From aengus.stewart at cancer.org.uk Fri Aug 1 10:05:36 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Fri, 01 Aug 2003 15:05:36 +0100 Subject: [EMBOSS] Q: HMMER in EMBASSY References: <002201c34c71$80014c50$494de780@CIT.NIH.GOV> <3F16B5F4.6010602@ebi.ac.uk> Message-ID: <3F2A73B0.F9723489@cancer.org.uk> How do native versions of programs relate to EMBASSY versions? The reason for my question is of course that the HMMER package is currently at 2.3.1 but within EMBASSY it is 2.1.1 Regards Aengus From ableasby at hgmp.mrc.ac.uk Fri Aug 1 11:29:57 2003 From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk) Date: Fri, 1 Aug 2003 16:29:57 +0100 (BST) Subject: [EMBOSS] Q: HMMER in EMBASSY Message-ID: <200308011529.h71FTuK03979@bromine.hgmp.mrc.ac.uk> The same versions should have the same functionality. HMMER currently lags behind the native version since Sean decided to change his file format handling from Stockholm to Pfam format. That is one of many reasons why a new indexing system is being developed for EMBOSS. An updated version of PHYLIP has been added to the CVS version of the source tree and is undergoing testing before that is released as an EMBASSY package. HTH Alan From aengus.stewart at cancer.org.uk Mon Aug 4 13:56:44 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Mon, 04 Aug 2003 18:56:44 +0100 Subject: [EMBOSS] JEMBOSS/tomcat 4.1.27/IRIX prob References: <002201c34c71$80014c50$494de780@CIT.NIH.GOV> <3F16B5F4.6010602@ebi.ac.uk> <3F2A73B0.F9723489@cancer.org.uk> Message-ID: <3F2E9E5C.C7568720@cancer.org.uk> Hi, By sheer coincidence I have been building JEMBOSS today with tomcat 4.1.27 and I eventually found your new install-jemboss-server.sh script. It didnt like running on IRIX falling over at the checking for incs/libs for png/gd/zlib. This is due to the locations used on IRIX and also because sometimes ( in the case of png ) they are soft-links rather than files so test -f fails. The libs are often in /usr/freeware/lib32 or /usr/freeware/lib64 rather than in $DIR/lib. I did a bit of editting to the install-jemboss-server.sh script to get it past the check_libs section and then when prompted to add anything else to the end of the configure options added my CC CFLAGS LDFLAGS.......etc........ Cheers Aengus From perseus at bioinformatics.ubc.ca Tue Aug 5 20:50:56 2003 From: perseus at bioinformatics.ubc.ca (Perseus Missirlis) Date: Tue, 05 Aug 2003 17:50:56 -0700 Subject: [EMBOSS] cpgplot %cg plots Message-ID: <510564b960.4b96051056@cmmt.ubc.ca> Hello, The graphical output of cpgplot includes Obs/Exp, %GC, CpG islands. However, text output of this information is limited to the CpG islands. I looked for parameter specifications allowing text output of Obs/Exp and %GC but to no avail. Can anyone assist me with this problem? Thanks, +----------------------------------+ | Perseus Missirlis | | Bioinformatics Graduate Student | | UBC Bioinformatics Centre (UBiC) | | Vancouver, BC, Canada | | http://bioinformatics.ubc.ca | +----------------------------------+ From perseus at bioinformatics.ubc.ca Tue Aug 5 20:50:56 2003 From: perseus at bioinformatics.ubc.ca (Perseus Missirlis) Date: Tue, 05 Aug 2003 17:50:56 -0700 Subject: [EMBOSS] cpgplot %cg plots Message-ID: <510564b960.4b96051056@cmmt.ubc.ca> Hello, The graphical output of cpgplot includes Obs/Exp, %GC, CpG islands. However, text output of this information is limited to the CpG islands. I looked for parameter specifications allowing text output of Obs/Exp and %GC but to no avail. Can anyone assist me with this problem? Thanks, +----------------------------------+ | Perseus Missirlis | | Bioinformatics Graduate Student | | UBC Bioinformatics Centre (UBiC) | | Vancouver, BC, Canada | | http://bioinformatics.ubc.ca | +----------------------------------+ From pemberaj at pugh.bip.bham.ac.uk Wed Aug 6 09:01:40 2003 From: pemberaj at pugh.bip.bham.ac.uk (Tony Pemberton) Date: Wed, 6 Aug 2003 14:01:40 +0100 Subject: [EMBOSS] sort from dbiflat In-Reply-To: <200301211830.SAA25776@bromine.hgmp.mrc.ac.uk> References: <200301211830.SAA25776@bromine.hgmp.mrc.ac.uk> Message-ID: Dear emboss users, I am currently running dbiflat on EMBL 75.0 and the sort stage is taking a very long time - been running for 5 days under Red Hat Linux 9.0 dual processor Athlon (1.7 GHz) 2Gb memory. Can anyone tell me if this is "normal"? Regards, Tony Pemberton ********************************************************************* Mr. A.J.Pemberton Tel: +121-414-3388 c/o Dept. Rheumatology, Fax: +121-414-6794 Medical School, E-mail: A.J.Pemberton at bham.ac.uk The University of Birmingham, Birmingham B15 2TT. U.K. ********************************************************************* From henrikki.almusa at helsinki.fi Thu Aug 7 07:48:24 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Thu, 7 Aug 2003 14:48:24 +0300 Subject: [EMBOSS] Q: HMMER in EMBASSY In-Reply-To: <200308011529.h71FTuK03979@bromine.hgmp.mrc.ac.uk> References: <200308011529.h71FTuK03979@bromine.hgmp.mrc.ac.uk> Message-ID: <200308071448.24634.henrikki.almusa@helsinki.fi> On Friday 01 August 2003 18:29, ableasby at hgmp.mrc.ac.uk wrote: > The same versions should have the same functionality. HMMER currently > lags behind the native version since Sean decided to change his > file format handling from Stockholm to Pfam format. That is one > of many reasons why a new indexing system is being developed for > EMBOSS. > > An updated version of PHYLIP has been added to the CVS version > of the source tree and is undergoing testing before that is > released as an EMBASSY package. Any idea long might this testing last? I'd be instrested with newer version of phylip. TIA -- Henrikki Almusa From ableasby at hgmp.mrc.ac.uk Thu Aug 7 09:32:23 2003 From: ableasby at hgmp.mrc.ac.uk (Alan Bleasby) Date: Thu, 7 Aug 2003 14:32:23 +0100 (BST) Subject: [EMBOSS] Q: HMMER in EMBASSY Message-ID: <200308071332.h77DWNQC008474@bromine.hgmp.mrc.ac.uk> It cannot be supplied as a package for the current stable release of EMBOSS as it relies on new datatypes that have only been added (to ACD) in the development (CVS) version. We've yet to discuss when the next release will be but I'd guess at a couple of months. Brgds Alan From maoj at mail.nih.gov Fri Aug 8 08:24:36 2003 From: maoj at mail.nih.gov (Jean Mao) Date: Fri, 8 Aug 2003 08:24:36 -0400 Subject: [EMBOSS] Question about Emma using emboss-GUI Message-ID: <104101c35da8$0812e210$494de780@CIT.NIH.GOV> Hi, I installed the Emboss-GUI and are testing it. I got an error message when I tried emma using the GUI web interface. The error message says: EMBOSS An error in ajsys.c at line 360: cannot find program 'clustalw' emma exited with status 1... However, I got no error when I tried emma on the command line. Would you help me? Thank you very much. ------------------------------------------------------------------- Jean Mao Helix Systems Bldg 12B, Rm 2N207 National Institutes of Health Bethesda, MD 20895 Email:maoj at helix.nih.gov ------------------------------------------------------------------ -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030808/b07e7483/attachment.html From tcarver at hgmp.mrc.ac.uk Fri Aug 8 08:30:58 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Fri, 8 Aug 2003 13:30:58 +0100 (BST) Subject: [EMBOSS] Question about Emma using emboss-GUI In-Reply-To: <104101c35da8$0812e210$494de780@CIT.NIH.GOV> Message-ID: Hi Jean Which EMBOSS-GUI are you testing? If you are using Jemboss you will need to add the path to clustalw to the jemboss.properties file (in $EMBOSS-INSTALL/share/EMBOSS/jemboss). The format of this file is described at: http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Jemboss/install/properties.html -so add it to the embossPath variable and if you are using a client-server installation re-start tomcat with the 'tomstart' script provided. Regards Tim Carver HGMP-RC On Fri, 8 Aug 2003, Jean Mao wrote: > Hi, > I installed the Emboss-GUI and are testing it. I got an error message when I tried emma using the GUI web interface. The error message says: > EMBOSS An error in ajsys.c at line 360: cannot find program 'clustalw' emma exited with status 1... > However, I got no error when I tried emma on the command line. Would you help me? Thank you very much. > > ------------------------------------------------------------------- > Jean Mao > Helix Systems > Bldg 12B, Rm 2N207 > National Institutes of Health > Bethesda, MD 20895 > Email:maoj at helix.nih.gov > ------------------------------------------------------------------ From matiasovicj at vfu.cz Fri Aug 8 10:01:18 2003 From: matiasovicj at vfu.cz (Jan Matiasovic) Date: Fri, 8 Aug 2003 16:01:18 +0200 Subject: [EMBOSS] diffrential restriction program Message-ID: <200308081601.18243.matiasovicj@vfu.cz> Hallo Emboss. I am looking for program which is able to find restriction endonuclease making different digestion on similar sequences. I do not know Emboss well, but I do not found this program in this package. Example: I have three alleles of horse DQA. I use Emboss restrict for all alleles and outputs compare using shell program diff. This show me I am able resolve this three alleles using Mnl I digestion. For three alleles it is piece of cake, but large number of allels generate a lot of diff?s outputs. Is program doing similar work available? I do not know programming, so I am not able to write any piece of code :(. Thank you for your answer. Jan Matiasovic PhD. University of Veterinary and Pharmaceutical Sciences Brno Department of Animal Genetics Czech Republic From mccarthy at cs.usask.ca Fri Aug 8 12:40:12 2003 From: mccarthy at cs.usask.ca (Luke McCarthy) Date: 08 Aug 2003 10:40:12 -0600 Subject: [EMBOSS] Question about Emma using emboss-GUI In-Reply-To: <104101c35da8$0812e210$494de780@CIT.NIH.GOV> References: <104101c35da8$0812e210$494de780@CIT.NIH.GOV> Message-ID: <1060360812.15285.11.camel@crazyharry.usask.ca> On Fri, 2003-08-08 at 06:24, Jean Mao wrote: > Hi, > I installed the Emboss-GUI and are testing it. I got an error message > when I tried emma using the GUI web interface. The error message says: > EMBOSS An error in ajsys.c at line 360: cannot find program 'clustalw' > emma exited with status 1... > However, I got no error when I tried emma on the command line. Would > you help me? Thank you very much. If you are using my EMBOSS::GUI, it is very likely that clustalw is not in the GUI's path. For security reasons, the GUI assumes a very strict path: normally just the directory containing the EMBOSS binaries and /bin (because one of the EMBOSS programs requires ls...) If this is the problem, there are a couple of solutions: first, you can link or move clustalw to the same directory as the rest of the EMBOSS binaries; second, you can add the directory containing clustalw to the GUI's path. If you decide to go the second route, you'll have to edit the GUI.pm module in a minor way, so email me off-list and I'll give you directions. In most situations, however, the first way is easier by far. Cheers, Luke -- Luke McCarthy Research Officer, Bioinformatics Department of Computer Science University of Saskatchewan mccarthy at cs.usask.ca From maoj at mail.nih.gov Mon Aug 11 10:59:33 2003 From: maoj at mail.nih.gov (Jean Mao) Date: Mon, 11 Aug 2003 10:59:33 -0400 Subject: [EMBOSS] question about emma Message-ID: <12e601c36019$2d024c00$494de780@CIT.NIH.GOV> Hi, We just installed emboss and found the default output format of emma is fasta. How can I change the default output to GCG-msf format? Thanks. Jean -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030811/15947b36/attachment.html From henrikki.almusa at helsinki.fi Tue Aug 12 01:32:19 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Tue, 12 Aug 2003 08:32:19 +0300 Subject: [EMBOSS] question about emma In-Reply-To: <12e601c36019$2d024c00$494de780@CIT.NIH.GOV> References: <12e601c36019$2d024c00$494de780@CIT.NIH.GOV> Message-ID: <200308120832.19585.henrikki.almusa@helsinki.fi> On Monday 11 August 2003 17:59, Jean Mao wrote: > Hi, We just installed emboss and found the default output format of emma is > fasta. How can I change the default output to GCG-msf format? Thanks. > > Jean Use option "-osformat msf". In http://www.emboss.org there is listing for all options in each program in link applications. Also there is a listing for all possible formats (reports, sequences etc) in user documetation. They might be a good place to find more information. -- Henrikki Almusa From kim at inb.uni-luebeck.de Tue Aug 12 06:01:57 2003 From: kim at inb.uni-luebeck.de (Jan T. Kim) Date: Tue, 12 Aug 2003 12:01:57 +0200 Subject: [EMBOSS] question about emma In-Reply-To: <200308120832.19585.henrikki.almusa@helsinki.fi>; from henrikki.almusa@helsinki.fi on Tue, Aug 12, 2003 at 08:32:19AM +0300 References: <12e601c36019$2d024c00$494de780@CIT.NIH.GOV> <200308120832.19585.henrikki.almusa@helsinki.fi> Message-ID: <20030812120157.A15726@pc10.inb.mu-luebeck.de> On Tue, Aug 12, 2003 at 08:32:19AM +0300, Henrikki Almusa wrote: > On Monday 11 August 2003 17:59, Jean Mao wrote: > > Hi, We just installed emboss and found the default output format of emma is > > fasta. How can I change the default output to GCG-msf format? Thanks. > > > > Jean > > Use option "-osformat msf". > > In http://www.emboss.org there is listing for all options in each program in > link applications. Also there is a listing for all possible formats (reports, > sequences etc) in user documetation. They might be a good place to find more > information. This is correct, but perhaps not exactly what Jean was looking for. At least, my understanding of a "default option" is that it takes effect without being explicitly specified. I used to achieve this effect by means of aliases, e.g. by putting alias emma='emma -osformat msf' into my ~/.bashrc file, but eventually, my need for such defaults decreased as I increasingly adopted the habit of putting together shell scripts that automate the analyses I'm interested in. However, I've been thinking from time to time that it would sometimes be handy to have a way to specify defaults for the EMBOSS programs, e.g. by means of an environment variable or a dotfile. Have I overlooked this? For example, it might be very convenient at times to change the default format for sequence output from FASTA to something which can accomodate more annotation information. Greetings from Luebeck, Jan -- +- Jan T. Kim -------------------------------------------------------+ | *NEW* email: kim at inb.uni-luebeck.de | | *NEW* WWW: http://www.inb.uni-luebeck.de/staff/kim.html | *-----=< hierarchical systems are for files, not for humans >=-----* From d.m.a.martin at dundee.ac.uk Tue Aug 12 06:11:42 2003 From: d.m.a.martin at dundee.ac.uk (David Martin) Date: Tue, 12 Aug 2003 11:11:42 +0100 Subject: [EMBOSS] question about emma In-Reply-To: <20030812120157.A15726@pc10.inb.mu-luebeck.de> Message-ID: On 12/8/03 11:01 am, "Jan T. Kim" wrote: > However, I've been thinking from time to time that it would sometimes > be handy to have a way to specify defaults for the EMBOSS programs, > e.g. by means of an environment variable or a dotfile. Have I overlooked > this? For example, it might be very convenient at times to change the > default format for sequence output from FASTA to something which > can accomodate more annotation information. If you read the administration guide, such default settings and how to override them are clearly documented. This has been in EMBOSS since 1.0.0 or earlier. The admin guide can be found on the emboss web site under the admin and setup section. ..d -- David Martin PhD Bioinformatics Scientific Officer Post-Genomics and Molecular Interactions Centre University of Dundee From d.m.a.martin at dundee.ac.uk Tue Aug 12 06:11:42 2003 From: d.m.a.martin at dundee.ac.uk (David Martin) Date: Tue, 12 Aug 2003 11:11:42 +0100 Subject: [EMBOSS] question about emma In-Reply-To: <20030812120157.A15726@pc10.inb.mu-luebeck.de> Message-ID: On 12/8/03 11:01 am, "Jan T. Kim" wrote: > However, I've been thinking from time to time that it would sometimes > be handy to have a way to specify defaults for the EMBOSS programs, > e.g. by means of an environment variable or a dotfile. Have I overlooked > this? For example, it might be very convenient at times to change the > default format for sequence output from FASTA to something which > can accomodate more annotation information. If you read the administration guide, such default settings and how to override them are clearly documented. This has been in EMBOSS since 1.0.0 or earlier. The admin guide can be found on the emboss web site under the admin and setup section. .d -- David Martin PhD Bioinformatics Scientific Officer Post-Genomics and Molecular Interactions Centre University of Dundee From henrikki.almusa at helsinki.fi Tue Aug 12 06:42:45 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Tue, 12 Aug 2003 13:42:45 +0300 Subject: [EMBOSS] question about emma Message-ID: <200308121342.45852.henrikki.almusa@helsinki.fi> On Tuesday 12 August 2003 13:11, David Martin wrote: > On 12/8/03 11:01 am, "Jan T. Kim" wrote: > > However, I've been thinking from time to time that it would sometimes > > be handy to have a way to specify defaults for the EMBOSS programs, > > e.g. by means of an environment variable or a dotfile. Have I overlooked > > this? For example, it might be very convenient at times to change the > > default format for sequence output from FASTA to something which > > can accomodate more annotation information. > > If you read the administration guide, such default settings and how to > override them are clearly documented. This has been in EMBOSS since 1.0.0 > or earlier. > > The admin guide can be found on the emboss web site under the admin and > setup section. I assume you mean "set emboss_output gcg" in either "~/.embossrc" or "emboss.default". That changes all the programs in emboss and not just one. I don't think there is program specific version of this (correct me if i'm wrong though). Anyone that can code might try to include setting like "set emboss_[program_name]_output gcg" in some future version? -- Henrikki Almusa From David.Bauer at SCHERING.DE Tue Aug 12 06:48:50 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Tue, 12 Aug 2003 12:48:50 +0200 