test sequence

Marie PAGEAU pageauma at ESI.UMontreal.CA
Fri Nov 1 15:01:07 EST 2002


Dear colleagues,

                A lady, professor of biochemistry at
the Universite de Montreal, sent me the following request.
Would you please be nice enough to help us?

                Your help would be highly appreciated.

                Best regards,

                             Marie Pageau

-----------------------------------------------------------

De : Muriel Aubry
Envoyé : 30 octobre, 2002 14:47
Objet : test sequence


Hi,

I am presently using the restrict and showseq programs from EMBOSS. I
have noticed that some very usual enzymes are not detected by the
program such as XhoI and PstI and a few others when the complete list of
enzymes is used.  I have here below a test sequence that should contain
XhoI, EcoRI, PstI, EcoRV, HindIII, KpnI, SacII, ApaI, SmaI, BamHI and
XbaI.

XhoI, PstI and EcoRV are not detected by restrict and showseq in the
test sequence shown below. Is there a problem with the restriction
enzyme list?

Test Sequence:

gagcagggggatctcggcgagctctcgagaattctcacgcgtctgcaggatatcaagcttgcggtaccgcgg
gcccggg





More information about the EMBOSS mailing list