From ableasby at hgmp.mrc.ac.uk Sun Jun 1 16:33:44 2003 From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk) Date: Sun, 1 Jun 2003 21:33:44 +0100 (BST) Subject: EMBOSS 2.7.0 released Message-ID: <200306012033.h51KXiw21881@bromine.hgmp.mrc.ac.uk> Version 2.7.0 is available from: http://www.uk.embnet.org/Software/EMBOSS ftp://ftp.uk.embnet.org/pub/EMBOSS This release introduces improved sequence type handling, new programs (e.g. TCODE) and bugfixes. REBASEEXTRACT now requires both a withrefm and a proto file from the NEB REBASE distribution. Additions to Jemboss include a simple sequence alignment editor. EMBASSY packages have been modified to allow compilation with the latest gcc3 compiler release. See the ChangeLog file for more information. Alan From info at rich-mond.com Mon Jun 2 11:45:52 2003 From: info at rich-mond.com (Richmond Agencies Limited.) Date: Mon, 2 Jun 2003 16:45:52 +0100 Subject: Lab Clearance Bargains! Message-ID: <200306021545.h52FjqL18228@host1.doc-net.com> You have received this email as you have previously expressed an interest in our products or services. It is not our intention to spam, if you do not wish to receive further emails, please contact us via the address at the end of this message. Richmond Agencies Limited. Newsletter ----------------------------------------------------------------- OUR LATEST CLEARANCES INCLUDE... -------------------------------- Biotech Company Anthos Lucy Microplate Luminometer Supplied with Twin Dispenser & PC Pye Unicam UV/VIS Spectrophotometer (type: Kompact SEQ) Supplied with PC, Software & Manuals MALDI TOF Beckman Biomek Robotic Sampler Supplied with Heto Cooling Trap & Edwards High Vacuum Pump Galaxy S Co2 Incubator IR 25 Litre Boxer Autoclave Leec Compact Dogital Upright Incubator Jouan Media Preparator SH105 Astecair 500 Stand Alone Fume Cupboard Sonicor Ultrasonic Bath Pharmacia LKB Peristaltic Pump Denly Laboratory Freezer Bibby CB162 Hotplate Stirrer Heidolph Buomax 1030 Orbital Shaker Vortex Genie 2 with Platform Head GENERAL CHEMISTRY LABORATORY ---------------------------- Steward Lab Stomacher 400 Stewart Scientific Hotplate Type SHA Brook Crompton Mixer Heidolph RZR2051 Mixer x2 Corning Hoplate Stirrer PC351 Electrothermal Heating Mantle 500ml NE Laboratory Centrifuge Jenway 1201 Hotplate Jenway 1000 Hotplate Stirrer Philips PM8251 Single Pen Chart Recorder Edwards Freeze Dryer Stomacher 400 Kjeltec Auto 1030 Analyzer Corning 850 Air Compressor Shandon Vokam 400 Robot Coupe R201 Ultra Lab Blender Analytichem International Vac-elut Electrotherm Heating Mantle 250ml x3 Yltra Turrax Lab Mixer Gasmet Gas Flow Meter Heidolph Mixer Stands x4 IKN Labortechnik RW16 Mixer & Stand Dawe Ultrasonic Bath Lloyd Instruments Graphic 450 Chart Recorder 6 Place Heating Mantle 250ml MSE Centaur 2 Centrifuge Gerhardt Vapodest 1 Gerhardt Kjeldatherm Gallenkamp Platform Scale Robot Coupe R3 Plus 3000 Lab Mixer Stuart Scientific Flask Shaker SF1 Heidolph RZR 2100 Mixer Lab Stads x3 Gallenkamp Hotplate Stirrer Perkin Elmer GP100 Graphics Printer Rotary Evaporator Bibby 349/2 Grant W38 Digital Water Bath Miele G7783 Laboratory Glass Washer Gallenkamp Vacuum Oven Gallenkamp Hotbox Oven Fan Assisted Size 2 x2 Micromat HRGC 412 Hydrogen Generator Perkin Elmer Autosystem XL Gas Chromatograph Perkin Elmer 8500 Gas Chromatograph Perkin Elmer Double Beam Spectrophotometer 124 Corning 410 Flame Photometer Techni Dri-Block Heater DB1 Brookfield Viscometer with Full Set of Spindles and Case Carbolite Digital Furnace 1100 deg Contact Our Sales Team on 01942 492622 SECOND HAND BALANCES! SPECIAL OFFER.. >From a Third to Half the original price --------------------------------------- Sartorious Research R106P Analytical Dual Band Balance, 4dp/5dp, wieghing Capacity 162g Sartorious LA4200S Top Pan Balance, 2dp, Wieghing Capacity 4,200g Mettler Toledo AM100 Analytical Dual Band Balance, 4dp - Wieghing Capacity 4g, 5dp - Wieghing Capacity 100g PAG Precisa 240A Analytical Balance,4dp wieghing capacity 240g For Further Information, Please Call 01942 492622 ----------------------------------------------------------------- Richmond Agencies Limited. The Old Dairy, 162 - 165 Warrington Road, Lower Ince, Wigan, WN3 4JS Tel: 01942 492 622, Fax: 01942 492 280, Email: info at rich-mond.com Issue: Equipment Just In - Issue 4 -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030602/ce3622e9/attachment.html From henrikki.almusa at helsinki.fi Tue Jun 3 04:35:13 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Tue, 3 Jun 2003 11:35:13 +0300 Subject: Embassy: phylip Message-ID: <200306031135.13243.henrikki.almusa@helsinki.fi> Hello, I'm intrested in "embassified phylip". However the version that can be found from "ftp://ftp.uk.embnet.org/pub/EMBOSS/" is the older 3.5 version instead of 3.6. Phylips webpage say that 3.6 is alpha, but it seems to work without problems. So i was wondering if it would be possible to get whatever modifications there are in phylips 3.5 into the 3.6 version as well? Also is there any documentation about the changes, i coulnd't find much from the phylips tarball downloaded from ftp site. NEWS file had just a note that changes were kept minimum. If i could find out how much there was changes I might be able to help in making the 3.6 version (although i'm not sure how much time i have or are my abilities in c sufficient for that :)). Thanks, -- Henrikki Almusa From ml at mb.au.dk Tue Jun 3 06:21:57 2003 From: ml at mb.au.dk (Martin Luetzelberger) Date: Tue, 3 Jun 2003 11:21:57 +0100 (BST) Subject: Bug in Jemboss? Message-ID: Dear Jemboss experts, with the new EMBOSS-2.7.0 version and the Jemboss GUI I get java errors (see below) when choosing some programs from the DISPLAY menu i.e. prettyplot. I haven't seen this with the previous (EMBOSS-2.6.0) version. j2sdk1.4.1_03 is installed on my system (Mandrake Linux 9.1). Any suggestions? /Martin java.lang.NullPointerException at org.emboss.jemboss.gui.form.SectionPanel.resolveDependents(SectionPanel.java:968) at org.emboss.jemboss.gui.form.SectionPanel.checkDependents(SectionPanel.java:813) at org.emboss.jemboss.gui.form.SectionPanel.(SectionPanel.java:476) at org.emboss.jemboss.gui.form.BuildJembossForm.attach(BuildJembossForm.java:348) at org.emboss.jemboss.gui.form.BuildJembossForm.(BuildJembossForm.java:124) at org.emboss.jemboss.gui.BuildProgramMenu$5.actionPerformed(BuildProgramMenu.java:339) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1786) at javax.swing.AbstractButton$ForwardActionEvents.actionPerformed(AbstractButton.java:1839) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:420) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:258) at javax.swing.AbstractButton.doClick(AbstractButton.java:289) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:1113) at javax.swing.plaf.basic.BasicMenuItemUI$MouseInputHandler.mouseReleased(BasicMenuItemUI.java:943) at java.awt.Component.processMouseEvent(Component.java:5099) at java.awt.Component.processEvent(Component.java:4896) at java.awt.Container.processEvent(Container.java:1569) at java.awt.Component.dispatchEventImpl(Component.java:3614) at java.awt.Container.dispatchEventImpl(Container.java:1627) at java.awt.Component.dispatchEvent(Component.java:3476) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:3483) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:3198) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:3128) at java.awt.Container.dispatchEventImpl(Container.java:1613) at java.awt.Window.dispatchEventImpl(Window.java:1606) at java.awt.Component.dispatchEvent(Component.java:3476) at java.awt.EventQueue.dispatchEvent(EventQueue.java:456) at java.awt.EventDispatchThread.pumpOneEventForHierarchy(EventDispatchThread.java:201) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:151) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:145) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:137) at java.awt.EventDispatchThread.run(EventDispatchThread.java:100) -- Martin L?tzelberger, PhD Department of Molecular Biology University of ?rhus C.F. M?llers All?, Bldg. 130 DK-8000 Aarhus C Denmark -- Phone: +45 26635544 Fax: +45 86196500 Www: http://www.rna.dk E-mail: ml at mb.au.dk -- From tcarver at hgmp.mrc.ac.uk Tue Jun 3 05:38:53 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Tue, 3 Jun 2003 10:38:53 +0100 (BST) Subject: Bug in Jemboss? In-Reply-To: Message-ID: Hi Martin Thanks for your message. I noticed this one yesterday. It will probably not display 'emma' as well. I have made a patch available at: ftp://ftp.uk.embnet.org/pub/EMBOSS/patchfiles/Jemboss/ There will probably be a follow up release very soon which will incorporate the patch. Regards Tim Carver HGMP-RC On Tue, 3 Jun 2003, Martin Luetzelberger wrote: > Dear Jemboss experts, > > with the new EMBOSS-2.7.0 version and the Jemboss GUI I get > java errors (see below) when choosing some programs from the DISPLAY menu > i.e. prettyplot. I haven't seen this with the previous (EMBOSS-2.6.0) > version. j2sdk1.4.1_03 is installed on my system (Mandrake Linux 9.1). > > Any suggestions? > > /Martin > > > > java.lang.NullPointerException > at > org.emboss.jemboss.gui.form.SectionPanel.resolveDependents(SectionPanel.java:968) > at > org.emboss.jemboss.gui.form.SectionPanel.checkDependents(SectionPanel.java:813) > at > org.emboss.jemboss.gui.form.SectionPanel.(SectionPanel.java:476) > at > org.emboss.jemboss.gui.form.BuildJembossForm.attach(BuildJembossForm.java:348) > at > org.emboss.jemboss.gui.form.BuildJembossForm.(BuildJembossForm.java:124) > at > org.emboss.jemboss.gui.BuildProgramMenu$5.actionPerformed(BuildProgramMenu.java:339) > at > javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1786) > at > javax.swing.AbstractButton$ForwardActionEvents.actionPerformed(AbstractButton.java:1839) > at > javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:420) > at > javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:258) > at javax.swing.AbstractButton.doClick(AbstractButton.java:289) > at > javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:1113) > at > javax.swing.plaf.basic.BasicMenuItemUI$MouseInputHandler.mouseReleased(BasicMenuItemUI.java:943) > at java.awt.Component.processMouseEvent(Component.java:5099) > at java.awt.Component.processEvent(Component.java:4896) > at java.awt.Container.processEvent(Container.java:1569) > at java.awt.Component.dispatchEventImpl(Component.java:3614) > at java.awt.Container.dispatchEventImpl(Container.java:1627) > at java.awt.Component.dispatchEvent(Component.java:3476) > at > java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:3483) > at > java.awt.LightweightDispatcher.processMouseEvent(Container.java:3198) > at > java.awt.LightweightDispatcher.dispatchEvent(Container.java:3128) > at java.awt.Container.dispatchEventImpl(Container.java:1613) > at java.awt.Window.dispatchEventImpl(Window.java:1606) > at java.awt.Component.dispatchEvent(Component.java:3476) > at java.awt.EventQueue.dispatchEvent(EventQueue.java:456) > at > java.awt.EventDispatchThread.pumpOneEventForHierarchy(EventDispatchThread.java:201) > at > java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:151) > at > java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:145) > at > java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:137) > at java.awt.EventDispatchThread.run(EventDispatchThread.java:100) > > > -- > Martin L?tzelberger, PhD > Department of Molecular Biology > University of ?rhus > C.F. M?llers All?, Bldg. 130 > DK-8000 Aarhus C > Denmark > -- > Phone: +45 26635544 > Fax: +45 86196500 > Www: http://www.rna.dk > E-mail: ml at mb.au.dk > -- > From ableasby at hgmp.mrc.ac.uk Tue Jun 3 09:23:53 2003 From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk) Date: Tue, 3 Jun 2003 14:23:53 +0100 (BST) Subject: EMBOSS 2.7.1 (bugfix release) Message-ID: <200306031323.h53DNrA25041@bromine.hgmp.mrc.ac.uk> This version is available for download and fixes the Jemboss problem with 'emma' and 'prettyplot' forms mentioned on this list earlier today. Alan From georg.otto at tuebingen.mpg.de Tue Jun 3 10:21:56 2003 From: georg.otto at tuebingen.mpg.de (Georg Otto) Date: Tue, 3 Jun 2003 16:21:56 +0200 Subject: sequence quality in eprimer3 Message-ID: Hi! I have a question concerning eprimer3: I have a number of files in Staden experiment format (for an example see below). I can use it as an input file for primer selection with eprimer3 without problems. In the documentation of eprimer3 it is mentioned that it is possible to use base calling quality values for primer selection, but I did not find an explanation how this is done. More specifically, I am not sure how I can get the program to use the phred values listed in my exp files (is it used at all?) and how to define a minimal quality threshold. Any hint will be very much appreciated. Cheers, Georg ID fb71b08.x1.exp EN fb71b08.x1.exp LN fb71b08.x1 LT SCF AV 4 4 4 4 4 6 6 4 4 4 4 4 6 6 6 4 4 6 7 7 8 10 14 18 9 9 7 7 8 AV 8 9 9 8 8 10 14 9 9 11 25 25 31 31 31 31 30 33 33 33 33 AV 32 40 32 27 24 24 32 23 27 27 29 29 40 40 35 28 17 15 15 AV 28 28 36 34 28 25 8 6 6 6 6 9 18 24 27 33 33 33 38 39 33 AV 31 31 34 34 31 33 33 27 25 14 12 12 23 32 39 44 44 44 39 AV 39 37 37 37 39 39 38 37 37 37 37 37 37 37 44 45 44 44 44 AV 45 45 45 32 26 26 18 27 15 18 18 18 18 15 18 21 25 24 24 AV 24 30 30 37 33 37 37 37 37 33 33 24 22 22 22 19 22 32 32 AV 37 30 32 28 28 33 33 32 37 37 45 45 32 32 21 17 15 25 29 AV 32 32 30 30 30 37 37 45 45 45 32 32 14 14 11 14 14 26 17 AV 21 21 21 21 30 37 41 51 51 51 32 32 13 13 13 28 27 30 30 AV 28 28 30 30 37 41 41 37 36 30 36 34 21 21 27 27 30 30 30 AV 30 30 34 34 34 30 30 30 41 41 51 51 37 37 30 34 34 37 37 AV 27 27 14 27 21 32 32 51 51 33 33 30 30 30 24 36 22 30 30 AV 36 36 41 30 34 34 39 39 34 34 25 21 21 24 34 32 39 37 37 AV 30 30 28 33 28 27 30 36 32 31 36 30 29 29 29 36 34 37 37 AV 41 41 30 30 30 41 32 37 37 33 33 33 33 33 30 37 37 37 41 AV 41 41 30 30 30 34 34 34 37 37 37 37 41 41 37 37 37 37 37 AV 37 37 37 37 37 32 32 32 32 37 45 45 45 37 37 37 40 38 37 AV 37 37 37 37 37 37 34 34 34 34 34 31 38 37 28 28 26 26 19 AV 22 24 32 32 37 37 34 40 31 30 30 28 27 18 29 38 34 37 34 AV 34 34 31 31 27 29 32 32 24 27 29 32 34 45 38 34 34 34 31 AV 31 31 30 22 19 19 19 22 25 28 31 31 31 24 22 22 21 21 18 AV 12 13 14 19 23 26 27 28 36 33 33 33 33 31 30 32 23 23 22 AV 22 22 22 31 33 34 33 33 33 27 24 21 19 19 21 24 20 18 18 AV 18 18 21 21 19 20 24 24 24 21 12 10 9 9 10 12 18 26 25 AV 25 25 23 23 24 25 13 11 11 11 12 13 17 24 24 24 24 29 30 AV 23 19 9 9 10 12 12 9 10 17 18 20 21 18 18 23 22 19 16 16 AV 16 14 18 10 11 14 25 25 9 7 7 8 8 9 12 18 10 12 7 9 9 9 AV 12 18 14 18 16 18 18 13 18 8 8 10 8 9 9 7 7 10 10 14 12 AV 21 15 15 18 16 16 11 8 7 7 7 7 10 10 9 8 4 4 SQ NGGTGGGCCG CTGTAAGCGT GAATTTTATG AGATGACACT ATAGAAGAGC TATGACGTCG CATGCACGCG TACGTATGTT TGGATCCTCT AGAGCGGCCG CCCTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTCATGTTG TTAGATATAT TTTAATCAAG CAACAAATGT CAAAAAAAAA GCTCAAAGAC AGGATCGGGA ACAGCTTCAG GGTTGTTCTG GGTTACACAA ACTCGTACAG AATGTTACGA ACAACACACA ATCTATAGGG GTTACTAGTG AAGCATTAAA CGCTAACAGA TCACATTTGT TACAGAGATG AGAGATGATT AACCTGAGGC ATTTTCAAAA GTCTGGTTGA AGCAGCAAAA TGGAGGTCTG AGATAAACTA TTATACACCT GGAACTATAG CACATAGTTC CTCATGAAAA GATTAGGTAT ATTAAAACTA TTTAATAAAG GTTAGATGCT ACACATGTTA GCAATTCCTC AGCTTTAGCT TTTAACCATC ATATGGCACT TGAAATAAGG TCACAATACG TACATCACTG AGATCTCTTT GAATATTTTC CCCAAAATCC TCCTCCAAAA TATGTCTGAA CTTTGGTN // From acanario at ualg.pt Tue Jun 3 11:22:43 2003 From: acanario at ualg.pt (Adelino Canario) Date: Tue, 03 Jun 2003 16:22:43 +0100 Subject: JEMBOSS In-Reply-To: <200306031135.13243.henrikki.almusa@helsinki.fi> Message-ID: <5.1.0.14.2.20030603162009.01f2b810@localhost> Hello I have been trying to use Jemboss but although the settings have and option to use a proxy it tries to access the HGMP server directly (and hits the firewall). Is there a solution? Thanks Adelino Canario From henrikki.almusa at helsinki.fi Wed Jun 4 11:02:16 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Wed, 4 Jun 2003 18:02:16 +0300 Subject: Trying to upgrade dreg Message-ID: <200306041802.16414.henrikki.almusa@helsinki.fi> Hello I'm trying to test my c skills with Emboss. And decided to start by trying to modify dreg to print out in emboss report format. I've made some changes and got it to print out a report. Unfortunately I haven't been completely succesful in modifying this. So here I am to ask for help and guidance :). So my questions are. What i'm doing wrong here? And how to fix it? At one point I got it to write the proper file out with all the maches in it. However it was case sensetive at that time and printing out some warnings. While trying to get rid of these i seemed to lose the ability to match anything anymore. And i can't seem to be able to fix now to do matching properly for some reason. My patch is added as attachment. Once this is done I'm planning to try change preg similarly. Or better yet, i think, to modify one of them so that it read both amino acid and nucleotide sequences, since the regex shouldn't care what strings it is used to test on. TIA -- Henrikki Almusa -------------- next part -------------- A non-text attachment was scrubbed... Name: emboss-dreg.patch Type: text/x-diff Size: 3060 bytes Desc: not available Url : http://lists.open-bio.org/pipermail/emboss/attachments/20030604/d490653a/attachment.bin From ableasby at hgmp.mrc.ac.uk Wed Jun 4 12:22:25 2003 From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk) Date: Wed, 4 Jun 2003 17:22:25 +0100 (BST) Subject: Trying to upgrade dreg Message-ID: <200306041622.h54GMPb22817@bromine.hgmp.mrc.ac.uk> Hello Henrikki, Perhaps it is best to first point you at: http://www.bioinformatics.ac.uk which are the CCP11 pages (who provide some funding for EMBOSS). At the left (under 'courses') you'll see an EMBOSS link. That goes to some programming course notes I wrote. If you go to the practicals sections and look at practical 9 you'll see a description of Report Format programming. That should help... in particular with the ACD taglist which your modification appears to be missing. Anyway, have a look at that and, if you're still having difficulties then get back to us. Alan Bleasby HGMP From pmr at ebi.ac.uk Wed Jun 4 12:22:22 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 04 Jun 2003 17:22:22 +0100 Subject: Trying to upgrade dreg References: <200306041802.16414.henrikki.almusa@helsinki.fi> Message-ID: <3EDE1CBE.4040206@ebi.ac.uk> Henrikki Almusa wrote: > Hello > > I'm trying to test my c skills with Emboss. And decided to start by trying to > modify dreg to print out in emboss report format. I've made some changes and > got it to print out a report. Unfortunately I haven't been completely > succesful in modifying this. So here I am to ask for help and guidance :). So > my questions are. What i'm doing wrong here? And how to fix it? You are close .... look at fuzznuc for a similar program. The main problem is that you need to initialize hit_name, otherwise the feature is not created. We will add an error message for that condition. Also, there is no need (and it is bad practice) to use a string instead of a regexp as the input in the ACD file. You can keep the original code. I assume you did it to have the original pattern for the report - but that is what acdGetValue does. An example modified dreg.c is attached. I tested it, but will not commit it. > Once this is done I'm planning to try change preg similarly. Or better yet, i > think, to modify one of them so that it read both amino acid and nucleotide > sequences, since the regex shouldn't care what strings it is used to test on. There are advantages to keeping them separate. One is the ability to add validation in the regular expressions. This is very complex if they can be DNA or protein. Please do send in a modified dreg and preg - we can credit you with making the changes! Hope this helps Peter From Jack.Leunissen at wur.nl Wed Jun 4 18:53:52 2003 From: Jack.Leunissen at wur.nl (Jack Leunissen) Date: Thu, 5 Jun 2003 00:53:52 +0200 Subject: EMBOSS release 2.7.* Message-ID: <001001c32aec$2b6fedf0$0300000a@kuifje> Dear EMBOSS team, I noticed that there is a change in input parameter for a single sequence in programs like dot*, water etc. which breaks their functioning in SRS, as it will do in many sequence handling scripts. The "Changelog" isn't all the clear about this too. There may be other new undiscovered "features" as well that I didn't see yet - and don't have the time to find out be trial and error. For the time being I see no other option than to reinstall EMBOSS 2.6.0 again to retain full functionality :-(( It would be nice if these things would be communicated more clearly well in advance of a new major release, and if there would be some form of downward compatibility to the "old" way of sequence specification. Regards, Jack Jack Leunissen Genome Informatics Wageningen University 6703 HA Wageningen, NL -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030605/a6ab7fe1/attachment.html From P.Ernst at dkfz-heidelberg.de Thu Jun 5 03:57:05 2003 From: P.Ernst at dkfz-heidelberg.de (Peter Ernst) Date: Thu, 5 Jun 2003 09:57:05 +0200 (MEST) Subject: Bio::Emboss perl module for EMBOSS-2.7.* Message-ID: Since EMBOSS-2.7.0, the following EMBOSS/Ajax functions have different prototypes, requiring a new release (0.3) of the Perl module Bio::Emboss: ---- snip ---- void ajFeatReverse (thys, ilen) AjPFeature thys ajint ilen AjBool ajFeatTagSet (thys, tag, value) AjPFeature thys AjPStr tag AjPStr value AjBool ajFeatTagSetC (thys, tag, value) AjPFeature thys char* tag AjPStr value ---- snip ---- http://www.perl.com/CPAN/modules/by-module/Bio/ Bio::Emboss perl module version 0.3 =================================== This module interfaces to the libraries of the EMBOSS package (European Molecular Biology Open Software Suite). With this module you can access EMBOSS databases and use EMBOSS functions. -- ======================================================================= Peter Ernst Department of Molecular Biophysics - B020 Deutsches Krebsforschungszentrum (German Cancer Research Center) DKFZ Im Neuenheimer Feld 580 / Technologiepark 3 69120 Heidelberg, Germany http://genome.dkfz-heidelberg.de/ ======================================================================= From gbottu at ben.vub.ac.be Thu Jun 5 04:19:53 2003 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Thu, 5 Jun 2003 10:19:53 +0200 (CEST) Subject: sequence quality in eprimer3 Message-ID: <200306050819.h558JrVk1065320@black.vub.ac.be> from : BEN I am afraid that the EMBOSS "wrapper" program eprimer3 does not handle the base assignment qualities, even if the manual briefly mentions it. Actually, EMBOSS does not handle Staden experiment files. If you ask seqret to write experiment::xxx it writes a sequence in the now obsolete Staden format. (let's not blame the developers, it is such a monumental task to implement everything...) You might install primer through its "native" interface, using the primer3_www.cgi script. This is more rich than EMBOSS, but is of course "featureless" (no access to personal files on the server). You still will have to extract "manually" the content of the AV lines and copy-and-paste in the "Sequence Quality" box. Regards, Guy Bottu From pmr at ebi.ac.uk Thu Jun 5 04:32:59 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 05 Jun 2003 09:32:59 +0100 Subject: sequence quality in eprimer3 References: <200306050819.h558JrVk1065320@black.vub.ac.be> Message-ID: <3EDF003B.2040305@ebi.ac.uk> Guy Bottu wrote: > I am afraid that the EMBOSS "wrapper" program eprimer3 does not handle the base > assignment qualities, even if the manual briefly mentions it. Actually, EMBOSS > does not handle Staden experiment files. If you ask seqret to write > experiment::xxx it writes a sequence in the now obsolete Staden format. > (let's not blame the developers, it is such a monumental task to implement > everything...) Not too difficult. I believe the Staden experiment file format is similar to EMBL. We don't see the Staden format as obsolete (and only GCG seem to call it "Staden" - it's just a nice name for a plain sequence format. > You might install primer through its "native" interface, using the > primer3_www.cgi script. This is more rich than EMBOSS, but is of course > "featureless" (no access to personal files on the server). You still will have > to extract "manually" the content of the AV lines and copy-and-paste in the > "Sequence Quality" box. We could try adding the base qualities - yet more options for eprimer3. How many users would like this added in EMBOSS? Peter From gbottu at ben.vub.ac.be Thu Jun 5 06:39:20 2003 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Thu, 5 Jun 2003 12:39:20 +0200 (CEST) Subject: sequence quality in eprimer3 Message-ID: <200306051039.h55AdKGa1068877@black.vub.ac.be> > Not too difficult. I believe the Staden experiment file format is > similar to EMBL. Already now EMBOSS can read in sequences in "experiment" format, because it takes it for EMBL format. There is however a problem : in experiment format the SQ ACGT... // does not necessarily come at the end of the file ! Also, there are a lot of extra tags. Maybe some of them, like the AV lines, need some special treatment in EMBOSS. > We don't see the Staden format as obsolete (and only GCG seem to call it > "Staden" - it's just a nice name for a plain sequence format). Well, the manual of the last version of the Staden package mentions that the format is obsolete and the programs do not write or read it anymore. If I am not wrong, Staden format differs in two things from "raw" format : - it allows for embedded comments between <> at any place in the sequence (EMBOSS writes and reads staden:xxx files with a comment at the top, but does not allow comments anywhere else) - traditionally Staden used for ambiguous bases the Stanford-Staden codes rather than the IUPAC-IUB (but they seem to have abandonned this) I think EMBOSS should certainly support "experiment" format. There is no problem with continuing to support also "staden", but then maybe do it correctly and not confuse it with "experiment" or "rax"/"text"/"plain". > We could try adding the base qualities - yet more options for eprimer3. > > How many users would like this added in EMBOSS? I have no idea how many users want to access all the options of Primer. It can certainly do no harm to support them all. But maybe then split the page in more "type:page" sections. In Staden, eprimer3 is unusable because the "Start" button disappears below the bottom of the screen. I do not know if other GUI's also have problems. Guy Bottu From pmr at ebi.ac.uk Thu Jun 5 06:53:52 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 05 Jun 2003 11:53:52 +0100 Subject: sequence quality in eprimer3 References: <200306051039.h55AdKGa1068877@black.vub.ac.be> Message-ID: <3EDF2140.4060803@ebi.ac.uk> Guy Bottu wrote: >>Not too difficult. I believe the Staden experiment file format is >>similar to EMBL. > > > Already now EMBOSS can read in sequences in "experiment" format, because it > takes it for EMBL format. There is however a problem : in experiment format the > SQ > ACGT... > // > does not necessarily come at the end of the file ! Also, there are a lot of > extra tags. Maybe some of them, like the AV lines, need some special treatment > in EMBOSS. Extra line types are easy to ignore. We would need some example files (to be saved in the test/data directory) to QA test the code. >>We don't see the Staden format as obsolete (and only GCG seem to call it >>"Staden" - it's just a nice name for a plain sequence format). > > > Well, the manual of the last version of the Staden package mentions that the > format is obsolete and the programs do not write or read it anymore. > If I am not wrong, Staden format differs in two things from "raw" format : > - it allows for embedded comments between <> at any place in the sequence > (EMBOSS writes and reads staden:xxx files with a comment at the top, but does > not allow comments anywhere else) > - traditionally Staden used for ambiguous bases the Stanford-Staden codes rather > than the IUPAC-IUB (but they seem to have abandonned this) > > I think EMBOSS should certainly support "experiment" format. There is no problem > with continuing to support also "staden", but then maybe do it correctly and not > confuse it with "experiment" or "rax"/"text"/"plain". "experiment" is another name for "staden". Easiest is probably to make it another name for "embl" if we can handle the format differences. Or we can make a copy of the ReadEmbl functions and make the expriment format changes there. >>We could try adding the base qualities - yet more options for eprimer3. >> >>How many users would like this added in EMBOSS? > > > I have no idea how many users want to access all the options of Primer. It can > certainly do no harm to support them all. But maybe then split the page in more > "type:page" sections. In Staden, eprimer3 is unusable because the "Start" button > disappears below the bottom of the screen. I do not know if other GUI's also > have problems. eprimer3 certainly needs lots of sections. Suggestions for good ways to split the sections are welcome (they only apply to GUIs - EMBOSS will ignore them anyway). All we need are: section section list of ACD qualifiers endsection endsection From letondal at pasteur.fr Thu Jun 5 08:52:47 2003 From: letondal at pasteur.fr (Catherine Letondal) Date: Thu, 05 Jun 2003 14:52:47 +0200 Subject: pestfind: name collision Message-ID: <200306051252.h55CqlhJ359524@electre.pasteur.fr> Hi, There is a name collision of an EMBOSS program called pestfind with the program pestfind that already existed (at least in Pise). I had to rename our original interface to Pestfind. (cf http://bioweb.pasteur.fr/seqanal/protein/intro-uk.html) However, it is very possible that the EMBOSS interface is equivalent or better. What do you think? Regards, -- Catherine Letondal -- Pasteur Institute Computing Center From battaile at mcw.edu Thu Jun 5 09:43:26 2003 From: battaile at mcw.edu (Kevin Battaile) Date: Thu, 5 Jun 2003 08:43:26 -0500 (CDT) Subject: wossname Message-ID: <48601.141.106.186.40.1054820606.squirrel@post.its.mcw.edu> I was installing 2.7.1 last night and noticed that 'wossname' seems to be broken. This is the only thing it reports: [linux3 emboss]$ ./wossname Finds programs by keywords in their one-line documentation Keyword to search for, or blank to list all programs: PROTEIN COMPOSITION checktrans Reports STOP codons and ORF statistics of a protein I was trying to add in the embassy programs to the jemboss list as described on the jemboss web site and can't since wossname doesn't seem to work. Has anyone else noticed this, or it is just me? -Kevin From asmann.Yan at mayo.edu Thu Jun 5 09:53:40 2003 From: asmann.Yan at mayo.edu (Asmann, Yan Ph.D.) Date: Thu, 5 Jun 2003 08:53:40 -0500 Subject: database size Message-ID: Hi, I have installed the EMBOSS2.7.0, and tried to index databases using dbifasta. I found that when database size is over 2GB (e.g. est_human... etc), dbifasta will give EMBOSS An error message as following: " in embdbi.c at line 295: Cannot open ./est_mouse for reading" I remember for version 2.2.0, there wasn't any error message for over-sized DBs, the dbifasta would start indexing but an "fragmentation fault" will happen later. Has anyone had the same problem for 2.7.0? Is anyone working on modifying dbi* programes for DBs larger than 2GB? Thanks, Yan From mathog at mendel.bio.caltech.edu Thu Jun 5 10:55:11 2003 From: mathog at mendel.bio.caltech.edu (David Mathog) Date: Thu, 05 Jun 2003 07:55:11 -0700 Subject: pestfind: name collision Message-ID: > > There is a name collision of an EMBOSS program called pestfind with the program > pestfind that already existed (at least in Pise). Yes, same problem here. > I had to rename our original > interface to Pestfind. > (cf http://bioweb.pasteur.fr/seqanal/protein/intro-uk.html) > However, it is very possible that the EMBOSS interface is equivalent or better. > What do you think? The original PESTFIND was a basic program by Martin Rechsteiner with corrections by Bob Stellwagen. I've never seen it run (not having basic on any of my machines) but In 1995 I obtained the code and ported it (more or less literally translated line for line) to ANSI C, that version is still available here: ftp://saf.bio.caltech.edu/pub/software/molbio/pestfind.zip At that time I left the name as "pestfind" because it was simply a translation of the original program into a new language. The numeric results were intended to exactly reproduce the original (and not improve on them in any way.) Later a PERL version was written by M.Grabner. I have not seen the code but according to this page: http://emb1.bcc.univie.ac.at/embnet/tools/bio/PESTfind/about.htm it was also a translation from the original basic. The pestfind in EMBOSS is by Michael K. Schuster and Martin Grabner. It appears to be a translation to C from MG's earlier Perl. I have not analyzed the EMBOSS code extensively but clearly it differs in some ways from the original PESTFIND since the results are not quite the same. A quick glance showed that the original had a weight term and two of its values were 186 and 163, this bit of code seems to be missing from the EMBOSS PESTFIND. Perhaps these are coded in there in some other manner, for instance, the values are derived from some included table and differ slightly from the integer values? The results produced by drm_PESTFIND (mine) and emboss_PESTFIND are (for instance): drm_PESTFIND: Potential PEST sequence 89-124 (flank_dist=34) HYTNPSQDVTVPCPVPSTPPTPSPSTPPTPSPSCCH The weight percent of PEDST is: 60.854301 The hydrophobicity index is: 39.809540 The PEST-FIND score is: 13.565096 --------------------------------- emboss_PESTFIND: Potential PEST motif with 34 amino acids between position 89 and 124. 