Subject: [EMBOSS] question about emma Message-ID: That's correct but I think Jan is looking for something different. The current configuration options (.embossrc etc.) control mostly functions which are common to all programs (output format, stdout, auto etc.) But if one wants to change the default behaviour of a particular program the only way I see now is to creat an alternative set of acd files with these settings. Let's say I want to have matcher output always with -aformat markx2 and 3 alternatives. It would be convenient to have some kind of sections in .embossrc for programs similar to the DB sections: PROG matcher [ aformat: markx2 alternatives: 3 ] Cheers, David. On 12/8/03 11:01 am, "Jan T. Kim" wrote: > However, I've been thinking from time to time that it would sometimes > be handy to have a way to specify defaults for the EMBOSS programs, > e.g. by means of an environment variable or a dotfile. Have I overlooked > this? For example, it might be very convenient at times to change the > default format for sequence output from FASTA to something which > can accomodate more annotation information. If you read the administration guide, such default settings and how to override them are clearly documented. This has been in EMBOSS since 1.0.0 or earlier. The admin guide can be found on the emboss web site under the admin and setup section. ..d -- David Martin PhD Bioinformatics Scientific Officer Post-Genomics and Molecular Interactions Centre University of Dundee From siegmund at develogen.com Tue Aug 12 10:19:21 2003 From: siegmund at develogen.com (Thomas Siegmund) Date: Tue, 12 Aug 2003 16:19:21 +0200 Subject: [EMBOSS] ANNOUNCE: Kaptain GUI for EMBOSS Message-ID: <200308121619.21030.siegmund@develogen.com> Hello everybody, a new version of the Kaptain GUI for EMBOSS is finished. As far as I know, support for EMBOSS 2.71 is complete. Please correct me if I'm wrong. Due to some changed command line attributes in EMBOSS this version of the GUI will work only with EMBOSS >= 2.70. Download as usual at http://userpage.fu-berlin.de/~sgmd/download.html MacOS X users might want to wait until the latest version (0.92) arrives at the fink repository. Thanks to Koen van der Drift there is an easy to install package at http://fink.sourceforge.net/pdb/package.php/emboss-kaptain Recent changelog entries: Version 0.92 Support for EMBOSS 2.71 is complete !! - added tcode.kaptn Version 0.91 - redesign of showseq.kaptn to support all new showseq features - describe qualifier for extractfeat.kaptn - equivalences option for rebaseextract.kaptn - solofragment qualifier for restrict.kaptn - prefer qualifier for megamerger.kaptn - context qualifier for sirna.kaptn - tolower qualifier for maskseq.kaptn and maskfeat.kaptn - default output directory can be set in embosslauncher - clean option for transeq.kaptn - msf -> sequence in infoalign.kaptn - sequencea -> sequence in pepstats.kaptn, pepwindow.kaptn, iep.kaptn digest.kaptn, garnier.kaptn, - sequence(a,b) -> (a,b)sequence in dottup.kaptn, dotmatcher.kaptn, dotpath.kaptn, stretcher.kaptn - inseqs -> sequence in emma.kaptn - seq(a,b) -> (a,b)sequence in merger.kaptn, megamerger.kaptn Thanks to Koen van der Drift for bugreports Version 0.90 - small kaptain.071-fix for showseq.kaptn - mini-fix for getorf.kaptn: standard genetic code is "0", not "1". - "-stdout" was missing in infoalign.kaptn and infoseq.kaptn. Now "show" works. - sequencea -> asequence in needle.kaptn, water.kaptn, matcher.kaptn (EMBOSS 2.7) - fname -> infile in abiview.kaptn (EMBOSS 2.7) Have fun Thomas -- Thomas Siegmund, Ph.D. DeveloGen AG Bioinformatics and Data Management Phone: +49(551) 505 58 651 E-Mails k?nnen unvollst From aengus.stewart at cancer.org.uk Tue Aug 12 15:11:43 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Tue, 12 Aug 2003 20:11:43 +0100 Subject: [EMBOSS] JEMBOSS login prob References: <002201c34c71$80014c50$494de780@CIT.NIH.GOV> <3F16B5F4.6010602@ebi.ac.uk> <3F2A73B0.F9723489@cancer.org.uk> <3F2E9E5C.C7568720@cancer.org.uk> Message-ID: <3F393BEF.C404AEFA@cancer.org.uk> Hi, I am running the jemboss client at the command line ( runJemboss.csh ) and I am having problems whenever attempting to select "Local and remote files". I get the following in a java dialogue box "Login to server failed please check your login details" at the command line I get "Exception in PrivateRequest Authentication Failed" and in the log file catalina.out I get "Failed Authorisation aengus STDERR java_pipe_read timeout java_rcv error Pipe Recv error 1" What makes it strange it that it accepts the username and password on login. Tomcat is stopped and started using tomstop/tomstart and run by user tomcat deploy.csh was run on the command line. I am guessing this is a permissions problem but havent a clue which file needs changing. Help! Cheers Aengus From tcarver at hgmp.mrc.ac.uk Tue Aug 12 15:28:01 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Tue, 12 Aug 2003 20:28:01 +0100 (BST) Subject: [EMBOSS] JEMBOSS login prob In-Reply-To: <3F393BEF.C404AEFA@cancer.org.uk> Message-ID: Hi Aengus I am guessing that you cannot run any of the EMBOSS applications as well? Or can you run embossversion via the interface for example? You should check that as root you have changed the permissions on: chown root $EMBOSS_INSTALL/bin/jembossctl chmod u+s $EMBOSS_INSTALL/bin/jembossctl Btw, why did you need to run deploy.csh? Did the services not get deployed with the install script? Tim > Hi, > > I am running the jemboss client at the command line ( runJemboss.csh ) > and I am having problems whenever attempting to select "Local and remote > files". > > I get the following in a java dialogue box > > "Login to server failed > please check your login details" > > at the command line I get > "Exception in PrivateRequest Authentication Failed" > > and in the log file catalina.out I get > "Failed Authorisation aengus > STDERR java_pipe_read timeout > java_rcv error > Pipe Recv error 1" > > What makes it strange it that it accepts the username and password on > login. > > > Tomcat is stopped and started using tomstop/tomstart and run by user > tomcat > > deploy.csh was run on the command line. > > I am guessing this is a permissions problem but havent a clue which file > needs changing. > > Help! > > > Cheers > Aengus > From aengus.stewart at cancer.org.uk Tue Aug 12 15:40:47 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Tue, 12 Aug 2003 20:40:47 +0100 Subject: [EMBOSS] JEMBOSS login prob References: Message-ID: <3F3942BF.14656401@cancer.org.uk> "Dr T. Carver" wrote: > > Hi Aengus > > I am guessing that you cannot run any of the EMBOSS applications as well? > Or can you run embossversion via the interface for example? You are absolutely correct - nothing works ( *groan* ) > You should check that as root you have changed the permissions on: > > chown root $EMBOSS_INSTALL/bin/jembossctl > chmod u+s $EMBOSS_INSTALL/bin/jembossctl > Yup I had done that - it has permissions as follows 152 -rwsr-xr-x 1 root cgal 77312 Aug 12 18:27 jembossctl > Btw, why did you need to run deploy.csh? Did the services not get deployed > with the install script? > Its a long story. Basically we are getting a new server and there is no way in a million years the sysadmin team will let me be root. Also probably being "tomcat" is out. Therefore I was attempting to discover on my own machine what bits of the install I can do and what requires user tomcat and root - so I could go to the sysadmins with a breakdown of what I had to do and what they had to do. Hence I was changing the permissions on /usr/java2/tomcat/webapps and /usr/java2/tomcat/shared and then running the script as myself this all worked file apart from the deployment was of course failing. I was then switching to user tomcat and running tomstop tomstart deploy.csh tomstop tomstart runJemboss.csh It all seemed to work fine apart from the small detail that it doesnt work! Aengus -- ---------------------------------------------------------------------------- Aengus Stewart Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ---------------------------------------------------------------------------- From tcarver at hgmp.mrc.ac.uk Tue Aug 12 15:57:01 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Tue, 12 Aug 2003 20:57:01 +0100 (BST) Subject: [EMBOSS] JEMBOSS login prob In-Reply-To: <3F3942BF.14656401@cancer.org.uk> Message-ID: Hmmm. Did you give the install script the correct UID then (i.e. tomcat uid and not yours)? You can double check what it is by looking in EMBOSS-2.x.x/config.status to see what it was set as (-DTOMCAT_UID). They will not let you have a non-priveleged 'tomcat' a/c on your new machine? All they would need to do is change the permissions on 'jembossctl' for you then! Tim On Tue, 12 Aug 2003, Aengus Stewart wrote: > "Dr T. Carver" wrote: > > > > Hi Aengus > > > > I am guessing that you cannot run any of the EMBOSS applications as well? > > Or can you run embossversion via the interface for example? > > You are absolutely correct - nothing works ( *groan* ) > > > You should check that as root you have changed the permissions on: > > > > chown root $EMBOSS_INSTALL/bin/jembossctl > > chmod u+s $EMBOSS_INSTALL/bin/jembossctl > > > > Yup I had done that - it has permissions as follows > > 152 -rwsr-xr-x 1 root cgal 77312 Aug 12 18:27 jembossctl > > > > Btw, why did you need to run deploy.csh? Did the services not get deployed > > with the install script? > > > > Its a long story. > > Basically we are getting a new server and there is no way in a million > years the sysadmin team will let me be root. > Also probably being "tomcat" is out. > > Therefore I was attempting to discover on my own machine what bits of > the install I can do and what requires user tomcat and root - so I could > go to the sysadmins with a breakdown of what I had to do and what they > had to do. > > Hence I was changing the permissions on /usr/java2/tomcat/webapps and > /usr/java2/tomcat/shared and then running the script as myself this all > worked file apart from the deployment was of course failing. > > I was then switching to user tomcat and running > > tomstop > tomstart > deploy.csh > tomstop > tomstart > runJemboss.csh > > It all seemed to work fine apart from the small detail that it doesnt > work! > > > Aengus > > -- > ---------------------------------------------------------------------------- > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK > ---------------------------------------------------------------------------- > From aengus.stewart at cancer.org.uk Tue Aug 12 16:06:24 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Tue, 12 Aug 2003 21:06:24 +0100 Subject: [EMBOSS] JEMBOSS login prob References: Message-ID: <3F3948C0.319AED0F@cancer.org.uk> "Dr T. Carver" wrote: > > Hmmm. Did you give the install script the correct UID then (i.e. tomcat > uid and not yours)? You can double check what it is by looking in > EMBOSS-2.x.x/config.status to see what it was set as (-DTOMCAT_UID). > I have Checked that it is correct from config.status with options \"'--with-java=/usr/java2/include/' '--with-javaos=/usr/java2/include//irix' '--with-thread=irix' '--prefix=/usr/local/mbsoftware/emboss' '--with-auth=shadow' '--with-pngdriver=/usr/freeware' 'CC=cc -DTOMCAT_UID=60003 ' 'LDFLAGS=-L/usr/freeware/lib32 -L/usr/freeware/lib'\" from /etc/passwd tomcat:x:60003:60003:Tomcat tiddly mouse:/usr/people/tomcat:/bin/ksh > They will not let you have a non-priveleged 'tomcat' a/c on your new > machine? All they would need to do is change the permissions on > 'jembossctl' for you then! > I imagine this could be negotiated but as this service will be externally available ( though authenticated ) they will nail down what is available by the web. However if it cant be fixed as it is then at least I have these emails to convince them with! Thanks for the help Tim. Cheers Aengus -- ---------------------------------------------------------------------------- Aengus Stewart Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ---------------------------------------------------------------------------- From kvddrift at earthlink.net Tue Aug 12 17:28:29 2003 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 12 Aug 2003 17:28:29 -0400 Subject: [EMBOSS] ANNOUNCE: Kaptain GUI for EMBOSS In-Reply-To: <200308121619.21030.siegmund@develogen.com> Message-ID: On Tuesday, August 12, 2003, at 10:19 AM, Thomas Siegmund wrote: > MacOS X users might want to wait until the latest version (0.92) > arrives at > the fink repository. Thanks to Koen van der Drift there is an easy to > install > package at > http://fink.sourceforge.net/pdb/package.php/emboss-kaptain > All credit of course goes to Thomas for maing the scripts! I just made a fink package to install them on Mac OS X. Note that this version of the scripts (0.92) has been submitted to fink, but is not yet added to the tree, so the current version available through fink is 0.90. I hope the fink team will add it asap. thanks, - Koen. From David.Bauer at SCHERING.DE Wed Aug 13 05:10:39 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Wed, 13 Aug 2003 11:10:39 +0200 Subject: [EMBOSS] pepwindow graphical output Message-ID: Hello, with pepwindow it is now possible to use alternative aa property scales from the aaindex database. But the plot always has the title: "Kyte-Doolitle Plot". Would it be possible to take the "D" line from the datafile as plot title ? Thanks, David. From emb at TOM.COM Thu Aug 14 19:38:41 2003 From: emb at TOM.COM (Shigeru Bower) Date: Thu, 14 Aug 2003 23:38:41 GMT Subject: [EMBOSS] teletypesetting Message-ID: An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030814/d8cf2850/attachment.html From aengus.stewart at cancer.org.uk Fri Aug 15 06:30:36 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Fri, 15 Aug 2003 11:30:36 +0100 Subject: [EMBOSS] -inf stdin printsextract problem? References: Message-ID: <3F3CB64C.46D33AB6@cancer.org.uk> Hi, This is with 2.7.1 Apollo>gunzip -c prints37_0.dat.gz | printsextract -inf stdin Extract data from PRINTS EMBOSS An error in printsextract.c at line 410: Premature EOF If I uncompress the dat file and then do printsextract prints37_0.dat Extract data from PRINTS It runs OK. I checked it with 2.6.0 And I get Extract data from PRINTS EMBOSS An error in printsextract.c at line 448: Premature EOF Cheers Aengus From David.Bauer at SCHERING.DE Mon Aug 18 01:43:22 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Mon, 18 Aug 2003 07:43:22 +0200 Subject: [EMBOSS] GDE Message-ID: Hello, has anybody tried to convert ACD to GDEmenus ? Cheers, David. From aengus.stewart at cancer.org.uk Tue Aug 19 11:16:40 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Tue, 19 Aug 2003 16:16:40 +0100 Subject: [EMBOSS] Jemboss 1.1 signed files References: Message-ID: <3F423F58.1E7F805E@cancer.org.uk> Hi, I was wondering how to take the 1.1.zip and create signed files so I can put them in my webserver tree. I imagined it was just a case of taking the jar files and replacing the old versions in /share/EMBOSS/jemboss/lib [axis] with the new ones and then running makeJNLP.sh again? However I am left with the two new files grout.jar JembossPrintAlignment.jar What do I do with them? -- ---------------------------------------------------------------------------- Aengus Stewart Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ---------------------------------------------------------------------------- From tcarver at hgmp.mrc.ac.uk Tue Aug 19 11:41:28 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Tue, 19 Aug 2003 16:41:28 +0100 (BST) Subject: [EMBOSS] Jemboss 1.1 signed files In-Reply-To: <3F423F58.1E7F805E@cancer.org.uk> Message-ID: The Jemboss-1.1.zip provided is specific to the HGMP-RC Jemboss server and contains for example the 'jemboss.properties' for the HGMP site. This zip is intended for users at the HGMP that are running the GUI as an alternative to Java Web Start. There are other differences that you have noted that means 'makeJNLP.sh' also has changed. This is all available in the CVS download but I recommend sticking with Jemboss-1.0 until the next release of EMBOSS. Hope this helps Tim > Hi, > > I was wondering how to take the 1.1.zip and create signed files so I can > put them in my webserver tree. > > I imagined it was just a case of taking the jar files and replacing the > old versions in > > /share/EMBOSS/jemboss/lib [axis] with the new ones and then running > makeJNLP.sh again? > > However I am left with the two new files > > grout.jar > JembossPrintAlignment.jar > > What do I do with them? > > > > > -- > ---------------------------------------------------------------------------- > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK > ---------------------------------------------------------------------------- > From aengus.stewart at cancer.org.uk Tue Aug 19 13:26:53 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Tue, 19 Aug 2003 18:26:53 +0100 Subject: [EMBOSS] Notes about emma References: Message-ID: <3F425DDD.F257D3A@cancer.org.uk> Hi, Some queries about emma emma -help -verbose gives the following section "-outseq" related qualifiers -osformat2 string Output seq format -osextension2 string File name extension -osname2 string Base file name -osdirectory2 string Output directory -osdbname2 string Database name to add -ossingle2 boolean Separate file for each entry -oufo2 string UFO features -offormat2 string Features format -ofname2 string Features file name -ofdirectory2 string Output directory "-dendoutfile" related qualifiers -odirectory3 string Output directory Though at the command line emma -osformat clustal or emma -osformat2 clustal or emma -osf clustal seem to work just as well. -osformat2 seems to be a red herring? Slightly more worrying is the clustal format header which the above commands put in the .aln file CLUSTAL W(1.4) multiple sequence alignment I have just trawled the system and the only clustalw on it is from 1.82 If I run it as clustalw I get the correct CLUSTAL W (1.82) multiple sequence alignment Cheers Aengus From pmr at ebi.ac.uk Wed Aug 20 05:53:44 2003 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Wed, 20 Aug 2003 10:53:44 +0100 (BST) Subject: [EMBOSS] Notes about emma In-Reply-To: <3F425DDD.F257D3A@cancer.org.uk> References: <3F425DDD.F257D3A@cancer.org.uk> Message-ID: <1142.217.134.66.24.1061373224.squirrel@webmail.ebi.ac.uk> Hi Aengus, > Some queries about emma > > Though at the command line > emma -osformat clustal > or > emma -osformat2 clustal > or > emma -osf clustal > seem to work just as well. > > -osformat2 seems to be a red herring? All these names are valid. EMBOSS accepts any unambiguous short qualifier names, so -osformat can naturally be reduced to -osf. The '2' is to allow several -osformat associated qualifiers to have unique names. Without the '2' -osformat refers to the current outseq, or to all outseqs. > Slightly more worrying is the clustal format header which the above > commands put in the .aln file > > CLUSTAL W(1.4) multiple sequence alignment EMBOSS rewrites the ALN file as a general ALN format. The version number is part of the EMBOSS 'clustal' format specification, and has no relation to the clustal version used by emma. Hope this helps, Peter From kmr at sanger.ac.uk Wed Aug 20 09:28:30 2003 From: kmr at sanger.ac.uk (Kim Rutherford) Date: Wed, 20 Aug 2003 14:28:30 +0100 Subject: [EMBOSS] Problem writing sequence files Message-ID: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> Hi. I'm trying to write a sequence to a named file. I tried this: AjPFile seqout_file = ajFileNewOut(seqout_name); AjPSeqout named_seqout = ajSeqoutNewF(seqout_file); AjPStr format_str = ajStrNew(); ajStrAssC(&format_str, "embl"); ajSeqOutSetFormat(named_seqout, format_str); ajSeqWrite(named_seqout, subseq); I get a segmentation fault and this backtrace: #0 0x1200b27a0 in ajFmtPrintF (file=0x0, fmt=0x1400172ce "ID %-10.10S standard; DNA; UNC; %d BP.