henrikki.almusa@helsinki.fi> On Monday 29 September 2003 12:52, Nancy Yu wrote: > I'm having problems with Mirror and I don't know where else to get help. I > installed Mirror according to instructions in SynCron (after reading README > from ftp.ebi.ac.uk/pub/databases/embl/new), and tested it with the "mirror > -n" option. I find that with some ftp sites it connects just fine; for > other sites Mirror cannot get a list of the target remote directory content > and times out; and other times it lists the target directory as empty, when > that directory actually has files in it. Home page for mirror is "http://sunsite.org.uk/packages/mirror/" There is a patch for ftp.pl, which fixes this kind of bug. I had similar problems and they were fixed with this. It also has a kind of security fix. And a lot of info on options in mirror (lke the html pages that comes with mirror). > Does this have to do with the setting of my mirror.defaults file or with > the different ftp sites?? Do people use other scripts/programs to keep > their local databases updated? Any suggestions would be greatly > appreciated. I have my own perl script which uses mirror for downloading some databases (wget has some negative sides for my situation). I did this simply to automatically do indexes for emboss and others (and to save some space on hard drive as well). Hope this helps -- Henrikki Almusa From d.gatherer at vir.gla.ac.uk Tue Sep 30 10:14:12 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Tue, 30 Sep 2003 11:14:12 +0100 Subject: [EMBOSS] ajCodCalcNc in chips Message-ID: <5.2.1.1.1.20030930111106.00b14960@udcf.gla.ac.uk> Hi Chips has the following line: Nc=ajCodCalcNc(&codon); Is the source for this function available? It might be useful for adapting to generate other codon bias measures. Cheers Derek _________________________ Derek Gatherer Ph.D. Cert.Ed. Computer Officer Institute of Virology Church St. Glasgow G11 5JR Phone: +44 141 330 6268 Fax: +44 141 337 2236 Email: d.gatherer at vir.gla.ac.uk Website: http://www.vir.gla.ac.uk From henrikki.almusa at helsinki.fi Tue Sep 30 12:15:39 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Tue, 30 Sep 2003 15:15:39 +0300 Subject: [EMBOSS] ajCodCalcNc in chips In-Reply-To: <5.2.1.1.1.20030930111106.00b14960@udcf.gla.ac.uk> References: <5.2.1.1.1.20030930111106.00b14960@udcf.gla.ac.uk> Message-ID: <200309301515.39768.henrikki.almusa@helsinki.fi> On Tuesday 30 September 2003 13:14, Derek Gatherer wrote: > Hi > > Chips has the following line: > > Nc=ajCodCalcNc(&codon); > > Is the source for this function available? It might be useful for adapting > to generate other codon bias measures. Srs at ebi (http://srs6.ebi.ac.uk/) can search for emboss functions, commands and so forth. Here "http://srs6.ebi.ac.uk/srsbin/cgi-bin/wgetz?-id+15hD01MACCC+-e+[EFUNC:'ajCodCalcNc']+-qnum+1+-enum+1" is the result for ajCodCalcNc. Hope this helps -- Henrikki Almusa