89 HYTNPSQDVTVPCPVPSTPPTPSPSTPPTPSPSCCH 124 DEPST: 60.53 % (w/w) Hydrophobicity index: 39.60 PEST score: 13.49 The differences are too large to be rounding errors - there's some (slight) intrinsic difference in the code. Part of this is probably due to the lack of an explicit "weight" term in the EMBOSS pestfind, and part may be due to the EMBOSS version correcting a bug in the original Basic version which I left (intentionally) intact in the C translation. The bottom line though is that: 1. The EMBOSS version seems to be doing a slightly different calculation than the original PESTFIND. The results are very close, they may even be "better" by some criteria, but they are not the same. 2. There was already an earlier program with that name. Usually with EMBOSS a port of "program" into an EMBOSS version resulted in "eprogram" in order to avoid exactly this sort of confusion. So the EMBOSS version should be renamed "epestfind". Regards, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From letondal at pasteur.fr Thu Jun 5 13:32:48 2003 From: letondal at pasteur.fr (Catherine Letondal) Date: Thu, 05 Jun 2003 19:32:48 +0200 Subject: pestfind: name collision In-Reply-To: Your message of "Thu, 05 Jun 2003 07:55:11 PDT." Message-ID: <200306051732.h55HWmhJ229993@electre.pasteur.fr> "David Mathog" wrote: Thanks David for this detailed answer! > [...] > I have not analyzed the EMBOSS code extensively but clearly > it differs in some ways from the original PESTFIND since the > results are not quite the same. A quick glance showed that > the original had a weight term and two of its > values were 186 and 163, this bit of code seems to be > missing from the EMBOSS PESTFIND. Perhaps these are coded in > there in some other manner, for instance, the values are derived > from some included table and differ slightly from the integer > values? > [...] > > The bottom line though is that: > > 1. The EMBOSS version seems to be doing a slightly different > calculation than the original PESTFIND. The results are > very close, they may even be "better" by some criteria, but > they are not the same. > > 2. There was already an earlier program with that name. > Usually with EMBOSS a port of "program" into an EMBOSS version > resulted in "eprogram" in order to avoid exactly this > sort of confusion. > > So the EMBOSS version should be renamed "epestfind". Do people from EMBOSS agree with this? -- Catherine Letondal -- Pasteur Institute Computing Center From ableasby at hgmp.mrc.ac.uk Thu Jun 5 13:40:12 2003 From: ableasby at hgmp.mrc.ac.uk (Alan Bleasby) Date: Thu, 5 Jun 2003 18:40:12 +0100 (BST) Subject: pestfind: name collision Message-ID: <200306051740.h55HeCaB006461@uranium.hgmp.mrc.ac.uk> Noone has objected since I asked a few hours ago so you can almost rest assured that it will be called epestfind in the next release. Alan From martin.petersen at id.unibe.ch Fri Jun 6 01:00:51 2003 From: martin.petersen at id.unibe.ch (Martin Petersen) Date: Fri, 06 Jun 2003 07:00:51 +0200 Subject: error in Jemboss authentication Message-ID: <200306060700.51169.martin.petersen@id.unibe.ch> Dear Jemboss experts I have a problem installing the Jemboss application with authentication. Every time, Jemboss wants to start a program on the server, it waits 30 seconds and gives back the message "authentication failed / Login to server failed / Please check your login details". The failure arrives with both shadow and PAM authentication. I use EMBOSS 2.6.0 and 2.7.1 on a SUSE Linux 8.2 machine. The method, that waits 30 seconds and gives back a false is Ajax.userAuth(), defined probably in the ajax/ajjava.c file. It seems like Ajax calls something that hangs, and after 30 seconds it stoppes it and gives back a "false". So perhaps I miss a file or I have a wrong version installed. The thing is, I really have no idea, where I have to search. So has anyone of you encountered this problem, too? Does anyone know where my problem could be founded? Or are there running Jemboss installations, where I could get a exact installation script? I packed some configuration files and installation description in the file: http://ubecx.unibe.ch/~petersen/help-jemboss.zip Regards, Martin Petersen ---------------------------------------- Martin Petersen Computer Service Dept. - University of Berne martin.petersen at id.unibe.ch From simon.andrews at bbsrc.ac.uk Mon Jun 9 10:10:06 2003 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Mon, 9 Jun 2003 15:10:06 +0100 Subject: needle -filter Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28A5A@bi-exsrv1.iapc.bbsrc.ac.uk> I'm trying to get needle to work from a set of sequences held in memory, rather than have it pick up its input from a file. For something like seqret I can do: cat seq.txt | seqret -filter -osf fasta | more and seqret will read in on stdin and write out on stdout. In the manual for needle it suggests that it too can accept -filter as a qualifier, but I can't get it to work. cat seq1.txt seq2.txt | needle -filter -sformat1 fasta -sformat2 fasta It always dies with the message "Bad option for -seqall with -auto defined". I'm trying to feed it two concatenated fasta files as input, but when I debug it it looks like it only gets one of them. Does anyone have any suggestions as to how I can make this work? Cheers Simon. -- Simon Andrews PhD Bioinformatics Dept The Babraham Institute simon.andrews at bbsrc.ac.uk +44 (0)1223 496463 From pmr at ebi.ac.uk Mon Jun 9 12:09:09 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 09 Jun 2003 17:09:09 +0100 Subject: needle -filter References: <2DC41140A89ED411989D00508BDCD9ED01E28A5A@bi-exsrv1.iapc.bbsrc.ac.uk> Message-ID: <3EE4B125.8060502@ebi.ac.uk> simon andrews (BI) wrote: > In the manual for needle it suggests that it too can accept -filter as a qualifier, but I can't get it to work. > > cat seq1.txt seq2.txt | needle -filter -sformat1 fasta -sformat2 fasta > > It always dies with the message "Bad option for -seqall with -auto defined". I'm trying to feed it two concatenated fasta files as input, but when I debug it it looks like it only gets one of them. > > Does anyone have any suggestions as to how I can make this work? EMBOSS (and anything else) expects one standard input. You are trying to read 2 inputs from stdin. needle will accept one sequence from stdin and another from "somewhere else". But you can do this: needle "cat seq1.txt|" "cat seq2.txt|" -sformat1 fasta -sformat2 fasta EMBOSS treats "cat seq1.txt|" as a command and reads the standard output. With -filter it will default to writing to stdout. Hope this helps, Peter Rice From mathog at mendel.bio.caltech.edu Mon Jun 9 14:55:25 2003 From: mathog at mendel.bio.caltech.edu (David Mathog) Date: Mon, 09 Jun 2003 11:55:25 -0700 Subject: needle -filter Message-ID: > Peter Rice wrote: > > simon andrews (BI) wrote: > > In the manual for needle it suggests that it too can accept -filter as a qualifier, but I can't get it to work. > > > > cat seq1.txt seq2.txt | needle -filter -sformat1 fasta -sformat2 fasta > > Hmm. So presumably they're coming out of some other program together in a stream and it's inconvenient for some reason to write them to files. Ok. > You are trying to read 2 inputs from stdin. needle will accept one > sequence from stdin and another from "somewhere else". > > But you can do this: > > needle "cat seq1.txt|" "cat seq2.txt|" -sformat1 fasta -sformat2 fasta That's got to be one of the ugliest syntaxes for reading in two files I've ever seen! Plus I don't understand how it differs from: needle seq1.txt seq2.txt It might be possible on some platforms to come up with a "firstfasta" filter program which would emit just the first fasta entry from the stream. It would have to run character by character and be able to push the ">" of the second entry back into the input stream, and I don't think that's guaranteed to work everywhere. Probably it would work on Unix though, so you could maybe do something like this: needle "firstfasta" "firstfasta" What Simon needs, and what Emboss doesn't have, is a built in splitter for multisequence files that will allow the individual sequences to be directed to specific inputs in a program like needle. Failing that one could create two fifos, use an external splitter to direct the bits into the fifos, and run needle with the fifos for the input file names. Probably better to build the splitter into EMBOSS though. Something like: cat twosequences.fasta | program -filter -route 1:infile1,2:infile2 where infile1/infile2 are the command line names for things that are typically called "-sequence" and the like. The problem with needle (and water) is that the sequences typically go on the command line unadorned, like: needle seq1 seq2 for which the syntax might be: -route 1:1,2:2 -route without -filter would be an error. The stream properties would make it a bit awkward for something like this: -route 1:1,1:2 If the program works by loading input 1, then input 2. No way to back up the stream so that input 2 could load with entry 1. The splitter/router could handle this, but only generally by saving the contents of the first streamed sequence somewhere for reuse. For a program to compare one to many there could also be: -route 1:1,2-END:2 In theory this splitter/router shouldn't be too hard to implement. In practice the various file inputs would need to read their data in the order specified by route, and short of reading each program's code one would have no way of knowing what that order is. Which suggests: program -listroutes which would emit the read order information that -route would use later. Regards, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From peptides at earthlink.net Mon Jun 9 21:33:11 2003 From: peptides at earthlink.net (David Stephens) Date: Mon, 9 Jun 2003 18:33:11 -0700 Subject: Catalog Request Form Message-ID: <20030610013959.3B0837D2A7@mercury.hgmp.mrc.ac.uk> -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030609/b4b46368/attachment.html From hanyj at genomics.org.cn Tue Jun 10 02:02:02 2003 From: hanyj at genomics.org.cn (hanyj) Date: Tue, 10 Jun 2003 14:02:02 +0800 Subject: about charge Message-ID: <001201c32f15$d0a6d900$f204a8c0@BGI.LOCAL> Dear Sir, I just used the program "charge". It worked well, but I did not know what the values' meanings were. For example, 0.10 or -0.10 ? Could you tell my ASAP, it is very important for me. Thank you in advance! Sincerely, Han yujun BGI, China -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030610/8b76d395/attachment.html From David.Bauer at SCHERING.DE Tue Jun 10 02:49:44 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Tue, 10 Jun 2003 08:49:44 +0200 Subject: Antwort: about charge Message-ID: Hello Han, charge uses the column "charge" from the datafile Eamino.dat (in a default setup it is in /usr/local/share/EMBOSS/data/). It gives D and E a charge of -1, K and R +1, H +0.5. Then it calculates the mean charge with across -window (default ist 5). Hope this helps, David. "hanyj" An: Gesendet von: Kopie: owner-emboss at hgm Thema: about charge p.mrc.ac.uk 10.06.03 08:02 Dear Sir, I just used the program "charge". It worked well, but I did not know what the values' meanings were. For example, 0.10 or -0.10 ? Could you tell my ASAP, it is very important for me. Thank you in advance! Sincerely, Han yujun BGI, China From simon.andrews at bbsrc.ac.uk Tue Jun 10 03:53:52 2003 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Tue, 10 Jun 2003 08:53:52 +0100 Subject: needle -filter Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28A5B@bi-exsrv1.iapc.bbsrc.ac.uk> > From: David Mathog > > Peter Rice wrote: > > > simon andrews (BI) wrote: > > > In the manual for needle it suggests that it too can > > > accept -filter as a qualifier, but I can't get it to work. > > > > > > cat seq1.txt seq2.txt | needle -filter -sformat1 > > > fasta -sformat2 fasta > > > > > Hmm. So presumably they're coming out of some other program > together in a stream and it's inconvenient for some reason to > write them to files. Ok. Yes, it's going to be used as part of a CGI script so the sequences are already in variables in the script. I could go down the line of creating temp files, but this gets to be a real pain (making sure different processes don't clash, and cleaning up afterwards), and it would slow things down as well. > > You are trying to read 2 inputs from stdin. needle will > > accept one sequence from stdin and another from "somewhere > > else". > > > > But you can do this: > > > > needle "cat seq1.txt|" "cat seq2.txt|" -sformat1 fasta > > -sformat2 fasta That's an interesting thing to know, but I don't think it really helps me. The example I gave with cat was just used to generate the pipe, the actual sequences would all have to come from one input stream. > It might be possible on some platforms to come up with a > "firstfasta" filter program which would emit just the > first fasta entry from the stream. It would have to run > character by character and be able to push the ">" of the > second entry back into the input stream, and I don't think > that's guaranteed to work everywhere. Probably it would work > on Unix though, so you could maybe do something like this: > > needle "firstfasta" "firstfasta" I don't think that would be any easier than going down the whole tempfile route. You'd still have the problem of getting firstfasta to figure out which stream it should pass a sequence in from when multiple instances were running. > What Simon needs, and what Emboss doesn't have, is a built in > splitter for multisequence files that will allow the > individual sequences to be directed to specific inputs in a > program like needle. Failing that one could create two > fifos, use an external splitter to direct the bits into the > fifos, and run needle with the fifos for the input file names. > > Probably better to build the splitter into EMBOSS though. > Something like: > > cat twosequences.fasta | program -filter -route > 1:infile1,2:infile2 This seems a good addition to the package, but for many programs you could probably make the route part optional, and just say that -filter expects all its sequences on STDIN in the same format. I don't think it would be too much of an imposition on the user to say that if you want to submit multiple sequences to a program in a single stream then they all have to come in the correct order. Projects such as BioPerl have stream filters which will read multiple concatenated sequences in most formats so hopefully that shouldn't present too many problems, but as David pointed out you'd have to be able to rewind (at least one line) in the stream for something like Fasta format. > If the program works by loading input 1, then input 2. No > way to back up the stream so that input 2 could load with > entry 1. The splitter/router could handle this, but only > generally by saving the contents of the first streamed > sequence somewhere for reuse. This sounds like the sort of scenario I'm trying to avoid with my initial query! What happens if you're putting 200 sequences into a multiple alignment, in a random order, and there's 5 copies running. It all gets a bit complex and messy :-) Again I'd be tempted to just say that if you want to put your inputs on STDIN they have to come in the right order. As a programmer that shouldn't be too hard to organise. As an aside, the idea of the asis: USA is a really nice way around this whole problem. The trouble is that it's limited (I presume) by the command line length your shell allows, and by you not being able to specify a name for the sequence. If there was some easy way around this limitation, then that would solve the problem for the situations I can think I'm likely to encounter. Simon. From pmr at ebi.ac.uk Tue Jun 10 04:48:04 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 10 Jun 2003 09:48:04 +0100 Subject: needle -filter References: Message-ID: <3EE59B44.4040007@ebi.ac.uk> David Mathog wrote: >>Peter Rice wrote: >>needle "cat seq1.txt|" "cat seq2.txt|" -sformat1 fasta -sformat2 fasta > > That's got to be one of the ugliest syntaxes for reading > in two files I've ever seen! It's standard in perl :-) Any file ending in a pipe character is a command producing standard output. > Plus I don't understand how > it differs from: > > needle seq1.txt seq2.txt Because you don't have to use cat ... you can use seqret, getz, or anything else :-) > It might be possible on some platforms to come up with a > "firstfasta" filter program which would emit just the > first fasta entry from the stream. That's already in EMBOSS several times, for example: nthseq seqret -first skipseq -skip 1 SRS, to quote one example, uses these to split inputs. > What Simon needs, and what Emboss doesn't have, is a built in > splitter for multisequence files that will allow the individual > sequences to be directed to specific inputs in a program like > needle. You mean needle seq1.txt:abc seq2.txt:xyz That is already available!!!! > For a program to compare one to many there could also be: > > -route 1:1,2-END:2 That would make workflows extremely messy. I reckon the existing EMBOSS syntax covers everything perfectly well. Hope this helps, Peter From jon at compbio.dundee.ac.uk Tue Jun 10 05:30:44 2003 From: jon at compbio.dundee.ac.uk (Jonathan Barber) Date: Tue, 10 Jun 2003 10:30:44 +0100 Subject: needle -filter In-Reply-To: <2DC41140A89ED411989D00508BDCD9ED01E28A5B@bi-exsrv1.iapc.bbsrc.ac.uk> References: <2DC41140A89ED411989D00508BDCD9ED01E28A5B@bi-exsrv1.iapc.bbsrc.ac.uk> Message-ID: <20030610093044.GE22944@flea.compbio.dundee.ac.uk> On Tue, Jun 10, 2003 at 08:53:52AM +0100, simon andrews (BI) wrote: > > From: David Mathog > > > Peter Rice wrote: > > > > simon andrews (BI) wrote: > > > > In the manual for needle it suggests that it too can > > > > accept -filter as a qualifier, but I can't get it to work. > > > > > > > > cat seq1.txt seq2.txt | needle -filter -sformat1 > > > > fasta -sformat2 fasta > > > > > > > > Hmm. So presumably they're coming out of some other program > > together in a stream and it's inconvenient for some reason to > > write them to files. Ok. > > Yes, it's going to be used as part of a CGI script so the sequences > are already in variables in the script. I could go down the line of > creating temp files, but this gets to be a real pain (making sure > different processes don't clash, and cleaning up afterwards), and it > would slow things down as well. If you're using Perl, the easiest way to do this is to use the core File::Temp module. tempdir() may be exactly what you need. [snip] > As an aside, the idea of the asis: USA is a really nice way around > this whole problem. The trouble is that it's limited (I presume) by > the command line length your shell allows, and by you not being able > to specify a name for the sequence. If there was some easy way around > this limitation, then that would solve the problem for the situations > I can think I'm likely to encounter. Again, if you're using Perl, then you can use system() with a list argument rather than a scalar, and this will avoid the shell, if your command doesn't have any shell metacharacters in it (perldoc -f system). -- Jon From kim at inb.uni-luebeck.de Tue Jun 10 06:44:16 2003 From: kim at inb.uni-luebeck.de (Jan T. Kim) Date: Tue, 10 Jun 2003 12:44:16 +0200 Subject: needle -filter In-Reply-To: <3EE59B44.4040007@ebi.ac.uk>; from pmr@ebi.ac.uk on Tue, Jun 10, 2003 at 09:48:04AM +0100 References: <3EE59B44.4040007@ebi.ac.uk> Message-ID: <20030610124416.B5472@pc10.inb.mu-luebeck.de> On Tue, Jun 10, 2003 at 09:48:04AM +0100, Peter Rice wrote: > > What Simon needs, and what Emboss doesn't have, is a built in > > splitter for multisequence files that will allow the individual > > sequences to be directed to specific inputs in a program like > > needle. > > You mean needle seq1.txt:abc seq2.txt:xyz > > That is already available!!!! In the case discussed here it seems that both sequence entries would come from the same file (e.g. seq1.txt), which is no problem as long as it's really a file. But what if the file really is an input stream? In that case, you'd need something like needle :abc :xyz Technically, this would entail some problems, as entry "xyz" may precede "abc" in the stream. The needle program would therefore have to scan the input stream using a list of entries which it needs, scanning twice, as I'd expect it to happen in needle :abc :xyz will not work with input streams. Perhaps, such capability could be implemented by defining some special name for the "standard input file" or "standard input database"? I haven't found such a thing in the USA specification, but perhaps, that's already invented? Kind regards, Jan -- +- Jan T. Kim -------------------------------------------------------+ | *NEW* email: kim at inb.uni-luebeck.de | | *NEW* WWW: http://www.inb.uni-luebeck.de/staff/kim.html | *-----=< hierarchical systems are for files, not for humans >=-----* From pmr at ebi.ac.uk Tue Jun 10 06:53:16 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 10 Jun 2003 11:53:16 +0100 Subject: needle -filter References: <3EE59B44.4040007@ebi.ac.uk> <20030610124416.B5472@pc10.inb.mu-luebeck.de> Message-ID: <3EE5B89C.8020304@ebi.ac.uk> Jan T. Kim wrote: > needle :abc :xyz > > will not work with input streams. Perhaps, such capability could be > implemented by defining some special name for the "standard input file" > or "standard input database"? I haven't found such a thing in the USA > specification, but perhaps, that's already invented? There is a special name - stdin - but it can only be opened once. How many Unix commands do read more than one input stream from stdin? Peter From simon.andrews at bbsrc.ac.uk Tue Jun 10 07:15:29 2003 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Tue, 10 Jun 2003 12:15:29 +0100 Subject: needle -filter Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28A5E@bi-exsrv1.iapc.bbsrc.ac.uk> > -----Original Message----- > From: Jonathan Barber [mailto:jon at compbio.dundee.ac.uk] > Sent: 10 June 2003 10:31 > To: 'emboss at embnet.org' > Subject: Re: needle -filter > > > As an aside, the idea of the asis: USA is a really nice way around > > this whole problem. The trouble is that it's limited (I presume) by > > the command line length your shell allows, and by you not being able > > to specify a name for the sequence. If there was some easy > > way around this limitation, then that would solve the problem for the > > situations I can think I'm likely to encounter. > > Again, if you're using Perl, then you can use system() with a list > argument rather than a scalar, and this will avoid the shell, if your > command doesn't have any shell metacharacters in it (perldoc > -f system). System doesn't help me as I can't read STDOUT from it, but looking at the docs for IPC::Open3 it looks like I can do the whole thing that way instead. Cheers for the pointer, I wouldn't have throught about doing it that way! After a bit of playing, it's not quite as easy as I'd hoped, but I got it to work. The script at the bottom shows one way to get needle to work without having to write anything to disk. One quick extra feature request though. For the asis:: USA, would it be possible to assign a name to the sequences passed in, even if it's only 1,2,3 or seq1 seq2 seq3 etc. It would make parsing of output files much easier. A way to specify a name in the USA would be even better (eg asis::name>GAGAGTGTAGT or whatever). Cheers for all the help on this, it seems to have provoked some interesting discussion. TTFN Simon. #!/usr/bin/perl -w use strict; use IPC::Open3; my $seq_a = 'CCAGCCCATTTATCTATACCATGAGGTAACTGAAGTAAGGAGAGCAGTGA'; my $seq_b = 'CCAGCCCATTTATCTATACCATGAGGTTTCTGAAGTAAGGAGAGCAGTGA'; open (ERRORS,'>/dev/null') || die "Can't open /dev/null :$!"; open3 (\*INPUT,\*OUTPUT,\*ERRORS,'needle',"asis::$seq_a","asis::$seq_b"); print INPUT "10\n"; print INPUT "0.5\n"; print INPUT "stdout\n"; print INPUT "\n"; close INPUT; print "OUTPUT: $_" while (); From pmr at ebi.ac.uk Tue Jun 10 07:38:33 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 10 Jun 2003 12:38:33 +0100 Subject: needle -filter References: <2DC41140A89ED411989D00508BDCD9ED01E28A5E@bi-exsrv1.iapc.bbsrc.ac.uk> Message-ID: <3EE5C339.6050004@ebi.ac.uk> simon andrews (BI) wrote: > One quick extra feature request though. For the asis:: USA, would it be > possible to assign a name to the sequences passed in, even if it's > only 1,2,3 or seq1 seq2 seq3 etc. It would make parsing of output files > much easier. A way to specify a name in the USA would be even better > (eg asis::name>GAGAGTGTAGT or whatever). Should be possible to do this: needle asis::aaacccgggttt -sid simon asis::aacccgg -sid peter -filter but there is a problem with the second -sid for needle because it is a seqall input, and specifying the id is a problem with possibly more than one input. We can look into allowing -sid for seqall input, for the first sequence in the stream. Peter From jon at compbio.dundee.ac.uk Tue Jun 10 07:58:34 2003 From: jon at compbio.dundee.ac.uk (Jonathan Barber) Date: Tue, 10 Jun 2003 12:58:34 +0100 Subject: needle -filter In-Reply-To: <2DC41140A89ED411989D00508BDCD9ED01E28A5E@bi-exsrv1.iapc.bbsrc.ac.uk> References: <2DC41140A89ED411989D00508BDCD9ED01E28A5E@bi-exsrv1.iapc.bbsrc.ac.uk> Message-ID: <20030610115834.GF22944@flea.compbio.dundee.ac.uk> On Tue, Jun 10, 2003 at 12:15:29PM +0100, simon andrews (BI) wrote: > > > > -----Original Message----- > > From: Jonathan Barber [mailto:jon at compbio.dundee.ac.uk] > > Sent: 10 June 2003 10:31 > > To: 'emboss at embnet.org' > > Subject: Re: needle -filter > > > > > As an aside, the idea of the asis: USA is a really nice way around > > > this whole problem. The trouble is that it's limited (I presume) by > > > the command line length your shell allows, and by you not being able > > > to specify a name for the sequence. If there was some easy > > > way around this limitation, then that would solve the problem for the > > > situations I can think I'm likely to encounter. > > > > Again, if you're using Perl, then you can use system() with a list > > argument rather than a scalar, and this will avoid the shell, if your > > command doesn't have any shell metacharacters in it (perldoc > > -f system). > > System doesn't help me as I can't read STDOUT from it, but looking at > the docs for IPC::Open3 it looks like I can do the whole thing that > way instead. Cheers for the pointer, I wouldn't have throught about > doing it that way! That's the way I usually handle the emboss programs as well, but I didn't think of using the asis, nifty. > > After a bit of playing, it's not quite as easy as I'd hoped, but I got > it to work. The script at the bottom shows one way to get needle to > work without having to write anything to disk. > > One quick extra feature request though. For the asis:: USA, would it be > possible to assign a name to the sequences passed in, even if it's > only 1,2,3 or seq1 seq2 seq3 etc. It would make parsing of output files > much easier. A way to specify a name in the USA would be even better > (eg asis::name>GAGAGTGTAGT or whatever). > > Cheers for all the help on this, it seems to have provoked some interesting > discussion. > > TTFN > > Simon. > > > #!/usr/bin/perl -w > use strict; > use IPC::Open3; > > my $seq_a = 'CCAGCCCATTTATCTATACCATGAGGTAACTGAAGTAAGGAGAGCAGTGA'; > > my $seq_b = 'CCAGCCCATTTATCTATACCATGAGGTTTCTGAAGTAAGGAGAGCAGTGA'; > > open (ERRORS,'>/dev/null') || die "Can't open /dev/null :$!"; > > open3 (\*INPUT,\*OUTPUT,\*ERRORS,'needle',"asis::$seq_a","asis::$seq_b"); > > print INPUT "10\n"; > print INPUT "0.5\n"; > print INPUT "stdout\n"; > print INPUT "\n"; > > close INPUT; > > print "OUTPUT: $_" while (); One small point on using open3() is that you should probably record the pid and waitpid() on it to prevent zombies: my $pid = open3 (\*INPUT,\*OUTPUT,\*ERRORS,'needle',"asis::$seq_a","asis::$seq_b"); print INPUT <; waitpid $pid, 0; -- Jon From kim at inb.uni-luebeck.de Tue Jun 10 10:20:30 2003 From: kim at inb.uni-luebeck.de (Jan T. Kim) Date: Tue, 10 Jun 2003 16:20:30 +0200 Subject: needle -filter In-Reply-To: <3EE5B89C.8020304@ebi.ac.uk>; from pmr@ebi.ac.uk on Tue, Jun 10, 2003 at 11:53:16AM +0100 References: <3EE59B44.4040007@ebi.ac.uk> <20030610124416.B5472@pc10.inb.mu-luebeck.de> <3EE5B89C.8020304@ebi.ac.uk> Message-ID: <20030610162030.A6214@pc10.inb.mu-luebeck.de> On Tue, Jun 10, 2003 at 11:53:16AM +0100, Peter Rice wrote: > Jan T. Kim wrote: > > needle :abc :xyz > > > > will not work with input streams. Perhaps, such capability could be > > implemented by defining some special name for the "standard input file" > > or "standard input database"? I haven't found such a thing in the USA > > specification, but perhaps, that's already invented? > > There is a special name - stdin - but it can only be opened once. Ok -- thanks for this pointer, I managed to overlook this. Among general lack of attention, I overlooked it because I was focusing on something like a special file name "-", which is generically used in the *nix / command line world to denote the standard input. > How many Unix commands do read more than one input stream from stdin? None. There are no multiple standards in the Unix world, so there is no multiple stdin... ;-) More seriously: The standard input is logically one input stream. The issue here is not multiple input streams which, in the Unix environment, would typically be handled by using named pipes (this may also be an approach for solving the problem from which this thread originated). In many cases, though, it is preferable to have one input stream which is structured into multiple records, such as sequence entries in our case. Handling such multiple-record input would be more convenient if EMBOSS did not have to perform a pass through an entire stream for each record it needs to obtain. This approach is restricted to streams which can be "reproduced", which does not generally apply to the standard input stream. Kind regards, Jan -- +- Jan T. Kim -------------------------------------------------------+ | *NEW* email: kim at inb.uni-luebeck.de | | *NEW* WWW: http://www.inb.uni-luebeck.de/staff/kim.html | *-----=< hierarchical systems are for files, not for humans >=-----* From pmr at ebi.ac.uk Tue Jun 10 10:47:31 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 10 Jun 2003 15:47:31 +0100 Subject: needle -filter References: <3EE59B44.4040007@ebi.ac.uk> <20030610124416.B5472@pc10.inb.mu-luebeck.de> <3EE5B89C.8020304@ebi.ac.uk> <20030610162030.A6214@pc10.inb.mu-luebeck.de> Message-ID: <3EE5EF83.7070008@ebi.ac.uk> Jan T. Kim wrote: > More seriously: The standard input is logically one input stream. The > issue here is not multiple input streams which, in the Unix environment, > would typically be handled by using named pipes (this may also be an > approach for solving the problem from which this thread originated). > In many cases, though, it is preferable to have one input stream which > is structured into multiple records, such as sequence entries in our > case. Handling such multiple-record input would be more convenient if > EMBOSS did not have to perform a pass through an entire stream for each > record it needs to obtain. This approach is restricted to streams which > can be "reproduced", which does not generally apply to the standard > input stream. EMBOSS does not (always) read the entire stream - but it would have to rewind the input to read a second sequence. Consider, for example, FASTA format: >abc aaacccgggttt >def tttgggcccaaa EMBOSS has to read the first line of the second sequence - just to know that the first sequence has ended. Peter From gbottu at ben.vub.ac.be Tue Jun 10 10:51:14 2003 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Tue, 10 Jun 2003 16:51:14 +0200 (CEST) Subject: problem with List Files + SRS access Message-ID: <200306101451.h5AEpE0k1310952@black.vub.ac.be> from : BEN Dear support, I just hit on a problem. I have an EMBOSS List File with more than 1000 entries that I try to give as input to an EMBOSS program. The program crashes with error message : task_create() failed for pid 1307576: max_proc_per_user (=256) exceeded for uid 430. EMBOSS An error in ajfile.c at line 125: fork create failed While the program is running, the command "ps x" gives : ... 