\n") at ajfmt.c:1118 #1 0x12008c6a4 in seqWriteEmbl (outseq=0x140057840) at ajseqwrite.c:1956 #2 0x120087ae4 in ajSeqWrite (outseq=0x140057840, seq=0x140057700) at ajseqwrite.c:540 #3 0x120019c10 in splitter_write (default_seqout=0x140057ac0, subseq=0x140057700, start=0, end=1139, seq=0x140048f00, seqout_name=0x14008b4a0) at splitter.c:179 #4 0x120019dd8 in splitter_ProcessChunk (seqout=0x140057ac0, seq=0x140048f00, start=0, end=1139, outseq_name=0x14008b4a0) at splitter.c:207 #5 0x120019844 in main (argc=4, argv=0x11fffc018) at splitter.c:87 It appears that named_seqout->File is null and ajSeqWrite() is expecting it to be non-null. Should I be calling a function other than ajSeqoutNewF() to create the AjPSeqout object (ie. named_seqout)? I'd appreciate if someone could let me know what I'm doing wrong or point me to some example code that does something similar. Thanks in advance, Kim. From aengus.stewart at cancer.org.uk Wed Aug 20 12:50:37 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Wed, 20 Aug 2003 17:50:37 +0100 Subject: [EMBOSS] Testing as if user - Antigenic References: <3F425DDD.F257D3A@cancer.org.uk> <1142.217.134.66.24.1061373224.squirrel@webmail.ebi.ac.uk> Message-ID: <3F43A6DC.ACB9258F@cancer.org.uk> Hi, I am going through the software attempting to test it as if I was a user ie doing the things I shouldnt. I have just given antigenic a DNA seq rather than a PROT seq and it gives at first glance what appears to be a reasonable result file. ######################################## # Program: antigenic # Rundate: Wed Aug 20 17:49:57 2003 # Report_format: motif # Report_file: btmg.dna.antigenic ######################################## #======================================= # # Sequence: BTMG from: 1 to: 1077 # HitCount: 35 #======================================= Max_score_pos at "*" (1) Score 1.362 length 48 at bases 519->566 * Sequence: CTTCCATGGCTAAGCCCCACCCCTGTGCCCCTCACCCCACCCACCTGG | | 519 566 (2) Score 1.335 length 30 at bases 10->39 * Sequence: GAGACAGACACCCAGTCAGTCCCGCCCTTG | | 10 39 It has recognised that the file was DNA rather than PROT as it has bases rather than residues in the headers. However having detected that the sequence is DNA should it run at all? Aengus From kmr at sanger.ac.uk Thu Aug 21 07:22:34 2003 From: kmr at sanger.ac.uk (Kim Rutherford) Date: Thu, 21 Aug 2003 12:22:34 +0100 Subject: [EMBOSS] Re: Problem writing sequence files In-Reply-To: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> Message-ID: <16196.43898.864303.718746@pcs2b.internal.sanger.ac.uk> On Wed, 20 Aug 2003 14:28:30 +0100, Kim Rutherford wrote: > Hi. I'm trying to write a sequence to a named file. I tried this: > AjPFile seqout_file = ajFileNewOut(seqout_name); > AjPSeqout named_seqout = ajSeqoutNewF(seqout_file); > AjPStr format_str = ajStrNew(); > ajStrAssC(&format_str, "embl"); > ajSeqOutSetFormat(named_seqout, format_str); > ajSeqWrite(named_seqout, subseq); > I get a segmentation fault ... I've realised that I don't need to do any of this in my application, I just need to add -ossingle to the command line to get the functionality I need. Sorry for the waste of time. Kim. From aengus.stewart at cancer.org.uk Thu Aug 21 12:12:40 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Thu, 21 Aug 2003 17:12:40 +0100 Subject: [EMBOSS] change to entret? References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> <16196.43898.864303.718746@pcs2b.internal.sanger.ac.uk> Message-ID: <3F44EF78.6BA9E7C2@cancer.org.uk> Hi The documentation says that entret will not return sequence from a GCG formatted database. It seems to returning the documentation and sequence in 2.7.1 This is very nice. Aengus From pmr at ebi.ac.uk Thu Aug 21 12:22:08 2003 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 21 Aug 2003 17:22:08 +0100 (BST) Subject: [EMBOSS] change to entret? In-Reply-To: <3F44EF78.6BA9E7C2@cancer.org.uk> References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> <16196.43898.864303.718746@pcs2b.internal.sanger.ac.uk> <3F44EF78.6BA9E7C2@cancer.org.uk> Message-ID: <1170.217.134.90.57.1061482928.squirrel@webmail.ebi.ac.uk> Hi Aengus, > The documentation says that entret will not return sequence from a GCG > formatted database. > > It seems to returning the documentation and sequence in 2.7.1 > > This is very nice. Thanks. We will update the documentation. Entret depends on the database access method and format parsing storing the entire text. When reading a GCG formatted database EMBOSS has to generate the sequence from the binary encoding. It now converts this into a sequence in a reasonable format when text is saved (i.e. when entret is being run). regards, Peter Rice From pmr at ebi.ac.uk Thu Aug 21 12:22:08 2003 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 21 Aug 2003 17:22:08 +0100 (BST) Subject: [EMBOSS] change to entret? In-Reply-To: <3F44EF78.6BA9E7C2@cancer.org.uk> References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> <16196.43898.864303.718746@pcs2b.internal.sanger.ac.uk> <3F44EF78.6BA9E7C2@cancer.org.uk> Message-ID: <1170.217.134.90.57.1061482928.squirrel@webmail.ebi.ac.uk> Hi Aengus, > The documentation says that entret will not return sequence from a GCG > formatted database. > > It seems to returning the documentation and sequence in 2.7.1 > > This is very nice. Thanks. We will update the documentation. Entret depends on the database access method and format parsing storing the entire text. When reading a GCG formatted database EMBOSS has to generate the sequence from the binary encoding. It now converts this into a sequence in a reasonable format when text is saved (i.e. when entret is being run). regards, Peter Rice From triciavelazquez_cg at catseye.mb.ca Thu Aug 21 13:36:21 2003 From: triciavelazquez_cg at catseye.mb.ca (Tricia Velazquez) Date: Thu, 21 Aug 2003 21:36:21 +0400 Subject: [EMBOSS] Remembe=?iso-8859-1?B?ciB0aGE=?=t lady? Message-ID: <784101c3680a$67946435$2f264fd5@ohn26f2> -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030821/3daf95f3/attachment.html From aengus.stewart at cancer.org.uk Thu Aug 21 13:36:37 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Thu, 21 Aug 2003 18:36:37 +0100 Subject: [EMBOSS] seqret jemboss comment References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> <16196.43898.864303.718746@pcs2b.internal.sanger.ac.uk> <3F44EF78.6BA9E7C2@cancer.org.uk> <1170.217.134.90.57.1061482928.squirrel@webmail.ebi.ac.uk> Message-ID: <3F450325.DCF19A52@cancer.org.uk> Hi, I have noticed that seqret is confusing for the users. You specify start and end reverse etc in the input sequence attribute and the output format in the output sequence attributes. The users tend to see all of these as output options and they get confused as they dont think they are inputting anything. Aengus -- ---------------------------------------------------------------------------- Aengus Stewart Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ---------------------------------------------------------------------------- From tcarver at hgmp.mrc.ac.uk Fri Aug 22 06:50:07 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Fri, 22 Aug 2003 11:50:07 +0100 (BST) Subject: [EMBOSS] seqret jemboss comment In-Reply-To: <3F450325.DCF19A52@cancer.org.uk> Message-ID: I guess the point is these options in emboss are seen as common operations on the input sequences. It just happens that the input sequence in seqret is the output sequence. I don't think this should change the GUI as it is a common concept throughout the programs but maybe should be made clear in the help documentation (that we are working on) for Jemboss. Tim On Thu, 21 Aug 2003, Aengus Stewart wrote: > > Hi, > > I have noticed that seqret is confusing for the users. > > You specify start and end reverse etc in the input sequence attribute > and the output format in the output sequence attributes. The users tend > to see all of these as output options and they get confused as they dont > think they are inputting anything. > > > > Aengus > > -- > ---------------------------------------------------------------------------- > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK > ---------------------------------------------------------------------------- > From urbe at liverpool.ac.uk Fri Aug 22 08:48:00 2003 From: urbe at liverpool.ac.uk (Sylvie =?iso-8859-1?Q?Urb=E9?=) Date: Fri, 22 Aug 2003 13:48:00 +0100 Subject: No subject Message-ID: Does EMBOSS contain an application that allows introduction of new restrictionsites as silent mutations in a given ORF? -- Sylvie Urb?, PhD The Physiological Laboratory University of Liverpool Crown Street Liverpool L69 3BX Phone: 0151 794 5432 (office) 0151 794 5729 (lab) Fax: 0151 794 4434 From simon.andrews at bbsrc.ac.uk Fri Aug 22 08:45:45 2003 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Fri, 22 Aug 2003 13:45:45 +0100 Subject: [EMBOSS] RE: Silent Mutations Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28B31@bi-exsrv1.iapc.bbsrc.ac.uk> > -----Original Message----- > From: Sylvie Urb? [mailto:urbe at liverpool.ac.uk] > Sent: 22 August 2003 13:48 > To: emboss at embnet.org > Subject: > > > Does EMBOSS contain an application that allows > introduction of new restrictionsites as silent > mutations in a given ORF? If you're not sure of the name of an EMBOSS program to perform a specific task (or even if one exists at all), you can use the wossname program to search for it. In this case: $ wossname mutation Finds programs by keywords in their one-line documentation SEARCH FOR 'MUTATION' silent Silent mutation restriction enzyme scan Once you've found a likely program you can read its full documentation using tfm $ tfm silent Displays a program's help documentation manual silent Function Silent mutation restriction enzyme scan Description silent does a scan of a nucleic acid sequence for silent mutation restriction enzyme sites. silent finds positions in a sequence where a point mutation could be made to introduce a specified restriction enzyme recognition site without changing the translation. Hope this helps Simon. From maoj at mail.nih.gov Fri Aug 22 09:09:30 2003 From: maoj at mail.nih.gov (Jean Mao) Date: Fri, 22 Aug 2003 09:09:30 -0400 Subject: [EMBOSS] question about EMBOSS-GUI help system Message-ID: <004801c368ae$9fc06450$494de780@CIT.NIH.GOV> Hi, I have installed emboss-gui from Luke McCarthy on our test server. I am trying to solve a problem and your help will be greatly appreciated. Problem: I selected a program on left panel, clicked on the 'help' link on right panel, clicked the 'go' link, the detail info about that specific program will be displayed. there are 2 links in this page 'go to the input files for this example' and 'go to the output files for this example'. When I click on either link, instead of taking me to where the input/output files are at the lower part of the same page, it will take me back to the EMBOSS-GUI homepage which is the same page I click 'help' image. Since the help page is created on the run, I assume the #input and #output in the html code failed to find the tag and therefore load the base html page. For your info, the following is the info I entered at the install.sh prompt, I also modified the file /usr/local/lib/perl5/site_perl/5.6.1/EMBOSS/GUI.pm (see below): -------------------------------------------------------------------------------------------------------------- # bsh install.sh Writing Makefile for EMBOSS::ACD Manifying blib/man3/EMBOSS::ACD.3 Installing /usr/freeware/catman/p_man/man3/EMBOSS::ACD.3 Writing /usr/local/lib/perl5/site_perl/5.6.1/irix-n32/auto/EMBOSS/ACD/.packlist Appending installation info to /usr/freeware/lib/perl5/5.6.1/irix-n32/perllocal.pod Writing Makefile for EMBOSS::GUI Manifying blib/man3/EMBOSS::GUI.3 Manifying blib/man3/EMBOSS::GUI.3 Installing /usr/local/lib/perl5/site_perl/5.6.1/EMBOSS/GUI.pm Installing /usr/freeware/catman/p_man/man3/EMBOSS::GUI.3 Writing /usr/local/lib/perl5/site_perl/5.6.1/irix-n32/auto/EMBOSS/GUI/.packlist Appending installation info to /usr/freeware/lib/perl5/5.6.1/irix-n32/perllocal.pod /usr/local/bin/perl postamble.pl /usr/local/bin/perl Please answer the following questions to set up EMBOSS::GUI: Where was EMBOSS installed? [ default is /usr/local ] > /usr/localapps/emboss Where was the EMBOSS data installed? [ default is /usr/localapps/emboss/share/EMBOSS ] > Where were the EMBOSS binaries installed? [ default is /usr/localapps/emboss/bin ] > Where is the root of the web server document tree? [ default is /home/httpd ] > /info/www1/htdocs Where should the EMBOSS::GUI HTML files be installed? [ default is /info/www1/htdocs/html/EMBOSS ] > /info/www1/htdocs/EMBOSS-GUI What is the hostname of the web server EMBOSS::GUI will be installed on? [ default is localhost ] > nimbus.nih.gov:8888 What is the URL corresponding to the HTML directory above? [ default is http://nimbus.nih.gov:8888/EMBOSS ] > http://nimbus.nih.gov:8888/EMBOSS-GUI Where should the EMBOSS::GUI CGI script be installed? [ default is /info/www1/htdocs/cgi-bin ] > /info/www1/cgi-bin What is the URL corresponding to the CGI directory above? [ default is http://nimbus.nih.gov:8888/cgi-bin ] > Installing EMBOSS::GUI HTML files... Generating default configuration files... Finds or fetches the data files read in by the EMBOSS programs And that should just about do it. Point your browser at http://nimbus.nih.gov:8888/EMBOSS-GUI/index.html to try it out... Please report any errors or strange occurrences to lukem at bioinfo.pbi.nrc.ca ------------------------------------------------------------------------------------------------------------- modify /usr/local/lib/perl5/site_perl/5.6.1/EMBOSS/GUI.pm: ----------------------------------------------------------------------------------------- command out line $ENV{'PLPLOT_LIB'} = "$EMBOSS_HOME"; add $ENV{'PLPLOT_LIB'} = "/usr/localapps/emboss/plplot/lib"; $ENV{'EMBOSSRC'} = "/usr/localapps/emboss"; change $ENV{'PATH'} = "$EMBOSS_BIN:/bin"; to $ENV{'PATH'} = "$EMBOSS_BIN:/bin /usr/local/bin"; ------------------------------------------------------------------------------------------- chmod a+r /info/www1/htdocs/EMBOSS-GUI/images/ Thank you very much. Jean -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030822/4c61bcfa/attachment.html From pmr at ebi.ac.uk Fri Aug 22 10:30:26 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 22 Aug 2003 15:30:26 +0100 Subject: [EMBOSS] Problem writing sequence files References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> Message-ID: <3F462902.5050209@ebi.ac.uk> Kim Rutherford wrote: > Hi. I'm trying to write a sequence to a named file. I tried this: > > AjPFile seqout_file = ajFileNewOut(seqout_name); > AjPSeqout named_seqout = ajSeqoutNewF(seqout_file); > > I get a segmentation fault and this backtrace: > I'd appreciate if someone could let me know what I'm doing wrong or > point me to some example code that does something similar. It is a bug. ajSeqoutNewF creates a sequence output object with an open file - but stores it as a "Knownfile" attribute. It was used in the USA processing, but ignored if you call ajSeqWrite directly. An easy fix - it will work in the next release ... and I see you already found it works nicely - and in the true EMBOSS style - when you do all the hard work in the ACD file. regards, Peter Rice From kmr at sanger.ac.uk Fri Aug 22 10:42:14 2003 From: kmr at sanger.ac.uk (Kim Rutherford) Date: Fri, 22 Aug 2003 15:42:14 +0100 Subject: [EMBOSS] Problem writing sequence files In-Reply-To: <3F462902.5050209@ebi.ac.uk> References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> <3F462902.5050209@ebi.ac.uk> Message-ID: <16198.11206.753722.596951@pcs2b.internal.sanger.ac.uk> On Fri, 22 Aug 2003 15:30:26 +0100, Peter Rice wrote: > Kim Rutherford wrote: >> Hi. I'm trying to write a sequence to a named file. I tried this: >> >> AjPFile seqout_file = ajFileNewOut(seqout_name); >> AjPSeqout named_seqout = ajSeqoutNewF(seqout_file); >> >> I get a segmentation fault and this backtrace: >> I'd appreciate if someone could let me know what I'm doing wrong or >> point me to some example code that does something similar. > It is a bug. > ajSeqoutNewF creates a sequence output object with an open file - but > stores it as a "Knownfile" attribute. It was used in the USA processing, > but ignored if you call ajSeqWrite directly. > An easy fix - it will work in the next release ... and I see you already > found it works nicely - and in the true EMBOSS style - when you do all > the hard work in the ACD file. Thanks for that. I've changed my strategy, but it still may be useful for me later. I'll