reverse numbering
Stefanie Lager
stefanielager at fastmail.ca
Fri Dec 6 11:02:21 EST 2002
Hi,
I saw that GCG and EMBOSS use different numbering system when
reversing sequences. If I align 2 sequences, using water from EMBOOS
and bestfit from GCG, and ask to use the reverse strand of sequence 2.
All EMBOSS programs reverse and complements sequence 2, giving it a
new numbering.
While bestfit (and other GCG programs) just compares the opposite
strand but keeps the numbering according to the ORIGINAL strand.
Is it possible to keep the numbering according to the original strand
also in EMBOSS programs, when comparing the reverse strand?
Stefanie
########################################
# Program: water
# Rundate: Fri Dec 06 16:50:52 2002
# Report_file: A_B.water
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: A.seq
# 2: B.seq
# Matrix: EDNAFULL
# Gap_penalty: 10.0
# Extend_penalty: 0.5
#
# Length: 33
# Identity: 33/33 (100.0%)
# Similarity: 33/33 (100.0%)
# Gaps: 0/33 ( 0.0%)
# Score: 165.0
#
#
#=======================================
A.seq 268 gcccaggagagccaaaaagccgagctggaaggc 300
|||||||||||||||||||||||||||||||||
B.seq 1 gcccaggagagccaaaaagccgagctggaaggc 33
#---------------------------------------
#---------------------------------------
BESTFIT of: A.gcg check: 5728 from: 1 to: 420
A.seq
to reverse of: B.gcg2 check: 1476 from: 1 to: 33
B.seq
Symbol comparison table: /disk4/gcg/gcgcore/data/rundata/swgapdna.cmp
CompCheck: 2335
Gap Weight: 50 Average Match: 10.000
Length Weight: 3 Average Mismatch: -9.000
Quality: 330 Length: 33
Ratio: 10.000 Gaps: 0
Percent Similarity: 100.000 Percent Identity: 100.000
Match display thresholds for the alignment(s):
| = IDENTITY
: = 5
. = 1
A.gcg x B.gcg2 December 6, 2002 16:51 ..
. . .
268 gcccaggagagccaaaaagccgagctggaaggc 300
|||||||||||||||||||||||||||||||||
33 gcccaggagagccaaaaagccgagctggaaggc 1
_________________________________________________________________
http://fastmail.ca/ - Fast Secure Web Email for Canadians
More information about the EMBOSS
mailing list