1307703 pts/2 <+ 0:00.00 1307706 pts/2 <+ 0:00.00 1307713 pts/2 <+ 0:00.00 1307714 pts/2 R + 0:00.29 getz -e [EMBL-id:AF017184]|[EMBL-acc:AF017184] 1307720 pts/2 <+ 0:00.00 1307722 pts/2 <+ 0:00.00 1307729 pts/2 <+ 0:00.00 ... Note that the EMBL databank is accessed by the "srs" method. For databanks acessed by the "emblcd" method there is no problem. Looks like a bug in the interface between EMBOSS and "getz", doesn'it ? (I am using EMBOSS 2.6.0 under CompaqTru64 5.1A). Sincerely, Guy Bottu From mathog at mendel.bio.caltech.edu Tue Jun 10 11:47:49 2003 From: mathog at mendel.bio.caltech.edu (David Mathog) Date: Tue, 10 Jun 2003 08:47:49 -0700 Subject: needle -filter Message-ID: > Peter Rice wrote: > > EMBOSS does not (always) read the entire stream - but it would have to > rewind the input to read a second sequence. > > Consider, for example, FASTA format: > > >abc > aaacccgggttt > >def > tttgggcccaaa > > EMBOSS has to read the first line of the second sequence - > just to know that the first sequence has ended. Only the first character of that line, which is what I was referring to in my earlier post. If the input uses getc() it can do an ungetc() at the second '>' and then exit. The next "firstfasta" should pick up the same '>' as its first character. At least on Unix. ungetc() isn't the most portable of functions - but all the OS's I know of allow it to be called at least once. Just don't expect to be able to call it a thousand times sequentially. Regards, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From pmr at ebi.ac.uk Tue Jun 10 12:02:16 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 10 Jun 2003 17:02:16 +0100 Subject: needle -filter References: Message-ID: <3EE60108.5050200@ebi.ac.uk> David Mathog wrote: > Only the first character of that line, which is what I was > referring to in my earlier post. If the input uses getc() > it can do an ungetc() at the second '>' and then exit. > The next "firstfasta" should pick up the same '>' > as its first character. At least on Unix. ungetc() isn't > the most portable of functions - but all the OS's I know > of allow it to be called at least once. Just don't > expect to be able to call it a thousand times sequentially. ... of course, I was carefully avoiding mention of GCG format which ruins any plans to use ungetc :-) ... and you can't seek back to the position in a pipe Peter From mathog at mendel.bio.caltech.edu Tue Jun 10 12:20:09 2003 From: mathog at mendel.bio.caltech.edu (David Mathog) Date: Tue, 10 Jun 2003 09:20:09 -0700 Subject: needle -filter Message-ID: > David Mathog wrote: > > > Only the first character of that line, which is what I was > > referring to in my earlier post. If the input uses getc() > > it can do an ungetc() at the second '>' and then exit. > > The next "firstfasta" should pick up the same '>' > > as its first character. At least on Unix. ungetc() isn't > > the most portable of functions - but all the OS's I know > > of allow it to be called at least once. Just don't > > expect to be able to call it a thousand times sequentially. > > ... of course, I was carefully avoiding mention of GCG format which > ruins any plans to use ungetc :-) > > ... and you can't seek back to the position in a pipe Not directly. But one can maintain inside getnextline() a rollback buffer that stores the last N lines from fgets(). Reread lines from the rollback buffer instead of the actual stream. That will typically do the job so long as the need to rollback is something reasonable, say, no more than a couple of hundreds of lines. Such a rollback buffer will have a lot of advantages over unget() sorts of functions. For instance, one could drop in bookmarks and start reading again from those positions. More importantly, it's completely portable. Regards, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From pmr at ebi.ac.uk Tue Jun 10 12:23:28 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 10 Jun 2003 17:23:28 +0100 Subject: needle -filter References: Message-ID: <3EE60600.10206@ebi.ac.uk> David Mathog wrote: >>... and you can't seek back to the position in a pipe > > > Not directly. But one can maintain inside getnextline() > a rollback buffer that stores the last N lines from fgets(). This is essentially an EMBOSS file buffer - but we avoid buffering every input because of the overhead. Let us stick with using EMBOSS to split up input files. It is simple and less likely to break something. Peter From abl at ica.cc Wed Jun 11 12:19:36 2003 From: abl at ica.cc (American Biotech) Date: Wed, 11 Jun 2003 12:19:36 -0400 Subject: Complimentary subscription from International Scientific Communications Message-ID: <446387924309200@ica.cc> Dear Colleague, Please accept my invitation to receive a free subscription to our journal, American Biotechnology Laboratory. American Biotechnology Laboratory, is the leading life science tabloid publication that includes news and information about the latest laboratory products and features articles submitted by prominent scientists from around the world reviewing laboratory techniques and applications of instrumentation and software. Following are the themes to be featured in ABL: * July - Incubators; Shakers; Thermal Cyclers; Real-Time PCR * August - Biomolecular Screening * September - Liquid Handling; Centrifuges * October - Microscopy and Image Analysis; Chemiluminescence * November - DNA/RNA Purification * December - Proteins and Peptides For your FREE subscription to American Biotechnology Laboratory, please click on the following link. http://www.icainfo.com/abl/appintro.asp?NewADD=YES&Priority=PEPAB I am confident that you will enjoy our journal and find it to be of significant professional value. I look forward to hearing from you. Sincerely yours, Brian Howard, Ph.D. Editor International Scientific Communications, Inc. 30 Controls Drive P.O. Box 870 Shelton, CT 06484 Tel.: 203-926-9300 Fax: 203-926-9310 iscpubs at iscpubs.com www.iscpubs.com -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030611/c0e1261b/attachment.html From voltigeur at worldonline.ch Thu Jun 12 04:04:57 2003 From: voltigeur at worldonline.ch (voltigeur at worldonline.ch) Date: Thu, 12 Jun 2003 10:04:57 +0200 Subject: emboss+jemboss on windows(tm) Message-ID: <3EE5965600001620@mx2.tiscali.ch> Hello, Last week I've compiled emboss (2.6.0) and jemboss (standalone version) under windows(xp) using the cygwin environment. It works fine. If anyone is interested I can provide either the binaries or the method to overcome the various problems (or both). Olivier Martin From ruediger at sanbi.ac.za Thu Jun 12 04:18:06 2003 From: ruediger at sanbi.ac.za (Ruediger Braeuning) Date: Thu, 12 Jun 2003 10:18:06 +0200 (SAST) Subject: emboss+jemboss on windows(tm) In-Reply-To: <3EE5965600001620@mx2.tiscali.ch> References: <3EE5965600001620@mx2.tiscali.ch> Message-ID: <20030612101542.U28367-100000@fling.sanbi.ac.za> Hi, I would be very interested in the method to overcome the various problems. I've tried myself and I haven't completely succeeded so far. Thanks Ruediger ------------------------------------------------------------------------- Ruediger Braeuning / South African National Bioinformatics Institute (=) University of the Western Cape Ph. +27 21 959 3645 / Private Bag X17 Fax +27 21 959 2512 (=) Bellville, 7535 www.sanbi.ac.za / South Africa On Thu, 12 Jun 2003 voltigeur at worldonline.ch wrote: > Hello, > > Last week I've compiled emboss (2.6.0) and jemboss > (standalone version) under windows(xp) using the > cygwin environment. It works fine. If anyone is > interested I can provide either the binaries or > the method to overcome the various problems (or > both). > > Olivier Martin > > > > > > > > From jrvalverde at cnb.uam.es Thu Jun 12 05:46:05 2003 From: jrvalverde at cnb.uam.es (José R. Valverde) Date: Thu, 12 Jun 2003 11:46:05 +0200 Subject: needle -filter In-Reply-To: <3EE60108.5050200@ebi.ac.uk> References: <3EE60108.5050200@ebi.ac.uk> Message-ID: <20030612114605.778b8158.jrvalverde@cnb.uam.es> > ... of course, I was carefully avoiding mention of GCG format which > ruins any plans to use ungetc :-) > > ... and you can't seek back to the position in a pipe > > Peter OK, time to abandon lurker mode. First, this is old stuff. K&R show how to handle this situations in their classic "The C Programming Language". The same approach may be used at any level (i.e. more than one character): simply use a bigger read buffer (or a dynamic one). The code in K&R: - ------------------------------------------------------------------------- #define BUFSIZE 100 char buf[BUFSIZE]; /* buffer for ungetch */ int bufp = 0; /* next free position in buf */ int getch(void) /* get a (possibly pushed-back) character */ { return (bufp > 0) ? buf[--bufp] : getchar(); } void ungetch(int c) /* push character back on input */ { if (bufp >= BUFSIZE) printf("ungetch: too many characters\n"); else buf[bufp++] = c; } - -------------------------------------------------------------------------- A dynamic one -- i once used something similar on an arcane db-processing program to deal with UW-type entries: you couldn't tell them until you found the '..' tag, at the end of possibly arbitrarily long comments, since one must read the whole entry sooner or later anyway into memory, it's not that much of a waste to do it like this: - --------------------------------------------------------------------------- #include static char *buf; /* buffer for ungetch */ static size_t bufsize = 128; /* current buffer size */ size_t bufp = 0; /* next free position in buf */ ungetch_init() { if ((buf = (char *) malloc(bufsize)) == NULL) perror("ungetch_init()"); } ungetch_exit() { free(buf); } int getch(void) /* get a (possibly pushed-back) character */ { return (bufp > 0) ? buf[--bufp] : getchar(); } void ungetch(int c) /* push character back on input */ { if (bufp >= bufsize) { /* realloc buf: duplicate its size * might use a linear increase as well, say "+=128" */ bufsize *= 2; if ((buf = (char *) realloc(buf, bufsize)) == NULL) perror("ungetch_init()"); } else buf[bufp++] = c; } - ----------------------------------------------------------------------- Trivial. Second: seeking back. How do 'more' and 'less' manage to seek back-forward stdin? How does ghostview= The simplest approach: read into a temporary file and, if needed, seek from it. The fastest approach: read everything into memory and move on memory (this is easier if one may use mmap(), but this is not so easy with stdin). Use a big enough lookeahead buffer and instead of reading char by char, read entry by entry. Use a double buffer: one buffer is used for the current entry, the other for the next one, a switch defines which is the current one. This is another classic, I can't remember the refference offhand though. j From pmr at ebi.ac.uk Thu Jun 12 05:55:15 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 12 Jun 2003 10:55:15 +0100 Subject: needle -filter References: <3EE60108.5050200@ebi.ac.uk> <20030612114605.778b8158.jrvalverde@cnb.uam.es> Message-ID: <3EE84E03.4080601@ebi.ac.uk> Jos? R. Valverde wrote: > OK, time to abandon lurker mode. Welcome!!! > First, this is old stuff. K&R show how to handle this situations in > their classic "The C Programming Language". The same approach may be used > at any level (i.e. more than one character): simply use a bigger read buffer > (or a dynamic one). But don't forget ... EMBOSS could be reading a huge stream through stdin. Something like a complex getz query piped in. You really do not want to hold all that in memory just for the odd special case. EMBOSS buffers a set number of lines for possible GCG input (if it has to guess the format) - but the buffer is for one input stream. We are talking about multiple input streams here, and special processing of stdin. It just doesn't look nice to me. Anyway, clearly a topic for tomorrow's EMBOSS team meeting.... Peter From Weiner at urz.uni-hd.de Thu Jun 12 07:40:46 2003 From: Weiner at urz.uni-hd.de (January Weiner 3) Date: Thu, 12 Jun 2003 13:40:46 +0200 (METDST) Subject: Troubles installing jemboss In-Reply-To: <3EE84E03.4080601@ebi.ac.uk> Message-ID: Hello, I'm trying to install jemboss in client-server configuration on a Solaris system. I run the install script, which runs fine untill the Makefile gots to the "utils" directory, where I get the following errors: -8<--------------------------- ./org/emboss/jemboss/gui/filetree/DragTree.java:139: Variable 'model' is already defined in this method. DefaultTreeModel model = (DefaultTreeModel)getModel(); ^ ./org/emboss/jemboss/gui/ResultsMenuBar.java:285: Variable 'fnt' is already defined in this method. Font fnt = fed.getFont(); ^ ./org/emboss/jemboss/gui/ResultsMenuBar.java:310: Variable 'fnt' is already defined in this method. Font fnt = fed.getFont(); ^ 3 errors *** Error code 1 make: Fatal error: Command failed for target `all-local' Current working directory /export/home/jw/Src/EMBOSS-2.7.1/jemboss *** Error code 1 make: Fatal error: Command failed for target `install-recursive' Current working directory /export/home/jw/Src/EMBOSS-2.7.1/jemboss *** Error code 1 make: Fatal error: Command failed for target `install-recursive' -8<--------------------------- Next, the scripts asks whether to install EMBASSY packages (I answer "no"), and again, it runs into several errors just before it says Changed /export/home/share/EMBOSS/jemboss/resources/jemboss.properties to reflect this installation Afterwards, I got several "Exception(s) in thread "main" java.lang.NoClassDefFoundError: javax/naming/Referenceable", and the control scripts do not seem to work. I have no experience whatsoever whith tomcat / Java, what do you think I do wrong? Regards, j. ----)-\//-///-----------------------------------January-Weiner-3------- La science est infaillible; mais les savants se trompent toujours. Anatole France From voltigeur at worldonline.ch Thu Jun 12 09:28:27 2003 From: voltigeur at worldonline.ch (voltigeur at worldonline.ch) Date: Thu, 12 Jun 2003 15:28:27 +0200 Subject: emboss binaries for windows Message-ID: <3EE5962100001D82@mx1.tiscali.ch> Hello, For those who wanted the binaries (and maybe for others), while making a zip file I've noticed that the size is huge (about 2 Mo for every program is making a zip file of about 114 Mo). That obviously wouldn't fit in an e-mail attachment... Unless I can put it on a server somewhere I'm afraid you'll have to use the HowTo I'm currently writing (expect it today or tomorrow) and compile everything yourself. The cygwin environment is handy but not optimized. Olivier Martin From david at starks-browning.com Thu Jun 12 09:34:51 2003 From: david at starks-browning.com (David Starks-Browning) Date: Thu, 12 Jun 2003 14:34:51 +0100 Subject: emboss binaries for windows In-Reply-To: <3EE5962100001D82@mx1.tiscali.ch> References: <3EE5962100001D82@mx1.tiscali.ch> Message-ID: <837-Thu12Jun2003143451+0100-david@starks-browning.com> On Thursday 12 Jun 03, voltigeur at worldonline.ch writes: > Hello, > > For those who wanted the binaries (and maybe for others), > while making a zip file I've noticed that the size is huge > (about 2 Mo for every program is making a zip file of about > 114 Mo). That obviously wouldn't fit in an e-mail attachment... > Unless I can put it on a server somewhere I'm afraid you'll > have to use the HowTo I'm currently writing (expect it today > or tomorrow) and compile everything yourself. > The cygwin environment is handy but not optimized. You could try using "strip" on the binaries or do the equivalent with a gcc command line option. What you're seeing is a feature of gcc, that symbols are included by default. I don't think it's Cygwin's fault. Regards, David From voltigeur at worldonline.ch Thu Jun 12 10:55:51 2003 From: voltigeur at worldonline.ch (voltigeur at worldonline.ch) Date: Thu, 12 Jun 2003 16:55:51 +0200 Subject: emboss binaries for windows In-Reply-To: <837-Thu12Jun2003143451+0100-david@starks-browning.com> Message-ID: <3EE5962100001ED4@mx1.tiscali.ch> >You could try using "strip" on the binaries or do the equivalent with >a gcc command line option. >What you're seeing is a feature of gcc, that symbols are included by >default. I don't think it's Cygwin's fault. I had a quick look at the cygwin FAQ and you're right. But differences remain. I've performed the same installation under linux and the programs are barely 100 Ko. The compilation is also much longer (it took about 1 hour under windows while only 15 minutes under linux red hat 9.0, on the same computer). Olivier Martin From david at starks-browning.com Thu Jun 12 11:17:18 2003 From: david at starks-browning.com (David Starks-Browning) Date: Thu, 12 Jun 2003 16:17:18 +0100 Subject: emboss binaries for windows In-Reply-To: <3EE5962100001ED4@mx1.tiscali.ch> References: <837-Thu12Jun2003143451+0100-david@starks-browning.com> <3EE5962100001ED4@mx1.tiscali.ch> Message-ID: <2342-Thu12Jun2003161718+0100-david@starks-browning.com> On Thursday 12 Jun 03, voltigeur at worldonline.ch writes: > The compilation is also much longer (it took about 1 hour under > windows while only 15 minutes under linux red hat 9.0, on the same > computer). Indeed, Cygwin will always be *extremely* slow compared to Linux for something like a package build. But that has nothing to do with distributing EMBOSS binaries. (Except to make them more valuable.) BTW, if someone wanted to a truly proper job of this, one could make a Cygwin package according to . But I doubt the benefits outweigh the effort, if you've only got a couple of people using EMBOSS under Cygwin. I'm sure the most useful thing anyone can produce is your "how to" for building EMBOSS under Cygwin. Regards, David From sa58794 at odin.mdacc.tmc.edu Thu Jun 12 17:32:50 2003 From: sa58794 at odin.mdacc.tmc.edu (clwu) Date: Thu, 12 Jun 2003 16:32:50 -0500 Subject: emboss binaries for windows In-Reply-To: <837-Thu12Jun2003143451+0100-david@starks-browning.com> References: <3EE5962100001D82@mx1.tiscali.ch> <837-Thu12Jun2003143451+0100-david@starks-browning.com> Message-ID: <3EE8F182.6010905@odin.mdacc.tmc.edu> Hi, I just upgraded my EMBOSS by compiling the new release under win2k/cygwin. After compilation, I used "strip" and "upx" to shrink the sizes of binary files. After "strip", I got about 700k for each file; after "upx", I got about 250k each. Finally, I got all binary files in total about 42M. I tried quite a few tools, and I didn't get any trouble for using them. Chunlei David Starks-Browning wrote: >On Thursday 12 Jun 03, voltigeur at worldonline.ch writes: > > >>Hello, >> >>For those who wanted the binaries (and maybe for others), >>while making a zip file I've noticed that the size is huge >>(about 2 Mo for every program is making a zip file of about >>114 Mo). That obviously wouldn't fit in an e-mail attachment... >>Unless I can put it on a server somewhere I'm afraid you'll >>have to use the HowTo I'm currently writing (expect it today >>or tomorrow) and compile everything yourself. >>The cygwin environment is handy but not optimized. >> >> > >You could try using "strip" on the binaries or do the equivalent with >a gcc command line option. > >What you're seeing is a feature of gcc, that symbols are included by >default. I don't think it's Cygwin's fault. > >Regards, >David > > > From voltigeur at worldonline.ch Fri Jun 13 02:08:02 2003 From: voltigeur at worldonline.ch (voltigeur at worldonline.ch) Date: Fri, 13 Jun 2003 08:08:02 +0200 Subject: HowTo for compiling emboss under windows Message-ID: <3EE5962100002235@mx1.tiscali.ch> Hello, This the (small) HowTo I told you about. Some remarks: - it's only for emboss, since it seems that people are more interested in it than in jemboss. I'll also write one for jemboss, though (soon). - it's how I did it on my computer, there might be differences and/or different ways of doing it. - I don't think there are mistakes, but who knows. - bug-fixes, remarks are wellcome EMBOSS: 1) install cygwin (http://www.cygwin.com). That's surely possible to compile without it, but it's making everything easier. You'll have to install the base part plus the devel/make and devel/gcc packages. Before installing, see the first line of 2). Then you'll have a linux-like command-line with tools like gcc and make. The paths are then made according to the place where you installed cygwin (ex: c\cygwin becomes /). 2) cygwin (and EMBOSS, and other linux/unix programs) don't like empty spaces in names. Be sure that you install everything in places without empty spaces (avoid "C:\Program Files\"). But by default cygwin uses your windows login (something like "FirstName LastName") to create the /home/user_folder. Find and edit the /etc/passwd file and rename "FirstName LastName" into "FirstName_LastName" (or whatever else). 3) quit and restart the cygwin bash (you'll start in your "FirstName_LastName" directory, you can delete "FirstName LastName"), download the EMBOSS package and cd to the place where you uncompressed it. Follow the usual procedure: ./configure --without-x CFLAGS=-s make make install --without-x because at one point the X11 library is required (even if useless) and without this flag the compilation would stop. CFLAGS=-s to make the binaries smaller. 4) you can now use the EMBOSS programs from the cygwin bash like you usually do from linux (but have a look at 5) and 6) before). 5) text files are different between windows and linux. If you save (for ex.) emboss.default from, say, wordpad, EMBOSS programs parsing this file won't be able to pass the first line and they will crash. To overcome this, use notepad instead (or save in a format you know that it won't be a problem), or convert the file to linux format (various tools are available on internet, it's a common problem). 6) EMBOSS has then been built with cygwin. To use it from a ms-dos cmd instead of the cygwin bash the cygwin1.dll has to be in your windows PATH (ex: C:\windows\system32). good luck, Olivier Martin From david at starks-browning.com Fri Jun 13 08:10:37 2003 From: david at starks-browning.com (David Starks-Browning) Date: Fri, 13 Jun 2003 13:10:37 +0100 Subject: HowTo for compiling emboss under windows In-Reply-To: <3EE5962100002235@mx1.tiscali.ch> References: <3EE5962100002235@mx1.tiscali.ch> Message-ID: <3429-Fri13Jun2003131037+0100-david@starks-browning.com> Olivier, Just a few comments: > 1) install cygwin (http://www.cygwin.com). That's surely possible to > compile without it, but it's making everything easier. No, you cannot compile EMBOSS as distributed without a POSIX emulation layer like Cygwin. There are other comparable systems like MKS (all commercial, I believe), but to do a native Windows port, you would need to modify EMBOSS. Someone has posted to this list in the past few months about this, check the archives. > procedure: > ./configure --without-x CFLAGS=-s > make > make install > > --without-x because at one point the X11 library is required (even if > useless) and without this flag the compilation would stop. > CFLAGS=-s to make the binaries smaller. Cygwin does also provide X, though it's a big download if you don't otherwise need it. Can you generate graphics without X? I know that Cygwin provides libpng, for example, but I haven't investigated whether EMBOSS can use it. > 5) text files are different between windows and linux. If you save > (for ex.) emboss.default from, say, wordpad, EMBOSS programs parsing > this file won't be able to pass the first line and they will crash. > To overcome this, use notepad instead I think you might have this backwards. Wordpad can handle UNIX end-of-line characters, but notepad cannot. And Cygwin provides vi and emacs. :-) > 6) EMBOSS has then been built with cygwin. To use it from a ms-dos cmd > instead of the cygwin bash the cygwin1.dll has to be in your windows > PATH (ex: C:\windows\system32). Putting cygwin1.dll in your Windows path (e.g. C:\windows\system32) is *strongly discouraged* by the Cygwin folks. You end up with a Cygwin installation that cannot be maintained by the normal Cygwin Setup program. If you want to run EMBOSS programs from the Windows command line, then add C:\cygwin\bin to your Windows PATH somehow. (But why not use Cygwin bash if you've got it?) Regards, David From voltigeur at worldonline.ch Fri Jun 13 10:49:19 2003 From: voltigeur at worldonline.ch (voltigeur at worldonline.ch) Date: Fri, 13 Jun 2003 16:49:19 +0200 Subject: HowTo for compiling emboss under windows In-Reply-To: <3429-Fri13Jun2003131037+0100-david@starks-browning.com> Message-ID: <3EE5965600002593@mx2.tiscali.ch> Hello, >No, you cannot compile EMBOSS as distributed without a POSIX emulation >layer like Cygwin. There are other comparable systems like MKS (all >commercial, I believe), but to do a native Windows port, you would >need to modify EMBOSS. Someone has posted to this list in the past >few months about this, check the archives. Yes, that's what I was thinking about. >Cygwin does also provide X, though it's a big download if you don't >otherwise need it. Can you generate graphics without X? I know that >Cygwin provides libpng, for example, but I haven't investigated >whether EMBOSS can use it. Installing X was one of the things I did at first, but since X doesn't seem to be used (plplot looks to be more useful, with an optional png output), I prefered to go on without it. >I think you migh have this backwards. Wordpad can handle UNIX >end-of-line characters, but notepad cannot. And Cygwin provides vi >and emacs. :-) Yes, I've tried every text format available in notepad, wordpad and word with no luck. But I knew one of them was supposed to work. It seems I guessed the wrong one. I even tried xemacs (which is not part of cygwin) but wasn't courageous enough to try vi. >If you want to run EMBOSS programs from the Windows command line, >then add C:\cygwin\bin to your Windows PATH somehow. (But why not use >Cygwin bash if you've got it?) I changed the PATH but that did not work... After compiling jemboss I found out that when running jemboss, it was calling wossname to build the GUI and to get the list of all emboss programs available. Of course it was calling it the java-windows way (and not the cygwin way) and the result was a "missing cygwin1.dll library". Thanks for your remarks, Olivier Martin From kim at inb.uni-luebeck.de Fri Jun 13 11:31:11 2003 From: kim at inb.uni-luebeck.de (Jan T. Kim) Date: Fri, 13 Jun 2003 17:31:11 +0200 Subject: needle: Strictly global alignment? Message-ID: <20030613173111.G13445@pc10.inb.mu-luebeck.de> Dear EMBOSSers, it seems to me that the alignment computed by needle is not a global alignment in the strict sense of the term, because the terminal gaps are not penalized. As an example, the alignment of sequences seq1 to seq2 has the same score as the alignment seq1long to seq2 in the attached file. Some code delving (EMBOSS-2.6.0/nucleus/embaln.c, function embAlignPathCalc) indicates to me that no gap penalty is taken into account when the top row and the left column of the matrix are initialized, meaning that terminal gaps at the left border of the alignment will not be scored. In the literature, a global alignment in which terminal gaps are not scored is called a semiglobal alignment. If my analysis is correct, I suggest to change the documentation accordingly. In addition, it would be nice to extend the needle program such that a global alignment sensu stricto can be carried out. Kind regards, Jan T. Kim -- +- Jan T. Kim -------------------------------------------------------+ | *NEW* email: kim at inb.uni-luebeck.de | | *NEW* WWW: http://www.inb.uni-luebeck.de/staff/kim.html | *-----=< hierarchical systems are for files, not for humans >=-----* -------------- next part -------------- > seq1 ctgcctgt > seq1long actgcactaactgcctgtaactga > seq2 ctgcggctgt From pmr at ebi.ac.uk Fri Jun 13 11:58:52 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 13 Jun 2003 16:58:52 +0100 Subject: needle: Strictly global alignment? References: <20030613173111.G13445@pc10.inb.mu-luebeck.de> Message-ID: <3EE9F4BC.5030405@ebi.ac.uk> Jan T. Kim wrote: > Dear EMBOSSers, > > it seems to me that the alignment computed by needle is not a global > alignment in the strict sense of the term, because the terminal gaps > are not penalized. > > In the literature, a global alignment in which terminal gaps are not > scored is called a semiglobal alignment. > > If my analysis is correct, I suggest to change the documentation > accordingly. In addition, it would be nice to extend the needle program > such that a global alignment sensu stricto can be carried out. Sorry, but the literature from computer science and maths does not match reality for biological sequences. Remember that you have no information that either sequence is complete. In bioinformatics, a global alignment is one which spans the full extents of the input sequences (e.g. Baxevanis & Ouellette (2001) "Bioinformatics" 2nd edition p189. There is no biological reason to penalise terminal gaps. And of course, for many biological purposes, a local alignment is what makes sense. ... Though we could add terminal gaps as an option for those rare cases where it could be useful. I note that stretcher also does not score terminal gaps. Hope this helps, Peter From kim at inb.uni-luebeck.de Fri Jun 13 12:59:44 2003 From: kim at inb.uni-luebeck.de (Jan T. Kim) Date: Fri, 13 Jun 2003 18:59:44 +0200 Subject: needle: Strictly global alignment? In-Reply-To: <3EE9F4BC.5030405@ebi.ac.uk>; from pmr@ebi.ac.uk on Fri, Jun 13, 2003 at 04:58:52PM +0100 References: <20030613173111.G13445@pc10.inb.mu-luebeck.de> <3EE9F4BC.5030405@ebi.ac.uk> Message-ID: <20030613185944.H13445@pc10.inb.mu-luebeck.de> Hi Peter, thanks for your quick reply. On Fri, Jun 13, 2003 at 04:58:52PM +0100, Peter Rice wrote: > Jan T. Kim wrote: > > Dear EMBOSSers, > > > > it seems to me that the alignment computed by needle is not a global > > alignment in the strict sense of the term, because the terminal gaps > > are not penalized. > > > > In the literature, a global alignment in which terminal gaps are not > > scored is called a semiglobal alignment. > > > > If my analysis is correct, I suggest to change the documentation > > accordingly. In addition, it would be nice to extend the needle program > > such that a global alignment sensu stricto can be carried out. > > Sorry, but the literature from computer science and maths does not match > reality for biological sequences. > > Remember that you have no information that either sequence is complete. This may often be the case, but certainly not always. Protein sequences are normally complete. More generally, it is quite well possible to derive positional information delineating regions of homology from biology. Initiation and termination positions of transcription and translation, intron / exon borders, protein domains and RNA segments characterized by specific secondary structures are notable examples. Of course, if the sequence ends are not due to such biological information but due to cloning or other technical (and hence not biological) processes, gaps should clearly not be penalized. > In bioinformatics, a global alignment is one which spans the full > extents of the input sequences (e.g. Baxevanis & Ouellette (2001) > "Bioinformatics" 2nd edition p189. Ok, that's what I implicitly called "global alignment sensu lato". Perhaps unfortunately, some bioinformatics books (e.g. Setubal & Meidanis, 1997: "Introduction to Computational Molecular Biology", page 49ff) use the term "global alignment" to denote an alignment in which terminal gaps are scored, and refer to a global alignment with "free ends" as a "semiglobal alignment". When I suggested modifying the needle program documentation, I intended to make it easier for those who have read this definition to correctly understand what needle does. As it stands now, such people may end up looking for an EMBOSS program for computing a semiglobal alignment and not realizing that needle does this. Adding a notice, e.g. needle does not penalize terminal gaps. This type of alignment is (also) called a "semiglobal alignment" in the literature. would prevent such futile searches. > There is no biological reason to > penalise terminal gaps. > > And of course, for many biological purposes, a local alignment is what > makes sense. > ... Though we could add terminal gaps as an option for those rare cases > where it could be useful. I note that stretcher also does not score > terminal gaps. Ok, I'd put that on my wish list, and I also put it on my list of programming projects. While the modifications to implement this should be marginal, I will have to familiarize myself somewhat more with the EMBOSS code base and standards so I can do the modifications properly... Kind regards, Jan -- +- Jan T. Kim -------------------------------------------------------+ | *NEW* email: kim at inb.uni-luebeck.de | | *NEW* WWW: http://www.inb.uni-luebeck.de/staff/kim.html | *-----=< hierarchical systems are for files, not for humans >=-----* From obig at bcgsc.ca Fri Jun 13 15:52:22 2003 From: obig at bcgsc.ca (Obi Griffith) Date: Fri, 13 Jun 2003 12:52:22 -0700 Subject: diffseq problems Message-ID: <3EEA2B76.5020103@bcgsc.ca> I have been having two problems with your diffseq program. I am using command line diffseq from the EMBOSS-2.5.0 package. 1) using the -columns option doesn't have any effect on the output. ie. I can't get the nicely formatted tabular data promised: # Report of diffseq of: AF129756 and AP000504 # AF129756 overlap starts at 6036 # AP000504 overlap starts at 1 # (AF129756) start end length sequence (AP000504) start end length sequence 6882 6882 1 't' 847 847 1 'a' 7830 7830 1 'a' 1795 1795 1 'g' 8307 8307 0 '' 2273 2273 1 't' 8500 8500 1 'a' 2466 2466 1 'g' 8688 8688 0 '' 2655 2658 4 'tgtg' 2) I get the following errors: Find differences (SNPs) between nearly identical sequences Input sequence:AF129756 Second sequence:AP000504 Word size [10]: 2 Output report [1.diffseq]: Warning: bad /replace value 'T' Warning: bad /replace value 'C' Warning: bad /replace value 'C' Warning: bad /replace value 'T' Warning: bad /replace value 'C' Warning: bad /replace value 'GCCTT' Any idea what's going on here? Obi. From David.Bauer at SCHERING.DE Sat Jun 14 02:45:05 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Sat, 14 Jun 2003 08:45:05 +0200 Subject: Antwort: diffseq problems Message-ID: Hello Obi, these warnings only mean, that the emboss code which reads feature table informations complains about the /replace tag in variation. But this was fixed in later releases. I don't get these warnings in 2.7.1. Anyway, this should have no influence on the computation. The two sequences you give as examples are genomic contigs of 185 and 100 kilobases. Do you get any results out of diffseq? If not, this could be due to memory limitations. Emboss programs tend to do everything within physical RAM. 6 Gb on my machine is too small for this :-) David. 2) I get the following errors: Find differences (SNPs) between nearly identical sequences Input sequence:AF129756 Second sequence:AP000504 Word size [10]: 2 Output report [1.diffseq]: Warning: bad /replace value 'T' Warning: bad /replace value 'C' Warning: bad /replace value 'C' Warning: bad /replace value 'T' Warning: bad /replace value 'C' Warning: bad /replace value 'GCCTT' Any idea what's going on here? Obi. From pmr at ebi.ac.uk Sun Jun 15 08:11:51 2003 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Sun, 15 Jun 2003 13:11:51 +0100 (BST) Subject: diffseq problems In-Reply-To: <3EEA2B76.5020103@bcgsc.ca> References: <3EEA2B76.5020103@bcgsc.ca> Message-ID: <1098.217.134.232.120.1055679111.squirrel@webmail.ebi.ac.uk> > I have been having two problems with your diffseq program. I am using > command line diffseq from the EMBOSS-2.5.0 package. The replace message is fixed in the current release (and in 2.6.0 I believe) It is only a warning. The columns output is new since 2.5.0 - the EMBOSS web pages have the current development documentation. The documentation for each release is included in the distribution. Hope this helps, Peter Rice From gbottu at ben.vub.ac.be Mon Jun 16 04:48:15 2003 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Mon, 16 Jun 2003 10:48:15 +0200 (CEST) Subject: needle: Strictly global alignment? Message-ID: <200306160848.h5G8mFmN1358206@black.vub.ac.be> > From owner-emboss at hgmp.mrc.ac.uk Fri Jun 13 18:00:04 2003 > X-Original-To: emboss at embnet.org > Date: Fri, 13 Jun 2003 16:58:52 +0100 > From: Peter Rice > User-Agent: Mozilla/5.0 (Windows; U; Windows NT 5.0; en-US; rv:1.0.2) Gecko/20030208 Netscape/7.02 > ... Though we could add terminal gaps as an option for those rare cases > where it could be useful. I note that stretcher also does not score > terminal gaps. I did some testing and, if I am not wrong, stretcher DOES penalize terminal gaps. For the rest, I agree with Jan Kim that needle and stretcher should allow the choice between penalizing and not penalizing terminal gaps and that the documentation should be more clear about this. Guy Bottu, BEN From pmr at ebi.ac.uk Mon Jun 16 05:22:32 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 16 Jun 2003 10:22:32 +0100 Subject: needle: Strictly global alignment? References: <200306160848.h5G8mFmN1358206@black.vub.ac.be> Message-ID: <3EED8C58.8010401@ebi.ac.uk> Guy Bottu wrote: > I did some testing and, if I am not wrong, stretcher DOES penalize terminal > gaps. Oops. This does seem to be true. In that case, we do need to update the documentation, and provide the option to switch the terminal gap penalties on/off. We may need to consider changing the default behaviour of one of the programs too. Thanks for pointing it out. Peter From gtps5 at gtptech.com Tue Jun 17 09:49:37 2003 From: gtps5 at gtptech.com (Carole Louis) Date: 17 Jun 2003 15:49:37 +0200 Subject: How to use ajListPeek Message-ID: <1055857779.1357.56.camel@thym> Hi, I am programming in Emboss and it seems to be cool but I have a problem. I do not know why but I can not use the data type "ajListPeek". It is strange because I can use ajListPop (but that is not what I want). Is there a problem with this data type ? Moreover, I notice on the internet, at the adress http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Data/ajlist.html that there is the word "ajListstrPop" instead of the word "ajListstrPeek". Thanks, Carole from Toulouse, France PS : I would like ask this question on the developper list but I can not suscribe on it. -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030617/4d1fe80d/attachment.html From pmr at ebi.ac.uk Tue Jun 17 09:55:40 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 17 Jun 2003 14:55:40 +0100 Subject: How to use ajListPeek References: <1055857779.1357.56.camel@thym> Message-ID: <3EEF1DDC.4090901@ebi.ac.uk> Carole Louis wrote: > I am programming in Emboss and it seems to be cool but I have a problem. > I do not know why but I can not use the data type "ajListPeek". It is > strange because I can use ajListPop (but that is not what I want). Is > there a problem with this data type ? ajListPeek should be fine. It is in the latest 2.7.1 EMBOSS release. ajListPeek and ajListstrPeek are both used in processing ACD files. You do need to be careful if you are copying ajListPop code - do not delete the list data if you only Peek because the real copy is on the list. You only clean up after you Pop it from the list. > Moreover, I notice on the internet, at the adress > http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Data/ajlist.html that > there is the word "ajListstrPop" instead of the word "ajListstrPeek". Hmmm ... we need to update the ajlist.html file then. The source code documentation (used to build the ajlist.html file) is correct. Hope this helps, Peter From gtps5 at gtptech.com Tue Jun 17 10:12:02 2003 From: gtps5 at gtptech.com (Carole Louis) Date: 17 Jun 2003 16:12:02 +0200 Subject: How to use ajListPeek In-Reply-To: <3EEF1DDC.4090901@ebi.ac.uk> References: <1055857779.1357.56.camel@thym> <3EEF1DDC.4090901@ebi.ac.uk> Message-ID: <1055859129.1357.70.camel@thym> OK. I'm using EMBOSS 2.6.0 and I think that is why I have some problems with ajListPeeK data type. Thanks Le mar 17/06/2003 ? 15:55, Peter Rice a ?crit : Carole Louis wrote: > I am programming in Emboss and it seems to be cool but I have a problem. > I do not know why but I can not use the data type "ajListPeek". It is > strange because I can use ajListPop (but that is not what I want). Is > there a problem with this data type ? ajListPeek should be fine. It is in the latest 2.7.1 EMBOSS release. ajListPeek and ajListstrPeek are both used in processing ACD files. You do need to be careful if you are copying ajListPop code - do not delete the list data if you only Peek because the real copy is on the list. You only clean up after you Pop it from the list. > Moreover, I notice on the internet, at the adress > http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Data/ajlist.html that > there is the word "ajListstrPop" instead of the word "ajListstrPeek". Hmmm ... we need to update the ajlist.html file then. The source code documentation (used to build the ajlist.html file) is correct. Hope this helps, Peter -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030617/ca54dc0b/attachment.html From pmr at ebi.ac.uk Tue Jun 17 10:14:42 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 17 Jun 2003 15:14:42 +0100 Subject: How to use ajListPeek References: <1055857779.1357.56.camel@thym> <3EEF1DDC.4090901@ebi.ac.uk> <1055859129.1357.70.camel@thym> Message-ID: <3EEF2252.2020309@ebi.ac.uk> Carole Louis wrote: > OK. I'm using EMBOSS 2.6.0 and I think that is why I have some problems > with ajListPeeK data type. Yes - it was new (and very useful) for the ACD processing. With 2.6.0 you can Pop and Push back again. regards, Peter From gtps5 at gtptech.com Tue Jun 17 10:28:01 2003 From: gtps5 at gtptech.com (Carole Louis) Date: 17 Jun 2003 16:28:01 +0200 Subject: How to use ajListPeek In-Reply-To: <3EEF2252.2020309@ebi.ac.uk> References: <1055857779.1357.56.camel@thym> <3EEF1DDC.4090901@ebi.ac.uk> <1055859129.1357.70.camel@thym> <3EEF2252.2020309@ebi.ac.uk> Message-ID: <1055860087.1357.79.camel@thym> Can I easily release my emboss version 2.6.0 without reinstalling the entire emboss 2.7.1. version ? It is because I had some problems to install jemboss in server mode the first time and I am affraid to do it again.... :-( Le mar 17/06/2003 ? 16:14, Peter Rice a ?crit : Carole Louis wrote: > OK. I'm using EMBOSS 2.6.0 and I think that is why I have some problems > with ajListPeeK data type. Yes - it was new (and very useful) for the ACD processing. With 2.6.0 you can Pop and Push back again. regards, Peter -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030617/2b99a85f/attachment.html From d.gatherer at vir.gla.ac.uk Wed Jun 18 09:16:32 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Wed, 18 Jun 2003 14:16:32 +0100 Subject: wossname Message-ID: <5.2.1.1.1.20030618141416.00aa1038@udcf.gla.ac.uk> Subject: wossname From: Kevin Battaile (battaile at mcw.edu) Date: Thu 05 Jun 2003 - 14:43:26 BST >I was installing 2.7.1 last night and noticed that 'wossname' seems to be >broken. Yes, I found this as well. _________________________ Derek Gatherer Ph.D. Cert.Ed. Computer Officer Institute of Virology Church St. Glasgow G11 5JR Phone: +44 141 330 6268 Fax: +44 141 337 2236 Email: d.gatherer at vir.gla.ac.uk Website: http://www.vir.gla.ac.uk From mbb8n at virginia.edu Wed Jun 18 11:13:35 2003 From: mbb8n at virginia.edu (Michael Black) Date: Wed, 18 Jun 2003 11:13:35 -0400 Subject: wossname In-Reply-To: <5.2.1.1.1.20030618141416.00aa1038@udcf.gla.ac.uk> Message-ID: <6E519076-A19F-11D7-985F-000393D1F330@virginia.edu> I installed 2.7.1 and standalone JemBoss on a DP PowerMac (OS X ver. 10.2.6) and a DP Linux node (RedHat) just last week, and wossname works fine for my installs. Do you get an error? _________________________________ Michael B. Black, Ph.D. Molecular Biology Computing Support Univ. of Virginia, ITC-ACHS PO Box 800555 Charlottesville, VA 22908-0555 voice: (434) 982-4039 fax: (434) 982-4030 mblack at virginia.edu _________________________________ On Wednesday, June 18, 2003, at 09:16 AM, Derek Gatherer wrote: > > Subject: wossname > From: Kevin Battaile > ( rel at post.its.mcw.edu&subject=Re:%20wossname>battaile at mcw.edu) > Date: Thu 05 Jun 2003 - 14:43:26 BST > > > >I was installing 2.7.1 last night and noticed that 'wossname' seems > to be > >broken. > > Yes, I found this as well. > > > _________________________ > > Derek Gatherer Ph.D. Cert.Ed. > Computer Officer > Institute of Virology > Church St. > Glasgow G11 5JR > > Phone: +44 141 330 6268 > Fax: +44 141 337 2236 > Email: d.gatherer at vir.gla.ac.uk > Website: http://www.vir.gla.ac.uk > > From d.gatherer at vir.gla.ac.uk Wed Jun 18 12:07:09 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Wed, 18 Jun 2003 17:07:09 +0100 Subject: Fwd: Re: wossname Message-ID: <5.2.1.1.1.20030618170634.00ab41f8@udcf.gla.ac.uk> > >No, no error at all, just zero output. I'm using 2.7.1 on a Tru64, with >w2h as a web front end and also via ordinary command line login after >telnetting from various PCs. Neither seems to work. All the other >applications are, as far as I can see, running fine. > >At 11:13 18/06/2003 -0400, Michael Black wrote: >>I installed 2.7.1 and standalone JemBoss on a DP PowerMac (OS X ver. >>10.2.6) and a DP Linux node (RedHat) just last week, and wossname works >>fine for my installs. Do you get an error? >> >>_________________________________ >>Michael B. Black, Ph.D. >>Molecular Biology Computing Support >>Univ. of Virginia, ITC-ACHS >>PO Box 800555 >>Charlottesville, VA >>22908-0555 >>voice: (434) 982-4039 >>fax: (434) 982-4030 >>mblack at virginia.edu >>_________________________________ >> >>On Wednesday, June 18, 2003, at 09:16 AM, Derek Gatherer wrote: >> >>> >>>Subject: wossname >>>From: Kevin Battaile >>>(>>rel at post.its.mcw.edu&subject=Re:%20wossname>battaile at mcw.edu) >>>Date: Thu 05 Jun 2003 - 14:43:26 BST >>> >>> >>> >I was installing 2.7.1 last night and noticed that 'wossname' seems >>>to be >>> >broken. >>> >>>Yes, I found this as well. >>> >>> >>>_________________________ >>> >>>Derek Gatherer Ph.D. Cert.Ed. >>>Computer Officer >>>Institute of Virology >>>Church St. >>>Glasgow G11 5JR >>> >>>Phone: +44 141 330 6268 >>>Fax: +44 141 337 2236 >>>Email: d.gatherer at vir.gla.ac.uk >>>Website: http://www.vir.gla.ac.uk _________________________ Derek Gatherer Ph.D. Cert.Ed. Computer Officer Institute of Virology Church St. Glasgow G11 5JR Phone: +44 141 330 6268 Fax: +44 141 337 2236 Email: d.gatherer at vir.gla.ac.uk Website: http://www.vir.gla.ac.uk From mccarthy at cs.usask.ca Wed Jun 18 12:22:58 2003 From: mccarthy at cs.usask.ca (Luke McCarthy) Date: 18 Jun 2003 10:22:58 -0600 Subject: Fwd: Re: wossname In-Reply-To: <5.2.1.1.1.20030618170634.00ab41f8@udcf.gla.ac.uk> References: <5.2.1.1.1.20030618170634.00ab41f8@udcf.gla.ac.uk> Message-ID: <1055953378.13777.26.camel@crazyharry.usask.ca> On Wed, 2003-06-18 at 10:07, Derek Gatherer wrote: > > > >No, no error at all, just zero output. I'm using 2.7.1 on a Tru64, with > >w2h as a web front end and also via ordinary command line login after > >telnetting from various PCs. Neither seems to work. All the other > >applications are, as far as I can see, running fine. Some time ago I found that wossname requires that the EMBOSS programs are in your path. This was true as recently as version 2.6.0 -- maybe it's still true now. Just something to check... Cheers, Luke -- Luke McCarthy Research Officer, Bioinformatics Department of Computer Science University of Saskatchewan mccarthy at cs.usask.ca From mbb8n at virginia.edu Wed Jun 18 14:21:17 2003 From: mbb8n at virginia.edu (Michael Black) Date: Wed, 18 Jun 2003 14:21:17 -0400 Subject: wossname In-Reply-To: <1055953378.13777.26.camel@crazyharry.usask.ca> Message-ID: True, on all my machines, the full path to ..../emboss-x.x.x/bin is in the users default path. _________________________________ Michael B. Black, Ph.D. Molecular Biology Computing Support Univ. of Virginia, ITC-ACHS Charlottesville, VA mblack at virginia.edu _________________________________ On Wednesday, June 18, 2003, at 12:22 PM, Luke McCarthy wrote: > On Wed, 2003-06-18 at 10:07, Derek Gatherer wrote: >>> >>> No, no error at all, just zero output. I'm using 2.7.1 on a Tru64, >>> with >>> w2h as a web front end and also via ordinary command line login after >>> telnetting from various PCs. Neither seems to work. All the other >>> applications are, as far as I can see, running fine. > > Some time ago I found that wossname requires that the EMBOSS programs > are in your path. This was true as recently as version 2.6.0 -- maybe > it's still true now. Just something to check... > > Cheers, > > Luke > -- > Luke McCarthy > Research Officer, Bioinformatics > Department of Computer Science > University of Saskatchewan > mccarthy at cs.usask.ca > > From d.gatherer at vir.gla.ac.uk Thu Jun 19 11:06:17 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Thu, 19 Jun 2003 16:06:17 +0100 Subject: wossname In-Reply-To: References: <1055953378.13777.26.camel@crazyharry.usask.ca> Message-ID: <5.2.1.1.1.20030619160218.00a7ab90@udcf.gla.ac.uk> Yes, that is the answer! Thanks to all 3 who suggested that. However, on w2h web front end, it still doesn't work (wossname doesn't, other EMBOSS applications seem to be fine) - but that's a w2h issue and probably belongs on a different mailing list. Cheers Derek At 14:21 18/06/2003 -0400, Michael Black wrote: >True, on all my machines, the full path to ..../emboss-x.x.x/bin is in the >users default path. > >_________________________________ >Michael B. Black, Ph.D. >Molecular Biology Computing Support >Univ. of Virginia, ITC-ACHS >Charlottesville, VA >mblack at virginia.edu >_________________________________ > >On Wednesday, June 18, 2003, at 12:22 PM, Luke McCarthy wrote: > >>On Wed, 2003-06-18 at 10:07, Derek Gatherer wrote: >>>> >>>>No, no error at all, just zero output. I'm using 2.7.1 on a Tru64, with >>>>w2h as a web front end and also via ordinary command line login after >>>>telnetting from various PCs. Neither seems to work. All the other >>>>applications are, as far as I can see, running fine. >> >>Some time ago I found that wossname requires that the EMBOSS programs >>are in your path. This was true as recently as version 2.6.0 -- maybe >>it's still true now. Just something to check... >> >>Cheers, >> >>Luke >>-- >>Luke McCarthy >>Research Officer, Bioinformatics >>Department of Computer Science >>University of Saskatchewan >>mccarthy at cs.usask.ca >> From pmr at ebi.ac.uk Fri Jun 20 05:08:15 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 20 Jun 2003 10:08:15 +0100 Subject: Fwd: Re: wossname References: <5.2.1.1.1.20030618170634.00ab41f8@udcf.gla.ac.uk> <1055953378.13777.26.camel@crazyharry.usask.ca> Message-ID: <3EF2CEFF.2040605@ebi.ac.uk> Luke McCarthy wrote: > Some time ago I found that wossname requires that the EMBOSS programs > are in your path. This was true as recently as version 2.6.0 -- maybe > it's still true now. Just something to check... True. wossname looks through the ACD files, but only reports applications that exist in the path. When you use ACDC to build and test ACD files you can accumulate extra ACD files that wossname has to ignore. Also, when you updata to a new EMBOSS release you can have old ACD files still installed. Hope this helps Peter From aengus.stewart at cancer.org.uk Mon Jun 23 06:44:21 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Mon, 23 Jun 2003 11:44:21 +0100 Subject: EMBL indexing strategy References: <1055953378.13777.26.camel@crazyharry.usask.ca> <5.2.1.1.1.20030619160218.00a7ab90@udcf.gla.ac.uk> Message-ID: <3EF6DA05.3DB4948A@cancer.org.uk> I am currently building the EMBL indexes and I was just wondering how other people organise them. I have no idea as yet what size entrynam.idx will end up being but I imagine the word "humungous" will apply. Do people index the sections ( EST, GSS, HUM, etc ) separately and follow Simon Andrews method of poviding an EMBL that is a composite of these sections or follow the lets index the bloody lot at one go route? Will there be any difference in the outcome either in admin terms or for the user? Regards Aengus -- ---------------------------------------------------------------------------- Aengus Stewart Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ---------------------------------------------------------------------------- From d.gatherer at vir.gla.ac.uk Mon Jun 23 11:40:27 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Mon, 23 Jun 2003 16:40:27 +0100 Subject: automake after adding local code In-Reply-To: <3EF6DA05.3DB4948A@cancer.org.uk> References: <1055953378.13777.26.camel@crazyharry.usask.ca> <5.2.1.1.1.20030619160218.00a7ab90@udcf.gla.ac.uk> Message-ID: <5.2.1.1.1.20030623162810.00aaff38@udcf.gla.ac.uk> I have installed 2.7.1 on a Tru64 into a directory EMBOSS. I have added locally written code to the EMBOSS/emboss/ directory. Then I modified EMBOSS/emboss/Makefile.am as described on http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Develop/program.html section 3. I then ran automake from the EMBOSS directory. The message "required file: ./ltconfig not found" appeared, but Makefile.in seemed to be created in the right place. I then ran ./configure as usual, which was fine, various Makefiles were produced, and ./make. This produced a rapid crash with the output given below. Obviously I'm doing something wrong here. Am I running automake inappropriately? From the automake GNU documentation, it would appear that it only needs to be run once as there is only a single configure.in file. Output from ./make #make No suffix list. Making all in plplot Making all in lib No suffix list. cd ../.. && CONFIG_FILES=plplot/lib/Makefile CONFIG_HEADERS= /bin/ksh ./config.status config.status: creating plplot/lib/Makefile config.status: executing depfiles commands cd .. && CONFIG_FILES=plplot/Makefile CONFIG_HEADERS= /bin/ksh ./config.status config.status: creating plplot/Makefile config.status: executing depfiles commands /bin/ksh ../libtool --mode=compile cc -DPACKAGE_NAME=\"\" -DPACKAGE_TARNAME=\"\" -DPACKAGE_VERSION=\"\" -DPACKAGE_STRING=\"\" -DPACKAGE_BUGREPORT=\"\" -DPACKAGE=\"EMBOSS\" -DVERSION=\"2.7.1\" -DSTDC_HEADERS=1 -DHAVE_SYS_TYPES_H=1 -DHAVE_SYS_STAT_H=1 -DHAVE_STDLIB_H=1 -DHAVE_STRING_H=1 -DHAVE_MEMORY_H=1 -DHAVE_STRINGS_H=1 -DHAVE_INTTYPES_H=1 -DHAVE_UNISTD_H=1 -DHAVE_DLFCN_H=1 -DHAVE_DIRENT_H=1 -DSTDC_HEADERS=1 -DHAVE_UNISTD_H=1 -DGETPGRP_VOID=1 -DHAVE_STRFTIME=1 -DHAVE_UNISTD_H=1 -DHAVE_FORK=1 -DHAVE_VFORK=1 -DHAVE_WORKING_VFORK=1 -DHAVE_WORKING_FORK=1 -DHAVE_VPRINTF=1 -DHAVE_DOPRNT=1 -DHAVE_MEMMOVE=1 -DHAVE_LIBM=1 -I. -I. -I./ -I/usr/include/gd -DNO_AUTH -g -ieee -c sh: .deps/pdfutils.pp: cannot create *** Exit 1 Stop. *** Exit 1 Stop. *** Exit 1 Stop. From j.leunissen at cmbi.kun.nl Mon Jun 23 11:58:13 2003 From: j.leunissen at cmbi.kun.nl (Jack Leunissen) Date: Mon, 23 Jun 2003 17:58:13 +0200 Subject: EMBL indexing strategy In-Reply-To: <3EF6DA05.3DB4948A@cancer.org.uk> Message-ID: <001301c339a0$526afe00$3382e089@bioinf01> I index the whole lot in one go. This is what the files look like: -rw-r--r-- 1 jackl geninf 479077377 Jun 18 02:22 entrynam.idx -rw-r--r-- 1 jackl geninf 403886332 Jun 18 02:33 acnum.trg -rw-r--r-- 1 jackl geninf 101085912 Jun 18 02:33 acnum.hit So about 1GB in all. Not too bad, considering that the flatfiles are 120 GB, and the SRS indices amount to 37 GB. Cheers, Jack > -----Original Message----- > From: owner-emboss at hgmp.mrc.ac.uk > [mailto:owner-emboss at hgmp.mrc.ac.uk] On Behalf Of Aengus Stewart > Sent: Monday, June 23, 2003 12:44 PM > To: emboss at embnet.org > Subject: EMBL indexing strategy > > > > I am currently building the EMBL indexes and I was just wondering how > other people organise them. > > I have no idea as yet what size entrynam.idx will end up being but I > imagine the word "humungous" will apply. > > Do people index the sections ( EST, GSS, HUM, etc ) separately and > follow Simon Andrews method of poviding an EMBL that is a composite of > these sections or follow the lets index the bloody lot at one > go route? > > Will there be any difference in the outcome either in admin > terms or for > the user? > > > Regards > Aengus > > > -- > -------------------------------------------------------------- > -------------- > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, > WC2A 3PX, UK > -------------------------------------------------------------- > -------------- > From jrvalverde at cnb.uam.es Tue Jun 24 02:52:30 2003 From: jrvalverde at cnb.uam.es (José R. Valverde) Date: Tue, 24 Jun 2003 08:52:30 +0200 Subject: automake after adding local code In-Reply-To: <5.2.1.1.1.20030623162810.00aaff38@udcf.gla.ac.uk> References: <1055953378.13777.26.camel@crazyharry.usask.ca> <5.2.1.1.1.20030619160218.00a7ab90@udcf.gla.ac.uk> <5.2.1.1.1.20030623162810.00aaff38@udcf.gla.ac.uk> Message-ID: <20030624085230.359c106f.jrvalverde@cnb.uam.es> On Mon, 23 Jun 2003 16:40:27 +0100 Derek Gatherer wrote: > I have installed 2.7.1 on a Tru64 into a directory EMBOSS. I have added > locally written code to the EMBOSS/emboss/ directory. Then I modified > EMBOSS/emboss/Makefile.am as described on > http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Develop/program.html section 3. > > I then ran automake from the EMBOSS directory. The message "required file: > ./ltconfig not found" appeared, but Makefile.in seemed to be created in the > right place. I then ran ./configure as usual, which was fine, various > Makefiles were produced, and ./make. > One of two: either you didn't run "automake -a" (or --add-missing) or you have an inadequate config environment. You need to update your build tools. The error appears because you either don't have GNU libtool installed or it is an old version. I'd advise to sync all the "config" tools by updating them to the latest version (automake, autoconf, libtool...). j -- These opinions are mine and only mine. Hey man, I saw them first! Jos? R. Valverde De nada sirve la Inteligencia Artificial cuando falta la Natural From aml at ica.cc Tue Jun 24 12:47:32 2003 From: aml at ica.cc (American Laboratory) Date: Tue, 24 Jun 2003 12:47:32 -0400 Subject: Receive a free subscription to American Laboratory Message-ID: <20030624165421.7932C7D2AD@mercury.hgmp.mrc.ac.uk> THIS NOTICE IS FOR: Our Colleagues SUBJECT: Reminder - Your Subscription to American Laboratory Magazine WHAT DO YOU HAVE TO DO?: http://www.icainfo.com/aml/appintro_new.asp?NewAdd=YES&Priority=PEPAL2 DEADLINE: June 27, 2003 Your FREE subscription to American Laboratory Magazine is available with the next issue! Please take a moment now to submit your application. American Laboratory covers the disciplines of analytical and bioanalytical chemistry, drug discovery, laboratory software and informatics. Each issue features articles written by leading scientists from around the world reviewing applications of instrumentation and new measurement technology. I am most confident that you will enjoy our journal and will find it to be of significant professional value. Begin your complimentary subscription NOW, click http://www.icainfo.com/aml/appintro_new.asp?NewAdd=YES&Priority=PEPAL2 I look forward to hearing from you. Brian Howard, Ph.D. Editor International Scientific Communications, Inc. 30 Controls Drive, P.O. Box 870 Shelton, CT 06484 Tel.: 203-926-9300, Fax: 203-926-9310 iscpubs at iscpubs.com www.iscpubs.com -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030624/9c152cfc/attachment.html From wyan at fimmu.com Tue Jun 24 20:54:09 2003 From: wyan at fimmu.com (=?GB2312?Q?=CD=F5=D1=DE?=) Date: Wed, 25 Jun 2003 8:54:9 +0800 Subject: chips Message-ID: <20030625010148.8DA847D0EF@mercury.hgmp.mrc.ac.uk> Dear Sir, Does the software of emboss can be run on window computer? I want to use the chips(codon usage) program, how can I do it? Thanks for your reply! Best Regards! sincerely yours, Jenny The institute of molecular biology the first military medical university Tonghe Guangzhou 510515 China From gtps5 at gtptech.com Wed Jun 25 05:50:44 2003 From: gtps5 at gtptech.com (Carole Louis) Date: 25 Jun 2003 11:50:44 +0200 Subject: Programming in Emboss Message-ID: <1056534645.1428.18.camel@thym> Hi, I am programming in Emboss but I do not understand why the buckle number 2 (see it in red) does not work. The problem is that the program does not pass by the buckle in red. Is it impossible to have two imbricated buckles or there is another problem ? I do not find the answer to my answer so, can someone help me, please ..... :-( Carole This is the code : //S?lection des meilleurs couples ajint compteur2 = 0; iterList3 = ajListIter(ListCoupleInit); // parcours liste couple avec score iterList4 = ajListIter(BestCouple); // liste contenant meilleurs couples ajint nbreBestCouple2 = 0; nbreBestCouple2 = ajListLength(BestCouple); ajFmtPrintF(outf,"\n nbre de meilleurs couples 2 : %d \n", nbreBestCouple2); //remplissage liste BestCouple while (ajListIterMore(iterList3)) { ajFmtPrintF(outf,"\n Boucle 1 \n"); res3 = (CoupleOlig) ajListIterNext(iterList3); ajint nbreBestCouple3 = 0; nbreBestCouple3 = ajListLength(BestCouple); ajFmtPrintF(outf,"\n nbre de meilleurs couples 3 : %d \n", nbreBestCouple3); if (compteur2 == 0) { ajFmtPrintF(outf,"\n Boucle 3 \n"); ajListPush(BestCouple, (void *) res3); ajFmtPrintF(outf,"\n Boucle 5 \n"); } compteur2 ++; while (ajListIterMore(iterList4)) { ajFmtPrintF(outf,"\n Boucle 2 \n"); res4 = (CoupleOlig) ajListIterNext(iterList4); if (res3->score <= res4->score) { ajFmtPrintF(outf,"\n Boucle 4 \n"); ajListInsert(iterList4, (void*) res3); } } } ajint nbreBestCouple = 0; nbreBestCouple = ajListLength(BestCouple); ajFmtPrintF(outf,"\n nbre de meilleurs couples : %d \n", nbreBestCouple); -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030625/17ad7bdf/attachment.html From mad at biol.unlp.edu.ar Wed Jun 25 12:31:22 2003 From: mad at biol.unlp.edu.ar (=?ISO-8859-1?Q?Mart=EDn_Sarachu?=) Date: Wed, 25 Jun 2003 13:31:22 -0300 Subject: embossdata bug? Message-ID: <3EF9CE5A.10604@biol.unlp.edu.ar> Hi EMBOSSers, I could not retrieve a file under the PRINTS directory with embossdata, tough the example worked ok. Here are the steps I followed: 1) the example in embossdata docs (tfm) works ok > $ embossdata -filename EPAM60 > Finds or fetches the data files read in by the EMBOSS programs > # The following directories can contain EMBOSS data files. > # They are searched in the following order until the file is found. > # If the directory does not exist, then this is noted below. > # '.' is the UNIX name for your current working directory. > > File ./EPAM60 Exists > File .embossdata/EPAM60 Does not exist > File /root/EPAM60 Does not exist > File /root/.embossdata/EPAM60 Does not exist > File /usr/local/emboss/share/EMBOSS/data/EPAM60 Exists > $ embossdata -fetch -filename EPAM60 > Finds or fetches the data files read in by the EMBOSS programs > File '/usr/local/emboss/share/EMBOSS/data/EPAM60' has been copied successfully. 2) but trying to fetch a PRINTS file fails > $ embossdata -filename 'PRINTS/PR00420' > Finds or fetches the data files read in by the EMBOSS programs > # The following directories can contain EMBOSS data files. > # They are searched in the following order until the file is found. > # If the directory does not exist, then this is noted below. > # '.' is the UNIX name for your current working directory. > > File ./PRINTS/PR00420 Does not exist > File .embossdata/PRINTS/PR00420 Does not exist > File /root/PRINTS/PR00420 Does not exist > File /root/.embossdata/PRINTS/PR00420 Does not exist > File /usr/local/emboss/share/EMBOSS/data//PRINTS/PR00420 Exists > $ embossdata -fetch -filename 'PRINTS/PR00420' > Finds or fetches the data files read in by the EMBOSS programs > > EMBOSS An error in embossdata.c at line 112: > The file 'PRINTS/PR00420' does not exist. > $ embossdata -fetch -filename PR00420 > Finds or fetches the data files read in by the EMBOSS programs > > EMBOSS An error in embossdata.c at line 112: > The file 'PR00420' does not exist. EMBOSS is version 2.6.0 Regards, martin -- Mart?n Sarachu mad at biol.unlp.edu.ar EMBNet Argentina http://www.ar.embnet.org From support at ancestry.com Wed Jun 25 18:31:43 2003 From: support at ancestry.com (support at ancestry.com) Date: Wed, 25 Jun 2003 16:31:43 -0600 (MDT) Subject: Application Message-ID: <3EFA22CF.000003.10210@utilnj01.int.rightnowtech.com> --------------------------------------------------------------- Thank you for your email. PLEASE NOTE: This is no longer a valid Technical Support email address and will not reach Customer Solutions. Any reply to this message will not receive a personalized response. To email Customer Solutions please use the Contact Form at the following URL: http://ancestry.custhelp.com/cgi-bin/ancestry.cfg/php/enduser/ask.php? You can also access this Contact Form at any time by simply using the "Email Ancestry Support" tab which appears on every page of the "Ask Ancestry" Knowledge Base. To access the Knowledge Base from any page of our website, simply click on the "?" tab at the upper right of the screen. In addition to our Contact Form, the "Ask Ancestry" Knowledge Base contains over 350 questions and answers which you can access in real time, thus not having to wait for an email response. Thank you, Ancestry.com Question --------------------------------------------------------------- Please see the attached zip file for details. ==================== application File Attachment ==================== your_details.zip, 82195 bytes, added to incident -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030625/2eea8cb7/attachment.html From andre.blavier at caissedesdepots.fr Thu Jun 26 05:42:53 2003 From: andre.blavier at caissedesdepots.fr (=?utf-8?Q?=22Blavier=2C_Andr=C3=A9=22?=) Date: Thu, 26 Jun 2003 11:42:53 +0200 Subject: chips Message-ID: Maybe you can give a try to my Windows port at http://perso.wanadoo.fr/ablavier/embosswin/embosswin.html -- Andr? Blavier > -----Message d'origine----- > De?: wyan at fimmu.com [mailto:wyan at fimmu.com] > Envoy??: mercredi 25 juin 2003 02:00 > ??: emboss at embnet.org > Objet?: chips > > > Dear Sir, > Does the software of emboss can be run on window > computer? I want to use the chips(codon usage) program, how > can I do it? Thanks for your reply! > Best Regards! > sincerely yours, > Jenny > The institute of molecular biology > the first military medical university > Tonghe Guangzhou 510515 > China > > > > From David.Bauer at SCHERING.DE Fri Jun 27 05:15:10 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Fri, 27 Jun 2003 11:15:10 +0200 Subject: digest, other enzymes Message-ID: Hello, I was asked by one of our users if it is possible to add recognition sites for Thrombin and 2 other proteases to digest. After looking a bit at the program I found that the recognition sites are hard coded in embmol.c and embprop.c Would it be possible to move them to a data file so one could add and change protease cleavage recognition sites (preferably in fuzzpro style) without having to change the code ? Thanks, David. From fbrosnan at berkley.ie Mon Jun 30 07:01:06 2003 From: fbrosnan at berkley.ie (Fergal Brosnan) Date: Mon, 30 Jun 2003 12:01:06 +0100 Subject: 2 Development roles in Ireland Message-ID: <361CD6509615834DBAD9C3B08ED2F309033EFD@SERVERCORK.Berkleycork.net> Hi All, We are currently recruiting 2 people, on a Bioinfo Developer with OO experience & the other a Statistical Developer to join a client Software company that focuses on the R&D sector of Pharma /Biotech. For more details contact me, Fergal, on +353 21 4559099. Rgds Fergal Fergal Brosnan, Berkley Recruitment, Ferryboat House, 1 lower Glanmire Rd, Cork, Ireland www.berkley.ie email:fbrosnan at berkley.ie Tel: 00353 21 4559090 Fax: 00353 21 4559095 -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030630/fed31cc2/attachment.html From voltigeur at worldonline.ch Mon Jun 30 10:22:31 2003 From: voltigeur at worldonline.ch (voltigeur at worldonline.ch) Date: Mon, 30 Jun 2003 16:22:31 +0200 Subject: HowTo for compiling (j)emboss under windows(tm) Message-ID: <3EFAF5E300001A77@mx2.tiscali.ch> Hello, At the end of this mail you will find the full version of my HowTo for compiling (j)embos under windows. The emboss part was modified according to the remarks, and the jemboss part should be error-free (but surely not the fastest or best way of compiling, at least it works). Remarks, bug-reports are welcome, Olivier Martin EMBOSS: 1) install cygwin (http://www.cygwin.com). That's surely possible to compile without it, but it's making everything easier. You'll have to install the base part plus the devel/make and devel/gcc packages. Before installing, see the first line of 2). Then you'll have a linux-like command-line with tools like gcc and make. The paths are then made according to the place where you installed cygwin (ex: c\cygwin becomes /). 2) cygwin (and EMBOSS, and other linux/unix programs) don't like empty spaces in names. Be sure that you install everything in places without empty spaces (avoid "C:\Program Files\"). But by default cygwin uses your windows login (something like "FirstName LastName") to create the /home/user_folder. Find and edit the /etc/passwd file and rename "FirstName LastName" into "FirstName_LastName" (or whatever else). 3) quit and restart the cygwin bash (you'll start in your "FirstName_LastName" directory, you can delete "FirstName LastName"), download the EMBOSS package and cd to the place where you uncompressed it. Follow the usual procedure: ./configure --without-x CFLAGS=-s make make install --without-x because at one point the X11 library is required (even if useless) and without this flag the compilation would stop. CFLAGS=-s to make the binaries smaller. 4) you can now use the EMBOSS programs from the cygwin bash like you usually do from linux (but have a look at 5) and 6) before). 5) text files are different between windows and linux. If you save (for ex.) emboss.default from, say, notepad, EMBOSS programs parsing this file won't be able to pass the first line and they will crash. To overcome this, use wordpad instead, or convert the file to linux format (various tools are available on internet, it's a common problem). 6) EMBOSS has then been built with cygwin. To use it from a ms-dos cmd instead of the cygwin bash the cygwin1.dll has to be in your windows PATH (since moving the .dll is discouraged, add another entry to the PATH variable). JEMBOSS (standalone version): I assume you start with EMBOSS already installed (see previous part). Running the install script as described in the webpages of EMBOSS would also take care of EMBOSS as well as JEMBOSS, but on my computer that led to errors in the make process (missing includes). I did not try to solve them (my goal was to make it work, not to debug everything. That shouldn't be too difficult, though). The remarks made in the EMBOSS part are still relevant. 1) install the java2 sdk in a place without empty spaces (i.e. don't use "C:\Program Files"). 2) modify the Makefile.am file from the jemboss directory: change the "javac org/emboss/jemboss/Jemboss.java" into "javac -classpath `cygpath -wp $CLASSPATH` org/emboss/jemboss/Jemboss.java" at both places in the "all-local" part. See "http://www.inonit.com/cygwin/faq/" for an explanation. 3) modify the install-server-jemboss.sh script located in the jemboss/utils directory. As in 2), change the "javac..." lines (four of them). Change also the "$JAVA_HOME/bin/jar cvf $JEMBOSS/resources/wossname.jar wossname.out" into "$JAVA_HOME/bin/jar cvf `cygpath -w $JEMBOSS/resources/wossname.jar` wossname.out" 4) using the cygwin setup.exe, install devel/automake and devel/libtool (that will also install other packages automatically). 5) run aclocal in the emboss directory. This will allow the various scripts to take into account the changes made to the Makefile.am. 6) run the install script (install-jemboss-server.sh) as described in the jemboss webpage. Warning: the default location for installation is not the same as for the emboss installation. Change it or you'll have binaries everywhere. 7) for some reason, the runJemboss.csh is incorrect (and there is no csh under cygwin so it wouldn't work anyway). You have to change it so that it will look like this: #!/bin/bash LD_LIBRARY_PATH="/usr/local/lib"; CLASSPATH="/usr/local/share/EMBOSS/jemboss/lib/soap.jar:/usr/local/share/EMBOSS/jemboss/lib/xerces.jar:/usr/local/share/EMBOSS/jemboss/lib/mail.jar:/usr/local/share/EMBOSS/jemboss/lib/activation.jar:/usr/local/share/EMBOSS/jemboss/lib/jakarta-regexp-1.2.jar:/usr/local/share/EMBOSS/jemboss/lib/jalview.jar:/usr/local/share/EMBOSS/jemboss/lib/jcert.jar:/usr/local/share/EMBOSS/jemboss/lib/jnet.jar:/usr/local/share/EMBOSS/jemboss/lib/jsse.jar:."; (cd /usr/local/share/EMBOSS/jemboss; java -classpath `cygpath -wp $CLASSPATH` org/emboss/jemboss/Jemboss local &) 8) check that your jemboss.properties is correct. Especially the paths must begin with /cygwin/, or emboss will search in C:\usr\local\... PS: for a reason that I can't understand, jemboss is searching for the binaries in a wrong place (for me /usr/local/share/EMBOSS/jemboss/PATH). As I was in lack of wise solutions, I simply moved the binaries to this place. There are smarter solutions, though. PPS: this procedure should also apply to the server-client version of jemboss (not tested), as long as you take care of the various pitfalls (i.e. using cygpath, not using paths with empty spaces,...). From ableasby at hgmp.mrc.ac.uk Sun Jun 1 20:33:44 2003 From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk) Date: Sun, 1 Jun 2003 21:33:44 +0100 (BST) Subject: EMBOSS 2.7.0 released Message-ID: <200306012033.h51KXiw21881@bromine.hgmp.mrc.ac.uk> Version 2.7.0 is available from: http://www.uk.embnet.org/Software/EMBOSS ftp://ftp.uk.embnet.org/pub/EMBOSS This release introduces improved sequence type handling, new programs (e.g. TCODE) and bugfixes. REBASEEXTRACT now requires both a withrefm and a proto file from the NEB REBASE distribution. Additions to Jemboss include a simple sequence alignment editor. EMBASSY packages have been modified to allow compilation with the latest gcc3 compiler release. See the ChangeLog file for more information. Alan From info at rich-mond.com Mon Jun 2 15:45:52 2003 From: info at rich-mond.com (Richmond Agencies Limited.) Date: Mon, 2 Jun 2003 16:45:52 +0100 Subject: Lab Clearance Bargains! Message-ID: <200306021545.h52FjqL18228@host1.doc-net.com> You have received this email as you have previously expressed an interest in our products or services. It is not our intention to spam, if you do not wish to receive further emails, please contact us via the address at the end of this message. Richmond Agencies Limited. Newsletter ----------------------------------------------------------------- OUR LATEST CLEARANCES INCLUDE... -------------------------------- Biotech Company Anthos Lucy Microplate Luminometer Supplied with Twin Dispenser & PC Pye Unicam UV/VIS Spectrophotometer (type: Kompact SEQ) Supplied with PC, Software & Manuals MALDI TOF Beckman Biomek Robotic Sampler Supplied with Heto Cooling Trap & Edwards High Vacuum Pump Galaxy S Co2 Incubator IR 25 Litre Boxer Autoclave Leec Compact Dogital Upright Incubator Jouan Media Preparator SH105 Astecair 500 Stand Alone Fume Cupboard Sonicor Ultrasonic Bath Pharmacia LKB Peristaltic Pump Denly Laboratory Freezer Bibby CB162 Hotplate Stirrer Heidolph Buomax 1030 Orbital Shaker Vortex Genie 2 with Platform Head GENERAL CHEMISTRY LABORATORY ---------------------------- Steward Lab Stomacher 400 Stewart Scientific Hotplate Type SHA Brook Crompton Mixer Heidolph RZR2051 Mixer x2 Corning Hoplate Stirrer PC351 Electrothermal Heating Mantle 500ml NE Laboratory Centrifuge Jenway 1201 Hotplate Jenway 1000 Hotplate Stirrer Philips PM8251 Single Pen Chart Recorder Edwards Freeze Dryer Stomacher 400 Kjeltec Auto 1030 Analyzer Corning 850 Air Compressor Shandon Vokam 400 Robot Coupe R201 Ultra Lab Blender Analytichem International Vac-elut Electrotherm Heating Mantle 250ml x3 Yltra Turrax Lab Mixer Gasmet Gas Flow Meter Heidolph Mixer Stands x4 IKN Labortechnik RW16 Mixer & Stand Dawe Ultrasonic Bath Lloyd Instruments Graphic 450 Chart Recorder 6 Place Heating Mantle 250ml MSE Centaur 2 Centrifuge Gerhardt Vapodest 1 Gerhardt Kjeldatherm Gallenkamp Platform Scale Robot Coupe R3 Plus 3000 Lab Mixer Stuart Scientific Flask Shaker SF1 Heidolph RZR 2100 Mixer Lab Stads x3 Gallenkamp Hotplate Stirrer Perkin Elmer GP100 Graphics Printer Rotary Evaporator Bibby 349/2 Grant W38 Digital Water Bath Miele G7783 Laboratory Glass Washer Gallenkamp Vacuum Oven Gallenkamp Hotbox Oven Fan Assisted Size 2 x2 Micromat HRGC 412 Hydrogen Generator Perkin Elmer Autosystem XL Gas Chromatograph Perkin Elmer 8500 Gas Chromatograph Perkin Elmer Double Beam Spectrophotometer 124 Corning 410 Flame Photometer Techni Dri-Block Heater DB1 Brookfield Viscometer with Full Set of Spindles and Case Carbolite Digital Furnace 1100 deg Contact Our Sales Team on 01942 492622 SECOND HAND BALANCES! SPECIAL OFFER.. >From a Third to Half the original price --------------------------------------- Sartorious Research R106P Analytical Dual Band Balance, 4dp/5dp, wieghing Capacity 162g Sartorious LA4200S Top Pan Balance, 2dp, Wieghing Capacity 4,200g Mettler Toledo AM100 Analytical Dual Band Balance, 4dp - Wieghing Capacity 4g, 5dp - Wieghing Capacity 100g PAG Precisa 240A Analytical Balance,4dp wieghing capacity 240g For Further Information, Please Call 01942 492622 ----------------------------------------------------------------- Richmond Agencies Limited. The Old Dairy, 162 - 165 Warrington Road, Lower Ince, Wigan, WN3 4JS Tel: 01942 492 622, Fax: 01942 492 280, Email: info at rich-mond.com Issue: Equipment Just In - Issue 4 -------------- next part -------------- An HTML attachment was scrubbed... URL: From henrikki.almusa at helsinki.fi Tue Jun 3 08:35:13 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Tue, 3 Jun 2003 11:35:13 +0300 Subject: Embassy: phylip Message-ID: <200306031135.13243.henrikki.almusa@helsinki.fi> Hello, I'm intrested in "embassified phylip". However the version that can be found from "ftp://ftp.uk.embnet.org/pub/EMBOSS/" is the older 3.5 version instead of 3.6. Phylips webpage say that 3.6 is alpha, but it seems to work without problems. So i was wondering if it would be possible to get whatever modifications there are in phylips 3.5 into the 3.6 version as well? Also is there any documentation about the changes, i coulnd't find much from the phylips tarball downloaded from ftp site. NEWS file had just a note that changes were kept minimum. If i could find out how much there was changes I might be able to help in making the 3.6 version (although i'm not sure how much time i have or are my abilities in c sufficient for that :)). Thanks, -- Henrikki Almusa From ml at mb.au.dk Tue Jun 3 10:21:57 2003 From: ml at mb.au.dk (Martin Luetzelberger) Date: Tue, 3 Jun 2003 11:21:57 +0100 (BST) Subject: Bug in Jemboss? Message-ID: Dear Jemboss experts, with the new EMBOSS-2.7.0 version and the Jemboss GUI I get java errors (see below) when choosing some programs from the DISPLAY menu i.e. prettyplot. I haven't seen this with the previous (EMBOSS-2.6.0) version. j2sdk1.4.1_03 is installed on my system (Mandrake Linux 9.1). Any suggestions? /Martin java.lang.NullPointerException at org.emboss.jemboss.gui.form.SectionPanel.resolveDependents(SectionPanel.java:968) at org.emboss.jemboss.gui.form.SectionPanel.checkDependents(SectionPanel.java:813) at org.emboss.jemboss.gui.form.SectionPanel.(SectionPanel.java:476) at org.emboss.jemboss.gui.form.BuildJembossForm.attach(BuildJembossForm.java:348) at org.emboss.jemboss.gui.form.BuildJembossForm.(BuildJembossForm.java:124) at org.emboss.jemboss.gui.BuildProgramMenu$5.actionPerformed(BuildProgramMenu.java:339) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1786) at javax.swing.AbstractButton$ForwardActionEvents.actionPerformed(AbstractButton.java:1839) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:420) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:258) at javax.swing.AbstractButton.doClick(AbstractButton.java:289) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:1113) at javax.swing.plaf.basic.BasicMenuItemUI$MouseInputHandler.mouseReleased(BasicMenuItemUI.java:943) at java.awt.Component.processMouseEvent(Component.java:5099) at java.awt.Component.processEvent(Component.java:4896) at java.awt.Container.processEvent(Container.java:1569) at java.awt.Component.dispatchEventImpl(Component.java:3614) at java.awt.Container.dispatchEventImpl(Container.java:1627) at java.awt.Component.dispatchEvent(Component.java:3476) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:3483) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:3198) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:3128) at java.awt.Container.dispatchEventImpl(Container.java:1613) at java.awt.Window.dispatchEventImpl(Window.java:1606) at java.awt.Component.dispatchEvent(Component.java:3476) at java.awt.EventQueue.dispatchEvent(EventQueue.java:456) at java.awt.EventDispatchThread.pumpOneEventForHierarchy(EventDispatchThread.java:201) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:151) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:145) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:137) at java.awt.EventDispatchThread.run(EventDispatchThread.java:100) -- Martin L?tzelberger, PhD Department of Molecular Biology University of ?rhus C.F. M?llers All?, Bldg. 130 DK-8000 Aarhus C Denmark -- Phone: +45 26635544 Fax: +45 86196500 Www: http://www.rna.dk E-mail: ml at mb.au.dk -- From tcarver at hgmp.mrc.ac.uk Tue Jun 3 09:38:53 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Tue, 3 Jun 2003 10:38:53 +0100 (BST) Subject: Bug in Jemboss? In-Reply-To: Message-ID: Hi Martin Thanks for your message. I noticed this one yesterday. It will probably not display 'emma' as well. I have made a patch available at: ftp://ftp.uk.embnet.org/pub/EMBOSS/patchfiles/Jemboss/ There will probably be a follow up release very soon which will incorporate the patch. Regards Tim Carver HGMP-RC On Tue, 3 Jun 2003, Martin Luetzelberger wrote: > Dear Jemboss experts, > > with the new EMBOSS-2.7.0 version and the Jemboss GUI I get > java errors (see below) when choosing some programs from the DISPLAY menu > i.e. prettyplot. I haven't seen this with the previous (EMBOSS-2.6.0) > version. j2sdk1.4.1_03 is installed on my system (Mandrake Linux 9.1). > > Any suggestions? > > /Martin > > > > java.lang.NullPointerException > at > org.emboss.jemboss.gui.form.SectionPanel.resolveDependents(SectionPanel.java:968) > at > org.emboss.jemboss.gui.form.SectionPanel.checkDependents(SectionPanel.java:813) > at > org.emboss.jemboss.gui.form.SectionPanel.(SectionPanel.java:476) > at > org.emboss.jemboss.gui.form.BuildJembossForm.attach(BuildJembossForm.java:348) > at > org.emboss.jemboss.gui.form.BuildJembossForm.(BuildJembossForm.java:124) > at > org.emboss.jemboss.gui.BuildProgramMenu$5.actionPerformed(BuildProgramMenu.java:339) > at > javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1786) > at > javax.swing.AbstractButton$ForwardActionEvents.actionPerformed(AbstractButton.java:1839) > at > javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:420) > at > javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:258) > at javax.swing.AbstractButton.doClick(AbstractButton.java:289) > at > javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:1113) > at > javax.swing.plaf.basic.BasicMenuItemUI$MouseInputHandler.mouseReleased(BasicMenuItemUI.java:943) > at java.awt.Component.processMouseEvent(Component.java:5099) > at java.awt.Component.processEvent(Component.java:4896) > at java.awt.Container.processEvent(Container.java:1569) > at java.awt.Component.dispatchEventImpl(Component.java:3614) > at java.awt.Container.dispatchEventImpl(Container.java:1627) > at java.awt.Component.dispatchEvent(Component.java:3476) > at > java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:3483) > at > java.awt.LightweightDispatcher.processMouseEvent(Container.java:3198) > at > java.awt.LightweightDispatcher.dispatchEvent(Container.java:3128) > at java.awt.Container.dispatchEventImpl(Container.java:1613) > at java.awt.Window.dispatchEventImpl(Window.java:1606) > at java.awt.Component.dispatchEvent(Component.java:3476) > at java.awt.EventQueue.dispatchEvent(EventQueue.java:456) > at > java.awt.EventDispatchThread.pumpOneEventForHierarchy(EventDispatchThread.java:201) > at > java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:151) > at > java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:145) > at > java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:137) > at java.awt.EventDispatchThread.run(EventDispatchThread.java:100) > > > -- > Martin L?tzelberger, PhD > Department of Molecular Biology > University of ?rhus > C.F. M?llers All?, Bldg. 130 > DK-8000 Aarhus C > Denmark > -- > Phone: +45 26635544 > Fax: +45 86196500 > Www: http://www.rna.dk > E-mail: ml at mb.au.dk > -- > From ableasby at hgmp.mrc.ac.uk Tue Jun 3 13:23:53 2003 From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk) Date: Tue, 3 Jun 2003 14:23:53 +0100 (BST) Subject: EMBOSS 2.7.1 (bugfix release) Message-ID: <200306031323.h53DNrA25041@bromine.hgmp.mrc.ac.uk> This version is available for download and fixes the Jemboss problem with 'emma' and 'prettyplot' forms mentioned on this list earlier today. Alan From georg.otto at tuebingen.mpg.de Tue Jun 3 14:21:56 2003 From: georg.otto at tuebingen.mpg.de (Georg Otto) Date: Tue, 3 Jun 2003 16:21:56 +0200 Subject: sequence quality in eprimer3 Message-ID: Hi! I have a question concerning eprimer3: I have a number of files in Staden experiment format (for an example see below). I can use it as an input file for primer selection with eprimer3 without problems. In the documentation of eprimer3 it is mentioned that it is possible to use base calling quality values for primer selection, but I did not find an explanation how this is done. More specifically, I am not sure how I can get the program to use the phred values listed in my exp files (is it used at all?) and how to define a minimal quality threshold. Any hint will be very much appreciated. Cheers, Georg ID fb71b08.x1.exp EN fb71b08.x1.exp LN fb71b08.x1 LT SCF AV 4 4 4 4 4 6 6 4 4 4 4 4 6 6 6 4 4 6 7 7 8 10 14 18 9 9 7 7 8 AV 8 9 9 8 8 10 14 9 9 11 25 25 31 31 31 31 30 33 33 33 33 AV 32 40 32 27 24 24 32 23 27 27 29 29 40 40 35 28 17 15 15 AV 28 28 36 34 28 25 8 6 6 6 6 9 18 24 27 33 33 33 38 39 33 AV 31 31 34 34 31 33 33 27 25 14 12 12 23 32 39 44 44 44 39 AV 39 37 37 37 39 39 38 37 37 37 37 37 37 37 44 45 44 44 44 AV 45 45 45 32 26 26 18 27 15 18 18 18 18 15 18 21 25 24 24 AV 24 30 30 37 33 37 37 37 37 33 33 24 22 22 22 19 22 32 32 AV 37 30 32 28 28 33 33 32 37 37 45 45 32 32 21 17 15 25 29 AV 32 32 30 30 30 37 37 45 45 45 32 32 14 14 11 14 14 26 17 AV 21 21 21 21 30 37 41 51 51 51 32 32 13 13 13 28 27 30 30 AV 28 28 30 30 37 41 41 37 36 30 36 34 21 21 27 27 30 30 30 AV 30 30 34 34 34 30 30 30 41 41 51 51 37 37 30 34 34 37 37 AV 27 27 14 27 21 32 32 51 51 33 33 30 30 30 24 36 22 30 30 AV 36 36 41 30 34 34 39 39 34 34 25 21 21 24 34 32 39 37 37 AV 30 30 28 33 28 27 30 36 32 31 36 30 29 29 29 36 34 37 37 AV 41 41 30 30 30 41 32 37 37 33 33 33 33 33 30 37 37 37 41 AV 41 41 30 30 30 34 34 34 37 37 37 37 41 41 37 37 37 37 37 AV 37 37 37 37 37 32 32 32 32 37 45 45 45 37 37 37 40 38 37 AV 37 37 37 37 37 37 34 34 34 34 34 31 38 37 28 28 26 26 19 AV 22 24 32 32 37 37 34 40 31 30 30 28 27 18 29 38 34 37 34 AV 34 34 31 31 27 29 32 32 24 27 29 32 34 45 38 34 34 34 31 AV 31 31 30 22 19 19 19 22 25 28 31 31 31 24 22 22 21 21 18 AV 12 13 14 19 23 26 27 28 36 33 33 33 33 31 30 32 23 23 22 AV 22 22 22 31 33 34 33 33 33 27 24 21 19 19 21 24 20 18 18 AV 18 18 21 21 19 20 24 24 24 21 12 10 9 9 10 12 18 26 25 AV 25 25 23 23 24 25 13 11 11 11 12 13 17 24 24 24 24 29 30 AV 23 19 9 9 10 12 12 9 10 17 18 20 21 18 18 23 22 19 16 16 AV 16 14 18 10 11 14 25 25 9 7 7 8 8 9 12 18 10 12 7 9 9 9 AV 12 18 14 18 16 18 18 13 18 8 8 10 8 9 9 7 7 10 10 14 12 AV 21 15 15 18 16 16 11 8 7 7 7 7 10 10 9 8 4 4 SQ NGGTGGGCCG CTGTAAGCGT GAATTTTATG AGATGACACT ATAGAAGAGC TATGACGTCG CATGCACGCG TACGTATGTT TGGATCCTCT AGAGCGGCCG CCCTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTCATGTTG TTAGATATAT TTTAATCAAG CAACAAATGT CAAAAAAAAA GCTCAAAGAC AGGATCGGGA ACAGCTTCAG GGTTGTTCTG GGTTACACAA ACTCGTACAG AATGTTACGA ACAACACACA ATCTATAGGG GTTACTAGTG AAGCATTAAA CGCTAACAGA TCACATTTGT TACAGAGATG AGAGATGATT AACCTGAGGC ATTTTCAAAA GTCTGGTTGA AGCAGCAAAA TGGAGGTCTG AGATAAACTA TTATACACCT GGAACTATAG CACATAGTTC CTCATGAAAA GATTAGGTAT ATTAAAACTA TTTAATAAAG GTTAGATGCT ACACATGTTA GCAATTCCTC AGCTTTAGCT TTTAACCATC ATATGGCACT TGAAATAAGG TCACAATACG TACATCACTG AGATCTCTTT GAATATTTTC CCCAAAATCC TCCTCCAAAA TATGTCTGAA CTTTGGTN // From acanario at ualg.pt Tue Jun 3 15:22:43 2003 From: acanario at ualg.pt (Adelino Canario) Date: Tue, 03 Jun 2003 16:22:43 +0100 Subject: JEMBOSS In-Reply-To: <200306031135.13243.henrikki.almusa@helsinki.fi> Message-ID: <5.1.0.14.2.20030603162009.01f2b810@localhost> Hello I have been trying to use Jemboss but although the settings have and option to use a proxy it tries to access the HGMP server directly (and hits the firewall). Is there a solution? Thanks Adelino Canario From henrikki.almusa at helsinki.fi Wed Jun 4 15:02:16 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Wed, 4 Jun 2003 18:02:16 +0300 Subject: Trying to upgrade dreg Message-ID: <200306041802.16414.henrikki.almusa@helsinki.fi> Hello I'm trying to test my c skills with Emboss. And decided to start by trying to modify dreg to print out in emboss report format. I've made some changes and got it to print out a report. Unfortunately I haven't been completely succesful in modifying this. So here I am to ask for help and guidance :). So my questions are. What i'm doing wrong here? And how to fix it? At one point I got it to write the proper file out with all the maches in it. However it was case sensetive at that time and printing out some warnings. While trying to get rid of these i seemed to lose the ability to match anything anymore. And i can't seem to be able to fix now to do matching properly for some reason. My patch is added as attachment. Once this is done I'm planning to try change preg similarly. Or better yet, i think, to modify one of them so that it read both amino acid and nucleotide sequences, since the regex shouldn't care what strings it is used to test on. TIA -- Henrikki Almusa -------------- next part -------------- A non-text attachment was scrubbed... Name: emboss-dreg.patch Type: text/x-diff Size: 3060 bytes Desc: not available URL: From ableasby at hgmp.mrc.ac.uk Wed Jun 4 16:22:25 2003 From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk) Date: Wed, 4 Jun 2003 17:22:25 +0100 (BST) Subject: Trying to upgrade dreg Message-ID: <200306041622.h54GMPb22817@bromine.hgmp.mrc.ac.uk> Hello Henrikki, Perhaps it is best to first point you at: http://www.bioinformatics.ac.uk which are the CCP11 pages (who provide some funding for EMBOSS). At the left (under 'courses') you'll see an EMBOSS link. That goes to some programming course notes I wrote. If you go to the practicals sections and look at practical 9 you'll see a description of Report Format programming. That should help... in particular with the ACD taglist which your modification appears to be missing. Anyway, have a look at that and, if you're still having difficulties then get back to us. Alan Bleasby HGMP From pmr at ebi.ac.uk Wed Jun 4 16:22:22 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Wed, 04 Jun 2003 17:22:22 +0100 Subject: Trying to upgrade dreg References: <200306041802.16414.henrikki.almusa@helsinki.fi> Message-ID: <3EDE1CBE.4040206@ebi.ac.uk> Henrikki Almusa wrote: > Hello > > I'm trying to test my c skills with Emboss. And decided to start by trying to > modify dreg to print out in emboss report format. I've made some changes and > got it to print out a report. Unfortunately I haven't been completely > succesful in modifying this. So here I am to ask for help and guidance :). So > my questions are. What i'm doing wrong here? And how to fix it? You are close .... look at fuzznuc for a similar program. The main problem is that you need to initialize hit_name, otherwise the feature is not created. We will add an error message for that condition. Also, there is no need (and it is bad practice) to use a string instead of a regexp as the input in the ACD file. You can keep the original code. I assume you did it to have the original pattern for the report - but that is what acdGetValue does. An example modified dreg.c is attached. I tested it, but will not commit it. > Once this is done I'm planning to try change preg similarly. Or better yet, i > think, to modify one of them so that it read both amino acid and nucleotide > sequences, since the regex shouldn't care what strings it is used to test on. There are advantages to keeping them separate. One is the ability to add validation in the regular expressions. This is very complex if they can be DNA or protein. Please do send in a modified dreg and preg - we can credit you with making the changes! Hope this helps Peter From Jack.Leunissen at wur.nl Wed Jun 4 22:53:52 2003 From: Jack.Leunissen at wur.nl (Jack Leunissen) Date: Thu, 5 Jun 2003 00:53:52 +0200 Subject: EMBOSS release 2.7.* Message-ID: <001001c32aec$2b6fedf0$0300000a@kuifje> Dear EMBOSS team, I noticed that there is a change in input parameter for a single sequence in programs like dot*, water etc. which breaks their functioning in SRS, as it will do in many sequence handling scripts. The "Changelog" isn't all the clear about this too. There may be other new undiscovered "features" as well that I didn't see yet - and don't have the time to find out be trial and error. For the time being I see no other option than to reinstall EMBOSS 2.6.0 again to retain full functionality :-(( It would be nice if these things would be communicated more clearly well in advance of a new major release, and if there would be some form of downward compatibility to the "old" way of sequence specification. Regards, Jack Jack Leunissen Genome Informatics Wageningen University 6703 HA Wageningen, NL -------------- next part -------------- An HTML attachment was scrubbed... URL: From P.Ernst at dkfz-heidelberg.de Thu Jun 5 07:57:05 2003 From: P.Ernst at dkfz-heidelberg.de (Peter Ernst) Date: Thu, 5 Jun 2003 09:57:05 +0200 (MEST) Subject: Bio::Emboss perl module for EMBOSS-2.7.* Message-ID: Since EMBOSS-2.7.0, the following EMBOSS/Ajax functions have different prototypes, requiring a new release (0.3) of the Perl module Bio::Emboss: ---- snip ---- void ajFeatReverse (thys, ilen) AjPFeature thys ajint ilen AjBool ajFeatTagSet (thys, tag, value) AjPFeature thys AjPStr tag AjPStr value AjBool ajFeatTagSetC (thys, tag, value) AjPFeature thys char* tag AjPStr value ---- snip ---- http://www.perl.com/CPAN/modules/by-module/Bio/ Bio::Emboss perl module version 0.3 =================================== This module interfaces to the libraries of the EMBOSS package (European Molecular Biology Open Software Suite). With this module you can access EMBOSS databases and use EMBOSS functions. -- ======================================================================= Peter Ernst Department of Molecular Biophysics - B020 Deutsches Krebsforschungszentrum (German Cancer Research Center) DKFZ Im Neuenheimer Feld 580 / Technologiepark 3 69120 Heidelberg, Germany http://genome.dkfz-heidelberg.de/ ======================================================================= From gbottu at ben.vub.ac.be Thu Jun 5 08:19:53 2003 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Thu, 5 Jun 2003 10:19:53 +0200 (CEST) Subject: sequence quality in eprimer3 Message-ID: <200306050819.h558JrVk1065320@black.vub.ac.be> from : BEN I am afraid that the EMBOSS "wrapper" program eprimer3 does not handle the base assignment qualities, even if the manual briefly mentions it. Actually, EMBOSS does not handle Staden experiment files. If you ask seqret to write experiment::xxx it writes a sequence in the now obsolete Staden format. (let's not blame the developers, it is such a monumental task to implement everything...) You might install primer through its "native" interface, using the primer3_www.cgi script. This is more rich than EMBOSS, but is of course "featureless" (no access to personal files on the server). You still will have to extract "manually" the content of the AV lines and copy-and-paste in the "Sequence Quality" box. Regards, Guy Bottu From pmr at ebi.ac.uk Thu Jun 5 08:32:59 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 05 Jun 2003 09:32:59 +0100 Subject: sequence quality in eprimer3 References: <200306050819.h558JrVk1065320@black.vub.ac.be> Message-ID: <3EDF003B.2040305@ebi.ac.uk> Guy Bottu wrote: > I am afraid that the EMBOSS "wrapper" program eprimer3 does not handle the base > assignment qualities, even if the manual briefly mentions it. Actually, EMBOSS > does not handle Staden experiment files. If you ask seqret to write > experiment::xxx it writes a sequence in the now obsolete Staden format. > (let's not blame the developers, it is such a monumental task to implement > everything...) Not too difficult. I believe the Staden experiment file format is similar to EMBL. We don't see the Staden format as obsolete (and only GCG seem to call it "Staden" - it's just a nice name for a plain sequence format. > You might install primer through its "native" interface, using the > primer3_www.cgi script. This is more rich than EMBOSS, but is of course > "featureless" (no access to personal files on the server). You still will have > to extract "manually" the content of the AV lines and copy-and-paste in the > "Sequence Quality" box. We could try adding the base qualities - yet more options for eprimer3. How many users would like this added in EMBOSS? Peter From gbottu at ben.vub.ac.be Thu Jun 5 10:39:20 2003 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Thu, 5 Jun 2003 12:39:20 +0200 (CEST) Subject: sequence quality in eprimer3 Message-ID: <200306051039.h55AdKGa1068877@black.vub.ac.be> > Not too difficult. I believe the Staden experiment file format is > similar to EMBL. Already now EMBOSS can read in sequences in "experiment" format, because it takes it for EMBL format. There is however a problem : in experiment format the SQ ACGT... // does not necessarily come at the end of the file ! Also, there are a lot of extra tags. Maybe some of them, like the AV lines, need some special treatment in EMBOSS. > We don't see the Staden format as obsolete (and only GCG seem to call it > "Staden" - it's just a nice name for a plain sequence format). Well, the manual of the last version of the Staden package mentions that the format is obsolete and the programs do not write or read it anymore. If I am not wrong, Staden format differs in two things from "raw" format : - it allows for embedded comments between <> at any place in the sequence (EMBOSS writes and reads staden:xxx files with a comment at the top, but does not allow comments anywhere else) - traditionally Staden used for ambiguous bases the Stanford-Staden codes rather than the IUPAC-IUB (but they seem to have abandonned this) I think EMBOSS should certainly support "experiment" format. There is no problem with continuing to support also "staden", but then maybe do it correctly and not confuse it with "experiment" or "rax"/"text"/"plain". > We could try adding the base qualities - yet more options for eprimer3. > > How many users would like this added in EMBOSS? I have no idea how many users want to access all the options of Primer. It can certainly do no harm to support them all. But maybe then split the page in more "type:page" sections. In Staden, eprimer3 is unusable because the "Start" button disappears below the bottom of the screen. I do not know if other GUI's also have problems. Guy Bottu From pmr at ebi.ac.uk Thu Jun 5 10:53:52 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 05 Jun 2003 11:53:52 +0100 Subject: sequence quality in eprimer3 References: <200306051039.h55AdKGa1068877@black.vub.ac.be> Message-ID: <3EDF2140.4060803@ebi.ac.uk> Guy Bottu wrote: >>Not too difficult. I believe the Staden experiment file format is >>similar to EMBL. > > > Already now EMBOSS can read in sequences in "experiment" format, because it > takes it for EMBL format. There is however a problem : in experiment format the > SQ > ACGT... > // > does not necessarily come at the end of the file ! Also, there are a lot of > extra tags. Maybe some of them, like the AV lines, need some special treatment > in EMBOSS. Extra line types are easy to ignore. We would need some example files (to be saved in the test/data directory) to QA test the code. >>We don't see the Staden format as obsolete (and only GCG seem to call it >>"Staden" - it's just a nice name for a plain sequence format). > > > Well, the manual of the last version of the Staden package mentions that the > format is obsolete and the programs do not write or read it anymore. > If I am not wrong, Staden format differs in two things from "raw" format : > - it allows for embedded comments between <> at any place in the sequence > (EMBOSS writes and reads staden:xxx files with a comment at the top, but does > not allow comments anywhere else) > - traditionally Staden used for ambiguous bases the Stanford-Staden codes rather > than the IUPAC-IUB (but they seem to have abandonned this) > > I think EMBOSS should certainly support "experiment" format. There is no problem > with continuing to support also "staden", but then maybe do it correctly and not > confuse it with "experiment" or "rax"/"text"/"plain". "experiment" is another name for "staden". Easiest is probably to make it another name for "embl" if we can handle the format differences. Or we can make a copy of the ReadEmbl functions and make the expriment format changes there. >>We could try adding the base qualities - yet more options for eprimer3. >> >>How many users would like this added in EMBOSS? > > > I have no idea how many users want to access all the options of Primer. It can > certainly do no harm to support them all. But maybe then split the page in more > "type:page" sections. In Staden, eprimer3 is unusable because the "Start" button > disappears below the bottom of the screen. I do not know if other GUI's also > have problems. eprimer3 certainly needs lots of sections. Suggestions for good ways to split the sections are welcome (they only apply to GUIs - EMBOSS will ignore them anyway). All we need are: section section list of ACD qualifiers endsection endsection From letondal at pasteur.fr Thu Jun 5 12:52:47 2003 From: letondal at pasteur.fr (Catherine Letondal) Date: Thu, 05 Jun 2003 14:52:47 +0200 Subject: pestfind: name collision Message-ID: <200306051252.h55CqlhJ359524@electre.pasteur.fr> Hi, There is a name collision of an EMBOSS program called pestfind with the program pestfind that already existed (at least in Pise). I had to rename our original interface to Pestfind. (cf http://bioweb.pasteur.fr/seqanal/protein/intro-uk.html) However, it is very possible that the EMBOSS interface is equivalent or better. What do you think? Regards, -- Catherine Letondal -- Pasteur Institute Computing Center From battaile at mcw.edu Thu Jun 5 13:43:26 2003 From: battaile at mcw.edu (Kevin Battaile) Date: Thu, 5 Jun 2003 08:43:26 -0500 (CDT) Subject: wossname Message-ID: <48601.141.106.186.40.1054820606.squirrel@post.its.mcw.edu> I was installing 2.7.1 last night and noticed that 'wossname' seems to be broken. This is the only thing it reports: [linux3 emboss]$ ./wossname Finds programs by keywords in their one-line documentation Keyword to search for, or blank to list all programs: PROTEIN COMPOSITION checktrans Reports STOP codons and ORF statistics of a protein I was trying to add in the embassy programs to the jemboss list as described on the jemboss web site and can't since wossname doesn't seem to work. Has anyone else noticed this, or it is just me? -Kevin From asmann.Yan at mayo.edu Thu Jun 5 13:53:40 2003 From: asmann.Yan at mayo.edu (Asmann, Yan Ph.D.) Date: Thu, 5 Jun 2003 08:53:40 -0500 Subject: database size Message-ID: Hi, I have installed the EMBOSS2.7.0, and tried to index databases using dbifasta. I found that when database size is over 2GB (e.g. est_human... etc), dbifasta will give EMBOSS An error message as following: " in embdbi.c at line 295: Cannot open ./est_mouse for reading" I remember for version 2.2.0, there wasn't any error message for over-sized DBs, the dbifasta would start indexing but an "fragmentation fault" will happen later. Has anyone had the same problem for 2.7.0? Is anyone working on modifying dbi* programes for DBs larger than 2GB? Thanks, Yan From mathog at mendel.bio.caltech.edu Thu Jun 5 14:55:11 2003 From: mathog at mendel.bio.caltech.edu (David Mathog) Date: Thu, 05 Jun 2003 07:55:11 -0700 Subject: pestfind: name collision Message-ID: > > There is a name collision of an EMBOSS program called pestfind with the program > pestfind that already existed (at least in Pise). Yes, same problem here. > I had to rename our original > interface to Pestfind. > (cf http://bioweb.pasteur.fr/seqanal/protein/intro-uk.html) > However, it is very possible that the EMBOSS interface is equivalent or better. > What do you think? The original PESTFIND was a basic program by Martin Rechsteiner with corrections by Bob Stellwagen. I've never seen it run (not having basic on any of my machines) but In 1995 I obtained the code and ported it (more or less literally translated line for line) to ANSI C, that version is still available here: ftp://saf.bio.caltech.edu/pub/software/molbio/pestfind.zip At that time I left the name as "pestfind" because it was simply a translation of the original program into a new language. The numeric results were intended to exactly reproduce the original (and not improve on them in any way.) Later a PERL version was written by M.Grabner. I have not seen the code but according to this page: http://emb1.bcc.univie.ac.at/embnet/tools/bio/PESTfind/about.htm it was also a translation from the original basic. The pestfind in EMBOSS is by Michael K. Schuster and Martin Grabner. It appears to be a translation to C from MG's earlier Perl. I have not analyzed the EMBOSS code extensively but clearly it differs in some ways from the original PESTFIND since the results are not quite the same. A quick glance showed that the original had a weight term and two of its values were 186 and 163, this bit of code seems to be missing from the EMBOSS PESTFIND. Perhaps these are coded in there in some other manner, for instance, the values are derived from some included table and differ slightly from the integer values? The results produced by drm_PESTFIND (mine) and emboss_PESTFIND are (for instance): drm_PESTFIND: Potential PEST sequence 89-124 (flank_dist=34) HYTNPSQDVTVPCPVPSTPPTPSPSTPPTPSPSCCH The weight percent of PEDST is: 60.854301 The hydrophobicity index is: 39.809540 The PEST-FIND score is: 13.565096 --------------------------------- emboss_PESTFIND: Potential PEST motif with 34 amino acids between position 89 and 124. 89 HYTNPSQDVTVPCPVPSTPPTPSPSTPPTPSPSCCH 124 DEPST: 60.53 % (w/w) Hydrophobicity index: 39.60 PEST score: 13.49 The differences are too large to be rounding errors - there's some (slight) intrinsic difference in the code. Part of this is probably due to the lack of an explicit "weight" term in the EMBOSS pestfind, and part may be due to the EMBOSS version correcting a bug in the original Basic version which I left (intentionally) intact in the C translation. The bottom line though is that: 1. The EMBOSS version seems to be doing a slightly different calculation than the original PESTFIND. The results are very close, they may even be "better" by some criteria, but they are not the same. 2. There was already an earlier program with that name. Usually with EMBOSS a port of "program" into an EMBOSS version resulted in "eprogram" in order to avoid exactly this sort of confusion. So the EMBOSS version should be renamed "epestfind". Regards, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From letondal at pasteur.fr Thu Jun 5 17:32:48 2003 From: letondal at pasteur.fr (Catherine Letondal) Date: Thu, 05 Jun 2003 19:32:48 +0200 Subject: pestfind: name collision In-Reply-To: Your message of "Thu, 05 Jun 2003 07:55:11 PDT." Message-ID: <200306051732.h55HWmhJ229993@electre.pasteur.fr> "David Mathog" wrote: Thanks David for this detailed answer! > [...] > I have not analyzed the EMBOSS code extensively but clearly > it differs in some ways from the original PESTFIND since the > results are not quite the same. A quick glance showed that > the original had a weight term and two of its > values were 186 and 163, this bit of code seems to be > missing from the EMBOSS PESTFIND. Perhaps these are coded in > there in some other manner, for instance, the values are derived > from some included table and differ slightly from the integer > values? > [...] > > The bottom line though is that: > > 1. The EMBOSS version seems to be doing a slightly different > calculation than the original PESTFIND. The results are > very close, they may even be "better" by some criteria, but > they are not the same. > > 2. There was already an earlier program with that name. > Usually with EMBOSS a port of "program" into an EMBOSS version > resulted in "eprogram" in order to avoid exactly this > sort of confusion. > > So the EMBOSS version should be renamed "epestfind". Do people from EMBOSS agree with this? -- Catherine Letondal -- Pasteur Institute Computing Center From ableasby at hgmp.mrc.ac.uk Thu Jun 5 17:40:12 2003 From: ableasby at hgmp.mrc.ac.uk (Alan Bleasby) Date: Thu, 5 Jun 2003 18:40:12 +0100 (BST) Subject: pestfind: name collision Message-ID: <200306051740.h55HeCaB006461@uranium.hgmp.mrc.ac.uk> Noone has objected since I asked a few hours ago so you can almost rest assured that it will be called epestfind in the next release. Alan From martin.petersen at id.unibe.ch Fri Jun 6 05:00:51 2003 From: martin.petersen at id.unibe.ch (Martin Petersen) Date: Fri, 06 Jun 2003 07:00:51 +0200 Subject: error in Jemboss authentication Message-ID: <200306060700.51169.martin.petersen@id.unibe.ch> Dear Jemboss experts I have a problem installing the Jemboss application with authentication. Every time, Jemboss wants to start a program on the server, it waits 30 seconds and gives back the message "authentication failed / Login to server failed / Please check your login details". The failure arrives with both shadow and PAM authentication. I use EMBOSS 2.6.0 and 2.7.1 on a SUSE Linux 8.2 machine. The method, that waits 30 seconds and gives back a false is Ajax.userAuth(), defined probably in the ajax/ajjava.c file. It seems like Ajax calls something that hangs, and after 30 seconds it stoppes it and gives back a "false". So perhaps I miss a file or I have a wrong version installed. The thing is, I really have no idea, where I have to search. So has anyone of you encountered this problem, too? Does anyone know where my problem could be founded? Or are there running Jemboss installations, where I could get a exact installation script? I packed some configuration files and installation description in the file: http://ubecx.unibe.ch/~petersen/help-jemboss.zip Regards, Martin Petersen ---------------------------------------- Martin Petersen Computer Service Dept. - University of Berne martin.petersen at id.unibe.ch From simon.andrews at bbsrc.ac.uk Mon Jun 9 14:10:06 2003 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Mon, 9 Jun 2003 15:10:06 +0100 Subject: needle -filter Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28A5A@bi-exsrv1.iapc.bbsrc.ac.uk> I'm trying to get needle to work from a set of sequences held in memory, rather than have it pick up its input from a file. For something like seqret I can do: cat seq.txt | seqret -filter -osf fasta | more and seqret will read in on stdin and write out on stdout. In the manual for needle it suggests that it too can accept -filter as a qualifier, but I can't get it to work. cat seq1.txt seq2.txt | needle -filter -sformat1 fasta -sformat2 fasta It always dies with the message "Bad option for -seqall with -auto defined". I'm trying to feed it two concatenated fasta files as input, but when I debug it it looks like it only gets one of them. Does anyone have any suggestions as to how I can make this work? Cheers Simon. -- Simon Andrews PhD Bioinformatics Dept The Babraham Institute simon.andrews at bbsrc.ac.uk +44 (0)1223 496463 From pmr at ebi.ac.uk Mon Jun 9 16:09:09 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 09 Jun 2003 17:09:09 +0100 Subject: needle -filter References: <2DC41140A89ED411989D00508BDCD9ED01E28A5A@bi-exsrv1.iapc.bbsrc.ac.uk> Message-ID: <3EE4B125.8060502@ebi.ac.uk> simon andrews (BI) wrote: > In the manual for needle it suggests that it too can accept -filter as a qualifier, but I can't get it to work. > > cat seq1.txt seq2.txt | needle -filter -sformat1 fasta -sformat2 fasta > > It always dies with the message "Bad option for -seqall with -auto defined". I'm trying to feed it two concatenated fasta files as input, but when I debug it it looks like it only gets one of them. > > Does anyone have any suggestions as to how I can make this work? EMBOSS (and anything else) expects one standard input. You are trying to read 2 inputs from stdin. needle will accept one sequence from stdin and another from "somewhere else". But you can do this: needle "cat seq1.txt|" "cat seq2.txt|" -sformat1 fasta -sformat2 fasta EMBOSS treats "cat seq1.txt|" as a command and reads the standard output. With -filter it will default to writing to stdout. Hope this helps, Peter Rice From mathog at mendel.bio.caltech.edu Mon Jun 9 18:55:25 2003 From: mathog at mendel.bio.caltech.edu (David Mathog) Date: Mon, 09 Jun 2003 11:55:25 -0700 Subject: needle -filter Message-ID: > Peter Rice wrote: > > simon andrews (BI) wrote: > > In the manual for needle it suggests that it too can accept -filter as a qualifier, but I can't get it to work. > > > > cat seq1.txt seq2.txt | needle -filter -sformat1 fasta -sformat2 fasta > > Hmm. So presumably they're coming out of some other program together in a stream and it's inconvenient for some reason to write them to files. Ok. > You are trying to read 2 inputs from stdin. needle will accept one > sequence from stdin and another from "somewhere else". > > But you can do this: > > needle "cat seq1.txt|" "cat seq2.txt|" -sformat1 fasta -sformat2 fasta That's got to be one of the ugliest syntaxes for reading in two files I've ever seen! Plus I don't understand how it differs from: needle seq1.txt seq2.txt It might be possible on some platforms to come up with a "firstfasta" filter program which would emit just the first fasta entry from the stream. It would have to run character by character and be able to push the ">" of the second entry back into the input stream, and I don't think that's guaranteed to work everywhere. Probably it would work on Unix though, so you could maybe do something like this: needle "firstfasta" "firstfasta" What Simon needs, and what Emboss doesn't have, is a built in splitter for multisequence files that will allow the individual sequences to be directed to specific inputs in a program like needle. Failing that one could create two fifos, use an external splitter to direct the bits into the fifos, and run needle with the fifos for the input file names. Probably better to build the splitter into EMBOSS though. Something like: cat twosequences.fasta | program -filter -route 1:infile1,2:infile2 where infile1/infile2 are the command line names for things that are typically called "-sequence" and the like. The problem with needle (and water) is that the sequences typically go on the command line unadorned, like: needle seq1 seq2 for which the syntax might be: -route 1:1,2:2 -route without -filter would be an error. The stream properties would make it a bit awkward for something like this: -route 1:1,1:2 If the program works by loading input 1, then input 2. No way to back up the stream so that input 2 could load with entry 1. The splitter/router could handle this, but only generally by saving the contents of the first streamed sequence somewhere for reuse. For a program to compare one to many there could also be: -route 1:1,2-END:2 In theory this splitter/router shouldn't be too hard to implement. In practice the various file inputs would need to read their data in the order specified by route, and short of reading each program's code one would have no way of knowing what that order is. Which suggests: program -listroutes which would emit the read order information that -route would use later. Regards, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From peptides at earthlink.net Tue Jun 10 01:33:11 2003 From: peptides at earthlink.net (David Stephens) Date: Mon, 9 Jun 2003 18:33:11 -0700 Subject: Catalog Request Form Message-ID: <20030610013959.3B0837D2A7@mercury.hgmp.mrc.ac.uk> An HTML attachment was scrubbed... URL: From hanyj at genomics.org.cn Tue Jun 10 06:02:02 2003 From: hanyj at genomics.org.cn (hanyj) Date: Tue, 10 Jun 2003 14:02:02 +0800 Subject: about charge Message-ID: <001201c32f15$d0a6d900$f204a8c0@BGI.LOCAL> Dear Sir, I just used the program "charge". It worked well, but I did not know what the values' meanings were. For example, 0.10 or -0.10 ? Could you tell my ASAP, it is very important for me. Thank you in advance! Sincerely, Han yujun BGI, China -------------- next part -------------- An HTML attachment was scrubbed... URL: From David.Bauer at SCHERING.DE Tue Jun 10 06:49:44 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Tue, 10 Jun 2003 08:49:44 +0200 Subject: Antwort: about charge Message-ID: Hello Han, charge uses the column "charge" from the datafile Eamino.dat (in a default setup it is in /usr/local/share/EMBOSS/data/). It gives D and E a charge of -1, K and R +1, H +0.5. Then it calculates the mean charge with across -window (default ist 5). Hope this helps, David. "hanyj" An: Gesendet von: Kopie: owner-emboss at hgm Thema: about charge p.mrc.ac.uk 10.06.03 08:02 Dear Sir, I just used the program "charge". It worked well, but I did not know what the values' meanings were. For example, 0.10 or -0.10 ? Could you tell my ASAP, it is very important for me. Thank you in advance! Sincerely, Han yujun BGI, China From simon.andrews at bbsrc.ac.uk Tue Jun 10 07:53:52 2003 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Tue, 10 Jun 2003 08:53:52 +0100 Subject: needle -filter Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28A5B@bi-exsrv1.iapc.bbsrc.ac.uk> > From: David Mathog > > Peter Rice wrote: > > > simon andrews (BI) wrote: > > > In the manual for needle it suggests that it too can > > > accept -filter as a qualifier, but I can't get it to work. > > > > > > cat seq1.txt seq2.txt | needle -filter -sformat1 > > > fasta -sformat2 fasta > > > > > Hmm. So presumably they're coming out of some other program > together in a stream and it's inconvenient for some reason to > write them to files. Ok. Yes, it's going to be used as part of a CGI script so the sequences are already in variables in the script. I could go down the line of creating temp files, but this gets to be a real pain (making sure different processes don't clash, and cleaning up afterwards), and it would slow things down as well. > > You are trying to read 2 inputs from stdin. needle will > > accept one sequence from stdin and another from "somewhere > > else". > > > > But you can do this: > > > > needle "cat seq1.txt|" "cat seq2.txt|" -sformat1 fasta > > -sformat2 fasta That's an interesting thing to know, but I don't think it really helps me. The example I gave with cat was just used to generate the pipe, the actual sequences would all have to come from one input stream. > It might be possible on some platforms to come up with a > "firstfasta" filter program which would emit just the > first fasta entry from the stream. It would have to run > character by character and be able to push the ">" of the > second entry back into the input stream, and I don't think > that's guaranteed to work everywhere. Probably it would work > on Unix though, so you could maybe do something like this: > > needle "firstfasta" "firstfasta" I don't think that would be any easier than going down the whole tempfile route. You'd still have the problem of getting firstfasta to figure out which stream it should pass a sequence in from when multiple instances were running. > What Simon needs, and what Emboss doesn't have, is a built in > splitter for multisequence files that will allow the > individual sequences to be directed to specific inputs in a > program like needle. Failing that one could create two > fifos, use an external splitter to direct the bits into the > fifos, and run needle with the fifos for the input file names. > > Probably better to build the splitter into EMBOSS though. > Something like: > > cat twosequences.fasta | program -filter -route > 1:infile1,2:infile2 This seems a good addition to the package, but for many programs you could probably make the route part optional, and just say that -filter expects all its sequences on STDIN in the same format. I don't think it would be too much of an imposition on the user to say that if you want to submit multiple sequences to a program in a single stream then they all have to come in the correct order. Projects such as BioPerl have stream filters which will read multiple concatenated sequences in most formats so hopefully that shouldn't present too many problems, but as David pointed out you'd have to be able to rewind (at least one line) in the stream for something like Fasta format. > If the program works by loading input 1, then input 2. No > way to back up the stream so that input 2 could load with > entry 1. The splitter/router could handle this, but only > generally by saving the contents of the first streamed > sequence somewhere for reuse. This sounds like the sort of scenario I'm trying to avoid with my initial query! What happens if you're putting 200 sequences into a multiple alignment, in a random order, and there's 5 copies running. It all gets a bit complex and messy :-) Again I'd be tempted to just say that if you want to put your inputs on STDIN they have to come in the right order. As a programmer that shouldn't be too hard to organise. As an aside, the idea of the asis: USA is a really nice way around this whole problem. The trouble is that it's limited (I presume) by the command line length your shell allows, and by you not being able to specify a name for the sequence. If there was some easy way around this limitation, then that would solve the problem for the situations I can think I'm likely to encounter. Simon. From pmr at ebi.ac.uk Tue Jun 10 08:48:04 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 10 Jun 2003 09:48:04 +0100 Subject: needle -filter References: Message-ID: <3EE59B44.4040007@ebi.ac.uk> David Mathog wrote: >>Peter Rice wrote: >>needle "cat seq1.txt|" "cat seq2.txt|" -sformat1 fasta -sformat2 fasta > > That's got to be one of the ugliest syntaxes for reading > in two files I've ever seen! It's standard in perl :-) Any file ending in a pipe character is a command producing standard output. > Plus I don't understand how > it differs from: > > needle seq1.txt seq2.txt Because you don't have to use cat ... you can use seqret, getz, or anything else :-) > It might be possible on some platforms to come up with a > "firstfasta" filter program which would emit just the > first fasta entry from the stream. That's already in EMBOSS several times, for example: nthseq seqret -first skipseq -skip 1 SRS, to quote one example, uses these to split inputs. > What Simon needs, and what Emboss doesn't have, is a built in > splitter for multisequence files that will allow the individual > sequences to be directed to specific inputs in a program like > needle. You mean needle seq1.txt:abc seq2.txt:xyz That is already available!!!! > For a program to compare one to many there could also be: > > -route 1:1,2-END:2 That would make workflows extremely messy. I reckon the existing EMBOSS syntax covers everything perfectly well. Hope this helps, Peter From jon at compbio.dundee.ac.uk Tue Jun 10 09:30:44 2003 From: jon at compbio.dundee.ac.uk (Jonathan Barber) Date: Tue, 10 Jun 2003 10:30:44 +0100 Subject: needle -filter In-Reply-To: <2DC41140A89ED411989D00508BDCD9ED01E28A5B@bi-exsrv1.iapc.bbsrc.ac.uk> References: <2DC41140A89ED411989D00508BDCD9ED01E28A5B@bi-exsrv1.iapc.bbsrc.ac.uk> Message-ID: <20030610093044.GE22944@flea.compbio.dundee.ac.uk> On Tue, Jun 10, 2003 at 08:53:52AM +0100, simon andrews (BI) wrote: > > From: David Mathog > > > Peter Rice wrote: > > > > simon andrews (BI) wrote: > > > > In the manual for needle it suggests that it too can > > > > accept -filter as a qualifier, but I can't get it to work. > > > > > > > > cat seq1.txt seq2.txt | needle -filter -sformat1 > > > > fasta -sformat2 fasta > > > > > > > > Hmm. So presumably they're coming out of some other program > > together in a stream and it's inconvenient for some reason to > > write them to files. Ok. > > Yes, it's going to be used as part of a CGI script so the sequences > are already in variables in the script. I could go down the line of > creating temp files, but this gets to be a real pain (making sure > different processes don't clash, and cleaning up afterwards), and it > would slow things down as well. If you're using Perl, the easiest way to do this is to use the core File::Temp module. tempdir() may be exactly what you need. [snip] > As an aside, the idea of the asis: USA is a really nice way around > this whole problem. The trouble is that it's limited (I presume) by > the command line length your shell allows, and by you not being able > to specify a name for the sequence. If there was some easy way around > this limitation, then that would solve the problem for the situations > I can think I'm likely to encounter. Again, if you're using Perl, then you can use system() with a list argument rather than a scalar, and this will avoid the shell, if your command doesn't have any shell metacharacters in it (perldoc -f system). -- Jon From kim at inb.uni-luebeck.de Tue Jun 10 10:44:16 2003 From: kim at inb.uni-luebeck.de (Jan T. Kim) Date: Tue, 10 Jun 2003 12:44:16 +0200 Subject: needle -filter In-Reply-To: <3EE59B44.4040007@ebi.ac.uk>; from pmr@ebi.ac.uk on Tue, Jun 10, 2003 at 09:48:04AM +0100 References: <3EE59B44.4040007@ebi.ac.uk> Message-ID: <20030610124416.B5472@pc10.inb.mu-luebeck.de> On Tue, Jun 10, 2003 at 09:48:04AM +0100, Peter Rice wrote: > > What Simon needs, and what Emboss doesn't have, is a built in > > splitter for multisequence files that will allow the individual > > sequences to be directed to specific inputs in a program like > > needle. > > You mean needle seq1.txt:abc seq2.txt:xyz > > That is already available!!!! In the case discussed here it seems that both sequence entries would come from the same file (e.g. seq1.txt), which is no problem as long as it's really a file. But what if the file really is an input stream? In that case, you'd need something like needle :abc :xyz Technically, this would entail some problems, as entry "xyz" may precede "abc" in the stream. The needle program would therefore have to scan the input stream using a list of entries which it needs, scanning twice, as I'd expect it to happen in needle :abc :xyz will not work with input streams. Perhaps, such capability could be implemented by defining some special name for the "standard input file" or "standard input database"? I haven't found such a thing in the USA specification, but perhaps, that's already invented? Kind regards, Jan -- +- Jan T. Kim -------------------------------------------------------+ | *NEW* email: kim at inb.uni-luebeck.de | | *NEW* WWW: http://www.inb.uni-luebeck.de/staff/kim.html | *-----=< hierarchical systems are for files, not for humans >=-----* From pmr at ebi.ac.uk Tue Jun 10 10:53:16 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 10 Jun 2003 11:53:16 +0100 Subject: needle -filter References: <3EE59B44.4040007@ebi.ac.uk> <20030610124416.B5472@pc10.inb.mu-luebeck.de> Message-ID: <3EE5B89C.8020304@ebi.ac.uk> Jan T. Kim wrote: > needle :abc :xyz > > will not work with input streams. Perhaps, such capability could be > implemented by defining some special name for the "standard input file" > or "standard input database"? I haven't found such a thing in the USA > specification, but perhaps, that's already invented? There is a special name - stdin - but it can only be opened once. How many Unix commands do read more than one input stream from stdin? Peter From simon.andrews at bbsrc.ac.uk Tue Jun 10 11:15:29 2003 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Tue, 10 Jun 2003 12:15:29 +0100 Subject: needle -filter Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28A5E@bi-exsrv1.iapc.bbsrc.ac.uk> > -----Original Message----- > From: Jonathan Barber [mailto:jon at compbio.dundee.ac.uk] > Sent: 10 June 2003 10:31 > To: 'emboss at embnet.org' > Subject: Re: needle -filter > > > As an aside, the idea of the asis: USA is a really nice way around > > this whole problem. The trouble is that it's limited (I presume) by > > the command line length your shell allows, and by you not being able > > to specify a name for the sequence. If there was some easy > > way around this limitation, then that would solve the problem for the > > situations I can think I'm likely to encounter. > > Again, if you're using Perl, then you can use system() with a list > argument rather than a scalar, and this will avoid the shell, if your > command doesn't have any shell metacharacters in it (perldoc > -f system). System doesn't help me as I can't read STDOUT from it, but looking at the docs for IPC::Open3 it looks like I can do the whole thing that way instead. Cheers for the pointer, I wouldn't have throught about doing it that way! After a bit of playing, it's not quite as easy as I'd hoped, but I got it to work. The script at the bottom shows one way to get needle to work without having to write anything to disk. One quick extra feature request though. For the asis:: USA, would it be possible to assign a name to the sequences passed in, even if it's only 1,2,3 or seq1 seq2 seq3 etc. It would make parsing of output files much easier. A way to specify a name in the USA would be even better (eg asis::name>GAGAGTGTAGT or whatever). Cheers for all the help on this, it seems to have provoked some interesting discussion. TTFN Simon. #!/usr/bin/perl -w use strict; use IPC::Open3; my $seq_a = 'CCAGCCCATTTATCTATACCATGAGGTAACTGAAGTAAGGAGAGCAGTGA'; my $seq_b = 'CCAGCCCATTTATCTATACCATGAGGTTTCTGAAGTAAGGAGAGCAGTGA'; open (ERRORS,'>/dev/null') || die "Can't open /dev/null :$!"; open3 (\*INPUT,\*OUTPUT,\*ERRORS,'needle',"asis::$seq_a","asis::$seq_b"); print INPUT "10\n"; print INPUT "0.5\n"; print INPUT "stdout\n"; print INPUT "\n"; close INPUT; print "OUTPUT: $_" while (); From pmr at ebi.ac.uk Tue Jun 10 11:38:33 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 10 Jun 2003 12:38:33 +0100 Subject: needle -filter References: <2DC41140A89ED411989D00508BDCD9ED01E28A5E@bi-exsrv1.iapc.bbsrc.ac.uk> Message-ID: <3EE5C339.6050004@ebi.ac.uk> simon andrews (BI) wrote: > One quick extra feature request though. For the asis:: USA, would it be > possible to assign a name to the sequences passed in, even if it's > only 1,2,3 or seq1 seq2 seq3 etc. It would make parsing of output files > much easier. A way to specify a name in the USA would be even better > (eg asis::name>GAGAGTGTAGT or whatever). Should be possible to do this: needle asis::aaacccgggttt -sid simon asis::aacccgg -sid peter -filter but there is a problem with the second -sid for needle because it is a seqall input, and specifying the id is a problem with possibly more than one input. We can look into allowing -sid for seqall input, for the first sequence in the stream. Peter From jon at compbio.dundee.ac.uk Tue Jun 10 11:58:34 2003 From: jon at compbio.dundee.ac.uk (Jonathan Barber) Date: Tue, 10 Jun 2003 12:58:34 +0100 Subject: needle -filter In-Reply-To: <2DC41140A89ED411989D00508BDCD9ED01E28A5E@bi-exsrv1.iapc.bbsrc.ac.uk> References: <2DC41140A89ED411989D00508BDCD9ED01E28A5E@bi-exsrv1.iapc.bbsrc.ac.uk> Message-ID: <20030610115834.GF22944@flea.compbio.dundee.ac.uk> On Tue, Jun 10, 2003 at 12:15:29PM +0100, simon andrews (BI) wrote: > > > > -----Original Message----- > > From: Jonathan Barber [mailto:jon at compbio.dundee.ac.uk] > > Sent: 10 June 2003 10:31 > > To: 'emboss at embnet.org' > > Subject: Re: needle -filter > > > > > As an aside, the idea of the asis: USA is a really nice way around > > > this whole problem. The trouble is that it's limited (I presume) by > > > the command line length your shell allows, and by you not being able > > > to specify a name for the sequence. If there was some easy > > > way around this limitation, then that would solve the problem for the > > > situations I can think I'm likely to encounter. > > > > Again, if you're using Perl, then you can use system() with a list > > argument rather than a scalar, and this will avoid the shell, if your > > command doesn't have any shell metacharacters in it (perldoc > > -f system). > > System doesn't help me as I can't read STDOUT from it, but looking at > the docs for IPC::Open3 it looks like I can do the whole thing that > way instead. Cheers for the pointer, I wouldn't have throught about > doing it that way! That's the way I usually handle the emboss programs as well, but I didn't think of using the asis, nifty. > > After a bit of playing, it's not quite as easy as I'd hoped, but I got > it to work. The script at the bottom shows one way to get needle to > work without having to write anything to disk. > > One quick extra feature request though. For the asis:: USA, would it be > possible to assign a name to the sequences passed in, even if it's > only 1,2,3 or seq1 seq2 seq3 etc. It would make parsing of output files > much easier. A way to specify a name in the USA would be even better > (eg asis::name>GAGAGTGTAGT or whatever). > > Cheers for all the help on this, it seems to have provoked some interesting > discussion. > > TTFN > > Simon. > > > #!/usr/bin/perl -w > use strict; > use IPC::Open3; > > my $seq_a = 'CCAGCCCATTTATCTATACCATGAGGTAACTGAAGTAAGGAGAGCAGTGA'; > > my $seq_b = 'CCAGCCCATTTATCTATACCATGAGGTTTCTGAAGTAAGGAGAGCAGTGA'; > > open (ERRORS,'>/dev/null') || die "Can't open /dev/null :$!"; > > open3 (\*INPUT,\*OUTPUT,\*ERRORS,'needle',"asis::$seq_a","asis::$seq_b"); > > print INPUT "10\n"; > print INPUT "0.5\n"; > print INPUT "stdout\n"; > print INPUT "\n"; > > close INPUT; > > print "OUTPUT: $_" while (); One small point on using open3() is that you should probably record the pid and waitpid() on it to prevent zombies: my $pid = open3 (\*INPUT,\*OUTPUT,\*ERRORS,'needle',"asis::$seq_a","asis::$seq_b"); print INPUT <; waitpid $pid, 0; -- Jon From kim at inb.uni-luebeck.de Tue Jun 10 14:20:30 2003 From: kim at inb.uni-luebeck.de (Jan T. Kim) Date: Tue, 10 Jun 2003 16:20:30 +0200 Subject: needle -filter In-Reply-To: <3EE5B89C.8020304@ebi.ac.uk>; from pmr@ebi.ac.uk on Tue, Jun 10, 2003 at 11:53:16AM +0100 References: <3EE59B44.4040007@ebi.ac.uk> <20030610124416.B5472@pc10.inb.mu-luebeck.de> <3EE5B89C.8020304@ebi.ac.uk> Message-ID: <20030610162030.A6214@pc10.inb.mu-luebeck.de> On Tue, Jun 10, 2003 at 11:53:16AM +0100, Peter Rice wrote: > Jan T. Kim wrote: > > needle :abc :xyz > > > > will not work with input streams. Perhaps, such capability could be > > implemented by defining some special name for the "standard input file" > > or "standard input database"? I haven't found such a thing in the USA > > specification, but perhaps, that's already invented? > > There is a special name - stdin - but it can only be opened once. Ok -- thanks for this pointer, I managed to overlook this. Among general lack of attention, I overlooked it because I was focusing on something like a special file name "-", which is generically used in the *nix / command line world to denote the standard input. > How many Unix commands do read more than one input stream from stdin? None. There are no multiple standards in the Unix world, so there is no multiple stdin... ;-) More seriously: The standard input is logically one input stream. The issue here is not multiple input streams which, in the Unix environment, would typically be handled by using named pipes (this may also be an approach for solving the problem from which this thread originated). In many cases, though, it is preferable to have one input stream which is structured into multiple records, such as sequence entries in our case. Handling such multiple-record input would be more convenient if EMBOSS did not have to perform a pass through an entire stream for each record it needs to obtain. This approach is restricted to streams which can be "reproduced", which does not generally apply to the standard input stream. Kind regards, Jan -- +- Jan T. Kim -------------------------------------------------------+ | *NEW* email: kim at inb.uni-luebeck.de | | *NEW* WWW: http://www.inb.uni-luebeck.de/staff/kim.html | *-----=< hierarchical systems are for files, not for humans >=-----* From pmr at ebi.ac.uk Tue Jun 10 14:47:31 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 10 Jun 2003 15:47:31 +0100 Subject: needle -filter References: <3EE59B44.4040007@ebi.ac.uk> <20030610124416.B5472@pc10.inb.mu-luebeck.de> <3EE5B89C.8020304@ebi.ac.uk> <20030610162030.A6214@pc10.inb.mu-luebeck.de> Message-ID: <3EE5EF83.7070008@ebi.ac.uk> Jan T. Kim wrote: > More seriously: The standard input is logically one input stream. The > issue here is not multiple input streams which, in the Unix environment, > would typically be handled by using named pipes (this may also be an > approach for solving the problem from which this thread originated). > In many cases, though, it is preferable to have one input stream which > is structured into multiple records, such as sequence entries in our > case. Handling such multiple-record input would be more convenient if > EMBOSS did not have to perform a pass through an entire stream for each > record it needs to obtain. This approach is restricted to streams which > can be "reproduced", which does not generally apply to the standard > input stream. EMBOSS does not (always) read the entire stream - but it would have to rewind the input to read a second sequence. Consider, for example, FASTA format: >abc aaacccgggttt >def tttgggcccaaa EMBOSS has to read the first line of the second sequence - just to know that the first sequence has ended. Peter From gbottu at ben.vub.ac.be Tue Jun 10 14:51:14 2003 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Tue, 10 Jun 2003 16:51:14 +0200 (CEST) Subject: problem with List Files + SRS access Message-ID: <200306101451.h5AEpE0k1310952@black.vub.ac.be> from : BEN Dear support, I just hit on a problem. I have an EMBOSS List File with more than 1000 entries that I try to give as input to an EMBOSS program. The program crashes with error message : task_create() failed for pid 1307576: max_proc_per_user (=256) exceeded for uid 430. EMBOSS An error in ajfile.c at line 125: fork create failed While the program is running, the command "ps x" gives : ... 1307703 pts/2 <+ 0:00.00 1307706 pts/2 <+ 0:00.00 1307713 pts/2 <+ 0:00.00 1307714 pts/2 R + 0:00.29 getz -e [EMBL-id:AF017184]|[EMBL-acc:AF017184] 1307720 pts/2 <+ 0:00.00 1307722 pts/2 <+ 0:00.00 1307729 pts/2 <+ 0:00.00 ... Note that the EMBL databank is accessed by the "srs" method. For databanks acessed by the "emblcd" method there is no problem. Looks like a bug in the interface between EMBOSS and "getz", doesn'it ? (I am using EMBOSS 2.6.0 under CompaqTru64 5.1A). Sincerely, Guy Bottu From mathog at mendel.bio.caltech.edu Tue Jun 10 15:47:49 2003 From: mathog at mendel.bio.caltech.edu (David Mathog) Date: Tue, 10 Jun 2003 08:47:49 -0700 Subject: needle -filter Message-ID: > Peter Rice wrote: > > EMBOSS does not (always) read the entire stream - but it would have to > rewind the input to read a second sequence. > > Consider, for example, FASTA format: > > >abc > aaacccgggttt > >def > tttgggcccaaa > > EMBOSS has to read the first line of the second sequence - > just to know that the first sequence has ended. Only the first character of that line, which is what I was referring to in my earlier post. If the input uses getc() it can do an ungetc() at the second '>' and then exit. The next "firstfasta" should pick up the same '>' as its first character. At least on Unix. ungetc() isn't the most portable of functions - but all the OS's I know of allow it to be called at least once. Just don't expect to be able to call it a thousand times sequentially. Regards, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From pmr at ebi.ac.uk Tue Jun 10 16:02:16 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 10 Jun 2003 17:02:16 +0100 Subject: needle -filter References: Message-ID: <3EE60108.5050200@ebi.ac.uk> David Mathog wrote: > Only the first character of that line, which is what I was > referring to in my earlier post. If the input uses getc() > it can do an ungetc() at the second '>' and then exit. > The next "firstfasta" should pick up the same '>' > as its first character. At least on Unix. ungetc() isn't > the most portable of functions - but all the OS's I know > of allow it to be called at least once. Just don't > expect to be able to call it a thousand times sequentially. ... of course, I was carefully avoiding mention of GCG format which ruins any plans to use ungetc :-) ... and you can't seek back to the position in a pipe Peter From mathog at mendel.bio.caltech.edu Tue Jun 10 16:20:09 2003 From: mathog at mendel.bio.caltech.edu (David Mathog) Date: Tue, 10 Jun 2003 09:20:09 -0700 Subject: needle -filter Message-ID: > David Mathog wrote: > > > Only the first character of that line, which is what I was > > referring to in my earlier post. If the input uses getc() > > it can do an ungetc() at the second '>' and then exit. > > The next "firstfasta" should pick up the same '>' > > as its first character. At least on Unix. ungetc() isn't > > the most portable of functions - but all the OS's I know > > of allow it to be called at least once. Just don't > > expect to be able to call it a thousand times sequentially. > > ... of course, I was carefully avoiding mention of GCG format which > ruins any plans to use ungetc :-) > > ... and you can't seek back to the position in a pipe Not directly. But one can maintain inside getnextline() a rollback buffer that stores the last N lines from fgets(). Reread lines from the rollback buffer instead of the actual stream. That will typically do the job so long as the need to rollback is something reasonable, say, no more than a couple of hundreds of lines. Such a rollback buffer will have a lot of advantages over unget() sorts of functions. For instance, one could drop in bookmarks and start reading again from those positions. More importantly, it's completely portable. Regards, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From pmr at ebi.ac.uk Tue Jun 10 16:23:28 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 10 Jun 2003 17:23:28 +0100 Subject: needle -filter References: Message-ID: <3EE60600.10206@ebi.ac.uk> David Mathog wrote: >>... and you can't seek back to the position in a pipe > > > Not directly. But one can maintain inside getnextline() > a rollback buffer that stores the last N lines from fgets(). This is essentially an EMBOSS file buffer - but we avoid buffering every input because of the overhead. Let us stick with using EMBOSS to split up input files. It is simple and less likely to break something. Peter From abl at ica.cc Wed Jun 11 16:19:36 2003 From: abl at ica.cc (American Biotech) Date: Wed, 11 Jun 2003 12:19:36 -0400 Subject: Complimentary subscription from International Scientific Communications Message-ID: <446387924309200@ica.cc> Dear Colleague, Please accept my invitation to receive a free subscription to our journal, American Biotechnology Laboratory. American Biotechnology Laboratory, is the leading life science tabloid publication that includes news and information about the latest laboratory products and features articles submitted by prominent scientists from around the world reviewing laboratory techniques and applications of instrumentation and software. Following are the themes to be featured in ABL: * July - Incubators; Shakers; Thermal Cyclers; Real-Time PCR * August - Biomolecular Screening * September - Liquid Handling; Centrifuges * October - Microscopy and Image Analysis; Chemiluminescence * November - DNA/RNA Purification * December - Proteins and Peptides For your FREE subscription to American Biotechnology Laboratory, please click on the following link. http://www.icainfo.com/abl/appintro.asp?NewADD=YES&Priority=PEPAB I am confident that you will enjoy our journal and find it to be of significant professional value. I look forward to hearing from you. Sincerely yours, Brian Howard, Ph.D. Editor International Scientific Communications, Inc. 30 Controls Drive P.O. Box 870 Shelton, CT 06484 Tel.: 203-926-9300 Fax: 203-926-9310 iscpubs at iscpubs.com www.iscpubs.com -------------- next part -------------- An HTML attachment was scrubbed... URL: From voltigeur at worldonline.ch Thu Jun 12 08:04:57 2003 From: voltigeur at worldonline.ch (voltigeur at worldonline.ch) Date: Thu, 12 Jun 2003 10:04:57 +0200 Subject: emboss+jemboss on windows(tm) Message-ID: <3EE5965600001620@mx2.tiscali.ch> Hello, Last week I've compiled emboss (2.6.0) and jemboss (standalone version) under windows(xp) using the cygwin environment. It works fine. If anyone is interested I can provide either the binaries or the method to overcome the various problems (or both). Olivier Martin From ruediger at sanbi.ac.za Thu Jun 12 08:18:06 2003 From: ruediger at sanbi.ac.za (Ruediger Braeuning) Date: Thu, 12 Jun 2003 10:18:06 +0200 (SAST) Subject: emboss+jemboss on windows(tm) In-Reply-To: <3EE5965600001620@mx2.tiscali.ch> References: <3EE5965600001620@mx2.tiscali.ch> Message-ID: <20030612101542.U28367-100000@fling.sanbi.ac.za> Hi, I would be very interested in the method to overcome the various problems. I've tried myself and I haven't completely succeeded so far. Thanks Ruediger ------------------------------------------------------------------------- Ruediger Braeuning / South African National Bioinformatics Institute (=) University of the Western Cape Ph. +27 21 959 3645 / Private Bag X17 Fax +27 21 959 2512 (=) Bellville, 7535 www.sanbi.ac.za / South Africa On Thu, 12 Jun 2003 voltigeur at worldonline.ch wrote: > Hello, > > Last week I've compiled emboss (2.6.0) and jemboss > (standalone version) under windows(xp) using the > cygwin environment. It works fine. If anyone is > interested I can provide either the binaries or > the method to overcome the various problems (or > both). > > Olivier Martin > > > > > > > > From jrvalverde at cnb.uam.es Thu Jun 12 09:46:05 2003 From: jrvalverde at cnb.uam.es (José R. Valverde) Date: Thu, 12 Jun 2003 11:46:05 +0200 Subject: needle -filter In-Reply-To: <3EE60108.5050200@ebi.ac.uk> References: <3EE60108.5050200@ebi.ac.uk> Message-ID: <20030612114605.778b8158.jrvalverde@cnb.uam.es> > ... of course, I was carefully avoiding mention of GCG format which > ruins any plans to use ungetc :-) > > ... and you can't seek back to the position in a pipe > > Peter OK, time to abandon lurker mode. First, this is old stuff. K&R show how to handle this situations in their classic "The C Programming Language". The same approach may be used at any level (i.e. more than one character): simply use a bigger read buffer (or a dynamic one). The code in K&R: - ------------------------------------------------------------------------- #define BUFSIZE 100 char buf[BUFSIZE]; /* buffer for ungetch */ int bufp = 0; /* next free position in buf */ int getch(void) /* get a (possibly pushed-back) character */ { return (bufp > 0) ? buf[--bufp] : getchar(); } void ungetch(int c) /* push character back on input */ { if (bufp >= BUFSIZE) printf("ungetch: too many characters\n"); else buf[bufp++] = c; } - -------------------------------------------------------------------------- A dynamic one -- i once used something similar on an arcane db-processing program to deal with UW-type entries: you couldn't tell them until you found the '..' tag, at the end of possibly arbitrarily long comments, since one must read the whole entry sooner or later anyway into memory, it's not that much of a waste to do it like this: - --------------------------------------------------------------------------- #include static char *buf; /* buffer for ungetch */ static size_t bufsize = 128; /* current buffer size */ size_t bufp = 0; /* next free position in buf */ ungetch_init() { if ((buf = (char *) malloc(bufsize)) == NULL) perror("ungetch_init()"); } ungetch_exit() { free(buf); } int getch(void) /* get a (possibly pushed-back) character */ { return (bufp > 0) ? buf[--bufp] : getchar(); } void ungetch(int c) /* push character back on input */ { if (bufp >= bufsize) { /* realloc buf: duplicate its size * might use a linear increase as well, say "+=128" */ bufsize *= 2; if ((buf = (char *) realloc(buf, bufsize)) == NULL) perror("ungetch_init()"); } else buf[bufp++] = c; } - ----------------------------------------------------------------------- Trivial. Second: seeking back. How do 'more' and 'less' manage to seek back-forward stdin? How does ghostview= The simplest approach: read into a temporary file and, if needed, seek from it. The fastest approach: read everything into memory and move on memory (this is easier if one may use mmap(), but this is not so easy with stdin). Use a big enough lookeahead buffer and instead of reading char by char, read entry by entry. Use a double buffer: one buffer is used for the current entry, the other for the next one, a switch defines which is the current one. This is another classic, I can't remember the refference offhand though. j From pmr at ebi.ac.uk Thu Jun 12 09:55:15 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 12 Jun 2003 10:55:15 +0100 Subject: needle -filter References: <3EE60108.5050200@ebi.ac.uk> <20030612114605.778b8158.jrvalverde@cnb.uam.es> Message-ID: <3EE84E03.4080601@ebi.ac.uk> Jos? R. Valverde wrote: > OK, time to abandon lurker mode. Welcome!!! > First, this is old stuff. K&R show how to handle this situations in > their classic "The C Programming Language". The same approach may be used > at any level (i.e. more than one character): simply use a bigger read buffer > (or a dynamic one). But don't forget ... EMBOSS could be reading a huge stream through stdin. Something like a complex getz query piped in. You really do not want to hold all that in memory just for the odd special case. EMBOSS buffers a set number of lines for possible GCG input (if it has to guess the format) - but the buffer is for one input stream. We are talking about multiple input streams here, and special processing of stdin. It just doesn't look nice to me. Anyway, clearly a topic for tomorrow's EMBOSS team meeting.... Peter From Weiner at urz.uni-hd.de Thu Jun 12 11:40:46 2003 From: Weiner at urz.uni-hd.de (January Weiner 3) Date: Thu, 12 Jun 2003 13:40:46 +0200 (METDST) Subject: Troubles installing jemboss In-Reply-To: <3EE84E03.4080601@ebi.ac.uk> Message-ID: Hello, I'm trying to install jemboss in client-server configuration on a Solaris system. I run the install script, which runs fine untill the Makefile gots to the "utils" directory, where I get the following errors: -8<--------------------------- ./org/emboss/jemboss/gui/filetree/DragTree.java:139: Variable 'model' is already defined in this method. DefaultTreeModel model = (DefaultTreeModel)getModel(); ^ ./org/emboss/jemboss/gui/ResultsMenuBar.java:285: Variable 'fnt' is already defined in this method. Font fnt = fed.getFont(); ^ ./org/emboss/jemboss/gui/ResultsMenuBar.java:310: Variable 'fnt' is already defined in this method. Font fnt = fed.getFont(); ^ 3 errors *** Error code 1 make: Fatal error: Command failed for target `all-local' Current working directory /export/home/jw/Src/EMBOSS-2.7.1/jemboss *** Error code 1 make: Fatal error: Command failed for target `install-recursive' Current working directory /export/home/jw/Src/EMBOSS-2.7.1/jemboss *** Error code 1 make: Fatal error: Command failed for target `install-recursive' -8<--------------------------- Next, the scripts asks whether to install EMBASSY packages (I answer "no"), and again, it runs into several errors just before it says Changed /export/home/share/EMBOSS/jemboss/resources/jemboss.properties to reflect this installation Afterwards, I got several "Exception(s) in thread "main" java.lang.NoClassDefFoundError: javax/naming/Referenceable", and the control scripts do not seem to work. I have no experience whatsoever whith tomcat / Java, what do you think I do wrong? Regards, j. ----)-\//-///-----------------------------------January-Weiner-3------- La science est infaillible; mais les savants se trompent toujours. Anatole France From voltigeur at worldonline.ch Thu Jun 12 13:28:27 2003 From: voltigeur at worldonline.ch (voltigeur at worldonline.ch) Date: Thu, 12 Jun 2003 15:28:27 +0200 Subject: emboss binaries for windows Message-ID: <3EE5962100001D82@mx1.tiscali.ch> Hello, For those who wanted the binaries (and maybe for others), while making a zip file I've noticed that the size is huge (about 2 Mo for every program is making a zip file of about 114 Mo). That obviously wouldn't fit in an e-mail attachment... Unless I can put it on a server somewhere I'm afraid you'll have to use the HowTo I'm currently writing (expect it today or tomorrow) and compile everything yourself. The cygwin environment is handy but not optimized. Olivier Martin From david at starks-browning.com Thu Jun 12 13:34:51 2003 From: david at starks-browning.com (David Starks-Browning) Date: Thu, 12 Jun 2003 14:34:51 +0100 Subject: emboss binaries for windows In-Reply-To: <3EE5962100001D82@mx1.tiscali.ch> References: <3EE5962100001D82@mx1.tiscali.ch> Message-ID: <837-Thu12Jun2003143451+0100-david@starks-browning.com> On Thursday 12 Jun 03, voltigeur at worldonline.ch writes: > Hello, > > For those who wanted the binaries (and maybe for others), > while making a zip file I've noticed that the size is huge > (about 2 Mo for every program is making a zip file of about > 114 Mo). That obviously wouldn't fit in an e-mail attachment... > Unless I can put it on a server somewhere I'm afraid you'll > have to use the HowTo I'm currently writing (expect it today > or tomorrow) and compile everything yourself. > The cygwin environment is handy but not optimized. You could try using "strip" on the binaries or do the equivalent with a gcc command line option. What you're seeing is a feature of gcc, that symbols are included by default. I don't think it's Cygwin's fault. Regards, David From voltigeur at worldonline.ch Thu Jun 12 14:55:51 2003 From: voltigeur at worldonline.ch (voltigeur at worldonline.ch) Date: Thu, 12 Jun 2003 16:55:51 +0200 Subject: emboss binaries for windows In-Reply-To: <837-Thu12Jun2003143451+0100-david@starks-browning.com> Message-ID: <3EE5962100001ED4@mx1.tiscali.ch> >You could try using "strip" on the binaries or do the equivalent with >a gcc command line option. >What you're seeing is a feature of gcc, that symbols are included by >default. I don't think it's Cygwin's fault. I had a quick look at the cygwin FAQ and you're right. But differences remain. I've performed the same installation under linux and the programs are barely 100 Ko. The compilation is also much longer (it took about 1 hour under windows while only 15 minutes under linux red hat 9.0, on the same computer). Olivier Martin From david at starks-browning.com Thu Jun 12 15:17:18 2003 From: david at starks-browning.com (David Starks-Browning) Date: Thu, 12 Jun 2003 16:17:18 +0100 Subject: emboss binaries for windows In-Reply-To: <3EE5962100001ED4@mx1.tiscali.ch> References: <837-Thu12Jun2003143451+0100-david@starks-browning.com> <3EE5962100001ED4@mx1.tiscali.ch> Message-ID: <2342-Thu12Jun2003161718+0100-david@starks-browning.com> On Thursday 12 Jun 03, voltigeur at worldonline.ch writes: > The compilation is also much longer (it took about 1 hour under > windows while only 15 minutes under linux red hat 9.0, on the same > computer). Indeed, Cygwin will always be *extremely* slow compared to Linux for something like a package build. But that has nothing to do with distributing EMBOSS binaries. (Except to make them more valuable.) BTW, if someone wanted to a truly proper job of this, one could make a Cygwin package according to . But I doubt the benefits outweigh the effort, if you've only got a couple of people using EMBOSS under Cygwin. I'm sure the most useful thing anyone can produce is your "how to" for building EMBOSS under Cygwin. Regards, David From sa58794 at odin.mdacc.tmc.edu Thu Jun 12 21:32:50 2003 From: sa58794 at odin.mdacc.tmc.edu (clwu) Date: Thu, 12 Jun 2003 16:32:50 -0500 Subject: emboss binaries for windows In-Reply-To: <837-Thu12Jun2003143451+0100-david@starks-browning.com> References: <3EE5962100001D82@mx1.tiscali.ch> <837-Thu12Jun2003143451+0100-david@starks-browning.com> Message-ID: <3EE8F182.6010905@odin.mdacc.tmc.edu> Hi, I just upgraded my EMBOSS by compiling the new release under win2k/cygwin. After compilation, I used "strip" and "upx" to shrink the sizes of binary files. After "strip", I got about 700k for each file; after "upx", I got about 250k each. Finally, I got all binary files in total about 42M. I tried quite a few tools, and I didn't get any trouble for using them. Chunlei David Starks-Browning wrote: >On Thursday 12 Jun 03, voltigeur at worldonline.ch writes: > > >>Hello, >> >>For those who wanted the binaries (and maybe for others), >>while making a zip file I've noticed that the size is huge >>(about 2 Mo for every program is making a zip file of about >>114 Mo). That obviously wouldn't fit in an e-mail attachment... >>Unless I can put it on a server somewhere I'm afraid you'll >>have to use the HowTo I'm currently writing (expect it today >>or tomorrow) and compile everything yourself. >>The cygwin environment is handy but not optimized. >> >> > >You could try using "strip" on the binaries or do the equivalent with >a gcc command line option. > >What you're seeing is a feature of gcc, that symbols are included by >default. I don't think it's Cygwin's fault. > >Regards, >David > > > From voltigeur at worldonline.ch Fri Jun 13 06:08:02 2003 From: voltigeur at worldonline.ch (voltigeur at worldonline.ch) Date: Fri, 13 Jun 2003 08:08:02 +0200 Subject: HowTo for compiling emboss under windows Message-ID: <3EE5962100002235@mx1.tiscali.ch> Hello, This the (small) HowTo I told you about. Some remarks: - it's only for emboss, since it seems that people are more interested in it than in jemboss. I'll also write one for jemboss, though (soon). - it's how I did it on my computer, there might be differences and/or different ways of doing it. - I don't think there are mistakes, but who knows. - bug-fixes, remarks are wellcome EMBOSS: 1) install cygwin (http://www.cygwin.com). That's surely possible to compile without it, but it's making everything easier. You'll have to install the base part plus the devel/make and devel/gcc packages. Before installing, see the first line of 2). Then you'll have a linux-like command-line with tools like gcc and make. The paths are then made according to the place where you installed cygwin (ex: c\cygwin becomes /). 2) cygwin (and EMBOSS, and other linux/unix programs) don't like empty spaces in names. Be sure that you install everything in places without empty spaces (avoid "C:\Program Files\"). But by default cygwin uses your windows login (something like "FirstName LastName") to create the /home/user_folder. Find and edit the /etc/passwd file and rename "FirstName LastName" into "FirstName_LastName" (or whatever else). 3) quit and restart the cygwin bash (you'll start in your "FirstName_LastName" directory, you can delete "FirstName LastName"), download the EMBOSS package and cd to the place where you uncompressed it. Follow the usual procedure: ./configure --without-x CFLAGS=-s make make install --without-x because at one point the X11 library is required (even if useless) and without this flag the compilation would stop. CFLAGS=-s to make the binaries smaller. 4) you can now use the EMBOSS programs from the cygwin bash like you usually do from linux (but have a look at 5) and 6) before). 5) text files are different between windows and linux. If you save (for ex.) emboss.default from, say, wordpad, EMBOSS programs parsing this file won't be able to pass the first line and they will crash. To overcome this, use notepad instead (or save in a format you know that it won't be a problem), or convert the file to linux format (various tools are available on internet, it's a common problem). 6) EMBOSS has then been built with cygwin. To use it from a ms-dos cmd instead of the cygwin bash the cygwin1.dll has to be in your windows PATH (ex: C:\windows\system32). good luck, Olivier Martin From david at starks-browning.com Fri Jun 13 12:10:37 2003 From: david at starks-browning.com (David Starks-Browning) Date: Fri, 13 Jun 2003 13:10:37 +0100 Subject: HowTo for compiling emboss under windows In-Reply-To: <3EE5962100002235@mx1.tiscali.ch> References: <3EE5962100002235@mx1.tiscali.ch> Message-ID: <3429-Fri13Jun2003131037+0100-david@starks-browning.com> Olivier, Just a few comments: > 1) install cygwin (http://www.cygwin.com). That's surely possible to > compile without it, but it's making everything easier. No, you cannot compile EMBOSS as distributed without a POSIX emulation layer like Cygwin. There are other comparable systems like MKS (all commercial, I believe), but to do a native Windows port, you would need to modify EMBOSS. Someone has posted to this list in the past few months about this, check the archives. > procedure: > ./configure --without-x CFLAGS=-s > make > make install > > --without-x because at one point the X11 library is required (even if > useless) and without this flag the compilation would stop. > CFLAGS=-s to make the binaries smaller. Cygwin does also provide X, though it's a big download if you don't otherwise need it. Can you generate graphics without X? I know that Cygwin provides libpng, for example, but I haven't investigated whether EMBOSS can use it. > 5) text files are different between windows and linux. If you save > (for ex.) emboss.default from, say, wordpad, EMBOSS programs parsing > this file won't be able to pass the first line and they will crash. > To overcome this, use notepad instead I think you might have this backwards. Wordpad can handle UNIX end-of-line characters, but notepad cannot. And Cygwin provides vi and emacs. :-) > 6) EMBOSS has then been built with cygwin. To use it from a ms-dos cmd > instead of the cygwin bash the cygwin1.dll has to be in your windows > PATH (ex: C:\windows\system32). Putting cygwin1.dll in your Windows path (e.g. C:\windows\system32) is *strongly discouraged* by the Cygwin folks. You end up with a Cygwin installation that cannot be maintained by the normal Cygwin Setup program. If you want to run EMBOSS programs from the Windows command line, then add C:\cygwin\bin to your Windows PATH somehow. (But why not use Cygwin bash if you've got it?) Regards, David From voltigeur at worldonline.ch Fri Jun 13 14:49:19 2003 From: voltigeur at worldonline.ch (voltigeur at worldonline.ch) Date: Fri, 13 Jun 2003 16:49:19 +0200 Subject: HowTo for compiling emboss under windows In-Reply-To: <3429-Fri13Jun2003131037+0100-david@starks-browning.com> Message-ID: <3EE5965600002593@mx2.tiscali.ch> Hello, >No, you cannot compile EMBOSS as distributed without a POSIX emulation >layer like Cygwin. There are other comparable systems like MKS (all >commercial, I believe), but to do a native Windows port, you would >need to modify EMBOSS. Someone has posted to this list in the past >few months about this, check the archives. Yes, that's what I was thinking about. >Cygwin does also provide X, though it's a big download if you don't >otherwise need it. Can you generate graphics without X? I know that >Cygwin provides libpng, for example, but I haven't investigated >whether EMBOSS can use it. Installing X was one of the things I did at first, but since X doesn't seem to be used (plplot looks to be more useful, with an optional png output), I prefered to go on without it. >I think you migh have this backwards. Wordpad can handle UNIX >end-of-line characters, but notepad cannot. And Cygwin provides vi >and emacs. :-) Yes, I've tried every text format available in notepad, wordpad and word with no luck. But I knew one of them was supposed to work. It seems I guessed the wrong one. I even tried xemacs (which is not part of cygwin) but wasn't courageous enough to try vi. >If you want to run EMBOSS programs from the Windows command line, >then add C:\cygwin\bin to your Windows PATH somehow. (But why not use >Cygwin bash if you've got it?) I changed the PATH but that did not work... After compiling jemboss I found out that when running jemboss, it was calling wossname to build the GUI and to get the list of all emboss programs available. Of course it was calling it the java-windows way (and not the cygwin way) and the result was a "missing cygwin1.dll library". Thanks for your remarks, Olivier Martin From kim at inb.uni-luebeck.de Fri Jun 13 15:31:11 2003 From: kim at inb.uni-luebeck.de (Jan T. Kim) Date: Fri, 13 Jun 2003 17:31:11 +0200 Subject: needle: Strictly global alignment? Message-ID: <20030613173111.G13445@pc10.inb.mu-luebeck.de> Dear EMBOSSers, it seems to me that the alignment computed by needle is not a global alignment in the strict sense of the term, because the terminal gaps are not penalized. As an example, the alignment of sequences seq1 to seq2 has the same score as the alignment seq1long to seq2 in the attached file. Some code delving (EMBOSS-2.6.0/nucleus/embaln.c, function embAlignPathCalc) indicates to me that no gap penalty is taken into account when the top row and the left column of the matrix are initialized, meaning that terminal gaps at the left border of the alignment will not be scored. In the literature, a global alignment in which terminal gaps are not scored is called a semiglobal alignment. If my analysis is correct, I suggest to change the documentation accordingly. In addition, it would be nice to extend the needle program such that a global alignment sensu stricto can be carried out. Kind regards, Jan T. Kim -- +- Jan T. Kim -------------------------------------------------------+ | *NEW* email: kim at inb.uni-luebeck.de | | *NEW* WWW: http://www.inb.uni-luebeck.de/staff/kim.html | *-----=< hierarchical systems are for files, not for humans >=-----* -------------- next part -------------- > seq1 ctgcctgt > seq1long actgcactaactgcctgtaactga > seq2 ctgcggctgt From pmr at ebi.ac.uk Fri Jun 13 15:58:52 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 13 Jun 2003 16:58:52 +0100 Subject: needle: Strictly global alignment? References: <20030613173111.G13445@pc10.inb.mu-luebeck.de> Message-ID: <3EE9F4BC.5030405@ebi.ac.uk> Jan T. Kim wrote: > Dear EMBOSSers, > > it seems to me that the alignment computed by needle is not a global > alignment in the strict sense of the term, because the terminal gaps > are not penalized. > > In the literature, a global alignment in which terminal gaps are not > scored is called a semiglobal alignment. > > If my analysis is correct, I suggest to change the documentation > accordingly. In addition, it would be nice to extend the needle program > such that a global alignment sensu stricto can be carried out. Sorry, but the literature from computer science and maths does not match reality for biological sequences. Remember that you have no information that either sequence is complete. In bioinformatics, a global alignment is one which spans the full extents of the input sequences (e.g. Baxevanis & Ouellette (2001) "Bioinformatics" 2nd edition p189. There is no biological reason to penalise terminal gaps. And of course, for many biological purposes, a local alignment is what makes sense. ... Though we could add terminal gaps as an option for those rare cases where it could be useful. I note that stretcher also does not score terminal gaps. Hope this helps, Peter From kim at inb.uni-luebeck.de Fri Jun 13 16:59:44 2003 From: kim at inb.uni-luebeck.de (Jan T. Kim) Date: Fri, 13 Jun 2003 18:59:44 +0200 Subject: needle: Strictly global alignment? In-Reply-To: <3EE9F4BC.5030405@ebi.ac.uk>; from pmr@ebi.ac.uk on Fri, Jun 13, 2003 at 04:58:52PM +0100 References: <20030613173111.G13445@pc10.inb.mu-luebeck.de> <3EE9F4BC.5030405@ebi.ac.uk> Message-ID: <20030613185944.H13445@pc10.inb.mu-luebeck.de> Hi Peter, thanks for your quick reply. On Fri, Jun 13, 2003 at 04:58:52PM +0100, Peter Rice wrote: > Jan T. Kim wrote: > > Dear EMBOSSers, > > > > it seems to me that the alignment computed by needle is not a global > > alignment in the strict sense of the term, because the terminal gaps > > are not penalized. > > > > In the literature, a global alignment in which terminal gaps are not > > scored is called a semiglobal alignment. > > > > If my analysis is correct, I suggest to change the documentation > > accordingly. In addition, it would be nice to extend the needle program > > such that a global alignment sensu stricto can be carried out. > > Sorry, but the literature from computer science and maths does not match > reality for biological sequences. > > Remember that you have no information that either sequence is complete. This may often be the case, but certainly not always. Protein sequences are normally complete. More generally, it is quite well possible to derive positional information delineating regions of homology from biology. Initiation and termination positions of transcription and translation, intron / exon borders, protein domains and RNA segments characterized by specific secondary structures are notable examples. Of course, if the sequence ends are not due to such biological information but due to cloning or other technical (and hence not biological) processes, gaps should clearly not be penalized. > In bioinformatics, a global alignment is one which spans the full > extents of the input sequences (e.g. Baxevanis & Ouellette (2001) > "Bioinformatics" 2nd edition p189. Ok, that's what I implicitly called "global alignment sensu lato". Perhaps unfortunately, some bioinformatics books (e.g. Setubal & Meidanis, 1997: "Introduction to Computational Molecular Biology", page 49ff) use the term "global alignment" to denote an alignment in which terminal gaps are scored, and refer to a global alignment with "free ends" as a "semiglobal alignment". When I suggested modifying the needle program documentation, I intended to make it easier for those who have read this definition to correctly understand what needle does. As it stands now, such people may end up looking for an EMBOSS program for computing a semiglobal alignment and not realizing that needle does this. Adding a notice, e.g. needle does not penalize terminal gaps. This type of alignment is (also) called a "semiglobal alignment" in the literature. would prevent such futile searches. > There is no biological reason to > penalise terminal gaps. > > And of course, for many biological purposes, a local alignment is what > makes sense. > ... Though we could add terminal gaps as an option for those rare cases > where it could be useful. I note that stretcher also does not score > terminal gaps. Ok, I'd put that on my wish list, and I also put it on my list of programming projects. While the modifications to implement this should be marginal, I will have to familiarize myself somewhat more with the EMBOSS code base and standards so I can do the modifications properly... Kind regards, Jan -- +- Jan T. Kim -------------------------------------------------------+ | *NEW* email: kim at inb.uni-luebeck.de | | *NEW* WWW: http://www.inb.uni-luebeck.de/staff/kim.html | *-----=< hierarchical systems are for files, not for humans >=-----* From obig at bcgsc.ca Fri Jun 13 19:52:22 2003 From: obig at bcgsc.ca (Obi Griffith) Date: Fri, 13 Jun 2003 12:52:22 -0700 Subject: diffseq problems Message-ID: <3EEA2B76.5020103@bcgsc.ca> I have been having two problems with your diffseq program. I am using command line diffseq from the EMBOSS-2.5.0 package. 1) using the -columns option doesn't have any effect on the output. ie. I can't get the nicely formatted tabular data promised: # Report of diffseq of: AF129756 and AP000504 # AF129756 overlap starts at 6036 # AP000504 overlap starts at 1 # (AF129756) start end length sequence (AP000504) start end length sequence 6882 6882 1 't' 847 847 1 'a' 7830 7830 1 'a' 1795 1795 1 'g' 8307 8307 0 '' 2273 2273 1 't' 8500 8500 1 'a' 2466 2466 1 'g' 8688 8688 0 '' 2655 2658 4 'tgtg' 2) I get the following errors: Find differences (SNPs) between nearly identical sequences Input sequence:AF129756 Second sequence:AP000504 Word size [10]: 2 Output report [1.diffseq]: Warning: bad /replace value 'T' Warning: bad /replace value 'C' Warning: bad /replace value 'C' Warning: bad /replace value 'T' Warning: bad /replace value 'C' Warning: bad /replace value 'GCCTT' Any idea what's going on here? Obi. From David.Bauer at SCHERING.DE Sat Jun 14 06:45:05 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Sat, 14 Jun 2003 08:45:05 +0200 Subject: Antwort: diffseq problems Message-ID: Hello Obi, these warnings only mean, that the emboss code which reads feature table informations complains about the /replace tag in variation. But this was fixed in later releases. I don't get these warnings in 2.7.1. Anyway, this should have no influence on the computation. The two sequences you give as examples are genomic contigs of 185 and 100 kilobases. Do you get any results out of diffseq? If not, this could be due to memory limitations. Emboss programs tend to do everything within physical RAM. 6 Gb on my machine is too small for this :-) David. 2) I get the following errors: Find differences (SNPs) between nearly identical sequences Input sequence:AF129756 Second sequence:AP000504 Word size [10]: 2 Output report [1.diffseq]: Warning: bad /replace value 'T' Warning: bad /replace value 'C' Warning: bad /replace value 'C' Warning: bad /replace value 'T' Warning: bad /replace value 'C' Warning: bad /replace value 'GCCTT' Any idea what's going on here? Obi. From pmr at ebi.ac.uk Sun Jun 15 12:11:51 2003 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Sun, 15 Jun 2003 13:11:51 +0100 (BST) Subject: diffseq problems In-Reply-To: <3EEA2B76.5020103@bcgsc.ca> References: <3EEA2B76.5020103@bcgsc.ca> Message-ID: <1098.217.134.232.120.1055679111.squirrel@webmail.ebi.ac.uk> > I have been having two problems with your diffseq program. I am using > command line diffseq from the EMBOSS-2.5.0 package. The replace message is fixed in the current release (and in 2.6.0 I believe) It is only a warning. The columns output is new since 2.5.0 - the EMBOSS web pages have the current development documentation. The documentation for each release is included in the distribution. Hope this helps, Peter Rice From gbottu at ben.vub.ac.be Mon Jun 16 08:48:15 2003 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Mon, 16 Jun 2003 10:48:15 +0200 (CEST) Subject: needle: Strictly global alignment? Message-ID: <200306160848.h5G8mFmN1358206@black.vub.ac.be> > From owner-emboss at hgmp.mrc.ac.uk Fri Jun 13 18:00:04 2003 > X-Original-To: emboss at embnet.org > Date: Fri, 13 Jun 2003 16:58:52 +0100 > From: Peter Rice > User-Agent: Mozilla/5.0 (Windows; U; Windows NT 5.0; en-US; rv:1.0.2) Gecko/20030208 Netscape/7.02 > ... Though we could add terminal gaps as an option for those rare cases > where it could be useful. I note that stretcher also does not score > terminal gaps. I did some testing and, if I am not wrong, stretcher DOES penalize terminal gaps. For the rest, I agree with Jan Kim that needle and stretcher should allow the choice between penalizing and not penalizing terminal gaps and that the documentation should be more clear about this. Guy Bottu, BEN From pmr at ebi.ac.uk Mon Jun 16 09:22:32 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 16 Jun 2003 10:22:32 +0100 Subject: needle: Strictly global alignment? References: <200306160848.h5G8mFmN1358206@black.vub.ac.be> Message-ID: <3EED8C58.8010401@ebi.ac.uk> Guy Bottu wrote: > I did some testing and, if I am not wrong, stretcher DOES penalize terminal > gaps. Oops. This does seem to be true. In that case, we do need to update the documentation, and provide the option to switch the terminal gap penalties on/off. We may need to consider changing the default behaviour of one of the programs too. Thanks for pointing it out. Peter From gtps5 at gtptech.com Tue Jun 17 13:49:37 2003 From: gtps5 at gtptech.com (Carole Louis) Date: 17 Jun 2003 15:49:37 +0200 Subject: How to use ajListPeek Message-ID: <1055857779.1357.56.camel@thym> Hi, I am programming in Emboss and it seems to be cool but I have a problem. I do not know why but I can not use the data type "ajListPeek". It is strange because I can use ajListPop (but that is not what I want). Is there a problem with this data type ? Moreover, I notice on the internet, at the adress http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Data/ajlist.html that there is the word "ajListstrPop" instead of the word "ajListstrPeek". Thanks, Carole from Toulouse, France PS : I would like ask this question on the developper list but I can not suscribe on it. -------------- next part -------------- An HTML attachment was scrubbed... URL: From pmr at ebi.ac.uk Tue Jun 17 13:55:40 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 17 Jun 2003 14:55:40 +0100 Subject: How to use ajListPeek References: <1055857779.1357.56.camel@thym> Message-ID: <3EEF1DDC.4090901@ebi.ac.uk> Carole Louis wrote: > I am programming in Emboss and it seems to be cool but I have a problem. > I do not know why but I can not use the data type "ajListPeek". It is > strange because I can use ajListPop (but that is not what I want). Is > there a problem with this data type ? ajListPeek should be fine. It is in the latest 2.7.1 EMBOSS release. ajListPeek and ajListstrPeek are both used in processing ACD files. You do need to be careful if you are copying ajListPop code - do not delete the list data if you only Peek because the real copy is on the list. You only clean up after you Pop it from the list. > Moreover, I notice on the internet, at the adress > http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Data/ajlist.html that > there is the word "ajListstrPop" instead of the word "ajListstrPeek". Hmmm ... we need to update the ajlist.html file then. The source code documentation (used to build the ajlist.html file) is correct. Hope this helps, Peter From gtps5 at gtptech.com Tue Jun 17 14:12:02 2003 From: gtps5 at gtptech.com (Carole Louis) Date: 17 Jun 2003 16:12:02 +0200 Subject: How to use ajListPeek In-Reply-To: <3EEF1DDC.4090901@ebi.ac.uk> References: <1055857779.1357.56.camel@thym> <3EEF1DDC.4090901@ebi.ac.uk> Message-ID: <1055859129.1357.70.camel@thym> OK. I'm using EMBOSS 2.6.0 and I think that is why I have some problems with ajListPeeK data type. Thanks Le mar 17/06/2003 ? 15:55, Peter Rice a ?crit : Carole Louis wrote: > I am programming in Emboss and it seems to be cool but I have a problem. > I do not know why but I can not use the data type "ajListPeek". It is > strange because I can use ajListPop (but that is not what I want). Is > there a problem with this data type ? ajListPeek should be fine. It is in the latest 2.7.1 EMBOSS release. ajListPeek and ajListstrPeek are both used in processing ACD files. You do need to be careful if you are copying ajListPop code - do not delete the list data if you only Peek because the real copy is on the list. You only clean up after you Pop it from the list. > Moreover, I notice on the internet, at the adress > http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Data/ajlist.html that > there is the word "ajListstrPop" instead of the word "ajListstrPeek". Hmmm ... we need to update the ajlist.html file then. The source code documentation (used to build the ajlist.html file) is correct. Hope this helps, Peter -------------- next part -------------- An HTML attachment was scrubbed... URL: From pmr at ebi.ac.uk Tue Jun 17 14:14:42 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 17 Jun 2003 15:14:42 +0100 Subject: How to use ajListPeek References: <1055857779.1357.56.camel@thym> <3EEF1DDC.4090901@ebi.ac.uk> <1055859129.1357.70.camel@thym> Message-ID: <3EEF2252.2020309@ebi.ac.uk> Carole Louis wrote: > OK. I'm using EMBOSS 2.6.0 and I think that is why I have some problems > with ajListPeeK data type. Yes - it was new (and very useful) for the ACD processing. With 2.6.0 you can Pop and Push back again. regards, Peter From gtps5 at gtptech.com Tue Jun 17 14:28:01 2003 From: gtps5 at gtptech.com (Carole Louis) Date: 17 Jun 2003 16:28:01 +0200 Subject: How to use ajListPeek In-Reply-To: <3EEF2252.2020309@ebi.ac.uk> References: <1055857779.1357.56.camel@thym> <3EEF1DDC.4090901@ebi.ac.uk> <1055859129.1357.70.camel@thym> <3EEF2252.2020309@ebi.ac.uk> Message-ID: <1055860087.1357.79.camel@thym> Can I easily release my emboss version 2.6.0 without reinstalling the entire emboss 2.7.1. version ? It is because I had some problems to install jemboss in server mode the first time and I am affraid to do it again.... :-( Le mar 17/06/2003 ? 16:14, Peter Rice a ?crit : Carole Louis wrote: > OK. I'm using EMBOSS 2.6.0 and I think that is why I have some problems > with ajListPeeK data type. Yes - it was new (and very useful) for the ACD processing. With 2.6.0 you can Pop and Push back again. regards, Peter -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.gatherer at vir.gla.ac.uk Wed Jun 18 13:16:32 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Wed, 18 Jun 2003 14:16:32 +0100 Subject: wossname Message-ID: <5.2.1.1.1.20030618141416.00aa1038@udcf.gla.ac.uk> Subject: wossname From: Kevin Battaile (battaile at mcw.edu) Date: Thu 05 Jun 2003 - 14:43:26 BST >I was installing 2.7.1 last night and noticed that 'wossname' seems to be >broken. Yes, I found this as well. _________________________ Derek Gatherer Ph.D. Cert.Ed. Computer Officer Institute of Virology Church St. Glasgow G11 5JR Phone: +44 141 330 6268 Fax: +44 141 337 2236 Email: d.gatherer at vir.gla.ac.uk Website: http://www.vir.gla.ac.uk From mbb8n at virginia.edu Wed Jun 18 15:13:35 2003 From: mbb8n at virginia.edu (Michael Black) Date: Wed, 18 Jun 2003 11:13:35 -0400 Subject: wossname In-Reply-To: <5.2.1.1.1.20030618141416.00aa1038@udcf.gla.ac.uk> Message-ID: <6E519076-A19F-11D7-985F-000393D1F330@virginia.edu> I installed 2.7.1 and standalone JemBoss on a DP PowerMac (OS X ver. 10.2.6) and a DP Linux node (RedHat) just last week, and wossname works fine for my installs. Do you get an error? _________________________________ Michael B. Black, Ph.D. Molecular Biology Computing Support Univ. of Virginia, ITC-ACHS PO Box 800555 Charlottesville, VA 22908-0555 voice: (434) 982-4039 fax: (434) 982-4030 mblack at virginia.edu _________________________________ On Wednesday, June 18, 2003, at 09:16 AM, Derek Gatherer wrote: > > Subject: wossname > From: Kevin Battaile > ( rel at post.its.mcw.edu&subject=Re:%20wossname>battaile at mcw.edu) > Date: Thu 05 Jun 2003 - 14:43:26 BST > > > >I was installing 2.7.1 last night and noticed that 'wossname' seems > to be > >broken. > > Yes, I found this as well. > > > _________________________ > > Derek Gatherer Ph.D. Cert.Ed. > Computer Officer > Institute of Virology > Church St. > Glasgow G11 5JR > > Phone: +44 141 330 6268 > Fax: +44 141 337 2236 > Email: d.gatherer at vir.gla.ac.uk > Website: http://www.vir.gla.ac.uk > > From d.gatherer at vir.gla.ac.uk Wed Jun 18 16:07:09 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Wed, 18 Jun 2003 17:07:09 +0100 Subject: Fwd: Re: wossname Message-ID: <5.2.1.1.1.20030618170634.00ab41f8@udcf.gla.ac.uk> > >No, no error at all, just zero output. I'm using 2.7.1 on a Tru64, with >w2h as a web front end and also via ordinary command line login after >telnetting from various PCs. Neither seems to work. All the other >applications are, as far as I can see, running fine. > >At 11:13 18/06/2003 -0400, Michael Black wrote: >>I installed 2.7.1 and standalone JemBoss on a DP PowerMac (OS X ver. >>10.2.6) and a DP Linux node (RedHat) just last week, and wossname works >>fine for my installs. Do you get an error? >> >>_________________________________ >>Michael B. Black, Ph.D. >>Molecular Biology Computing Support >>Univ. of Virginia, ITC-ACHS >>PO Box 800555 >>Charlottesville, VA >>22908-0555 >>voice: (434) 982-4039 >>fax: (434) 982-4030 >>mblack at virginia.edu >>_________________________________ >> >>On Wednesday, June 18, 2003, at 09:16 AM, Derek Gatherer wrote: >> >>> >>>Subject: wossname >>>From: Kevin Battaile >>>(>>rel at post.its.mcw.edu&subject=Re:%20wossname>battaile at mcw.edu) >>>Date: Thu 05 Jun 2003 - 14:43:26 BST >>> >>> >>> >I was installing 2.7.1 last night and noticed that 'wossname' seems >>>to be >>> >broken. >>> >>>Yes, I found this as well. >>> >>> >>>_________________________ >>> >>>Derek Gatherer Ph.D. Cert.Ed. >>>Computer Officer >>>Institute of Virology >>>Church St. >>>Glasgow G11 5JR >>> >>>Phone: +44 141 330 6268 >>>Fax: +44 141 337 2236 >>>Email: d.gatherer at vir.gla.ac.uk >>>Website: http://www.vir.gla.ac.uk _________________________ Derek Gatherer Ph.D. Cert.Ed. Computer Officer Institute of Virology Church St. Glasgow G11 5JR Phone: +44 141 330 6268 Fax: +44 141 337 2236 Email: d.gatherer at vir.gla.ac.uk Website: http://www.vir.gla.ac.uk From mccarthy at cs.usask.ca Wed Jun 18 16:22:58 2003 From: mccarthy at cs.usask.ca (Luke McCarthy) Date: 18 Jun 2003 10:22:58 -0600 Subject: Fwd: Re: wossname In-Reply-To: <5.2.1.1.1.20030618170634.00ab41f8@udcf.gla.ac.uk> References: <5.2.1.1.1.20030618170634.00ab41f8@udcf.gla.ac.uk> Message-ID: <1055953378.13777.26.camel@crazyharry.usask.ca> On Wed, 2003-06-18 at 10:07, Derek Gatherer wrote: > > > >No, no error at all, just zero output. I'm using 2.7.1 on a Tru64, with > >w2h as a web front end and also via ordinary command line login after > >telnetting from various PCs. Neither seems to work. All the other > >applications are, as far as I can see, running fine. Some time ago I found that wossname requires that the EMBOSS programs are in your path. This was true as recently as version 2.6.0 -- maybe it's still true now. Just something to check... Cheers, Luke -- Luke McCarthy Research Officer, Bioinformatics Department of Computer Science University of Saskatchewan mccarthy at cs.usask.ca From mbb8n at virginia.edu Wed Jun 18 18:21:17 2003 From: mbb8n at virginia.edu (Michael Black) Date: Wed, 18 Jun 2003 14:21:17 -0400 Subject: wossname In-Reply-To: <1055953378.13777.26.camel@crazyharry.usask.ca> Message-ID: True, on all my machines, the full path to ..../emboss-x.x.x/bin is in the users default path. _________________________________ Michael B. Black, Ph.D. Molecular Biology Computing Support Univ. of Virginia, ITC-ACHS Charlottesville, VA mblack at virginia.edu _________________________________ On Wednesday, June 18, 2003, at 12:22 PM, Luke McCarthy wrote: > On Wed, 2003-06-18 at 10:07, Derek Gatherer wrote: >>> >>> No, no error at all, just zero output. I'm using 2.7.1 on a Tru64, >>> with >>> w2h as a web front end and also via ordinary command line login after >>> telnetting from various PCs. Neither seems to work. All the other >>> applications are, as far as I can see, running fine. > > Some time ago I found that wossname requires that the EMBOSS programs > are in your path. This was true as recently as version 2.6.0 -- maybe > it's still true now. Just something to check... > > Cheers, > > Luke > -- > Luke McCarthy > Research Officer, Bioinformatics > Department of Computer Science > University of Saskatchewan > mccarthy at cs.usask.ca > > From d.gatherer at vir.gla.ac.uk Thu Jun 19 15:06:17 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Thu, 19 Jun 2003 16:06:17 +0100 Subject: wossname In-Reply-To: References: <1055953378.13777.26.camel@crazyharry.usask.ca> Message-ID: <5.2.1.1.1.20030619160218.00a7ab90@udcf.gla.ac.uk> Yes, that is the answer! Thanks to all 3 who suggested that. However, on w2h web front end, it still doesn't work (wossname doesn't, other EMBOSS applications seem to be fine) - but that's a w2h issue and probably belongs on a different mailing list. Cheers Derek At 14:21 18/06/2003 -0400, Michael Black wrote: >True, on all my machines, the full path to ..../emboss-x.x.x/bin is in the >users default path. > >_________________________________ >Michael B. Black, Ph.D. >Molecular Biology Computing Support >Univ. of Virginia, ITC-ACHS >Charlottesville, VA >mblack at virginia.edu >_________________________________ > >On Wednesday, June 18, 2003, at 12:22 PM, Luke McCarthy wrote: > >>On Wed, 2003-06-18 at 10:07, Derek Gatherer wrote: >>>> >>>>No, no error at all, just zero output. I'm using 2.7.1 on a Tru64, with >>>>w2h as a web front end and also via ordinary command line login after >>>>telnetting from various PCs. Neither seems to work. All the other >>>>applications are, as far as I can see, running fine. >> >>Some time ago I found that wossname requires that the EMBOSS programs >>are in your path. This was true as recently as version 2.6.0 -- maybe >>it's still true now. Just something to check... >> >>Cheers, >> >>Luke >>-- >>Luke McCarthy >>Research Officer, Bioinformatics >>Department of Computer Science >>University of Saskatchewan >>mccarthy at cs.usask.ca >> From pmr at ebi.ac.uk Fri Jun 20 09:08:15 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 20 Jun 2003 10:08:15 +0100 Subject: Fwd: Re: wossname References: <5.2.1.1.1.20030618170634.00ab41f8@udcf.gla.ac.uk> <1055953378.13777.26.camel@crazyharry.usask.ca> Message-ID: <3EF2CEFF.2040605@ebi.ac.uk> Luke McCarthy wrote: > Some time ago I found that wossname requires that the EMBOSS programs > are in your path. This was true as recently as version 2.6.0 -- maybe > it's still true now. Just something to check... True. wossname looks through the ACD files, but only reports applications that exist in the path. When you use ACDC to build and test ACD files you can accumulate extra ACD files that wossname has to ignore. Also, when you updata to a new EMBOSS release you can have old ACD files still installed. Hope this helps Peter From aengus.stewart at cancer.org.uk Mon Jun 23 10:44:21 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Mon, 23 Jun 2003 11:44:21 +0100 Subject: EMBL indexing strategy References: <1055953378.13777.26.camel@crazyharry.usask.ca> <5.2.1.1.1.20030619160218.00a7ab90@udcf.gla.ac.uk> Message-ID: <3EF6DA05.3DB4948A@cancer.org.uk> I am currently building the EMBL indexes and I was just wondering how other people organise them. I have no idea as yet what size entrynam.idx will end up being but I imagine the word "humungous" will apply. Do people index the sections ( EST, GSS, HUM, etc ) separately and follow Simon Andrews method of poviding an EMBL that is a composite of these sections or follow the lets index the bloody lot at one go route? Will there be any difference in the outcome either in admin terms or for the user? Regards Aengus -- ---------------------------------------------------------------------------- Aengus Stewart Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ---------------------------------------------------------------------------- From d.gatherer at vir.gla.ac.uk Mon Jun 23 15:40:27 2003 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Mon, 23 Jun 2003 16:40:27 +0100 Subject: automake after adding local code In-Reply-To: <3EF6DA05.3DB4948A@cancer.org.uk> References: <1055953378.13777.26.camel@crazyharry.usask.ca> <5.2.1.1.1.20030619160218.00a7ab90@udcf.gla.ac.uk> Message-ID: <5.2.1.1.1.20030623162810.00aaff38@udcf.gla.ac.uk> I have installed 2.7.1 on a Tru64 into a directory EMBOSS. I have added locally written code to the EMBOSS/emboss/ directory. Then I modified EMBOSS/emboss/Makefile.am as described on http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Develop/program.html section 3. I then ran automake from the EMBOSS directory. The message "required file: ./ltconfig not found" appeared, but Makefile.in seemed to be created in the right place. I then ran ./configure as usual, which was fine, various Makefiles were produced, and ./make. This produced a rapid crash with the output given below. Obviously I'm doing something wrong here. Am I running automake inappropriately? From the automake GNU documentation, it would appear that it only needs to be run once as there is only a single configure.in file. Output from ./make #make No suffix list. Making all in plplot Making all in lib No suffix list. cd ../.. && CONFIG_FILES=plplot/lib/Makefile CONFIG_HEADERS= /bin/ksh ./config.status config.status: creating plplot/lib/Makefile config.status: executing depfiles commands cd .. && CONFIG_FILES=plplot/Makefile CONFIG_HEADERS= /bin/ksh ./config.status config.status: creating plplot/Makefile config.status: executing depfiles commands /bin/ksh ../libtool --mode=compile cc -DPACKAGE_NAME=\"\" -DPACKAGE_TARNAME=\"\" -DPACKAGE_VERSION=\"\" -DPACKAGE_STRING=\"\" -DPACKAGE_BUGREPORT=\"\" -DPACKAGE=\"EMBOSS\" -DVERSION=\"2.7.1\" -DSTDC_HEADERS=1 -DHAVE_SYS_TYPES_H=1 -DHAVE_SYS_STAT_H=1 -DHAVE_STDLIB_H=1 -DHAVE_STRING_H=1 -DHAVE_MEMORY_H=1 -DHAVE_STRINGS_H=1 -DHAVE_INTTYPES_H=1 -DHAVE_UNISTD_H=1 -DHAVE_DLFCN_H=1 -DHAVE_DIRENT_H=1 -DSTDC_HEADERS=1 -DHAVE_UNISTD_H=1 -DGETPGRP_VOID=1 -DHAVE_STRFTIME=1 -DHAVE_UNISTD_H=1 -DHAVE_FORK=1 -DHAVE_VFORK=1 -DHAVE_WORKING_VFORK=1 -DHAVE_WORKING_FORK=1 -DHAVE_VPRINTF=1 -DHAVE_DOPRNT=1 -DHAVE_MEMMOVE=1 -DHAVE_LIBM=1 -I. -I. -I./ -I/usr/include/gd -DNO_AUTH -g -ieee -c sh: .deps/pdfutils.pp: cannot create *** Exit 1 Stop. *** Exit 1 Stop. *** Exit 1 Stop. From j.leunissen at cmbi.kun.nl Mon Jun 23 15:58:13 2003 From: j.leunissen at cmbi.kun.nl (Jack Leunissen) Date: Mon, 23 Jun 2003 17:58:13 +0200 Subject: EMBL indexing strategy In-Reply-To: <3EF6DA05.3DB4948A@cancer.org.uk> Message-ID: <001301c339a0$526afe00$3382e089@bioinf01> I index the whole lot in one go. This is what the files look like: -rw-r--r-- 1 jackl geninf 479077377 Jun 18 02:22 entrynam.idx -rw-r--r-- 1 jackl geninf 403886332 Jun 18 02:33 acnum.trg -rw-r--r-- 1 jackl geninf 101085912 Jun 18 02:33 acnum.hit So about 1GB in all. Not too bad, considering that the flatfiles are 120 GB, and the SRS indices amount to 37 GB. Cheers, Jack > -----Original Message----- > From: owner-emboss at hgmp.mrc.ac.uk > [mailto:owner-emboss at hgmp.mrc.ac.uk] On Behalf Of Aengus Stewart > Sent: Monday, June 23, 2003 12:44 PM > To: emboss at embnet.org > Subject: EMBL indexing strategy > > > > I am currently building the EMBL indexes and I was just wondering how > other people organise them. > > I have no idea as yet what size entrynam.idx will end up being but I > imagine the word "humungous" will apply. > > Do people index the sections ( EST, GSS, HUM, etc ) separately and > follow Simon Andrews method of poviding an EMBL that is a composite of > these sections or follow the lets index the bloody lot at one > go route? > > Will there be any difference in the outcome either in admin > terms or for > the user? > > > Regards > Aengus > > > -- > -------------------------------------------------------------- > -------------- > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, > WC2A 3PX, UK > -------------------------------------------------------------- > -------------- > From jrvalverde at cnb.uam.es Tue Jun 24 06:52:30 2003 From: jrvalverde at cnb.uam.es (José R. Valverde) Date: Tue, 24 Jun 2003 08:52:30 +0200 Subject: automake after adding local code In-Reply-To: <5.2.1.1.1.20030623162810.00aaff38@udcf.gla.ac.uk> References: <1055953378.13777.26.camel@crazyharry.usask.ca> <5.2.1.1.1.20030619160218.00a7ab90@udcf.gla.ac.uk> <5.2.1.1.1.20030623162810.00aaff38@udcf.gla.ac.uk> Message-ID: <20030624085230.359c106f.jrvalverde@cnb.uam.es> On Mon, 23 Jun 2003 16:40:27 +0100 Derek Gatherer wrote: > I have installed 2.7.1 on a Tru64 into a directory EMBOSS. I have added > locally written code to the EMBOSS/emboss/ directory. Then I modified > EMBOSS/emboss/Makefile.am as described on > http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Doc/Develop/program.html section 3. > > I then ran automake from the EMBOSS directory. The message "required file: > ./ltconfig not found" appeared, but Makefile.in seemed to be created in the > right place. I then ran ./configure as usual, which was fine, various > Makefiles were produced, and ./make. > One of two: either you didn't run "automake -a" (or --add-missing) or you have an inadequate config environment. You need to update your build tools. The error appears because you either don't have GNU libtool installed or it is an old version. I'd advise to sync all the "config" tools by updating them to the latest version (automake, autoconf, libtool...). j -- These opinions are mine and only mine. Hey man, I saw them first! Jos? R. Valverde De nada sirve la Inteligencia Artificial cuando falta la Natural From aml at ica.cc Tue Jun 24 16:47:32 2003 From: aml at ica.cc (American Laboratory) Date: Tue, 24 Jun 2003 12:47:32 -0400 Subject: Receive a free subscription to American Laboratory Message-ID: <20030624165421.7932C7D2AD@mercury.hgmp.mrc.ac.uk> THIS NOTICE IS FOR: Our Colleagues SUBJECT: Reminder - Your Subscription to American Laboratory Magazine WHAT DO YOU HAVE TO DO?: http://www.icainfo.com/aml/appintro_new.asp?NewAdd=YES&Priority=PEPAL2 DEADLINE: June 27, 2003 Your FREE subscription to American Laboratory Magazine is available with the next issue! Please take a moment now to submit your application. American Laboratory covers the disciplines of analytical and bioanalytical chemistry, drug discovery, laboratory software and informatics. Each issue features articles written by leading scientists from around the world reviewing applications of instrumentation and new measurement technology. I am most confident that you will enjoy our journal and will find it to be of significant professional value. Begin your complimentary subscription NOW, click http://www.icainfo.com/aml/appintro_new.asp?NewAdd=YES&Priority=PEPAL2 I look forward to hearing from you. Brian Howard, Ph.D. Editor International Scientific Communications, Inc. 30 Controls Drive, P.O. Box 870 Shelton, CT 06484 Tel.: 203-926-9300, Fax: 203-926-9310 iscpubs at iscpubs.com www.iscpubs.com -------------- next part -------------- An HTML attachment was scrubbed... URL: From wyan at fimmu.com Wed Jun 25 00:54:09 2003 From: wyan at fimmu.com (=?GB2312?Q?=CD=F5=D1=DE?=) Date: Wed, 25 Jun 2003 8:54:9 +0800 Subject: chips Message-ID: <20030625010148.8DA847D0EF@mercury.hgmp.mrc.ac.uk> Dear Sir, Does the software of emboss can be run on window computer? I want to use the chips(codon usage) program, how can I do it? Thanks for your reply! Best Regards! sincerely yours, Jenny The institute of molecular biology the first military medical university Tonghe Guangzhou 510515 China From gtps5 at gtptech.com Wed Jun 25 09:50:44 2003 From: gtps5 at gtptech.com (Carole Louis) Date: 25 Jun 2003 11:50:44 +0200 Subject: Programming in Emboss Message-ID: <1056534645.1428.18.camel@thym> Hi, I am programming in Emboss but I do not understand why the buckle number 2 (see it in red) does not work. The problem is that the program does not pass by the buckle in red. Is it impossible to have two imbricated buckles or there is another problem ? I do not find the answer to my answer so, can someone help me, please ..... :-( Carole This is the code : //S?lection des meilleurs couples ajint compteur2 = 0; iterList3 = ajListIter(ListCoupleInit); // parcours liste couple avec score iterList4 = ajListIter(BestCouple); // liste contenant meilleurs couples ajint nbreBestCouple2 = 0; nbreBestCouple2 = ajListLength(BestCouple); ajFmtPrintF(outf,"\n nbre de meilleurs couples 2 : %d \n", nbreBestCouple2); //remplissage liste BestCouple while (ajListIterMore(iterList3)) { ajFmtPrintF(outf,"\n Boucle 1 \n"); res3 = (CoupleOlig) ajListIterNext(iterList3); ajint nbreBestCouple3 = 0; nbreBestCouple3 = ajListLength(BestCouple); ajFmtPrintF(outf,"\n nbre de meilleurs couples 3 : %d \n", nbreBestCouple3); if (compteur2 == 0) { ajFmtPrintF(outf,"\n Boucle 3 \n"); ajListPush(BestCouple, (void *) res3); ajFmtPrintF(outf,"\n Boucle 5 \n"); } compteur2 ++; while (ajListIterMore(iterList4)) { ajFmtPrintF(outf,"\n Boucle 2 \n"); res4 = (CoupleOlig) ajListIterNext(iterList4); if (res3->score <= res4->score) { ajFmtPrintF(outf,"\n Boucle 4 \n"); ajListInsert(iterList4, (void*) res3); } } } ajint nbreBestCouple = 0; nbreBestCouple = ajListLength(BestCouple); ajFmtPrintF(outf,"\n nbre de meilleurs couples : %d \n", nbreBestCouple); -------------- next part -------------- An HTML attachment was scrubbed... URL: From mad at biol.unlp.edu.ar Wed Jun 25 16:31:22 2003 From: mad at biol.unlp.edu.ar (=?ISO-8859-1?Q?Mart=EDn_Sarachu?=) Date: Wed, 25 Jun 2003 13:31:22 -0300 Subject: embossdata bug? Message-ID: <3EF9CE5A.10604@biol.unlp.edu.ar> Hi EMBOSSers, I could not retrieve a file under the PRINTS directory with embossdata, tough the example worked ok. Here are the steps I followed: 1) the example in embossdata docs (tfm) works ok > $ embossdata -filename EPAM60 > Finds or fetches the data files read in by the EMBOSS programs > # The following directories can contain EMBOSS data files. > # They are searched in the following order until the file is found. > # If the directory does not exist, then this is noted below. > # '.' is the UNIX name for your current working directory. > > File ./EPAM60 Exists > File .embossdata/EPAM60 Does not exist > File /root/EPAM60 Does not exist > File /root/.embossdata/EPAM60 Does not exist > File /usr/local/emboss/share/EMBOSS/data/EPAM60 Exists > $ embossdata -fetch -filename EPAM60 > Finds or fetches the data files read in by the EMBOSS programs > File '/usr/local/emboss/share/EMBOSS/data/EPAM60' has been copied successfully. 2) but trying to fetch a PRINTS file fails > $ embossdata -filename 'PRINTS/PR00420' > Finds or fetches the data files read in by the EMBOSS programs > # The following directories can contain EMBOSS data files. > # They are searched in the following order until the file is found. > # If the directory does not exist, then this is noted below. > # '.' is the UNIX name for your current working directory. > > File ./PRINTS/PR00420 Does not exist > File .embossdata/PRINTS/PR00420 Does not exist > File /root/PRINTS/PR00420 Does not exist > File /root/.embossdata/PRINTS/PR00420 Does not exist > File /usr/local/emboss/share/EMBOSS/data//PRINTS/PR00420 Exists > $ embossdata -fetch -filename 'PRINTS/PR00420' > Finds or fetches the data files read in by the EMBOSS programs > > EMBOSS An error in embossdata.c at line 112: > The file 'PRINTS/PR00420' does not exist. > $ embossdata -fetch -filename PR00420 > Finds or fetches the data files read in by the EMBOSS programs > > EMBOSS An error in embossdata.c at line 112: > The file 'PR00420' does not exist. EMBOSS is version 2.6.0 Regards, martin -- Mart?n Sarachu mad at biol.unlp.edu.ar EMBNet Argentina http://www.ar.embnet.org From support at ancestry.com Wed Jun 25 22:31:43 2003 From: support at ancestry.com (support at ancestry.com) Date: Wed, 25 Jun 2003 16:31:43 -0600 (MDT) Subject: Application Message-ID: <3EFA22CF.000003.10210@utilnj01.int.rightnowtech.com> --------------------------------------------------------------- Thank you for your email. PLEASE NOTE: This is no longer a valid Technical Support email address and will not reach Customer Solutions. Any reply to this message will not receive a personalized response. To email Customer Solutions please use the Contact Form at the following URL: http://ancestry.custhelp.com/cgi-bin/ancestry.cfg/php/enduser/ask.php? You can also access this Contact Form at any time by simply using the "Email Ancestry Support" tab which appears on every page of the "Ask Ancestry" Knowledge Base. To access the Knowledge Base from any page of our website, simply click on the "?" tab at the upper right of the screen. In addition to our Contact Form, the "Ask Ancestry" Knowledge Base contains over 350 questions and answers which you can access in real time, thus not having to wait for an email response. Thank you, Ancestry.com Question --------------------------------------------------------------- Please see the attached zip file for details. ==================== application File Attachment ==================== your_details.zip, 82195 bytes, added to incident -------------- next part -------------- An HTML attachment was scrubbed... URL: From andre.blavier at caissedesdepots.fr Thu Jun 26 09:42:53 2003 From: andre.blavier at caissedesdepots.fr (=?utf-8?Q?=22Blavier=2C_Andr=C3=A9=22?=) Date: Thu, 26 Jun 2003 11:42:53 +0200 Subject: chips Message-ID: Maybe you can give a try to my Windows port at http://perso.wanadoo.fr/ablavier/embosswin/embosswin.html -- Andr? Blavier > -----Message d'origine----- > De?: wyan at fimmu.com [mailto:wyan at fimmu.com] > Envoy??: mercredi 25 juin 2003 02:00 > ??: emboss at embnet.org > Objet?: chips > > > Dear Sir, > Does the software of emboss can be run on window > computer? I want to use the chips(codon usage) program, how > can I do it? Thanks for your reply! > Best Regards! > sincerely yours, > Jenny > The institute of molecular biology > the first military medical university > Tonghe Guangzhou 510515 > China > > > > From David.Bauer at SCHERING.DE Fri Jun 27 09:15:10 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Fri, 27 Jun 2003 11:15:10 +0200 Subject: digest, other enzymes Message-ID: Hello, I was asked by one of our users if it is possible to add recognition sites for Thrombin and 2 other proteases to digest. After looking a bit at the program I found that the recognition sites are hard coded in embmol.c and embprop.c Would it be possible to move them to a data file so one could add and change protease cleavage recognition sites (preferably in fuzzpro style) without having to change the code ? Thanks, David. From fbrosnan at berkley.ie Mon Jun 30 11:01:06 2003 From: fbrosnan at berkley.ie (Fergal Brosnan) Date: Mon, 30 Jun 2003 12:01:06 +0100 Subject: 2 Development roles in Ireland Message-ID: <361CD6509615834DBAD9C3B08ED2F309033EFD@SERVERCORK.Berkleycork.net> Hi All, We are currently recruiting 2 people, on a Bioinfo Developer with OO experience & the other a Statistical Developer to join a client Software company that focuses on the R&D sector of Pharma /Biotech. For more details contact me, Fergal, on +353 21 4559099. Rgds Fergal Fergal Brosnan, Berkley Recruitment, Ferryboat House, 1 lower Glanmire Rd, Cork, Ireland www.berkley.ie email:fbrosnan at berkley.ie Tel: 00353 21 4559090 Fax: 00353 21 4559095 -------------- next part -------------- An HTML attachment was scrubbed... URL: From voltigeur at worldonline.ch Mon Jun 30 14:22:31 2003 From: voltigeur at worldonline.ch (voltigeur at worldonline.ch) Date: Mon, 30 Jun 2003 16:22:31 +0200 Subject: HowTo for compiling (j)emboss under windows(tm) Message-ID: <3EFAF5E300001A77@mx2.tiscali.ch> Hello, At the end of this mail you will find the full version of my HowTo for compiling (j)embos under windows. The emboss part was modified according to the remarks, and the jemboss part should be error-free (but surely not the fastest or best way of compiling, at least it works). Remarks, bug-reports are welcome, Olivier Martin EMBOSS: 1) install cygwin (http://www.cygwin.com). That's surely possible to compile without it, but it's making everything easier. You'll have to install the base part plus the devel/make and devel/gcc packages. Before installing, see the first line of 2). Then you'll have a linux-like command-line with tools like gcc and make. The paths are then made according to the place where you installed cygwin (ex: c\cygwin becomes /). 2) cygwin (and EMBOSS, and other linux/unix programs) don't like empty spaces in names. Be sure that you install everything in places without empty spaces (avoid "C:\Program Files\"). But by default cygwin uses your windows login (something like "FirstName LastName") to create the /home/user_folder. Find and edit the /etc/passwd file and rename "FirstName LastName" into "FirstName_LastName" (or whatever else). 3) quit and restart the cygwin bash (you'll start in your "FirstName_LastName" directory, you can delete "FirstName LastName"), download the EMBOSS package and cd to the place where you uncompressed it. Follow the usual procedure: ./configure --without-x CFLAGS=-s make make install --without-x because at one point the X11 library is required (even if useless) and without this flag the compilation would stop. CFLAGS=-s to make the binaries smaller. 4) you can now use the EMBOSS programs from the cygwin bash like you usually do from linux (but have a look at 5) and 6) before). 5) text files are different between windows and linux. If you save (for ex.) emboss.default from, say, notepad, EMBOSS programs parsing this file won't be able to pass the first line and they will crash. To overcome this, use wordpad instead, or convert the file to linux format (various tools are available on internet, it's a common problem). 6) EMBOSS has then been built with cygwin. To use it from a ms-dos cmd instead of the cygwin bash the cygwin1.dll has to be in your windows PATH (since moving the .dll is discouraged, add another entry to the PATH variable). JEMBOSS (standalone version): I assume you start with EMBOSS already installed (see previous part). Running the install script as described in the webpages of EMBOSS would also take care of EMBOSS as well as JEMBOSS, but on my computer that led to errors in the make process (missing includes). I did not try to solve them (my goal was to make it work, not to debug everything. That shouldn't be too difficult, though). The remarks made in the EMBOSS part are still relevant. 1) install the java2 sdk in a place without empty spaces (i.e. don't use "C:\Program Files"). 2) modify the Makefile.am file from the jemboss directory: change the "javac org/emboss/jemboss/Jemboss.java" into "javac -classpath `cygpath -wp $CLASSPATH` org/emboss/jemboss/Jemboss.java" at both places in the "all-local" part. See "http://www.inonit.com/cygwin/faq/" for an explanation. 3) modify the install-server-jemboss.sh script located in the jemboss/utils directory. As in 2), change the "javac..." lines (four of them). Change also the "$JAVA_HOME/bin/jar cvf $JEMBOSS/resources/wossname.jar wossname.out" into "$JAVA_HOME/bin/jar cvf `cygpath -w $JEMBOSS/resources/wossname.jar` wossname.out" 4) using the cygwin setup.exe, install devel/automake and devel/libtool (that will also install other packages automatically). 5) run aclocal in the emboss directory. This will allow the various scripts to take into account the changes made to the Makefile.am. 6) run the install script (install-jemboss-server.sh) as described in the jemboss webpage. Warning: the default location for installation is not the same as for the emboss installation. Change it or you'll have binaries everywhere. 7) for some reason, the runJemboss.csh is incorrect (and there is no csh under cygwin so it wouldn't work anyway). You have to change it so that it will look like this: #!/bin/bash LD_LIBRARY_PATH="/usr/local/lib"; CLASSPATH="/usr/local/share/EMBOSS/jemboss/lib/soap.jar:/usr/local/share/EMBOSS/jemboss/lib/xerces.jar:/usr/local/share/EMBOSS/jemboss/lib/mail.jar:/usr/local/share/EMBOSS/jemboss/lib/activation.jar:/usr/local/share/EMBOSS/jemboss/lib/jakarta-regexp-1.2.jar:/usr/local/share/EMBOSS/jemboss/lib/jalview.jar:/usr/local/share/EMBOSS/jemboss/lib/jcert.jar:/usr/local/share/EMBOSS/jemboss/lib/jnet.jar:/usr/local/share/EMBOSS/jemboss/lib/jsse.jar:."; (cd /usr/local/share/EMBOSS/jemboss; java -classpath `cygpath -wp $CLASSPATH` org/emboss/jemboss/Jemboss local &) 8) check that your jemboss.properties is correct. Especially the paths must begin with /cygwin/, or emboss will search in C:\usr\local\... PS: for a reason that I can't understand, jemboss is searching for the binaries in a wrong place (for me /usr/local/share/EMBOSS/jemboss/PATH). As I was in lack of wise solutions, I simply moved the binaries to this place. There are smarter solutions, though. PPS: this procedure should also apply to the server-client version of jemboss (not tested), as long as you take care of the various pitfalls (i.e. using cygpath, not using paths with empty spaces,...).