do a "cvs update". Kim. From mccarthy at cs.usask.ca Fri Aug 22 11:51:55 2003 From: mccarthy at cs.usask.ca (Luke McCarthy) Date: 22 Aug 2003 09:51:55 -0600 Subject: [EMBOSS] question about EMBOSS-GUI help system In-Reply-To: <004801c368ae$9fc06450$494de780@CIT.NIH.GOV> References: <004801c368ae$9fc06450$494de780@CIT.NIH.GOV> Message-ID: <1061567515.7096.4.camel@crazyharry.usask.ca> On Fri, 2003-08-22 at 07:09, Jean Mao wrote: > Problem: > I selected a program on left panel, clicked on the 'help' link on > right panel, clicked the 'go' link, the detail info about that > specific program will be displayed. there are 2 links in this page 'go > to the input files for this example' and 'go to the output files for > this example'. When I click on either link, instead of taking me to > where the input/output files are at the lower part of the same page, > it will take me back to the EMBOSS-GUI homepage which is the same page > I click 'help' image. Since the help page is created on the run, I > assume the #input and #output in the html code failed to find the tag > and therefore load the base html page. The problem is that the GUI sticks a tag in the header of each page it generates. This isn't necessary at all anymore, so I'll fix the code and put up a new package at http://bioinfo.pbi.nrc.ca/~lukem/ I'll reply to this thread when the new version is up. Cheers, Luke -- Luke McCarthy Research Officer, Bioinformatics Department of Computer Science University of Saskatchewan mccarthy at cs.usask.ca From mccarthy at cs.usask.ca Fri Aug 22 12:28:18 2003 From: mccarthy at cs.usask.ca (Luke McCarthy) Date: 22 Aug 2003 10:28:18 -0600 Subject: [EMBOSS] question about EMBOSS-GUI help system In-Reply-To: <1061567515.7096.4.camel@crazyharry.usask.ca> References: <004801c368ae$9fc06450$494de780@CIT.NIH.GOV> <1061567515.7096.4.camel@crazyharry.usask.ca> Message-ID: <1061569698.7134.26.camel@crazyharry.usask.ca> A new version of the EMBOSS-GUI code is up at http://bioinfo.pbi.nrc.ca/~lukem/EMBOSS/ (you can download directly from http://bioinfo.pbi.nrc.ca/~lukem/EMBOSS/EMBOSS-GUI.tar.gz) Note that the URL differs from the one I gave in the previous message. Mea culpa. I have removed from the header that which was breaking internal links in the application manual pages. So now when you click on 'Go to the input files for this example', you should actually go there... Even if you have previously installed the GUI, you can simply rerun the install script and the new version will replace the old one. Email me if you have any problems. Cheers, Luke -- Luke McCarthy Research Officer, Bioinformatics Department of Computer Science University of Saskatchewan mccarthy at cs.usask.ca From kellert at ohsu.edu Fri Aug 22 12:50:15 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Fri, 22 Aug 2003 09:50:15 -0700 Subject: [EMBOSS] update logistics Message-ID: Greetings, I was 'getting into" emboss several months ago. I have version 2.5.1 installed on my machine. Then work exigencies arose and I could not do any work with it. Now I'm trying to get back to it, but am perplexed about the best way to update the programs. My machine is running Mac OSX 10.2.6 and I have fink installed, though I installed Emboss from a disk image/installer provided by The BioTeam (Bill VanEttan) which puts it at /usr/local/biotools/bin/. For someone who is not a computer scientist, just a biochemist trying to develop bioinformatics as a service for the clients of his DNA core faciity, what do the cognoscenti recommend? Thanks, Tom K. Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From bgibbon at email.arizona.edu Fri Aug 22 15:17:11 2003 From: bgibbon at email.arizona.edu (Bryan Gibbon) Date: Fri, 22 Aug 2003 12:17:11 -0700 Subject: [EMBOSS] update logistics In-Reply-To: Message-ID: <5.0.2.1.0.20030822112643.00a8d210@bgibbon.inbox.email.arizona.edu> Tom, I use a similar setup. In order to be able to have current EMBOSS releases I download and compile with the source code from HGMP with the following commands. cd ~/src (or the directory you downloaded the file to) tar -xvzf EMBOSS*.gz ./configure --prefix=/usr/local/biotools make sudo make install This places all of the binaries and libraries etc. in the Biotools installation directories and it works great. Of course you have to install the Developer tools (on the hard drive in "/Applications/Installers") and Xfree86 packages (available from the Apple web site on the Mac OS X tab, Downloads, Unix & Open Source). Hope this helps, Bryan Gibbon University of Arizona Department of Plant Sciences Forbes 303 Tucson AZ 85721-0036 USA Tel: (520) 621-9154 FAX: (520) 621-3692 http://ag.arizona.edu/research/larkinslab/ From franchise-invite at gawab.com Mon Aug 25 15:49:14 2003 From: franchise-invite at gawab.com (Yen) Date: Tue, 26 Aug 2003 03:49:14 +0800 Subject: [EMBOSS] Business Opportunity - Master Franchise for Education Services Message-ID: <20030825195318.186D87D0E4@mercury.hgmp.mrc.ac.uk> Global Business For You Program For Success The Secret to Wealth Creation Is to ride on trend like you surf a wave... ... the SkyQuestCom Tidal Wave SkyQuestCom has been chalking up milestones and revolutionizing the way we work, play and learn ever since it exploded into the e-learning scene. IT'S LIKE NO OTHER SkyQuestCom is the world's first multimedia e-learning portal to deliver Live and Archived learning events on a regular basis. LIVE Webcasts Twice a Month Internationally renowned speakers are brought into your living room or office LIVE twice a month to talk to you about corporate and personal development, lifestyle and family issues. Highly sought-after experts like Robert Kiyosaki, Corey Rudl, Anthony Robbins and Harvey Mackay teach you all they know and answer your questions in REAL TIME. Unlimited Access to Hundreds of Seminars Imagine having the world's leading experts at your disposal 24 hours a day, 7 days a week; guiding you through your professional and personal development. Over 4,000 of the latest books by the world's most respected authors Pages and pages of invaluable information you can absorb over and over again, without the inconvenience of traveling to a bookstore or library, or having to pay extra money. Learn to use 41 of the Most Popular Computer Programs At Your Own Pace Learn the computer in the comfort of your home, save cost and be free from pressure. Plus, you will not be charged for re-sitting for a course! Learning the computer is now a leisure activity you can do in your free time instead of a laborious series of classes. International Network Have access to an e-forum network that lets you chat with up to 7 people form all over the world, plus 15 MegaBytes of webspace to build your own presence on the web! Make yourself, your business and your family available on the Net! There is no other more powerful vehicle. WORLDWIDE REACH Having penetrated over 25 countries, SkyQuestCom lets you interact with other learners all over the world - to learn from and exchange information with others just as dedicated to the pursuit of knowledge and excellence as you are. UNLIMITED BUSINESS OPPORTUNITIES Apart from deriving value from SkyQuestCom's products, you can transform it into a business for yourself at no extra cost. Be a part of this exciting global business and be rewarded by the BEST Compensation Plan around! GREAT VALUE FOR MONEY - WITH MONEY BACK GUARANTEE And now the big question: HOW MUCH? Live and Interactive webcasts every two weeks Hundreds of power-packed seminars Comprehensive Computer Training Channel Netlibrary of over 4,000 of the latest titles E-forum network. Personal webpage builder Unlimited business opportunities Valued at thousands but available at the affordable price of ONLY USD250 per annum! Interested to delve deeper into SkyQuestCom? Select this link. For more details on Master franchise program, please email franchise at gawab.com -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20030826/4089ea89/attachment.html From d.m.a.martin at dundee.ac.uk Wed Aug 27 09:44:28 2003 From: d.m.a.martin at dundee.ac.uk (David Martin) Date: Wed, 27 Aug 2003 14:44:28 +0100 Subject: [EMBOSS] Where did the protein structure programs go? Message-ID: EMBOSS had some protein structure stuff in it. This all seems to have disappeared? ..d -- David Martin PhD Bioinformatics Scientific Officer Post-Genomics and Molecular Interactions Centre University of Dundee From bb2duprm at uco.es Thu Aug 28 06:04:37 2003 From: bb2duprm at uco.es (mario) Date: Thu, 28 Aug 2003 12:04:37 +0200 Subject: [EMBOSS] a question about emma Message-ID: <000001c36d4c$812a9720$b074d696@uco.es> I am a new user of EMBOSS. I have installed all the packages in my computer running under Linux Red Hat 9.2 and it works correctly, except EMMA programm. When I use it, I can read an error message saying that clustalw is not found. I think I have to download clustalw programm and install it, but where have I to do it??? In emboss directory, or I have to add it tho Red Hat packages? I don?t know what to do about it... Can somebody help me about how to obtain the correct version of clustalw for my machine and how to install it properly for working with EMBOSS? I?ll be very happy if somebody could help me. Best wishes. Mario Duran From henrikki.almusa at helsinki.fi Thu Aug 28 06:24:34 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Thu, 28 Aug 2003 13:24:34 +0300 Subject: [EMBOSS] a question about emma In-Reply-To: <000001c36d4c$812a9720$b074d696@uco.es> References: <000001c36d4c$812a9720$b074d696@uco.es> Message-ID: <200308281324.34847.henrikki.almusa@helsinki.fi> On Thursday 28 August 2003 13:04, mario wrote: > I think I have to download clustalw programm and install it, but where have > I to do it??? In emboss directory, or I have to add it tho Red Hat > packages? I don?t know what to do about it... You can get this from ebi's ftp server in here: ftp://ftp.ebi.ac.uk/pub/software/unix/clustalw/ > Can somebody help me about how to obtain the correct version of clustalw > for my machine and how to install it properly for working with EMBOSS? I?ll > be very happy if somebody could help me. How to install it. Well i would think that if you install clustalw and have it in path, then it should work. However since i haven't used emma myself i can't be sure. My suggestion is to install clustalw and add it to path and try emma again. -- Henrikki Almusa From aengus.stewart at cancer.org.uk Thu Aug 28 06:52:24 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Thu, 28 Aug 2003 11:52:24 +0100 Subject: [EMBOSS] simple EST sequence assembly References: <000001c36d4c$812a9720$b074d696@uco.es> Message-ID: <3F4DDEE8.86D39404@cancer.org.uk> Hi, I have a couple of users who routinely use GCGs gelassemble to do "mini" assembly projects with ESTs. They find that the Staden package is overkill for this I am at a bit of a loss as to what/how to suggest an alternative within EMBOSS. Is there an "assemble" program on the horizon? Regards Aengus -- ---------------------------------------------------------------------------- Aengus Stewart Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ---------------------------------------------------------------------------- From grimplet at ensam.inra.fr Thu Aug 28 08:24:36 2003 From: grimplet at ensam.inra.fr (Jerome Grimplet) Date: Thu, 28 Aug 2003 14:24:36 +0200 Subject: [EMBOSS] simple EST sequence assembly In-Reply-To: <3F4DDEE8.86D39404@cancer.org.uk> References: <000001c36d4c$812a9720$b074d696@uco.es> <3F4DDEE8.86D39404@cancer.org.uk> Message-ID: <200308281424.36949.grimplet@ensam.inra.fr> CAP3, you've got to ask it to Xiaqiu Huang (xqhuang at cs.iastate.edu). Precise your platform in the mail Regards, jerome Le Jeudi 28 Ao?t 2003 12:52, Aengus Stewart a ?crit : > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do "mini" > assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative within > EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus -- J?r?me Grimplet Laboratoire de Biochimie M?tabolique et Technologie UMR Sciences Pour l'Oenologie 2, Place Viala 34060 Montpellier Cedex 01 Tel: 33(0)4.99.61.27.56 Fax: 33(0)4.99.61.28.57 grimplet at ensam.inra.fr From stefanielager at fastmail.ca Sun Aug 31 07:27:23 2003 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Sun, 31 Aug 2003 07:27:23 -0400 (EDT) Subject: Fwd: [EMBOSS] simple EST sequence assembly Message-ID: <3F51DB9B.00006B.89366@ns.interchange.ca> CAP3 is also used by TIGR in there "TGI Clustering tools (TGICL)", adapted for EST clustering. It's available under Artistic License from: http://www.tigr.org/tdb/tgi/software/ Stefanie > > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do > "mini" assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative > within EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus > > > -- > ------------------------------------------------------------------ > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A > 3PX, UK _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From grimplet at ensam.inra.fr Thu Aug 28 08:24:36 2003 From: grimplet at ensam.inra.fr (Jerome Grimplet) Date: Thu, 28 Aug 2003 14:24:36 +0200 Subject: [EMBOSS] simple EST sequence assembly In-Reply-To: <3F4DDEE8.86D39404@cancer.org.uk> References: <000001c36d4c$812a9720$b074d696@uco.es> <3F4DDEE8.86D39404@cancer.org.uk> Message-ID: <200308281424.36949.grimplet@ensam.inra.fr> From stefanielager at fastmail.ca Sun Aug 31 07:27:23 2003 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Sun, 31 Aug 2003 07:27:23 -0400 (EDT) Subject: Fwd: [EMBOSS] simple EST sequence assembly Message-ID: <3F51DB9B.00006B.89366@ns.interchange.ca> From owner-emboss at hgmp.mrc.ac.uk Thu Aug 28 08:24:36 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Thu, 28 Aug 2003 14:24:36 +0200 Subject: [EMBOSS] simple EST sequence assembly In-Reply-To: <3F4DDEE8.86D39404@cancer.org.uk> References: <000001c36d4c$812a9720$b074d696@uco.es> <3F4DDEE8.86D39404@cancer.org.uk> Message-ID: <200308281424.36949.grimplet@ensam.inra.fr> CAP3, you've got to ask it to Xiaqiu Huang (xqhuang at cs.iastate.edu). Precise your platform in the mail Regards, jerome Le Jeudi 28 Ao?t 2003 12:52, Aengus Stewart a ?crit : > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do "mini" > assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative within > EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus -- J?r?me Grimplet Laboratoire de Biochimie M?tabolique et Technologie UMR Sciences Pour l'Oenologie 2, Place Viala 34060 Montpellier Cedex 01 Tel: 33(0)4.99.61.27.56 Fax: 33(0)4.99.61.28.57 grimplet at ensam.inra.fr From owner-emboss at hgmp.mrc.ac.uk Sun Aug 31 07:27:23 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Sun, 31 Aug 2003 07:27:23 -0400 (EDT) Subject: Fwd: [EMBOSS] simple EST sequence assembly Message-ID: <3F51DB9B.00006B.89366@ns.interchange.ca> CAP3 is also used by TIGR in there "TGI Clustering tools (TGICL)", adapted for EST clustering. It's available under Artistic License from: http://www.tigr.org/tdb/tgi/software/ Stefanie > > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do > "mini" assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative > within EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus > > > -- > ------------------------------------------------------------------ > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A > 3PX, UK _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From owner-emboss at hgmp.mrc.ac.uk Thu Aug 28 08:24:36 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Thu, 28 Aug 2003 14:24:36 +0200 Subject: [EMBOSS] simple EST sequence assembly In-Reply-To: <3F4DDEE8.86D39404@cancer.org.uk> References: <000001c36d4c$812a9720$b074d696@uco.es> <3F4DDEE8.86D39404@cancer.org.uk> Message-ID: <200308281424.36949.grimplet@ensam.inra.fr> CAP3, you've got to ask it to Xiaqiu Huang (xqhuang at cs.iastate.edu). Precise your platform in the mail Regards, jerome Le Jeudi 28 Ao?t 2003 12:52, Aengus Stewart a ?crit : > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do "mini" > assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative within > EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus -- J?r?me Grimplet Laboratoire de Biochimie M?tabolique et Technologie UMR Sciences Pour l'Oenologie 2, Place Viala 34060 Montpellier Cedex 01 Tel: 33(0)4.99.61.27.56 Fax: 33(0)4.99.61.28.57 grimplet at ensam.inra.fr From owner-emboss at hgmp.mrc.ac.uk Thu Aug 28 08:24:36 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Thu, 28 Aug 2003 14:24:36 +0200 Subject: [EMBOSS] simple EST sequence assembly In-Reply-To: <3F4DDEE8.86D39404@cancer.org.uk> References: <000001c36d4c$812a9720$b074d696@uco.es> <3F4DDEE8.86D39404@cancer.org.uk> Message-ID: <200308281424.36949.grimplet@ensam.inra.fr> CAP3, you've got to ask it to Xiaqiu Huang (xqhuang at cs.iastate.edu). Precise your platform in the mail Regards, jerome Le Jeudi 28 Ao?t 2003 12:52, Aengus Stewart a ?crit : > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do "mini" > assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative within > EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus -- J?r?me Grimplet Laboratoire de Biochimie M?tabolique et Technologie UMR Sciences Pour l'Oenologie 2, Place Viala 34060 Montpellier Cedex 01 Tel: 33(0)4.99.61.27.56 Fax: 33(0)4.99.61.28.57 grimplet at ensam.inra.fr From owner-emboss at hgmp.mrc.ac.uk Sun Aug 31 07:27:23 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Sun, 31 Aug 2003 07:27:23 -0400 (EDT) Subject: Fwd: [EMBOSS] simple EST sequence assembly Message-ID: <3F51DB9B.00006B.89366@ns.interchange.ca> CAP3 is also used by TIGR in there "TGI Clustering tools (TGICL)", adapted for EST clustering. It's available under Artistic License from: http://www.tigr.org/tdb/tgi/software/ Stefanie > > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do > "mini" assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative > within EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus > > > -- > ------------------------------------------------------------------ > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A > 3PX, UK _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From aengus.stewart at cancer.org.uk Fri Aug 1 14:05:36 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Fri, 01 Aug 2003 15:05:36 +0100 Subject: [EMBOSS] Q: HMMER in EMBASSY References: <002201c34c71$80014c50$494de780@CIT.NIH.GOV> <3F16B5F4.6010602@ebi.ac.uk> Message-ID: <3F2A73B0.F9723489@cancer.org.uk> How do native versions of programs relate to EMBASSY versions? The reason for my question is of course that the HMMER package is currently at 2.3.1 but within EMBASSY it is 2.1.1 Regards Aengus From ableasby at hgmp.mrc.ac.uk Fri Aug 1 15:29:57 2003 From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk) Date: Fri, 1 Aug 2003 16:29:57 +0100 (BST) Subject: [EMBOSS] Q: HMMER in EMBASSY Message-ID: <200308011529.h71FTuK03979@bromine.hgmp.mrc.ac.uk> The same versions should have the same functionality. HMMER currently lags behind the native version since Sean decided to change his file format handling from Stockholm to Pfam format. That is one of many reasons why a new indexing system is being developed for EMBOSS. An updated version of PHYLIP has been added to the CVS version of the source tree and is undergoing testing before that is released as an EMBASSY package. HTH Alan From aengus.stewart at cancer.org.uk Mon Aug 4 17:56:44 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Mon, 04 Aug 2003 18:56:44 +0100 Subject: [EMBOSS] JEMBOSS/tomcat 4.1.27/IRIX prob References: <002201c34c71$80014c50$494de780@CIT.NIH.GOV> <3F16B5F4.6010602@ebi.ac.uk> <3F2A73B0.F9723489@cancer.org.uk> Message-ID: <3F2E9E5C.C7568720@cancer.org.uk> Hi, By sheer coincidence I have been building JEMBOSS today with tomcat 4.1.27 and I eventually found your new install-jemboss-server.sh script. It didnt like running on IRIX falling over at the checking for incs/libs for png/gd/zlib. This is due to the locations used on IRIX and also because sometimes ( in the case of png ) they are soft-links rather than files so test -f fails. The libs are often in /usr/freeware/lib32 or /usr/freeware/lib64 rather than in $DIR/lib. I did a bit of editting to the install-jemboss-server.sh script to get it past the check_libs section and then when prompted to add anything else to the end of the configure options added my CC CFLAGS LDFLAGS.......etc........ Cheers Aengus From perseus at bioinformatics.ubc.ca Wed Aug 6 00:50:56 2003 From: perseus at bioinformatics.ubc.ca (Perseus Missirlis) Date: Tue, 05 Aug 2003 17:50:56 -0700 Subject: [EMBOSS] cpgplot %cg plots Message-ID: <510564b960.4b96051056@cmmt.ubc.ca> Hello, The graphical output of cpgplot includes Obs/Exp, %GC, CpG islands. However, text output of this information is limited to the CpG islands. I looked for parameter specifications allowing text output of Obs/Exp and %GC but to no avail. Can anyone assist me with this problem? Thanks, +----------------------------------+ | Perseus Missirlis | | Bioinformatics Graduate Student | | UBC Bioinformatics Centre (UBiC) | | Vancouver, BC, Canada | | http://bioinformatics.ubc.ca | +----------------------------------+ From perseus at bioinformatics.ubc.ca Wed Aug 6 00:50:56 2003 From: perseus at bioinformatics.ubc.ca (Perseus Missirlis) Date: Tue, 05 Aug 2003 17:50:56 -0700 Subject: [EMBOSS] cpgplot %cg plots Message-ID: <510564b960.4b96051056@cmmt.ubc.ca> Hello, The graphical output of cpgplot includes Obs/Exp, %GC, CpG islands. However, text output of this information is limited to the CpG islands. I looked for parameter specifications allowing text output of Obs/Exp and %GC but to no avail. Can anyone assist me with this problem? Thanks, +----------------------------------+ | Perseus Missirlis | | Bioinformatics Graduate Student | | UBC Bioinformatics Centre (UBiC) | | Vancouver, BC, Canada | | http://bioinformatics.ubc.ca | +----------------------------------+ From pemberaj at pugh.bip.bham.ac.uk Wed Aug 6 13:01:40 2003 From: pemberaj at pugh.bip.bham.ac.uk (Tony Pemberton) Date: Wed, 6 Aug 2003 14:01:40 +0100 Subject: [EMBOSS] sort from dbiflat In-Reply-To: <200301211830.SAA25776@bromine.hgmp.mrc.ac.uk> References: <200301211830.SAA25776@bromine.hgmp.mrc.ac.uk> Message-ID: Dear emboss users, I am currently running dbiflat on EMBL 75.0 and the sort stage is taking a very long time - been running for 5 days under Red Hat Linux 9.0 dual processor Athlon (1.7 GHz) 2Gb memory. Can anyone tell me if this is "normal"? Regards, Tony Pemberton ********************************************************************* Mr. A.J.Pemberton Tel: +121-414-3388 c/o Dept. Rheumatology, Fax: +121-414-6794 Medical School, E-mail: A.J.Pemberton at bham.ac.uk The University of Birmingham, Birmingham B15 2TT. U.K. ********************************************************************* From henrikki.almusa at helsinki.fi Thu Aug 7 11:48:24 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Thu, 7 Aug 2003 14:48:24 +0300 Subject: [EMBOSS] Q: HMMER in EMBASSY In-Reply-To: <200308011529.h71FTuK03979@bromine.hgmp.mrc.ac.uk> References: <200308011529.h71FTuK03979@bromine.hgmp.mrc.ac.uk> Message-ID: <200308071448.24634.henrikki.almusa@helsinki.fi> On Friday 01 August 2003 18:29, ableasby at hgmp.mrc.ac.uk wrote: > The same versions should have the same functionality. HMMER currently > lags behind the native version since Sean decided to change his > file format handling from Stockholm to Pfam format. That is one > of many reasons why a new indexing system is being developed for > EMBOSS. > > An updated version of PHYLIP has been added to the CVS version > of the source tree and is undergoing testing before that is > released as an EMBASSY package. Any idea long might this testing last? I'd be instrested with newer version of phylip. TIA -- Henrikki Almusa From ableasby at hgmp.mrc.ac.uk Thu Aug 7 13:32:23 2003 From: ableasby at hgmp.mrc.ac.uk (Alan Bleasby) Date: Thu, 7 Aug 2003 14:32:23 +0100 (BST) Subject: [EMBOSS] Q: HMMER in EMBASSY Message-ID: <200308071332.h77DWNQC008474@bromine.hgmp.mrc.ac.uk> It cannot be supplied as a package for the current stable release of EMBOSS as it relies on new datatypes that have only been added (to ACD) in the development (CVS) version. We've yet to discuss when the next release will be but I'd guess at a couple of months. Brgds Alan From maoj at mail.nih.gov Fri Aug 8 12:24:36 2003 From: maoj at mail.nih.gov (Jean Mao) Date: Fri, 8 Aug 2003 08:24:36 -0400 Subject: [EMBOSS] Question about Emma using emboss-GUI Message-ID: <104101c35da8$0812e210$494de780@CIT.NIH.GOV> Hi, I installed the Emboss-GUI and are testing it. I got an error message when I tried emma using the GUI web interface. The error message says: EMBOSS An error in ajsys.c at line 360: cannot find program 'clustalw' emma exited with status 1... However, I got no error when I tried emma on the command line. Would you help me? Thank you very much. ------------------------------------------------------------------- Jean Mao Helix Systems Bldg 12B, Rm 2N207 National Institutes of Health Bethesda, MD 20895 Email:maoj at helix.nih.gov ------------------------------------------------------------------ -------------- next part -------------- An HTML attachment was scrubbed... URL: From tcarver at hgmp.mrc.ac.uk Fri Aug 8 12:30:58 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Fri, 8 Aug 2003 13:30:58 +0100 (BST) Subject: [EMBOSS] Question about Emma using emboss-GUI In-Reply-To: <104101c35da8$0812e210$494de780@CIT.NIH.GOV> Message-ID: Hi Jean Which EMBOSS-GUI are you testing? If you are using Jemboss you will need to add the path to clustalw to the jemboss.properties file (in $EMBOSS-INSTALL/share/EMBOSS/jemboss). The format of this file is described at: http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Jemboss/install/properties.html -so add it to the embossPath variable and if you are using a client-server installation re-start tomcat with the 'tomstart' script provided. Regards Tim Carver HGMP-RC On Fri, 8 Aug 2003, Jean Mao wrote: > Hi, > I installed the Emboss-GUI and are testing it. I got an error message when I tried emma using the GUI web interface. The error message says: > EMBOSS An error in ajsys.c at line 360: cannot find program 'clustalw' emma exited with status 1... > However, I got no error when I tried emma on the command line. Would you help me? Thank you very much. > > ------------------------------------------------------------------- > Jean Mao > Helix Systems > Bldg 12B, Rm 2N207 > National Institutes of Health > Bethesda, MD 20895 > Email:maoj at helix.nih.gov > ------------------------------------------------------------------ From matiasovicj at vfu.cz Fri Aug 8 14:01:18 2003 From: matiasovicj at vfu.cz (Jan Matiasovic) Date: Fri, 8 Aug 2003 16:01:18 +0200 Subject: [EMBOSS] diffrential restriction program Message-ID: <200308081601.18243.matiasovicj@vfu.cz> Hallo Emboss. I am looking for program which is able to find restriction endonuclease making different digestion on similar sequences. I do not know Emboss well, but I do not found this program in this package. Example: I have three alleles of horse DQA. I use Emboss restrict for all alleles and outputs compare using shell program diff. This show me I am able resolve this three alleles using Mnl I digestion. For three alleles it is piece of cake, but large number of allels generate a lot of diff?s outputs. Is program doing similar work available? I do not know programming, so I am not able to write any piece of code :(. Thank you for your answer. Jan Matiasovic PhD. University of Veterinary and Pharmaceutical Sciences Brno Department of Animal Genetics Czech Republic From mccarthy at cs.usask.ca Fri Aug 8 16:40:12 2003 From: mccarthy at cs.usask.ca (Luke McCarthy) Date: 08 Aug 2003 10:40:12 -0600 Subject: [EMBOSS] Question about Emma using emboss-GUI In-Reply-To: <104101c35da8$0812e210$494de780@CIT.NIH.GOV> References: <104101c35da8$0812e210$494de780@CIT.NIH.GOV> Message-ID: <1060360812.15285.11.camel@crazyharry.usask.ca> On Fri, 2003-08-08 at 06:24, Jean Mao wrote: > Hi, > I installed the Emboss-GUI and are testing it. I got an error message > when I tried emma using the GUI web interface. The error message says: > EMBOSS An error in ajsys.c at line 360: cannot find program 'clustalw' > emma exited with status 1... > However, I got no error when I tried emma on the command line. Would > you help me? Thank you very much. If you are using my EMBOSS::GUI, it is very likely that clustalw is not in the GUI's path. For security reasons, the GUI assumes a very strict path: normally just the directory containing the EMBOSS binaries and /bin (because one of the EMBOSS programs requires ls...) If this is the problem, there are a couple of solutions: first, you can link or move clustalw to the same directory as the rest of the EMBOSS binaries; second, you can add the directory containing clustalw to the GUI's path. If you decide to go the second route, you'll have to edit the GUI.pm module in a minor way, so email me off-list and I'll give you directions. In most situations, however, the first way is easier by far. Cheers, Luke -- Luke McCarthy Research Officer, Bioinformatics Department of Computer Science University of Saskatchewan mccarthy at cs.usask.ca From maoj at mail.nih.gov Mon Aug 11 14:59:33 2003 From: maoj at mail.nih.gov (Jean Mao) Date: Mon, 11 Aug 2003 10:59:33 -0400 Subject: [EMBOSS] question about emma Message-ID: <12e601c36019$2d024c00$494de780@CIT.NIH.GOV> Hi, We just installed emboss and found the default output format of emma is fasta. How can I change the default output to GCG-msf format? Thanks. Jean -------------- next part -------------- An HTML attachment was scrubbed... URL: From henrikki.almusa at helsinki.fi Tue Aug 12 05:32:19 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Tue, 12 Aug 2003 08:32:19 +0300 Subject: [EMBOSS] question about emma In-Reply-To: <12e601c36019$2d024c00$494de780@CIT.NIH.GOV> References: <12e601c36019$2d024c00$494de780@CIT.NIH.GOV> Message-ID: <200308120832.19585.henrikki.almusa@helsinki.fi> On Monday 11 August 2003 17:59, Jean Mao wrote: > Hi, We just installed emboss and found the default output format of emma is > fasta. How can I change the default output to GCG-msf format? Thanks. > > Jean Use option "-osformat msf". In http://www.emboss.org there is listing for all options in each program in link applications. Also there is a listing for all possible formats (reports, sequences etc) in user documetation. They might be a good place to find more information. -- Henrikki Almusa From kim at inb.uni-luebeck.de Tue Aug 12 10:01:57 2003 From: kim at inb.uni-luebeck.de (Jan T. Kim) Date: Tue, 12 Aug 2003 12:01:57 +0200 Subject: [EMBOSS] question about emma In-Reply-To: <200308120832.19585.henrikki.almusa@helsinki.fi>; from henrikki.almusa@helsinki.fi on Tue, Aug 12, 2003 at 08:32:19AM +0300 References: <12e601c36019$2d024c00$494de780@CIT.NIH.GOV> <200308120832.19585.henrikki.almusa@helsinki.fi> Message-ID: <20030812120157.A15726@pc10.inb.mu-luebeck.de> On Tue, Aug 12, 2003 at 08:32:19AM +0300, Henrikki Almusa wrote: > On Monday 11 August 2003 17:59, Jean Mao wrote: > > Hi, We just installed emboss and found the default output format of emma is > > fasta. How can I change the default output to GCG-msf format? Thanks. > > > > Jean > > Use option "-osformat msf". > > In http://www.emboss.org there is listing for all options in each program in > link applications. Also there is a listing for all possible formats (reports, > sequences etc) in user documetation. They might be a good place to find more > information. This is correct, but perhaps not exactly what Jean was looking for. At least, my understanding of a "default option" is that it takes effect without being explicitly specified. I used to achieve this effect by means of aliases, e.g. by putting alias emma='emma -osformat msf' into my ~/.bashrc file, but eventually, my need for such defaults decreased as I increasingly adopted the habit of putting together shell scripts that automate the analyses I'm interested in. However, I've been thinking from time to time that it would sometimes be handy to have a way to specify defaults for the EMBOSS programs, e.g. by means of an environment variable or a dotfile. Have I overlooked this? For example, it might be very convenient at times to change the default format for sequence output from FASTA to something which can accomodate more annotation information. Greetings from Luebeck, Jan -- +- Jan T. Kim -------------------------------------------------------+ | *NEW* email: kim at inb.uni-luebeck.de | | *NEW* WWW: http://www.inb.uni-luebeck.de/staff/kim.html | *-----=< hierarchical systems are for files, not for humans >=-----* From d.m.a.martin at dundee.ac.uk Tue Aug 12 10:11:42 2003 From: d.m.a.martin at dundee.ac.uk (David Martin) Date: Tue, 12 Aug 2003 11:11:42 +0100 Subject: [EMBOSS] question about emma In-Reply-To: <20030812120157.A15726@pc10.inb.mu-luebeck.de> Message-ID: On 12/8/03 11:01 am, "Jan T. Kim" wrote: > However, I've been thinking from time to time that it would sometimes > be handy to have a way to specify defaults for the EMBOSS programs, > e.g. by means of an environment variable or a dotfile. Have I overlooked > this? For example, it might be very convenient at times to change the > default format for sequence output from FASTA to something which > can accomodate more annotation information. If you read the administration guide, such default settings and how to override them are clearly documented. This has been in EMBOSS since 1.0.0 or earlier. The admin guide can be found on the emboss web site under the admin and setup section. ..d -- David Martin PhD Bioinformatics Scientific Officer Post-Genomics and Molecular Interactions Centre University of Dundee From d.m.a.martin at dundee.ac.uk Tue Aug 12 10:11:42 2003 From: d.m.a.martin at dundee.ac.uk (David Martin) Date: Tue, 12 Aug 2003 11:11:42 +0100 Subject: [EMBOSS] question about emma In-Reply-To: <20030812120157.A15726@pc10.inb.mu-luebeck.de> Message-ID: On 12/8/03 11:01 am, "Jan T. Kim" wrote: > However, I've been thinking from time to time that it would sometimes > be handy to have a way to specify defaults for the EMBOSS programs, > e.g. by means of an environment variable or a dotfile. Have I overlooked > this? For example, it might be very convenient at times to change the > default format for sequence output from FASTA to something which > can accomodate more annotation information. If you read the administration guide, such default settings and how to override them are clearly documented. This has been in EMBOSS since 1.0.0 or earlier. The admin guide can be found on the emboss web site under the admin and setup section. .d -- David Martin PhD Bioinformatics Scientific Officer Post-Genomics and Molecular Interactions Centre University of Dundee From henrikki.almusa at helsinki.fi Tue Aug 12 10:42:45 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Tue, 12 Aug 2003 13:42:45 +0300 Subject: [EMBOSS] question about emma Message-ID: <200308121342.45852.henrikki.almusa@helsinki.fi> On Tuesday 12 August 2003 13:11, David Martin wrote: > On 12/8/03 11:01 am, "Jan T. Kim" wrote: > > However, I've been thinking from time to time that it would sometimes > > be handy to have a way to specify defaults for the EMBOSS programs, > > e.g. by means of an environment variable or a dotfile. Have I overlooked > > this? For example, it might be very convenient at times to change the > > default format for sequence output from FASTA to something which > > can accomodate more annotation information. > > If you read the administration guide, such default settings and how to > override them are clearly documented. This has been in EMBOSS since 1.0.0 > or earlier. > > The admin guide can be found on the emboss web site under the admin and > setup section. I assume you mean "set emboss_output gcg" in either "~/.embossrc" or "emboss.default". That changes all the programs in emboss and not just one. I don't think there is program specific version of this (correct me if i'm wrong though). Anyone that can code might try to include setting like "set emboss_[program_name]_output gcg" in some future version? -- Henrikki Almusa From David.Bauer at SCHERING.DE Tue Aug 12 10:48:50 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Tue, 12 Aug 2003 12:48:50 +0200 Subject: [EMBOSS] question about emma Message-ID: That's correct but I think Jan is looking for something different. The current configuration options (.embossrc etc.) control mostly functions which are common to all programs (output format, stdout, auto etc.) But if one wants to change the default behaviour of a particular program the only way I see now is to creat an alternative set of acd files with these settings. Let's say I want to have matcher output always with -aformat markx2 and 3 alternatives. It would be convenient to have some kind of sections in .embossrc for programs similar to the DB sections: PROG matcher [ aformat: markx2 alternatives: 3 ] Cheers, David. On 12/8/03 11:01 am, "Jan T. Kim" wrote: > However, I've been thinking from time to time that it would sometimes > be handy to have a way to specify defaults for the EMBOSS programs, > e.g. by means of an environment variable or a dotfile. Have I overlooked > this? For example, it might be very convenient at times to change the > default format for sequence output from FASTA to something which > can accomodate more annotation information. If you read the administration guide, such default settings and how to override them are clearly documented. This has been in EMBOSS since 1.0.0 or earlier. The admin guide can be found on the emboss web site under the admin and setup section. ..d -- David Martin PhD Bioinformatics Scientific Officer Post-Genomics and Molecular Interactions Centre University of Dundee From siegmund at develogen.com Tue Aug 12 14:19:21 2003 From: siegmund at develogen.com (Thomas Siegmund) Date: Tue, 12 Aug 2003 16:19:21 +0200 Subject: [EMBOSS] ANNOUNCE: Kaptain GUI for EMBOSS Message-ID: <200308121619.21030.siegmund@develogen.com> Hello everybody, a new version of the Kaptain GUI for EMBOSS is finished. As far as I know, support for EMBOSS 2.71 is complete. Please correct me if I'm wrong. Due to some changed command line attributes in EMBOSS this version of the GUI will work only with EMBOSS >= 2.70. Download as usual at http://userpage.fu-berlin.de/~sgmd/download.html MacOS X users might want to wait until the latest version (0.92) arrives at the fink repository. Thanks to Koen van der Drift there is an easy to install package at http://fink.sourceforge.net/pdb/package.php/emboss-kaptain Recent changelog entries: Version 0.92 Support for EMBOSS 2.71 is complete !! - added tcode.kaptn Version 0.91 - redesign of showseq.kaptn to support all new showseq features - describe qualifier for extractfeat.kaptn - equivalences option for rebaseextract.kaptn - solofragment qualifier for restrict.kaptn - prefer qualifier for megamerger.kaptn - context qualifier for sirna.kaptn - tolower qualifier for maskseq.kaptn and maskfeat.kaptn - default output directory can be set in embosslauncher - clean option for transeq.kaptn - msf -> sequence in infoalign.kaptn - sequencea -> sequence in pepstats.kaptn, pepwindow.kaptn, iep.kaptn digest.kaptn, garnier.kaptn, - sequence(a,b) -> (a,b)sequence in dottup.kaptn, dotmatcher.kaptn, dotpath.kaptn, stretcher.kaptn - inseqs -> sequence in emma.kaptn - seq(a,b) -> (a,b)sequence in merger.kaptn, megamerger.kaptn Thanks to Koen van der Drift for bugreports Version 0.90 - small kaptain.071-fix for showseq.kaptn - mini-fix for getorf.kaptn: standard genetic code is "0", not "1". - "-stdout" was missing in infoalign.kaptn and infoseq.kaptn. Now "show" works. - sequencea -> asequence in needle.kaptn, water.kaptn, matcher.kaptn (EMBOSS 2.7) - fname -> infile in abiview.kaptn (EMBOSS 2.7) Have fun Thomas -- Thomas Siegmund, Ph.D. DeveloGen AG Bioinformatics and Data Management Phone: +49(551) 505 58 651 E-Mails k?nnen unvollst From aengus.stewart at cancer.org.uk Tue Aug 12 19:11:43 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Tue, 12 Aug 2003 20:11:43 +0100 Subject: [EMBOSS] JEMBOSS login prob References: <002201c34c71$80014c50$494de780@CIT.NIH.GOV> <3F16B5F4.6010602@ebi.ac.uk> <3F2A73B0.F9723489@cancer.org.uk> <3F2E9E5C.C7568720@cancer.org.uk> Message-ID: <3F393BEF.C404AEFA@cancer.org.uk> Hi, I am running the jemboss client at the command line ( runJemboss.csh ) and I am having problems whenever attempting to select "Local and remote files". I get the following in a java dialogue box "Login to server failed please check your login details" at the command line I get "Exception in PrivateRequest Authentication Failed" and in the log file catalina.out I get "Failed Authorisation aengus STDERR java_pipe_read timeout java_rcv error Pipe Recv error 1" What makes it strange it that it accepts the username and password on login. Tomcat is stopped and started using tomstop/tomstart and run by user tomcat deploy.csh was run on the command line. I am guessing this is a permissions problem but havent a clue which file needs changing. Help! Cheers Aengus From tcarver at hgmp.mrc.ac.uk Tue Aug 12 19:28:01 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Tue, 12 Aug 2003 20:28:01 +0100 (BST) Subject: [EMBOSS] JEMBOSS login prob In-Reply-To: <3F393BEF.C404AEFA@cancer.org.uk> Message-ID: Hi Aengus I am guessing that you cannot run any of the EMBOSS applications as well? Or can you run embossversion via the interface for example? You should check that as root you have changed the permissions on: chown root $EMBOSS_INSTALL/bin/jembossctl chmod u+s $EMBOSS_INSTALL/bin/jembossctl Btw, why did you need to run deploy.csh? Did the services not get deployed with the install script? Tim > Hi, > > I am running the jemboss client at the command line ( runJemboss.csh ) > and I am having problems whenever attempting to select "Local and remote > files". > > I get the following in a java dialogue box > > "Login to server failed > please check your login details" > > at the command line I get > "Exception in PrivateRequest Authentication Failed" > > and in the log file catalina.out I get > "Failed Authorisation aengus > STDERR java_pipe_read timeout > java_rcv error > Pipe Recv error 1" > > What makes it strange it that it accepts the username and password on > login. > > > Tomcat is stopped and started using tomstop/tomstart and run by user > tomcat > > deploy.csh was run on the command line. > > I am guessing this is a permissions problem but havent a clue which file > needs changing. > > Help! > > > Cheers > Aengus > From aengus.stewart at cancer.org.uk Tue Aug 12 19:40:47 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Tue, 12 Aug 2003 20:40:47 +0100 Subject: [EMBOSS] JEMBOSS login prob References: Message-ID: <3F3942BF.14656401@cancer.org.uk> "Dr T. Carver" wrote: > > Hi Aengus > > I am guessing that you cannot run any of the EMBOSS applications as well? > Or can you run embossversion via the interface for example? You are absolutely correct - nothing works ( *groan* ) > You should check that as root you have changed the permissions on: > > chown root $EMBOSS_INSTALL/bin/jembossctl > chmod u+s $EMBOSS_INSTALL/bin/jembossctl > Yup I had done that - it has permissions as follows 152 -rwsr-xr-x 1 root cgal 77312 Aug 12 18:27 jembossctl > Btw, why did you need to run deploy.csh? Did the services not get deployed > with the install script? > Its a long story. Basically we are getting a new server and there is no way in a million years the sysadmin team will let me be root. Also probably being "tomcat" is out. Therefore I was attempting to discover on my own machine what bits of the install I can do and what requires user tomcat and root - so I could go to the sysadmins with a breakdown of what I had to do and what they had to do. Hence I was changing the permissions on /usr/java2/tomcat/webapps and /usr/java2/tomcat/shared and then running the script as myself this all worked file apart from the deployment was of course failing. I was then switching to user tomcat and running tomstop tomstart deploy.csh tomstop tomstart runJemboss.csh It all seemed to work fine apart from the small detail that it doesnt work! Aengus -- ---------------------------------------------------------------------------- Aengus Stewart Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ---------------------------------------------------------------------------- From tcarver at hgmp.mrc.ac.uk Tue Aug 12 19:57:01 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Tue, 12 Aug 2003 20:57:01 +0100 (BST) Subject: [EMBOSS] JEMBOSS login prob In-Reply-To: <3F3942BF.14656401@cancer.org.uk> Message-ID: Hmmm. Did you give the install script the correct UID then (i.e. tomcat uid and not yours)? You can double check what it is by looking in EMBOSS-2.x.x/config.status to see what it was set as (-DTOMCAT_UID). They will not let you have a non-priveleged 'tomcat' a/c on your new machine? All they would need to do is change the permissions on 'jembossctl' for you then! Tim On Tue, 12 Aug 2003, Aengus Stewart wrote: > "Dr T. Carver" wrote: > > > > Hi Aengus > > > > I am guessing that you cannot run any of the EMBOSS applications as well? > > Or can you run embossversion via the interface for example? > > You are absolutely correct - nothing works ( *groan* ) > > > You should check that as root you have changed the permissions on: > > > > chown root $EMBOSS_INSTALL/bin/jembossctl > > chmod u+s $EMBOSS_INSTALL/bin/jembossctl > > > > Yup I had done that - it has permissions as follows > > 152 -rwsr-xr-x 1 root cgal 77312 Aug 12 18:27 jembossctl > > > > Btw, why did you need to run deploy.csh? Did the services not get deployed > > with the install script? > > > > Its a long story. > > Basically we are getting a new server and there is no way in a million > years the sysadmin team will let me be root. > Also probably being "tomcat" is out. > > Therefore I was attempting to discover on my own machine what bits of > the install I can do and what requires user tomcat and root - so I could > go to the sysadmins with a breakdown of what I had to do and what they > had to do. > > Hence I was changing the permissions on /usr/java2/tomcat/webapps and > /usr/java2/tomcat/shared and then running the script as myself this all > worked file apart from the deployment was of course failing. > > I was then switching to user tomcat and running > > tomstop > tomstart > deploy.csh > tomstop > tomstart > runJemboss.csh > > It all seemed to work fine apart from the small detail that it doesnt > work! > > > Aengus > > -- > ---------------------------------------------------------------------------- > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK > ---------------------------------------------------------------------------- > From aengus.stewart at cancer.org.uk Tue Aug 12 20:06:24 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Tue, 12 Aug 2003 21:06:24 +0100 Subject: [EMBOSS] JEMBOSS login prob References: Message-ID: <3F3948C0.319AED0F@cancer.org.uk> "Dr T. Carver" wrote: > > Hmmm. Did you give the install script the correct UID then (i.e. tomcat > uid and not yours)? You can double check what it is by looking in > EMBOSS-2.x.x/config.status to see what it was set as (-DTOMCAT_UID). > I have Checked that it is correct from config.status with options \"'--with-java=/usr/java2/include/' '--with-javaos=/usr/java2/include//irix' '--with-thread=irix' '--prefix=/usr/local/mbsoftware/emboss' '--with-auth=shadow' '--with-pngdriver=/usr/freeware' 'CC=cc -DTOMCAT_UID=60003 ' 'LDFLAGS=-L/usr/freeware/lib32 -L/usr/freeware/lib'\" from /etc/passwd tomcat:x:60003:60003:Tomcat tiddly mouse:/usr/people/tomcat:/bin/ksh > They will not let you have a non-priveleged 'tomcat' a/c on your new > machine? All they would need to do is change the permissions on > 'jembossctl' for you then! > I imagine this could be negotiated but as this service will be externally available ( though authenticated ) they will nail down what is available by the web. However if it cant be fixed as it is then at least I have these emails to convince them with! Thanks for the help Tim. Cheers Aengus -- ---------------------------------------------------------------------------- Aengus Stewart Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ---------------------------------------------------------------------------- From kvddrift at earthlink.net Tue Aug 12 21:28:29 2003 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 12 Aug 2003 17:28:29 -0400 Subject: [EMBOSS] ANNOUNCE: Kaptain GUI for EMBOSS In-Reply-To: <200308121619.21030.siegmund@develogen.com> Message-ID: On Tuesday, August 12, 2003, at 10:19 AM, Thomas Siegmund wrote: > MacOS X users might want to wait until the latest version (0.92) > arrives at > the fink repository. Thanks to Koen van der Drift there is an easy to > install > package at > http://fink.sourceforge.net/pdb/package.php/emboss-kaptain > All credit of course goes to Thomas for maing the scripts! I just made a fink package to install them on Mac OS X. Note that this version of the scripts (0.92) has been submitted to fink, but is not yet added to the tree, so the current version available through fink is 0.90. I hope the fink team will add it asap. thanks, - Koen. From David.Bauer at SCHERING.DE Wed Aug 13 09:10:39 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Wed, 13 Aug 2003 11:10:39 +0200 Subject: [EMBOSS] pepwindow graphical output Message-ID: Hello, with pepwindow it is now possible to use alternative aa property scales from the aaindex database. But the plot always has the title: "Kyte-Doolitle Plot". Would it be possible to take the "D" line from the datafile as plot title ? Thanks, David. From emb at TOM.COM Thu Aug 14 23:38:41 2003 From: emb at TOM.COM (Shigeru Bower) Date: Thu, 14 Aug 2003 23:38:41 GMT Subject: [EMBOSS] teletypesetting Message-ID: An HTML attachment was scrubbed... URL: From aengus.stewart at cancer.org.uk Fri Aug 15 10:30:36 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Fri, 15 Aug 2003 11:30:36 +0100 Subject: [EMBOSS] -inf stdin printsextract problem? References: Message-ID: <3F3CB64C.46D33AB6@cancer.org.uk> Hi, This is with 2.7.1 Apollo>gunzip -c prints37_0.dat.gz | printsextract -inf stdin Extract data from PRINTS EMBOSS An error in printsextract.c at line 410: Premature EOF If I uncompress the dat file and then do printsextract prints37_0.dat Extract data from PRINTS It runs OK. I checked it with 2.6.0 And I get Extract data from PRINTS EMBOSS An error in printsextract.c at line 448: Premature EOF Cheers Aengus From David.Bauer at SCHERING.DE Mon Aug 18 05:43:22 2003 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Mon, 18 Aug 2003 07:43:22 +0200 Subject: [EMBOSS] GDE Message-ID: Hello, has anybody tried to convert ACD to GDEmenus ? Cheers, David. From aengus.stewart at cancer.org.uk Tue Aug 19 15:16:40 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Tue, 19 Aug 2003 16:16:40 +0100 Subject: [EMBOSS] Jemboss 1.1 signed files References: Message-ID: <3F423F58.1E7F805E@cancer.org.uk> Hi, I was wondering how to take the 1.1.zip and create signed files so I can put them in my webserver tree. I imagined it was just a case of taking the jar files and replacing the old versions in /share/EMBOSS/jemboss/lib [axis] with the new ones and then running makeJNLP.sh again? However I am left with the two new files grout.jar JembossPrintAlignment.jar What do I do with them? -- ---------------------------------------------------------------------------- Aengus Stewart Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ---------------------------------------------------------------------------- From tcarver at hgmp.mrc.ac.uk Tue Aug 19 15:41:28 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Tue, 19 Aug 2003 16:41:28 +0100 (BST) Subject: [EMBOSS] Jemboss 1.1 signed files In-Reply-To: <3F423F58.1E7F805E@cancer.org.uk> Message-ID: The Jemboss-1.1.zip provided is specific to the HGMP-RC Jemboss server and contains for example the 'jemboss.properties' for the HGMP site. This zip is intended for users at the HGMP that are running the GUI as an alternative to Java Web Start. There are other differences that you have noted that means 'makeJNLP.sh' also has changed. This is all available in the CVS download but I recommend sticking with Jemboss-1.0 until the next release of EMBOSS. Hope this helps Tim > Hi, > > I was wondering how to take the 1.1.zip and create signed files so I can > put them in my webserver tree. > > I imagined it was just a case of taking the jar files and replacing the > old versions in > > /share/EMBOSS/jemboss/lib [axis] with the new ones and then running > makeJNLP.sh again? > > However I am left with the two new files > > grout.jar > JembossPrintAlignment.jar > > What do I do with them? > > > > > -- > ---------------------------------------------------------------------------- > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK > ---------------------------------------------------------------------------- > From aengus.stewart at cancer.org.uk Tue Aug 19 17:26:53 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Tue, 19 Aug 2003 18:26:53 +0100 Subject: [EMBOSS] Notes about emma References: Message-ID: <3F425DDD.F257D3A@cancer.org.uk> Hi, Some queries about emma emma -help -verbose gives the following section "-outseq" related qualifiers -osformat2 string Output seq format -osextension2 string File name extension -osname2 string Base file name -osdirectory2 string Output directory -osdbname2 string Database name to add -ossingle2 boolean Separate file for each entry -oufo2 string UFO features -offormat2 string Features format -ofname2 string Features file name -ofdirectory2 string Output directory "-dendoutfile" related qualifiers -odirectory3 string Output directory Though at the command line emma -osformat clustal or emma -osformat2 clustal or emma -osf clustal seem to work just as well. -osformat2 seems to be a red herring? Slightly more worrying is the clustal format header which the above commands put in the .aln file CLUSTAL W(1.4) multiple sequence alignment I have just trawled the system and the only clustalw on it is from 1.82 If I run it as clustalw I get the correct CLUSTAL W (1.82) multiple sequence alignment Cheers Aengus From pmr at ebi.ac.uk Wed Aug 20 09:53:44 2003 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Wed, 20 Aug 2003 10:53:44 +0100 (BST) Subject: [EMBOSS] Notes about emma In-Reply-To: <3F425DDD.F257D3A@cancer.org.uk> References: <3F425DDD.F257D3A@cancer.org.uk> Message-ID: <1142.217.134.66.24.1061373224.squirrel@webmail.ebi.ac.uk> Hi Aengus, > Some queries about emma > > Though at the command line > emma -osformat clustal > or > emma -osformat2 clustal > or > emma -osf clustal > seem to work just as well. > > -osformat2 seems to be a red herring? All these names are valid. EMBOSS accepts any unambiguous short qualifier names, so -osformat can naturally be reduced to -osf. The '2' is to allow several -osformat associated qualifiers to have unique names. Without the '2' -osformat refers to the current outseq, or to all outseqs. > Slightly more worrying is the clustal format header which the above > commands put in the .aln file > > CLUSTAL W(1.4) multiple sequence alignment EMBOSS rewrites the ALN file as a general ALN format. The version number is part of the EMBOSS 'clustal' format specification, and has no relation to the clustal version used by emma. Hope this helps, Peter From kmr at sanger.ac.uk Wed Aug 20 13:28:30 2003 From: kmr at sanger.ac.uk (Kim Rutherford) Date: Wed, 20 Aug 2003 14:28:30 +0100 Subject: [EMBOSS] Problem writing sequence files Message-ID: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> Hi. I'm trying to write a sequence to a named file. I tried this: AjPFile seqout_file = ajFileNewOut(seqout_name); AjPSeqout named_seqout = ajSeqoutNewF(seqout_file); AjPStr format_str = ajStrNew(); ajStrAssC(&format_str, "embl"); ajSeqOutSetFormat(named_seqout, format_str); ajSeqWrite(named_seqout, subseq); I get a segmentation fault and this backtrace: #0 0x1200b27a0 in ajFmtPrintF (file=0x0, fmt=0x1400172ce "ID %-10.10S standard; DNA; UNC; %d BP.\n") at ajfmt.c:1118 #1 0x12008c6a4 in seqWriteEmbl (outseq=0x140057840) at ajseqwrite.c:1956 #2 0x120087ae4 in ajSeqWrite (outseq=0x140057840, seq=0x140057700) at ajseqwrite.c:540 #3 0x120019c10 in splitter_write (default_seqout=0x140057ac0, subseq=0x140057700, start=0, end=1139, seq=0x140048f00, seqout_name=0x14008b4a0) at splitter.c:179 #4 0x120019dd8 in splitter_ProcessChunk (seqout=0x140057ac0, seq=0x140048f00, start=0, end=1139, outseq_name=0x14008b4a0) at splitter.c:207 #5 0x120019844 in main (argc=4, argv=0x11fffc018) at splitter.c:87 It appears that named_seqout->File is null and ajSeqWrite() is expecting it to be non-null. Should I be calling a function other than ajSeqoutNewF() to create the AjPSeqout object (ie. named_seqout)? I'd appreciate if someone could let me know what I'm doing wrong or point me to some example code that does something similar. Thanks in advance, Kim. From aengus.stewart at cancer.org.uk Wed Aug 20 16:50:37 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Wed, 20 Aug 2003 17:50:37 +0100 Subject: [EMBOSS] Testing as if user - Antigenic References: <3F425DDD.F257D3A@cancer.org.uk> <1142.217.134.66.24.1061373224.squirrel@webmail.ebi.ac.uk> Message-ID: <3F43A6DC.ACB9258F@cancer.org.uk> Hi, I am going through the software attempting to test it as if I was a user ie doing the things I shouldnt. I have just given antigenic a DNA seq rather than a PROT seq and it gives at first glance what appears to be a reasonable result file. ######################################## # Program: antigenic # Rundate: Wed Aug 20 17:49:57 2003 # Report_format: motif # Report_file: btmg.dna.antigenic ######################################## #======================================= # # Sequence: BTMG from: 1 to: 1077 # HitCount: 35 #======================================= Max_score_pos at "*" (1) Score 1.362 length 48 at bases 519->566 * Sequence: CTTCCATGGCTAAGCCCCACCCCTGTGCCCCTCACCCCACCCACCTGG | | 519 566 (2) Score 1.335 length 30 at bases 10->39 * Sequence: GAGACAGACACCCAGTCAGTCCCGCCCTTG | | 10 39 It has recognised that the file was DNA rather than PROT as it has bases rather than residues in the headers. However having detected that the sequence is DNA should it run at all? Aengus From kmr at sanger.ac.uk Thu Aug 21 11:22:34 2003 From: kmr at sanger.ac.uk (Kim Rutherford) Date: Thu, 21 Aug 2003 12:22:34 +0100 Subject: [EMBOSS] Re: Problem writing sequence files In-Reply-To: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> Message-ID: <16196.43898.864303.718746@pcs2b.internal.sanger.ac.uk> On Wed, 20 Aug 2003 14:28:30 +0100, Kim Rutherford wrote: > Hi. I'm trying to write a sequence to a named file. I tried this: > AjPFile seqout_file = ajFileNewOut(seqout_name); > AjPSeqout named_seqout = ajSeqoutNewF(seqout_file); > AjPStr format_str = ajStrNew(); > ajStrAssC(&format_str, "embl"); > ajSeqOutSetFormat(named_seqout, format_str); > ajSeqWrite(named_seqout, subseq); > I get a segmentation fault ... I've realised that I don't need to do any of this in my application, I just need to add -ossingle to the command line to get the functionality I need. Sorry for the waste of time. Kim. From aengus.stewart at cancer.org.uk Thu Aug 21 16:12:40 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Thu, 21 Aug 2003 17:12:40 +0100 Subject: [EMBOSS] change to entret? References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> <16196.43898.864303.718746@pcs2b.internal.sanger.ac.uk> Message-ID: <3F44EF78.6BA9E7C2@cancer.org.uk> Hi The documentation says that entret will not return sequence from a GCG formatted database. It seems to returning the documentation and sequence in 2.7.1 This is very nice. Aengus From pmr at ebi.ac.uk Thu Aug 21 16:22:08 2003 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 21 Aug 2003 17:22:08 +0100 (BST) Subject: [EMBOSS] change to entret? In-Reply-To: <3F44EF78.6BA9E7C2@cancer.org.uk> References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> <16196.43898.864303.718746@pcs2b.internal.sanger.ac.uk> <3F44EF78.6BA9E7C2@cancer.org.uk> Message-ID: <1170.217.134.90.57.1061482928.squirrel@webmail.ebi.ac.uk> Hi Aengus, > The documentation says that entret will not return sequence from a GCG > formatted database. > > It seems to returning the documentation and sequence in 2.7.1 > > This is very nice. Thanks. We will update the documentation. Entret depends on the database access method and format parsing storing the entire text. When reading a GCG formatted database EMBOSS has to generate the sequence from the binary encoding. It now converts this into a sequence in a reasonable format when text is saved (i.e. when entret is being run). regards, Peter Rice From pmr at ebi.ac.uk Thu Aug 21 16:22:08 2003 From: pmr at ebi.ac.uk (pmr at ebi.ac.uk) Date: Thu, 21 Aug 2003 17:22:08 +0100 (BST) Subject: [EMBOSS] change to entret? In-Reply-To: <3F44EF78.6BA9E7C2@cancer.org.uk> References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> <16196.43898.864303.718746@pcs2b.internal.sanger.ac.uk> <3F44EF78.6BA9E7C2@cancer.org.uk> Message-ID: <1170.217.134.90.57.1061482928.squirrel@webmail.ebi.ac.uk> Hi Aengus, > The documentation says that entret will not return sequence from a GCG > formatted database. > > It seems to returning the documentation and sequence in 2.7.1 > > This is very nice. Thanks. We will update the documentation. Entret depends on the database access method and format parsing storing the entire text. When reading a GCG formatted database EMBOSS has to generate the sequence from the binary encoding. It now converts this into a sequence in a reasonable format when text is saved (i.e. when entret is being run). regards, Peter Rice From triciavelazquez_cg at catseye.mb.ca Thu Aug 21 17:36:21 2003 From: triciavelazquez_cg at catseye.mb.ca (Tricia Velazquez) Date: Thu, 21 Aug 2003 21:36:21 +0400 Subject: [EMBOSS] Remembe=?iso-8859-1?B?ciB0aGE=?=t lady? Message-ID: <784101c3680a$67946435$2f264fd5@ohn26f2> An HTML attachment was scrubbed... URL: From aengus.stewart at cancer.org.uk Thu Aug 21 17:36:37 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Thu, 21 Aug 2003 18:36:37 +0100 Subject: [EMBOSS] seqret jemboss comment References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> <16196.43898.864303.718746@pcs2b.internal.sanger.ac.uk> <3F44EF78.6BA9E7C2@cancer.org.uk> <1170.217.134.90.57.1061482928.squirrel@webmail.ebi.ac.uk> Message-ID: <3F450325.DCF19A52@cancer.org.uk> Hi, I have noticed that seqret is confusing for the users. You specify start and end reverse etc in the input sequence attribute and the output format in the output sequence attributes. The users tend to see all of these as output options and they get confused as they dont think they are inputting anything. Aengus -- ---------------------------------------------------------------------------- Aengus Stewart Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ---------------------------------------------------------------------------- From tcarver at hgmp.mrc.ac.uk Fri Aug 22 10:50:07 2003 From: tcarver at hgmp.mrc.ac.uk (Dr T. Carver) Date: Fri, 22 Aug 2003 11:50:07 +0100 (BST) Subject: [EMBOSS] seqret jemboss comment In-Reply-To: <3F450325.DCF19A52@cancer.org.uk> Message-ID: I guess the point is these options in emboss are seen as common operations on the input sequences. It just happens that the input sequence in seqret is the output sequence. I don't think this should change the GUI as it is a common concept throughout the programs but maybe should be made clear in the help documentation (that we are working on) for Jemboss. Tim On Thu, 21 Aug 2003, Aengus Stewart wrote: > > Hi, > > I have noticed that seqret is confusing for the users. > > You specify start and end reverse etc in the input sequence attribute > and the output format in the output sequence attributes. The users tend > to see all of these as output options and they get confused as they dont > think they are inputting anything. > > > > Aengus > > -- > ---------------------------------------------------------------------------- > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK > ---------------------------------------------------------------------------- > From urbe at liverpool.ac.uk Fri Aug 22 12:48:00 2003 From: urbe at liverpool.ac.uk (Sylvie =?iso-8859-1?Q?Urb=E9?=) Date: Fri, 22 Aug 2003 13:48:00 +0100 Subject: No subject Message-ID: Does EMBOSS contain an application that allows introduction of new restrictionsites as silent mutations in a given ORF? -- Sylvie Urb?, PhD The Physiological Laboratory University of Liverpool Crown Street Liverpool L69 3BX Phone: 0151 794 5432 (office) 0151 794 5729 (lab) Fax: 0151 794 4434 From simon.andrews at bbsrc.ac.uk Fri Aug 22 12:45:45 2003 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Fri, 22 Aug 2003 13:45:45 +0100 Subject: [EMBOSS] RE: Silent Mutations Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28B31@bi-exsrv1.iapc.bbsrc.ac.uk> > -----Original Message----- > From: Sylvie Urb? [mailto:urbe at liverpool.ac.uk] > Sent: 22 August 2003 13:48 > To: emboss at embnet.org > Subject: > > > Does EMBOSS contain an application that allows > introduction of new restrictionsites as silent > mutations in a given ORF? If you're not sure of the name of an EMBOSS program to perform a specific task (or even if one exists at all), you can use the wossname program to search for it. In this case: $ wossname mutation Finds programs by keywords in their one-line documentation SEARCH FOR 'MUTATION' silent Silent mutation restriction enzyme scan Once you've found a likely program you can read its full documentation using tfm $ tfm silent Displays a program's help documentation manual silent Function Silent mutation restriction enzyme scan Description silent does a scan of a nucleic acid sequence for silent mutation restriction enzyme sites. silent finds positions in a sequence where a point mutation could be made to introduce a specified restriction enzyme recognition site without changing the translation. Hope this helps Simon. From maoj at mail.nih.gov Fri Aug 22 13:09:30 2003 From: maoj at mail.nih.gov (Jean Mao) Date: Fri, 22 Aug 2003 09:09:30 -0400 Subject: [EMBOSS] question about EMBOSS-GUI help system Message-ID: <004801c368ae$9fc06450$494de780@CIT.NIH.GOV> Hi, I have installed emboss-gui from Luke McCarthy on our test server. I am trying to solve a problem and your help will be greatly appreciated. Problem: I selected a program on left panel, clicked on the 'help' link on right panel, clicked the 'go' link, the detail info about that specific program will be displayed. there are 2 links in this page 'go to the input files for this example' and 'go to the output files for this example'. When I click on either link, instead of taking me to where the input/output files are at the lower part of the same page, it will take me back to the EMBOSS-GUI homepage which is the same page I click 'help' image. Since the help page is created on the run, I assume the #input and #output in the html code failed to find the tag and therefore load the base html page. For your info, the following is the info I entered at the install.sh prompt, I also modified the file /usr/local/lib/perl5/site_perl/5.6.1/EMBOSS/GUI.pm (see below): -------------------------------------------------------------------------------------------------------------- # bsh install.sh Writing Makefile for EMBOSS::ACD Manifying blib/man3/EMBOSS::ACD.3 Installing /usr/freeware/catman/p_man/man3/EMBOSS::ACD.3 Writing /usr/local/lib/perl5/site_perl/5.6.1/irix-n32/auto/EMBOSS/ACD/.packlist Appending installation info to /usr/freeware/lib/perl5/5.6.1/irix-n32/perllocal.pod Writing Makefile for EMBOSS::GUI Manifying blib/man3/EMBOSS::GUI.3 Manifying blib/man3/EMBOSS::GUI.3 Installing /usr/local/lib/perl5/site_perl/5.6.1/EMBOSS/GUI.pm Installing /usr/freeware/catman/p_man/man3/EMBOSS::GUI.3 Writing /usr/local/lib/perl5/site_perl/5.6.1/irix-n32/auto/EMBOSS/GUI/.packlist Appending installation info to /usr/freeware/lib/perl5/5.6.1/irix-n32/perllocal.pod /usr/local/bin/perl postamble.pl /usr/local/bin/perl Please answer the following questions to set up EMBOSS::GUI: Where was EMBOSS installed? [ default is /usr/local ] > /usr/localapps/emboss Where was the EMBOSS data installed? [ default is /usr/localapps/emboss/share/EMBOSS ] > Where were the EMBOSS binaries installed? [ default is /usr/localapps/emboss/bin ] > Where is the root of the web server document tree? [ default is /home/httpd ] > /info/www1/htdocs Where should the EMBOSS::GUI HTML files be installed? [ default is /info/www1/htdocs/html/EMBOSS ] > /info/www1/htdocs/EMBOSS-GUI What is the hostname of the web server EMBOSS::GUI will be installed on? [ default is localhost ] > nimbus.nih.gov:8888 What is the URL corresponding to the HTML directory above? [ default is http://nimbus.nih.gov:8888/EMBOSS ] > http://nimbus.nih.gov:8888/EMBOSS-GUI Where should the EMBOSS::GUI CGI script be installed? [ default is /info/www1/htdocs/cgi-bin ] > /info/www1/cgi-bin What is the URL corresponding to the CGI directory above? [ default is http://nimbus.nih.gov:8888/cgi-bin ] > Installing EMBOSS::GUI HTML files... Generating default configuration files... Finds or fetches the data files read in by the EMBOSS programs And that should just about do it. Point your browser at http://nimbus.nih.gov:8888/EMBOSS-GUI/index.html to try it out... Please report any errors or strange occurrences to lukem at bioinfo.pbi.nrc.ca ------------------------------------------------------------------------------------------------------------- modify /usr/local/lib/perl5/site_perl/5.6.1/EMBOSS/GUI.pm: ----------------------------------------------------------------------------------------- command out line $ENV{'PLPLOT_LIB'} = "$EMBOSS_HOME"; add $ENV{'PLPLOT_LIB'} = "/usr/localapps/emboss/plplot/lib"; $ENV{'EMBOSSRC'} = "/usr/localapps/emboss"; change $ENV{'PATH'} = "$EMBOSS_BIN:/bin"; to $ENV{'PATH'} = "$EMBOSS_BIN:/bin /usr/local/bin"; ------------------------------------------------------------------------------------------- chmod a+r /info/www1/htdocs/EMBOSS-GUI/images/ Thank you very much. Jean -------------- next part -------------- An HTML attachment was scrubbed... URL: From pmr at ebi.ac.uk Fri Aug 22 14:30:26 2003 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 22 Aug 2003 15:30:26 +0100 Subject: [EMBOSS] Problem writing sequence files References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> Message-ID: <3F462902.5050209@ebi.ac.uk> Kim Rutherford wrote: > Hi. I'm trying to write a sequence to a named file. I tried this: > > AjPFile seqout_file = ajFileNewOut(seqout_name); > AjPSeqout named_seqout = ajSeqoutNewF(seqout_file); > > I get a segmentation fault and this backtrace: > I'd appreciate if someone could let me know what I'm doing wrong or > point me to some example code that does something similar. It is a bug. ajSeqoutNewF creates a sequence output object with an open file - but stores it as a "Knownfile" attribute. It was used in the USA processing, but ignored if you call ajSeqWrite directly. An easy fix - it will work in the next release ... and I see you already found it works nicely - and in the true EMBOSS style - when you do all the hard work in the ACD file. regards, Peter Rice From kmr at sanger.ac.uk Fri Aug 22 14:42:14 2003 From: kmr at sanger.ac.uk (Kim Rutherford) Date: Fri, 22 Aug 2003 15:42:14 +0100 Subject: [EMBOSS] Problem writing sequence files In-Reply-To: <3F462902.5050209@ebi.ac.uk> References: <16195.30590.557878.936867@pcs2b.internal.sanger.ac.uk> <3F462902.5050209@ebi.ac.uk> Message-ID: <16198.11206.753722.596951@pcs2b.internal.sanger.ac.uk> On Fri, 22 Aug 2003 15:30:26 +0100, Peter Rice wrote: > Kim Rutherford wrote: >> Hi. I'm trying to write a sequence to a named file. I tried this: >> >> AjPFile seqout_file = ajFileNewOut(seqout_name); >> AjPSeqout named_seqout = ajSeqoutNewF(seqout_file); >> >> I get a segmentation fault and this backtrace: >> I'd appreciate if someone could let me know what I'm doing wrong or >> point me to some example code that does something similar. > It is a bug. > ajSeqoutNewF creates a sequence output object with an open file - but > stores it as a "Knownfile" attribute. It was used in the USA processing, > but ignored if you call ajSeqWrite directly. > An easy fix - it will work in the next release ... and I see you already > found it works nicely - and in the true EMBOSS style - when you do all > the hard work in the ACD file. Thanks for that. I've changed my strategy, but it still may be useful for me later. I'll do a "cvs update". Kim. From mccarthy at cs.usask.ca Fri Aug 22 15:51:55 2003 From: mccarthy at cs.usask.ca (Luke McCarthy) Date: 22 Aug 2003 09:51:55 -0600 Subject: [EMBOSS] question about EMBOSS-GUI help system In-Reply-To: <004801c368ae$9fc06450$494de780@CIT.NIH.GOV> References: <004801c368ae$9fc06450$494de780@CIT.NIH.GOV> Message-ID: <1061567515.7096.4.camel@crazyharry.usask.ca> On Fri, 2003-08-22 at 07:09, Jean Mao wrote: > Problem: > I selected a program on left panel, clicked on the 'help' link on > right panel, clicked the 'go' link, the detail info about that > specific program will be displayed. there are 2 links in this page 'go > to the input files for this example' and 'go to the output files for > this example'. When I click on either link, instead of taking me to > where the input/output files are at the lower part of the same page, > it will take me back to the EMBOSS-GUI homepage which is the same page > I click 'help' image. Since the help page is created on the run, I > assume the #input and #output in the html code failed to find the tag > and therefore load the base html page. The problem is that the GUI sticks a tag in the header of each page it generates. This isn't necessary at all anymore, so I'll fix the code and put up a new package at http://bioinfo.pbi.nrc.ca/~lukem/ I'll reply to this thread when the new version is up. Cheers, Luke -- Luke McCarthy Research Officer, Bioinformatics Department of Computer Science University of Saskatchewan mccarthy at cs.usask.ca From mccarthy at cs.usask.ca Fri Aug 22 16:28:18 2003 From: mccarthy at cs.usask.ca (Luke McCarthy) Date: 22 Aug 2003 10:28:18 -0600 Subject: [EMBOSS] question about EMBOSS-GUI help system In-Reply-To: <1061567515.7096.4.camel@crazyharry.usask.ca> References: <004801c368ae$9fc06450$494de780@CIT.NIH.GOV> <1061567515.7096.4.camel@crazyharry.usask.ca> Message-ID: <1061569698.7134.26.camel@crazyharry.usask.ca> A new version of the EMBOSS-GUI code is up at http://bioinfo.pbi.nrc.ca/~lukem/EMBOSS/ (you can download directly from http://bioinfo.pbi.nrc.ca/~lukem/EMBOSS/EMBOSS-GUI.tar.gz) Note that the URL differs from the one I gave in the previous message. Mea culpa. I have removed from the header that which was breaking internal links in the application manual pages. So now when you click on 'Go to the input files for this example', you should actually go there... Even if you have previously installed the GUI, you can simply rerun the install script and the new version will replace the old one. Email me if you have any problems. Cheers, Luke -- Luke McCarthy Research Officer, Bioinformatics Department of Computer Science University of Saskatchewan mccarthy at cs.usask.ca From kellert at ohsu.edu Fri Aug 22 16:50:15 2003 From: kellert at ohsu.edu (Thomas Keller) Date: Fri, 22 Aug 2003 09:50:15 -0700 Subject: [EMBOSS] update logistics Message-ID: Greetings, I was 'getting into" emboss several months ago. I have version 2.5.1 installed on my machine. Then work exigencies arose and I could not do any work with it. Now I'm trying to get back to it, but am perplexed about the best way to update the programs. My machine is running Mac OSX 10.2.6 and I have fink installed, though I installed Emboss from a disk image/installer provided by The BioTeam (Bill VanEttan) which puts it at /usr/local/biotools/bin/. For someone who is not a computer scientist, just a biochemist trying to develop bioinformatics as a service for the clients of his DNA core faciity, what do the cognoscenti recommend? Thanks, Tom K. Tom Keller, Ph.D. http://www.ohsu.edu/core kellert at ohsu.edu 503-494-2442 From bgibbon at email.arizona.edu Fri Aug 22 19:17:11 2003 From: bgibbon at email.arizona.edu (Bryan Gibbon) Date: Fri, 22 Aug 2003 12:17:11 -0700 Subject: [EMBOSS] update logistics In-Reply-To: Message-ID: <5.0.2.1.0.20030822112643.00a8d210@bgibbon.inbox.email.arizona.edu> Tom, I use a similar setup. In order to be able to have current EMBOSS releases I download and compile with the source code from HGMP with the following commands. cd ~/src (or the directory you downloaded the file to) tar -xvzf EMBOSS*.gz ./configure --prefix=/usr/local/biotools make sudo make install This places all of the binaries and libraries etc. in the Biotools installation directories and it works great. Of course you have to install the Developer tools (on the hard drive in "/Applications/Installers") and Xfree86 packages (available from the Apple web site on the Mac OS X tab, Downloads, Unix & Open Source). Hope this helps, Bryan Gibbon University of Arizona Department of Plant Sciences Forbes 303 Tucson AZ 85721-0036 USA Tel: (520) 621-9154 FAX: (520) 621-3692 http://ag.arizona.edu/research/larkinslab/ From franchise-invite at gawab.com Mon Aug 25 19:49:14 2003 From: franchise-invite at gawab.com (Yen) Date: Tue, 26 Aug 2003 03:49:14 +0800 Subject: [EMBOSS] Business Opportunity - Master Franchise for Education Services Message-ID: <20030825195318.186D87D0E4@mercury.hgmp.mrc.ac.uk> Global Business For You Program For Success The Secret to Wealth Creation Is to ride on trend like you surf a wave... ... the SkyQuestCom Tidal Wave SkyQuestCom has been chalking up milestones and revolutionizing the way we work, play and learn ever since it exploded into the e-learning scene. IT'S LIKE NO OTHER SkyQuestCom is the world's first multimedia e-learning portal to deliver Live and Archived learning events on a regular basis. LIVE Webcasts Twice a Month Internationally renowned speakers are brought into your living room or office LIVE twice a month to talk to you about corporate and personal development, lifestyle and family issues. Highly sought-after experts like Robert Kiyosaki, Corey Rudl, Anthony Robbins and Harvey Mackay teach you all they know and answer your questions in REAL TIME. Unlimited Access to Hundreds of Seminars Imagine having the world's leading experts at your disposal 24 hours a day, 7 days a week; guiding you through your professional and personal development. Over 4,000 of the latest books by the world's most respected authors Pages and pages of invaluable information you can absorb over and over again, without the inconvenience of traveling to a bookstore or library, or having to pay extra money. Learn to use 41 of the Most Popular Computer Programs At Your Own Pace Learn the computer in the comfort of your home, save cost and be free from pressure. Plus, you will not be charged for re-sitting for a course! Learning the computer is now a leisure activity you can do in your free time instead of a laborious series of classes. International Network Have access to an e-forum network that lets you chat with up to 7 people form all over the world, plus 15 MegaBytes of webspace to build your own presence on the web! Make yourself, your business and your family available on the Net! There is no other more powerful vehicle. WORLDWIDE REACH Having penetrated over 25 countries, SkyQuestCom lets you interact with other learners all over the world - to learn from and exchange information with others just as dedicated to the pursuit of knowledge and excellence as you are. UNLIMITED BUSINESS OPPORTUNITIES Apart from deriving value from SkyQuestCom's products, you can transform it into a business for yourself at no extra cost. Be a part of this exciting global business and be rewarded by the BEST Compensation Plan around! GREAT VALUE FOR MONEY - WITH MONEY BACK GUARANTEE And now the big question: HOW MUCH? Live and Interactive webcasts every two weeks Hundreds of power-packed seminars Comprehensive Computer Training Channel Netlibrary of over 4,000 of the latest titles E-forum network. Personal webpage builder Unlimited business opportunities Valued at thousands but available at the affordable price of ONLY USD250 per annum! Interested to delve deeper into SkyQuestCom? Select this link. For more details on Master franchise program, please email franchise at gawab.com -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.m.a.martin at dundee.ac.uk Wed Aug 27 13:44:28 2003 From: d.m.a.martin at dundee.ac.uk (David Martin) Date: Wed, 27 Aug 2003 14:44:28 +0100 Subject: [EMBOSS] Where did the protein structure programs go? Message-ID: EMBOSS had some protein structure stuff in it. This all seems to have disappeared? ..d -- David Martin PhD Bioinformatics Scientific Officer Post-Genomics and Molecular Interactions Centre University of Dundee From bb2duprm at uco.es Thu Aug 28 10:04:37 2003 From: bb2duprm at uco.es (mario) Date: Thu, 28 Aug 2003 12:04:37 +0200 Subject: [EMBOSS] a question about emma Message-ID: <000001c36d4c$812a9720$b074d696@uco.es> I am a new user of EMBOSS. I have installed all the packages in my computer running under Linux Red Hat 9.2 and it works correctly, except EMMA programm. When I use it, I can read an error message saying that clustalw is not found. I think I have to download clustalw programm and install it, but where have I to do it??? In emboss directory, or I have to add it tho Red Hat packages? I don?t know what to do about it... Can somebody help me about how to obtain the correct version of clustalw for my machine and how to install it properly for working with EMBOSS? I?ll be very happy if somebody could help me. Best wishes. Mario Duran From henrikki.almusa at helsinki.fi Thu Aug 28 10:24:34 2003 From: henrikki.almusa at helsinki.fi (Henrikki Almusa) Date: Thu, 28 Aug 2003 13:24:34 +0300 Subject: [EMBOSS] a question about emma In-Reply-To: <000001c36d4c$812a9720$b074d696@uco.es> References: <000001c36d4c$812a9720$b074d696@uco.es> Message-ID: <200308281324.34847.henrikki.almusa@helsinki.fi> On Thursday 28 August 2003 13:04, mario wrote: > I think I have to download clustalw programm and install it, but where have > I to do it??? In emboss directory, or I have to add it tho Red Hat > packages? I don?t know what to do about it... You can get this from ebi's ftp server in here: ftp://ftp.ebi.ac.uk/pub/software/unix/clustalw/ > Can somebody help me about how to obtain the correct version of clustalw > for my machine and how to install it properly for working with EMBOSS? I?ll > be very happy if somebody could help me. How to install it. Well i would think that if you install clustalw and have it in path, then it should work. However since i haven't used emma myself i can't be sure. My suggestion is to install clustalw and add it to path and try emma again. -- Henrikki Almusa From aengus.stewart at cancer.org.uk Thu Aug 28 10:52:24 2003 From: aengus.stewart at cancer.org.uk (Aengus Stewart) Date: Thu, 28 Aug 2003 11:52:24 +0100 Subject: [EMBOSS] simple EST sequence assembly References: <000001c36d4c$812a9720$b074d696@uco.es> Message-ID: <3F4DDEE8.86D39404@cancer.org.uk> Hi, I have a couple of users who routinely use GCGs gelassemble to do "mini" assembly projects with ESTs. They find that the Staden package is overkill for this I am at a bit of a loss as to what/how to suggest an alternative within EMBOSS. Is there an "assemble" program on the horizon? Regards Aengus -- ---------------------------------------------------------------------------- Aengus Stewart Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK ---------------------------------------------------------------------------- From grimplet at ensam.inra.fr Thu Aug 28 12:24:36 2003 From: grimplet at ensam.inra.fr (Jerome Grimplet) Date: Thu, 28 Aug 2003 14:24:36 +0200 Subject: [EMBOSS] simple EST sequence assembly In-Reply-To: <3F4DDEE8.86D39404@cancer.org.uk> References: <000001c36d4c$812a9720$b074d696@uco.es> <3F4DDEE8.86D39404@cancer.org.uk> Message-ID: <200308281424.36949.grimplet@ensam.inra.fr> CAP3, you've got to ask it to Xiaqiu Huang (xqhuang at cs.iastate.edu). Precise your platform in the mail Regards, jerome Le Jeudi 28 Ao?t 2003 12:52, Aengus Stewart a ?crit : > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do "mini" > assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative within > EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus -- J?r?me Grimplet Laboratoire de Biochimie M?tabolique et Technologie UMR Sciences Pour l'Oenologie 2, Place Viala 34060 Montpellier Cedex 01 Tel: 33(0)4.99.61.27.56 Fax: 33(0)4.99.61.28.57 grimplet at ensam.inra.fr From stefanielager at fastmail.ca Sun Aug 31 11:27:23 2003 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Sun, 31 Aug 2003 07:27:23 -0400 (EDT) Subject: Fwd: [EMBOSS] simple EST sequence assembly Message-ID: <3F51DB9B.00006B.89366@ns.interchange.ca> CAP3 is also used by TIGR in there "TGI Clustering tools (TGICL)", adapted for EST clustering. It's available under Artistic License from: http://www.tigr.org/tdb/tgi/software/ Stefanie > > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do > "mini" assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative > within EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus > > > -- > ------------------------------------------------------------------ > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A > 3PX, UK _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From grimplet at ensam.inra.fr Thu Aug 28 12:24:36 2003 From: grimplet at ensam.inra.fr (Jerome Grimplet) Date: Thu, 28 Aug 2003 14:24:36 +0200 Subject: [EMBOSS] simple EST sequence assembly In-Reply-To: <3F4DDEE8.86D39404@cancer.org.uk> References: <000001c36d4c$812a9720$b074d696@uco.es> <3F4DDEE8.86D39404@cancer.org.uk> Message-ID: <200308281424.36949.grimplet@ensam.inra.fr> From stefanielager at fastmail.ca Sun Aug 31 11:27:23 2003 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Sun, 31 Aug 2003 07:27:23 -0400 (EDT) Subject: Fwd: [EMBOSS] simple EST sequence assembly Message-ID: <3F51DB9B.00006B.89366@ns.interchange.ca> From owner-emboss at hgmp.mrc.ac.uk Thu Aug 28 12:24:36 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Thu, 28 Aug 2003 14:24:36 +0200 Subject: [EMBOSS] simple EST sequence assembly In-Reply-To: <3F4DDEE8.86D39404@cancer.org.uk> References: <000001c36d4c$812a9720$b074d696@uco.es> <3F4DDEE8.86D39404@cancer.org.uk> Message-ID: <200308281424.36949.grimplet@ensam.inra.fr> CAP3, you've got to ask it to Xiaqiu Huang (xqhuang at cs.iastate.edu). Precise your platform in the mail Regards, jerome Le Jeudi 28 Ao?t 2003 12:52, Aengus Stewart a ?crit : > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do "mini" > assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative within > EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus -- J?r?me Grimplet Laboratoire de Biochimie M?tabolique et Technologie UMR Sciences Pour l'Oenologie 2, Place Viala 34060 Montpellier Cedex 01 Tel: 33(0)4.99.61.27.56 Fax: 33(0)4.99.61.28.57 grimplet at ensam.inra.fr From owner-emboss at hgmp.mrc.ac.uk Sun Aug 31 11:27:23 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Sun, 31 Aug 2003 07:27:23 -0400 (EDT) Subject: Fwd: [EMBOSS] simple EST sequence assembly Message-ID: <3F51DB9B.00006B.89366@ns.interchange.ca> CAP3 is also used by TIGR in there "TGI Clustering tools (TGICL)", adapted for EST clustering. It's available under Artistic License from: http://www.tigr.org/tdb/tgi/software/ Stefanie > > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do > "mini" assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative > within EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus > > > -- > ------------------------------------------------------------------ > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A > 3PX, UK _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From owner-emboss at hgmp.mrc.ac.uk Thu Aug 28 12:24:36 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Thu, 28 Aug 2003 14:24:36 +0200 Subject: [EMBOSS] simple EST sequence assembly In-Reply-To: <3F4DDEE8.86D39404@cancer.org.uk> References: <000001c36d4c$812a9720$b074d696@uco.es> <3F4DDEE8.86D39404@cancer.org.uk> Message-ID: <200308281424.36949.grimplet@ensam.inra.fr> CAP3, you've got to ask it to Xiaqiu Huang (xqhuang at cs.iastate.edu). Precise your platform in the mail Regards, jerome Le Jeudi 28 Ao?t 2003 12:52, Aengus Stewart a ?crit : > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do "mini" > assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative within > EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus -- J?r?me Grimplet Laboratoire de Biochimie M?tabolique et Technologie UMR Sciences Pour l'Oenologie 2, Place Viala 34060 Montpellier Cedex 01 Tel: 33(0)4.99.61.27.56 Fax: 33(0)4.99.61.28.57 grimplet at ensam.inra.fr From owner-emboss at hgmp.mrc.ac.uk Thu Aug 28 12:24:36 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Thu, 28 Aug 2003 14:24:36 +0200 Subject: [EMBOSS] simple EST sequence assembly In-Reply-To: <3F4DDEE8.86D39404@cancer.org.uk> References: <000001c36d4c$812a9720$b074d696@uco.es> <3F4DDEE8.86D39404@cancer.org.uk> Message-ID: <200308281424.36949.grimplet@ensam.inra.fr> CAP3, you've got to ask it to Xiaqiu Huang (xqhuang at cs.iastate.edu). Precise your platform in the mail Regards, jerome Le Jeudi 28 Ao?t 2003 12:52, Aengus Stewart a ?crit : > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do "mini" > assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative within > EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus -- J?r?me Grimplet Laboratoire de Biochimie M?tabolique et Technologie UMR Sciences Pour l'Oenologie 2, Place Viala 34060 Montpellier Cedex 01 Tel: 33(0)4.99.61.27.56 Fax: 33(0)4.99.61.28.57 grimplet at ensam.inra.fr From owner-emboss at hgmp.mrc.ac.uk Sun Aug 31 11:27:23 2003 From: owner-emboss at hgmp.mrc.ac.uk (owner-emboss at hgmp.mrc.ac.uk) Date: Sun, 31 Aug 2003 07:27:23 -0400 (EDT) Subject: Fwd: [EMBOSS] simple EST sequence assembly Message-ID: <3F51DB9B.00006B.89366@ns.interchange.ca> CAP3 is also used by TIGR in there "TGI Clustering tools (TGICL)", adapted for EST clustering. It's available under Artistic License from: http://www.tigr.org/tdb/tgi/software/ Stefanie > > Hi, > > I have a couple of users who routinely use GCGs gelassemble to do > "mini" assembly projects with ESTs. > > They find that the Staden package is overkill for this > > I am at a bit of a loss as to what/how to suggest an alternative > within EMBOSS. > > Is there an "assemble" program on the horizon? > > > > Regards > Aengus > > > -- > ------------------------------------------------------------------ > Aengus Stewart > Computational Genome Analysis Laboratory Tel: +44 (0)20 7269 3679 > Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A > 3PX, UK _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians