From hamsa_t at yahoo.com Mon Dec 2 01:20:41 2002 From: hamsa_t at yahoo.com (Hamsa Tadepally) Date: Sun, 1 Dec 2002 22:20:41 -0800 (PST) Subject: Reg:emboss Message-ID: <20021202062041.89078.qmail@web14410.mail.yahoo.com> Sir, I am a student of Bioinformatics. I need help regarding the EMBOSS software..How can I randomize teo sequences and compare them using EMBOSS? Is there an option available. It would be kind of you if you could kindly help me. Thanking you and with regards, Hamsa __________________________________________________ Do you Yahoo!? Yahoo! Mail Plus - Powerful. Affordable. Sign up now. http://mailplus.yahoo.com From gbottu at ben.vub.ac.be Mon Dec 2 04:48:02 2002 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Mon, 2 Dec 2002 10:48:02 +0100 (CET) Subject: comparing randomized sequences Message-ID: <200212020948.gB29m26F1059818@black.vub.ac.be> from : Belgian EMBnet Node Dear student, You can run the program shuffleseq with parameter -shuffle=n on sequence B to obtain n randomized versions. Then you can run needle or water on sequence A and the shuffleseq output. (or some variation of this scheme). Guy Bottu From marcus at chah.ucc.ie Mon Dec 2 09:42:56 2002 From: marcus at chah.ucc.ie (Marcus Claesson) Date: Mon, 2 Dec 2002 14:42:56 +0000 (GMT) Subject: DBIBLAST error when creating blast database Message-ID: Hello, When I try to create a blast database for use within emboss (I have EMBOSS-2.5.1), it won't work. I created the ecoli.aa db using 'formatdb'. This is what I'm doing: ............. [marcus at nsfm39 db]$ ls -l ecoli.aa* -rw-rw-r-- 1 marcus marcus 563415 Nov 11 17:08 ecoli.aa.phr -rw-rw-r-- 1 marcus marcus 34376 Nov 11 17:08 ecoli.aa.pin -rw-rw-r-- 1 marcus marcus 34312 Nov 11 17:08 ecoli.aa.pnd -rw-rw-r-- 1 marcus marcus 180 Nov 11 17:08 ecoli.aa.pni -rw-rw-r-- 1 marcus marcus 354726 Nov 11 17:08 ecoli.aa.psd -rw-rw-r-- 1 marcus marcus 8287 Nov 11 17:08 ecoli.aa.psi -rw-rw-r-- 1 marcus marcus 1363280 Nov 11 17:08 ecoli.aa.psq [marcus at nsfm39 db]$ dbiblast Index a BLAST database Database name: ecoli.aa Database directory [.]: Wildcard database filename [ecoli.aa]: Release number [0.0]: Index date [00/00/00]: N : nucleic P : protein ? : unknown Sequence type [unknown]: P 1 : wublast and setdb/pressdb 2 : formatdb 0 : unknown Blast index version [unknown]: 2 EMBOSS An error in dbiblast.c at line 351: No files selected ........................ Could anyone help me with this? Thanx in advance! Marcus From peter.rice at uk.lionbioscience.com Mon Dec 2 08:55:22 2002 From: peter.rice at uk.lionbioscience.com (Peter Rice) Date: Mon, 02 Dec 2002 13:55:22 +0000 Subject: DBIBLAST error when creating blast database References: Message-ID: <3DEB664A.1030901@uk.lionbioscience.com> Marcus Claesson wrote: > Hello, > > When I try to create a blast database for use within emboss (I have > EMBOSS-2.5.1), it won't work. I created the ecoli.aa db using 'formatdb'. > This is what I'm doing: > > Wildcard database filename [ecoli.aa]: > > EMBOSS An error in dbiblast.c at line 351: > No files selected > ........................ > > Could anyone help me with this? Your wildcard filename fails to find any files. If you still had the ecoli.aa fasta file (the one formatdb was used on) this would work - the wildcard filename check finds that file and then tries the formatdb index extensions. You should specify ecoli.aa.* (in quotes if on the command line because of the '*') Hope this helps Peter -- ------------------------------------------------ Peter Rice, LION Bioscience Ltd, Cambridge, UK peter.rice at uk.lionbioscience.com +44 1223 224723 From marcus at chah.ucc.ie Mon Dec 2 10:45:53 2002 From: marcus at chah.ucc.ie (Marcus Claesson) Date: Mon, 2 Dec 2002 15:45:53 +0000 (GMT) Subject: DBIBLAST error when creating blast database In-Reply-To: <3DEB664A.1030901@uk.lionbioscience.com> Message-ID: > Your wildcard filename fails to find any files. > If you still had the ecoli.aa fasta file (the one formatdb was used on) > this would work - the wildcard filename check finds that file and then > tries the formatdb index extensions. > > You should specify ecoli.aa.* (in quotes if on the command line because of > the '*') > Tried it, but it will still not fully work. Looks like this now: [marcus at nsfm39 db]$ ls -l ecoli.aa.* -rw------- 1 marcus marcus 1774183 Dec 2 14:15 ecoli.aa.fasta -rw-rw-r-- 1 marcus marcus 563415 Nov 11 17:08 ecoli.aa.phr -rw-rw-r-- 1 marcus marcus 34376 Nov 11 17:08 ecoli.aa.pin -rw-rw-r-- 1 marcus marcus 34312 Nov 11 17:08 ecoli.aa.pnd -rw-rw-r-- 1 marcus marcus 180 Nov 11 17:08 ecoli.aa.pni -rw-rw-r-- 1 marcus marcus 354726 Nov 11 17:08 ecoli.aa.psd -rw-rw-r-- 1 marcus marcus 8287 Nov 11 17:08 ecoli.aa.psi -rw-rw-r-- 1 marcus marcus 1363280 Nov 11 17:08 ecoli.aa.psq [marcus at nsfm39 db]$ dbiblast Index a BLAST database Database name: ecoli.aa Database directory [.]: Wildcard database filename [ecoli.aa]: ecoli.aa.* Release number [0.0]: Index date [00/00/00]: N : nucleic P : protein ? : unknown Sequence type [unknown]: P 1 : wublast and setdb/pressdb 2 : formatdb 0 : unknown Blast index version [unknown]:2 Warning: Duplicate ID skipped: '0?0???7(AE000312)' All hits will point to first ID found Warning: Duplicate ID skipped: '0?0???7(AE000312)' All hits will point to first ID found Warning: Duplicate ID skipped: '0?0???7(AE000312)' All hits will point to first ID found Warning: Duplicate ID skipped: '0?0???7(AE000312)' All hits will point to first ID found Warning: Duplicate ID skipped: '0?0???7(AE000314)' All hits will point to first ID found .. .. .. and so on... Am I almost there? Regards Marcus From peter.rice at uk.lionbioscience.com Mon Dec 2 09:46:53 2002 From: peter.rice at uk.lionbioscience.com (Peter Rice) Date: Mon, 02 Dec 2002 14:46:53 +0000 Subject: DBIBLAST error when creating blast database References: Message-ID: <3DEB725D.6010604@uk.lionbioscience.com> Marcus Claesson wrote: > Tried it, but it will still not fully work. > Looks like this now: > Warning: Duplicate ID skipped: '0?0???7(AE000312)' All hits will point to > first ID found > .. > and so on... > > Am I almost there? Yes - almost !!! The latest formatdb from NCBI creates "version 4" blast index files. NCBI have not provided any documentation on this format, so it is not supported by EMBOSS. To produce the 'old' (non-ASN.1) index files, use: formatdb -A F That should fix it. Peter -- ------------------------------------------------ Peter Rice, LION Bioscience Ltd, Cambridge, UK peter.rice at uk.lionbioscience.com +44 1223 224723 From marcus at chah.ucc.ie Mon Dec 2 11:49:17 2002 From: marcus at chah.ucc.ie (Marcus Claesson) Date: Mon, 2 Dec 2002 16:49:17 +0000 (GMT) Subject: DBIBLAST error when creating blast database In-Reply-To: <3DEB725D.6010604@uk.lionbioscience.com> Message-ID: > The latest formatdb from NCBI creates "version 4" blast index files. NCBI > have not provided any documentation on this format, so it is not supported > by EMBOSS. To produce the 'old' (non-ASN.1) index files, use: > > formatdb -A F > > That should fix it. Not fully, but at least I don't get any error messages. The ecoli.aa db won't show up when I run 'showdb'. Here's what I did: [marcus at nsfm39 db]$ formatdb -A F -i ecoli.aa -p T -o T [marcus at nsfm39 db]$ ll|grep "Dec 2" -rw------- 1 marcus marcus 1774183 Dec 2 14:15 ecoli.aa -rw-rw-r-- 1 marcus marcus 387530 Dec 2 15:29 ecoli.aa.phr -rw-rw-r-- 1 marcus marcus 34372 Dec 2 15:29 ecoli.aa.pin -rw-rw-r-- 1 marcus marcus 34312 Dec 2 15:29 ecoli.aa.pnd -rw-rw-r-- 1 marcus marcus 180 Dec 2 15:29 ecoli.aa.pni -rw-rw-r-- 1 marcus marcus 354726 Dec 2 15:29 ecoli.aa.psd -rw-rw-r-- 1 marcus marcus 8287 Dec 2 15:29 ecoli.aa.psi -rw-rw-r-- 1 marcus marcus 1363280 Dec 2 15:29 ecoli.aa.psq -rw-rw-r-- 1 marcus marcus 642786 Dec 2 15:29 formatdb.log [marcus at nsfm39 db]$ dbiblast Index a BLAST database Database name: ecoli.aa Database directory [.]: Wildcard database filename [ecoli.aa]: ecoli.aa.* Release number [0.0]: Index date [00/00/00]: N : nucleic P : protein ? : unknown Sequence type [unknown]: P 1 : wublast and setdb/pressdb 2 : formatdb 0 : unknown Blast index version [unknown]: 2 [marcus at nsfm39 db]$ showdb Displays information on the currently available databases # Name Type ID Qry All Comment # ==== ==== == === === ======= tpir P OK OK OK PIR using NBRF access for 4 files tsw P OK OK OK Swissprot native format with EMBL CD-ROM index tswnew P OK OK OK Swissnew as 3 files in native format with EMBL CD-ROM index twp P OK OK OK EMBL new in native format with EMBL CD-ROM index gb N OK - - Genbank IDs gba N OK - - Genbank ACs tembl N OK OK OK EMBL in native format with EMBL CD-ROM index tgb N OK - - Genbank IDs tgenbank N OK OK OK GenBank in native format with EMBL CD-ROM index [marcus at nsfm39 db]$ ll|grep "Dec 2" -rw-rw-r-- 1 marcus marcus 300 Dec 2 15:30 acnum.hit -rw-rw-r-- 1 marcus marcus 300 Dec 2 15:30 acnum.trg -rw-rw-r-- 1 marcus marcus 322 Dec 2 15:30 division.lkp -rw------- 1 marcus marcus 1774183 Dec 2 14:15 ecoli.aa -rw-rw-r-- 1 marcus marcus 387530 Dec 2 15:29 ecoli.aa.phr -rw-rw-r-- 1 marcus marcus 34372 Dec 2 15:29 ecoli.aa.pin -rw-rw-r-- 1 marcus marcus 34312 Dec 2 15:29 ecoli.aa.pnd -rw-rw-r-- 1 marcus marcus 180 Dec 2 15:29 ecoli.aa.pni -rw-rw-r-- 1 marcus marcus 354726 Dec 2 15:29 ecoli.aa.psd -rw-rw-r-- 1 marcus marcus 8287 Dec 2 15:29 ecoli.aa.psi -rw-rw-r-- 1 marcus marcus 1363280 Dec 2 15:29 ecoli.aa.psq -rw-rw-r-- 1 marcus marcus 86080 Dec 2 15:30 entrynam.idx -rw-rw-r-- 1 marcus marcus 642786 Dec 2 15:29 formatdb.log Thus, nothing new in showdb... Thanks for helping me Peter! /Marcus From peter.rice at uk.lionbioscience.com Mon Dec 2 10:41:42 2002 From: peter.rice at uk.lionbioscience.com (Peter Rice) Date: Mon, 02 Dec 2002 15:41:42 +0000 Subject: DBIBLAST error when creating blast database References: Message-ID: <3DEB7F36.2050601@uk.lionbioscience.com> Marcus Claesson wrote: > Not fully, but at least I don't get any error messages. The ecoli.aa db > won't show up when I run 'showdb'. You need to add the database to your site-wide emboss.defaults file (or your own ~/.embossrc file). We had a suggestion last week to generate the emboss.defaults lines in dbiblast - that will help you, but I don't expect to have time until the New Year. The database definition will look like this: DB ecoliaa [ type: P format: ncbi method: blast dir: /user/claesson/data indexdir: /user/classon/data comment: "E.coli protein data" ] -- ------------------------------------------------ Peter Rice, LION Bioscience Ltd, Cambridge, UK peter.rice at uk.lionbioscience.com +44 1223 224723 From maximtel at ibpm.pushchino.ru Tue Dec 3 18:22:06 2002 From: maximtel at ibpm.pushchino.ru (Maxim A. Telegin) Date: Tue, 3 Dec 2002 15:22:06 -0800 Subject: SHOWDB Message-ID: <004e01c29b22$cbc51780$300213c3@ibpm.serpukhov.su> Dear colleagues! After the compiling of EMBOSS package I've executed the showdb program. I think it must show the available databases as explain in Users Guide, but it shown nothing. Also such commands as "localhost$ seqret embl:bla-bla-bla" doesn't work. What does it mean? Sincerely yours, Maxim A. Telegin -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20021203/d5f94ca6/attachment.html From dbasalam at caramail.com Tue Dec 3 14:50:18 2002 From: dbasalam at caramail.com (basalam duru) Date: Tue, 03 Dec 2002 14:50:18 GMT+1 Subject: IN GOOD FAITH. Message-ID: <1038923418021128@caramail.com> My Dear, I am well confident of your capability to assist me in a transaction for mutual benefit of both parties, ie (me and you) I am also believing that you will not expose or betray the trust and confidence I am about to establish with you. I have decided to contact you with greatest delight and personal respect. I am ALHAJI DURU BASALAM. Former Director of National Union of hotels Sierra Leon presently now in Cote d?Ivoire because of Political Problem in my Country Sierra Leon. During my stay in Office I acquired $25 million Dollars, through money being mapped out for hotels Renovation in my Country Sierra Leon. Now due to war, I and the entire management could not be able to utilise the money being mapped out for the project. Now I diverted this money to a nearby Country Cote d?Ivoire and deposited the money into a BANK here in Abidjan for immediate transfer, for investment. Now the war in my country is over with the help of ECOMOG soldiers, the present goverment of sierra leone has revoked the passport of all officers who served under the former regime and now asked countries to expel such person at the same time freeze their account and confiscate their asset, It is on this note that Iam contacting you, all I needed from you is to furnish me with your bank particulars: 1)Account name 2)Account number 3)Bank address,telephone fax number. Now I would like to use your company account to transfer the money for investment. If my wish to invest in your Company is accepted with you as the manager, please contact me for more clarification. Thanks and God bless. NOTE: YOUR PERCENTAGE IS HIGHLY NEGOCIATED FOR YOUR NOBLE ASSISTANCE. HOPING TO HEAR FROM YOU SOONEST. ALHAJI DURU BASALAM Director National Union of hotels Sierra Leone _________________________________________________________ Gagne une PS2 ! Envoie un SMS avec le code PS au 61166 (0,35? Hors co?t du SMS) From Wiepert.Mathieu at mayo.edu Wed Dec 4 11:42:55 2002 From: Wiepert.Mathieu at mayo.edu (Wiepert, Mathieu) Date: Wed, 4 Dec 2002 10:42:55 -0600 Subject: emma or clustalw problem? Message-ID: <2F41CC6C9777D311ACBD009027B108EA0541BFFC@excsrv32.mayo.edu> Hi, Not sure if I have an SUE, or reached a limit in the software or hardware. I have a file with 457 fasta formatted sequences, that I want an MSF for, so I can prettyplot it. I tried emma (see command line following). Can I use a file of sequences, or do I need separate sequences, or have I broken the USA formatting required? My file is like the example file, only with many more sequences? The segmentation fault at the end concerns me... COMMAND LINE: ~/sequences $ emma -inseqs seqs.fa Multiple alignment program - interface to ClustalW program Output sequence [1001501.aln]: Output file [1001501.dnd]: ..clustalw -infile=5511A -outfile=5511B -align -type=dna -output=gcg -pwdnamatrix=iub -pwgapopen=10.000 -pwgapext=0.100 -newtree=5511C -dnamatrix= -gapopen=10.000 -gapext=5.000 -gapdist=8 -hgapresidues=GPSNDQEKR -maxdiv=30.. CLUSTAL W (1.82) Multiple Sequence Alignments Sequence type explicitly set to DNA ERROR: Could not open sequence file 5511A No. of seqs. read = -1. No alignment! Error: failed to open filename 5511B Problem writing out EMBOSS alignment fileSegmentation fault -mat -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20021204/d7d36dcc/attachment.html From starksb at ebi.ac.uk Wed Dec 4 11:49:24 2002 From: starksb at ebi.ac.uk (David Starks-Browning) Date: Wed, 4 Dec 2002 16:49:24 +0000 Subject: emma or clustalw problem? In-Reply-To: <2F41CC6C9777D311ACBD009027B108EA0541BFFC@excsrv32.mayo.edu> References: <2F41CC6C9777D311ACBD009027B108EA0541BFFC@excsrv32.mayo.edu> Message-ID: <484-Wed04Dec2002164924+0000-starksb@ebi.ac.uk> On Wednesday 4 Dec 02, Wiepert, Mathieu writes: > Hi, > > Not sure if I have an SUE SUE? > , or reached a limit in the software or > hardware. Clustalw is rather badly broken. The patch below provides a workaround suitable for Linux. (Was that your platform? You didn't say.) Regards, David *** emboss/emma.c.orig Thu Aug 22 16:09:03 2002 --- emboss/emma.c Wed Oct 30 12:18:17 2002 *************** *** 440,446 **** static AjPStr emma_getUniqueFileName() { ! static char ext[2] = "A"; AjPStr filename = NULL; --- 440,446 ---- static AjPStr emma_getUniqueFileName() { ! static char ext[6] = "A0000"; AjPStr filename = NULL; From Wiepert.Mathieu at mayo.edu Wed Dec 4 11:52:47 2002 From: Wiepert.Mathieu at mayo.edu (Wiepert, Mathieu) Date: Wed, 4 Dec 2002 10:52:47 -0600 Subject: emma or clustalw problem? Message-ID: <2F41CC6C9777D311ACBD009027B108EA0541BFFE@excsrv32.mayo.edu> > SUE? Stupid User Error I'll apply the patch. You are correct, I didn't really provide enough information, thx, -Mat From sebastian.bassi at ar.advantaseeds.com Thu Dec 5 08:04:59 2002 From: sebastian.bassi at ar.advantaseeds.com (Sebastian Bassi) Date: Thu, 5 Dec 2002 14:04:59 +0100 Subject: emma or clustalw problem? Message-ID: Hi, Sometimes the problems like this occurs when the program is expecting a UNIX formated text file and you put a windows style text file. I have had the inverse problem, I have downloaded a genome fasta file from the NCBI and the program I was using to handle it was unable to open it, since it expected a windows style text file and the downloaded file was with Unix format. The EOL character is different. There's a Windows program called CONVERT, it works as a pop up menu, just click the file with secondary button and select CONVERT TO (3 options, UNIX, PC or MAC). If you are using UNIX, there are some comand line utilities to do this (in Solaris is already built in). I don't know if EMBOSS have problem with this. ERROR: Could not open sequence file 5511A No. of seqs. read = -1. No alignment! Error: failed to open filename 5511B Problem writing out EMBOSS alignment fileSegmentation fault -mat -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20021205/1080e421/attachment.html From Wiepert.Mathieu at mayo.edu Thu Dec 5 08:25:40 2002 From: Wiepert.Mathieu at mayo.edu (Wiepert, Mathieu) Date: Thu, 5 Dec 2002 07:25:40 -0600 Subject: emma or clustalw problem? Message-ID: <2F41CC6C9777D311ACBD009027B108EA0541C00B@excsrv32.mayo.edu> Hi, Thanks for the tip. I tried the code change to emma as suggested by David Starks-Browning, and that seemed to fix my problem. Always good to keep an eye on the EOL types though. In fact, many editors have built in functions to do that conversion, and have little reminders in the status bar. I configured my Ultraedit toolbar, making that function more readily accessible in my toolbar ;-) -Mat -----Original Message----- From: Sebastian Bassi [mailto:sebastian.bassi at ar.advantaseeds.com] Sent: Thursday, December 05, 2002 7:05 AM To: Wiepert, Mathieu; emboss at embnet.org Subject: RE: emma or clustalw problem? Hi, Sometimes the problems like this occurs when the program is expecting a UNIX formated text file and you put a windows style text file. I have had the inverse problem, I have downloaded a genome fasta file from the NCBI and the program I was using to handle it was unable to open it, since it expected a windows style text file and the downloaded file was with Unix format. The EOL character is different. There's a Windows program called CONVERT, it works as a pop up menu, just click the file with secondary button and select CONVERT TO (3 options, UNIX, PC or MAC). If you are using UNIX, there are some comand line utilities to do this (in Solaris is already built in). I don't know if EMBOSS have problem with this. ERROR: Could not open sequence file 5511A No. of seqs. read = -1. No alignment! Error: failed to open filename 5511B Problem writing out EMBOSS alignment fileSegmentation fault -mat -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20021205/630171c8/attachment.html From starksb at ebi.ac.uk Thu Dec 5 09:21:30 2002 From: starksb at ebi.ac.uk (David Starks-Browning) Date: Thu, 5 Dec 2002 14:21:30 +0000 Subject: emma or clustalw problem? In-Reply-To: References: Message-ID: <1406-Thu05Dec2002142130+0000-starksb@ebi.ac.uk> On Thursday 5 Dec 02, Sebastian Bassi writes: > Hi, > > Sometimes the problems like this occurs when the program is > expecting a UNIX formated text file and you put a windows style text > file. ... Mathieu's problem was that clustalw is quite broken when it comes to string buffer management. Emma provides it the command line argument "5511A" and clustalw screws up the string buffer containing the filename, and attempts to open something different. In fact it's the string with an extra "garbage" character at the end. Although the error message says that 5511A was missing, in fact it was looking for 5511A^Y (where ^Y is ctrl-Y), or something like that. You don't see the extra ^Y in the error message. You see it in the open() system call when you study it with strace. (Which is how I determined this.) This only seems to be a problem on Linux, and only when the filename is 5 characters, which happens whenever Emma's PID is 4 characters. Hence the nature of my suggested workaround, which pads the filename to > 5 characters, no matter what the PID is. On the other hand, I know folks who have found clustalw to also break, on other platforms, when the filename is too long. I don't know what the limits are, so I don't know if it's safe to apply my Linux workaround to emma.c in general, for all platforms. > ERROR: Could not open sequence file 5511A > > > No. of seqs. read = -1. No alignment! > Error: failed to open filename 5511B > Problem writing out EMBOSS alignment fileSegmentation fault > > -mat From stefanielager at fastmail.ca Fri Dec 6 11:02:21 2002 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Fri, 6 Dec 2002 11:02:21 -0500 (EST) Subject: reverse numbering Message-ID: <3DF0CA0D.0000BB.68670@ns.interchange.ca> Hi, I saw that GCG and EMBOSS use different numbering system when reversing sequences. If I align 2 sequences, using water from EMBOOS and bestfit from GCG, and ask to use the reverse strand of sequence 2. All EMBOSS programs reverse and complements sequence 2, giving it a new numbering. While bestfit (and other GCG programs) just compares the opposite strand but keeps the numbering according to the ORIGINAL strand. Is it possible to keep the numbering according to the original strand also in EMBOSS programs, when comparing the reverse strand? Stefanie ######################################## # Program: water # Rundate: Fri Dec 06 16:50:52 2002 # Report_file: A_B.water ######################################## #======================================= # # Aligned_sequences: 2 # 1: A.seq # 2: B.seq # Matrix: EDNAFULL # Gap_penalty: 10.0 # Extend_penalty: 0.5 # # Length: 33 # Identity: 33/33 (100.0%) # Similarity: 33/33 (100.0%) # Gaps: 0/33 ( 0.0%) # Score: 165.0 # # #======================================= A.seq 268 gcccaggagagccaaaaagccgagctggaaggc 300 ||||||||||||||||||||||||||||||||| B.seq 1 gcccaggagagccaaaaagccgagctggaaggc 33 #--------------------------------------- #--------------------------------------- BESTFIT of: A.gcg check: 5728 from: 1 to: 420 A.seq to reverse of: B.gcg2 check: 1476 from: 1 to: 33 B.seq Symbol comparison table: /disk4/gcg/gcgcore/data/rundata/swgapdna.cmp CompCheck: 2335 Gap Weight: 50 Average Match: 10.000 Length Weight: 3 Average Mismatch: -9.000 Quality: 330 Length: 33 Ratio: 10.000 Gaps: 0 Percent Similarity: 100.000 Percent Identity: 100.000 Match display thresholds for the alignment(s): | = IDENTITY : = 5 . = 1 A.gcg x B.gcg2 December 6, 2002 16:51 .. . . . 268 gcccaggagagccaaaaagccgagctggaaggc 300 ||||||||||||||||||||||||||||||||| 33 gcccaggagagccaaaaagccgagctggaaggc 1 _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From ald at novozymesbiotech.com Fri Dec 6 14:16:47 2002 From: ald at novozymesbiotech.com (ALLO (Alfredo Lopez De Leon)) Date: Fri, 6 Dec 2002 11:16:47 -0800 Subject: Upgrade? Message-ID: Hi, I have been using EMBOSS version 2.4.1 and I would like to upgrade to version 2.5.1. I read all the 2.5.1 documentation (I believe I have) and there are no instructions on how to install 2.5.1. on top of an older version. Am I supposed to wipe out 2.4.1 and start from square number 1 with 2.5.1? Thanks in advance for you help and comments. Sincerely, Alfredo Lopez De Leon Ph.D. Postdoctoral Fellow, Molecular Biology and Bioinformatics Department Novozymes Biotech , Inc. 1445 Drew Avenue, Davis, CA 95616 From gearh006 at umn.edu Fri Dec 6 16:00:04 2002 From: gearh006 at umn.edu (Micah Gearhart) Date: Fri, 6 Dec 2002 15:00:04 -0600 Subject: siRNA applications Message-ID: I just started using EMBOSS and subscribed to this list today. 1) Does anyone know where I can get the sirna application since it does not appear to be in the latest distribution? 2) Is there an archive of this mailing list that I could consult for answers to my future questions? Thanks, Micah Gearhart University of Minnesota From gwilliam at hgmp.mrc.ac.uk Mon Dec 9 04:15:20 2002 From: gwilliam at hgmp.mrc.ac.uk (Gary Williams, Tel 01223 494522) Date: Mon, 09 Dec 2002 09:15:20 +0000 Subject: siRNA applications References: Message-ID: <3DF45F28.23A753E@hgmp.mrc.ac.uk> I'm still developing sirna. It should be in the next release. Regards, Gary Micah Gearhart wrote: > > I just started using EMBOSS and subscribed to this list today. > > 1) Does anyone know where I can get the sirna application since it does not > appear to be in the latest distribution? > > 2) Is there an archive of this mailing list that I could consult for answers > to my future questions? > > Thanks, > > Micah Gearhart > University of Minnesota -- Gary Williams Tel: +44 1223 494522 Fax: +44 1223 494512 mailto:G.Williams at hgmp.mrc.ac.uk http://www.hgmp.mrc.ac.uk/ Bioinformatics,MRC HGMP Resource Centre,Hinxton,Cambridge, CB10 1SB,UK From pdas at caltech.edu Tue Dec 10 23:27:45 2002 From: pdas at caltech.edu (pradeep das) Date: Tue, 10 Dec 2002 20:27:45 -0800 Subject: emboss for mac os x Message-ID: hi all, i'm an almost complete unix dummy. i've tried a few times to set up an emboss installation on my powerbook, but have never succeded. i'm happy using the command line, though, so i don't need to know how to set up jemboss and such. each time i've tried, i go through the compilation process described in the readme file (". /configure" followed by "make install"), but then i have no idea what to do next. actually, i just tried this again and this time, the 'make install' didn't complete - gave me errors. should i move the compiled files to a particular directory? do i need to edit the makefile (or whatever) and speficy the target directory before compiling? i'm a serious gcg addict (much prefer it to macvector and other programs like that) and i'm going to lose telnet (and thereby gcg) access at my old university pretty soon. hence the desperation! i would appreciate any help in the matter. thanks, pradeep p.s. if i can get it to work, i'd be more than happy to help write a thorugh installation guide for macs. From grsvc at mucc.mahidol.ac.th Wed Dec 11 01:50:11 2002 From: grsvc at mucc.mahidol.ac.th (Suksiri Vichasri) Date: Wed, 11 Dec 2002 13:50:11 +0700 (ICT) Subject: emboss for mac os x In-Reply-To: Message-ID: <20021211132700.D16801-100000@mucc.mahidol.ac.th> The installation of EMBOSS on MacOS 10.1.x and newer works fine thanks to the efforts of Alan Bleasby. Just follow the instructions given in the admin guide. After extracting the .gz file, changing to the correct emboss directory, ./configure, make and sudo make install should be all that is necessary to get emboss installed in /usr/local. Take care that your PATH variable contains /usr/local/bin and that you add the PLPLOT_LIB variable (setenv PLPLOT_LIB='/usr/local/share/EMBOSS') to your tcsh settings. This variable is necessary for graphics output. Please let me know whether this works for you. Kindly, Rudi On Tue, 10 Dec 2002, pradeep das wrote: > hi all, > i'm an almost complete unix dummy. i've tried a few times to set up an > emboss installation on my powerbook, but have never succeded. i'm happy > using the command line, though, so i don't need to know how to set up > jemboss and such. > > each time i've tried, i go through the compilation process described in the > readme file (". /configure" followed by "make install"), but then i have no > idea what to do next. actually, i just tried this again and this time, the > 'make install' didn't complete - gave me errors. > > should i move the compiled files to a particular directory? do i need to > edit the makefile (or whatever) and speficy the target directory before > compiling? > > i'm a serious gcg addict (much prefer it to macvector and other programs > like that) and i'm going to lose telnet (and thereby gcg) access at my old > university pretty soon. hence the desperation! > > i would appreciate any help in the matter. > > thanks, > pradeep > > p.s. if i can get it to work, i'd be more than happy to help write a thorugh > installation guide for macs. > > > From abrown at nimr.mrc.ac.uk Wed Dec 11 04:27:39 2002 From: abrown at nimr.mrc.ac.uk (Alex Brown) Date: Wed, 11 Dec 2002 09:27:39 +0000 Subject: emboss for mac os x In-Reply-To: Message-ID: 'morning Pradeep. I am also a bit of unix grasshopper, but I managed to install EMBOSS on my G4 under Darwin. There is great set of instructions from a William Van Etten of the Blackstone Tecnology Group at the following web site: http://gnu-darwin.sourceforge.net/gdc/emboss.txt This got me up and running. You will need to install X-windows - have a look at XDarwin (http://www.xdarwin.org/) or XFree86 (http://www.xfree86.org/). By the way - there are some good books on unix and Macs in the O'Reilly series, aimed at us novices. They are well worth having a look at. You could also look at the gnu-Darwin pages (http://gnu- darwin.sourceforge.net/) which has loads of unix soteware (scientific and other) which is quite easy to install. Once you've installed X Windows and EMBOSS, you'll get the hang of things. Good luck, Alex Brown MRC-T, London On Wednesday, December 11, 2002, at 04:27 am, pradeep das wrote: > hi all, > i'm an almost complete unix dummy. i've tried a few times to set up an > emboss installation on my powerbook, but have never succeded. i'm happy > using the command line, though, so i don't need to know how to set up > jemboss and such. > > each time i've tried, i go through the compilation process described in > the > readme file (". /configure" followed by "make install"), but then i > have no > idea what to do next. actually, i just tried this again and this time, > the > 'make install' didn't complete - gave me errors. > > should i move the compiled files to a particular directory? do i need to > edit the makefile (or whatever) and speficy the target directory before > compiling? > > i'm a serious gcg addict (much prefer it to macvector and other programs > like that) and i'm going to lose telnet (and thereby gcg) access at my > old > university pretty soon. hence the desperation! > > i would appreciate any help in the matter. > > thanks, > pradeep > > p.s. if i can get it to work, i'd be more than happy to help write a > thorugh > installation guide for macs. > > From rpg at mrc-lmb.cam.ac.uk Wed Dec 11 04:34:46 2002 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Wed, 11 Dec 2002 09:34:46 +0000 (GMT) Subject: emboss for mac os x In-Reply-To: from Alex Brown at "Dec 11, 2002 09:27:39 am" Message-ID: <200212110934.JAA17077@alf1.mrc-lmb.cam.ac.uk> Check out http://fink.sourceforge.net/ for a fantastic way of getting all sorts of unixy goodness for your Macs. I obtained EMBOSS this way, too. My personal experience (in brief) is at http://www.rg-d.com/BioLOG/archive/nov02.html#20021120ah and there are useful links therein. r -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From ruediger at sanbi.ac.za Thu Dec 12 04:36:07 2002 From: ruediger at sanbi.ac.za (Ruediger Braeuning) Date: Thu, 12 Dec 2002 11:36:07 +0200 (SAST) Subject: seqret & getz Message-ID: <20021212112959.X63135-100000@fling.sanbi.ac.za> Hi, I've aliased the SRS getz command: getz: aliased to /kraal/srs/bin/solaris8/getz I wanted to use SRS for the seqret command but seqret couldn't find getz. Putting a symbolic link to getz in /emboss/bin worked but it is not the nicest thing. Does anyone have a good solution for that problem (eg environment variables)? Thanks Ruediger ------------------------------------------------------------------------- Ruediger Braeuning / South African National Bioinformatics Institute (=) University of the Western Cape Ph. +27 21 959 3645 / Private Bag X17 Fax +27 21 959 2512 (=) Bellville, 7535 www.sanbi.ac.za / South Africa From btiwari at molbiol.ox.ac.uk Thu Dec 12 05:05:40 2002 From: btiwari at molbiol.ox.ac.uk (Bela Tiwari) Date: Thu, 12 Dec 2002 10:05:40 +0000 (GMT) Subject: seqret & getz In-Reply-To: <20021212112959.X63135-100000@fling.sanbi.ac.za> Message-ID: > >I wanted to use SRS for the seqret command but seqret couldn't find getz. > >Putting a symbolic link to getz in /emboss/bin worked but it is not >the nicest thing. Does anyone have a good solution for that problem (eg >environment variables)? > Hello, Are you sourcing the prep_srs script, which comes with the srs release, in your environment to set all the SRS variables before running seqret? In addition to setting variables, this script should add the relevant SRS directories to your PATH. Maybe rely on getz being found because it is in a directory on your PATH, insteady using an alias? Note that by default, prep_srs puts the SRS directories at the start of the PATH, so if you don't want them there, you might want to edit the script. I hope this helps. Bela .-.-.-.-.-.-.-.-.-.-.-.-.-.-.-. Dr. Bela Tiwari Acting Manager OU Bioinformatics Centre SWD School of Pathology South Parks Road Oxford OX1 3RE 01865 (2)75507 http://www.molbiol.ox.ac.uk .-.-.-.-.-.-.-.-.-.-.-.-.-.-.-. From peter.rice at uk.lionbioscience.com Thu Dec 12 05:29:12 2002 From: peter.rice at uk.lionbioscience.com (Peter Rice) Date: Thu, 12 Dec 2002 10:29:12 +0000 Subject: seqret & getz References: <20021212112959.X63135-100000@fling.sanbi.ac.za> Message-ID: <3DF864F8.9020705@uk.lionbioscience.com> Ruediger Braeuning wrote: > Hi, > > I've aliased the SRS getz command: > > getz: aliased to /kraal/srs/bin/solaris8/getz > > I wanted to use SRS for the seqret command but seqret couldn't find getz. EMBOSS can use an alternative (or full) name for getz. I did this when running SRS5 and SRS6 at Sanger, but it works for you too. Add this line to your database definition in EMBOSS: app: "/kraal/srs/bin/solaris8/getz" Hope this helps, Peter -- ------------------------------------------------ Peter Rice, LION Bioscience Ltd, Cambridge, UK peter.rice at uk.lionbioscience.com +44 1223 224723 From squiresb at macrogenics.com Thu Dec 12 14:41:33 2002 From: squiresb at macrogenics.com (Burke Squires) Date: Thu, 12 Dec 2002 13:41:33 -0600 Subject: Genbank in extractfeat? In-Reply-To: Message-ID: Hello, I am trying to test out extractfeat but I am having trouble using a genbank file. Is it possible to extract from a genbank file and am I just doing something stupid? Burke Squires From David.Bauer at SCHERING.DE Fri Dec 13 01:45:21 2002 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Fri, 13 Dec 2002 07:45:21 +0100 Subject: Antwort: Genbank in extractfeat? Message-ID: Hi, which version do you use ? In older versions of EMBOSS this used to work only with EMBL format and not with GenBank. As far as I remember the feature reading libraries support GenBank format at least since version 2.4. David. Hello, I am trying to test out extractfeat but I am having trouble using a genbank file. Is it possible to extract from a genbank file and am I just doing something stupid? Burke Squires From asen.nenov at metalife.de Mon Dec 16 03:40:29 2002 From: asen.nenov at metalife.de (Asen Nenov) Date: Mon, 16 Dec 2002 10:40:29 +0200 Subject: EMBOSS under WIN2000 Message-ID: <001501c2a4de$da24e060$3801a8c0@metalife.bg> Hi, I am using EMBOSS undex Mandrake Linux and the package is working properly. Now I have to run a web-based system including EMBOSS package under WIN2000 server platform. My question is: Is it possible to run the package under windows. I know it is possible to recompile selected program and also that copliling under CYGWIN is not working at all. Any help appreciated. Regards Asen Nenov METALIFE AG - Sofia, Bulgaria asen.nenov at metalife.de www.metalife.de ++359 2 950 1802 From David.Bauer at SCHERING.DE Mon Dec 16 04:24:13 2002 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Mon, 16 Dec 2002 10:24:13 +0100 Subject: EMBOSS under WIN2000 Message-ID: Hello Asen, just throw away the Win2000 :-) But seriously, why not leaving the EMBOSS on a Linux server with Apache and one of the WWW interfaces: (http://www.hgmp.mrc.ac.uk/Software/EMBOSS/interfaces.html) You could install Luke's EMBOSS GUI which is very emboss specific but easy to set up. If you need an interface for other sequence analysis programs I would suggest Cathrine Letondal's PISE. This you can use for emboss and dozens other sequence analysis programs. Sincerely, David. Hi, I am using EMBOSS undex Mandrake Linux and the package is working properly. Now I have to run a web-based system including EMBOSS package under WIN2000 server platform. My question is: Is it possible to run the package under windows. I know it is possible to recompile selected program and also that copliling under CYGWIN is not working at all. Any help appreciated. Regards Asen Nenov METALIFE AG - Sofia, Bulgaria asen.nenov at metalife.de www.metalife.de ++359 2 950 1802 From sharmila at ebi.ac.uk Mon Dec 16 08:52:56 2002 From: sharmila at ebi.ac.uk (Sharmila Pillai) Date: Mon, 16 Dec 2002 13:52:56 +0000 (GMT) Subject: EMBOSS under WIN2000 Message-ID: Hello Asen, On the same note, as David's, if you are interested, I have a SOAP interface to EMBOSS - a client (your windows machine) can talk (SOAP) to a remote machine running a webserver/AXIS and has EMBOSS installed in it. For now, you can access most of teh EMBOSS applications excluding graphical ones. Regards, Sharmila. > > Hello Asen, > > just throw away the Win2000 :-) > But seriously, why not leaving the EMBOSS on a Linux server with Apache and > one > of the WWW interfaces: > (http://www.hgmp.mrc.ac.uk/Software/EMBOSS/interfaces.html) > You could install Luke's EMBOSS GUI which is very emboss specific but easy to > set up. > If you need an interface for other sequence analysis programs I would suggest > Cathrine Letondal's PISE. > This you can use for emboss and dozens other sequence analysis programs. > > Sincerely, > David. > > > Hi, > > I am using EMBOSS undex Mandrake Linux and the package is working properly. > Now I have to run a web-based system including EMBOSS package under WIN2000 > server platform. My question is: Is it possible to run the package under > windows. I know it is possible to recompile selected program and also that > copliling under CYGWIN is not working at all. > Any help appreciated. > > Regards > Asen Nenov > > METALIFE AG - Sofia, Bulgaria > asen.nenov at metalife.de > www.metalife.de > ++359 2 950 1802 From cbonnard at isrec-sg1.unil.ch Mon Dec 16 09:28:03 2002 From: cbonnard at isrec-sg1.unil.ch (Claude Bonnard) Date: Mon, 16 Dec 2002 15:28:03 +0100 Subject: Warning: Cannot open division file '' Message-ID: <10212161528.ZM5934@isrec-sg1> Hello, Trying to use a database indexed with dbiflat, I have the followind result: > pepinfo swissprot:104K_THEPA Plots simple amino acid properties in parallel Warning: Cannot open division file '' for database 'swissprot' Warning: seqCdQry failed Error: Unable to read sequence 'swissprot:104K_THEPA' The formatting is made with those parameters -------------------------------- dbiflat -idformat=SWISS -directory=/db/swiss-prot/ -dbname=swissprot \ -release=$SW_RELEASE -date=$DATE \ -filenames=swiss.dat -indexdirectory=/db/emboss/swissprot/$SW_RELEASE -------------------------------- In emboss.default, this base is defined as: ---------------------------------- DB swissprot [ type: P comment: "SWISSPROT sequences" method: emblcd format: swiss dbalias: swissprot dir: /db/emboss/swissprot/40/ file: swiss.dat indexdir: /db/emboss/swissprot/40/ ] ---------------------------------- The content of this directory is: ---------------------------------- drwxr-sr-x 2 emboss sib 1024 Dec 16 15:17 . drwxr-sr-x 3 emboss sib 512 Dec 16 14:50 .. -rw-r--r-- 1 emboss sib 583792 Dec 16 14:54 acnum.hit -rw-r--r-- 1 emboss sib 2040590 Dec 16 14:54 acnum.trg -rw-r--r-- 1 emboss sib 327 Dec 16 14:54 division.lkp -rw-r--r-- 1 emboss sib 2407300 Dec 16 14:54 entrynam.idx -rw-r--r-- 1 emboss sib 0 Dec 16 14:54 INDEX_DATE lrwxrwxrwx 1 emboss sib 24 Dec 16 15:17 swiss.dat -> /db/swiss-prot/swiss.dat ---------------------------------- Any idea? Thanks Cheers Claude -- Claude Bonnard Ph.D. ISREC (Swiss Institute for Experimental Cancer Research) Bioinformatics Group Ch des Boveresses 155 CH-1066 Epalinges Switzerland phone: [41-21]-692-5891 fax: [41-21]-652-6933 From ableasby at hgmp.mrc.ac.uk Mon Dec 16 16:33:50 2002 From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk) Date: Mon, 16 Dec 2002 21:33:50 GMT Subject: Clustalw fix for EMBOSS Message-ID: <200212162133.VAA29519@bromine.hgmp.mrc.ac.uk> There is a patched clustalw available for download as: ftp://ftp.uk.embnet.org/pub/EMBOSS/clustal/clustalw1.83.UNIX.tar.gz This fixes a couple of memory corruption errors and replaces the gets() function with fgets() to tidy up the compilation a bit. It is to be regarded as both unofficial and "use at your own risk". I'll be reporting my fixes to Des et al so, hopefully there'll be an official 1.8.3 out soon. In the meantime it ought to solve problems Linux people have been having with 'emma'. Alan From grimplet at ensam.inra.fr Tue Dec 17 08:35:43 2002 From: grimplet at ensam.inra.fr (=?iso-8859-1?q?j=E9r=F4me=20Grimplet?=) Date: Tue, 17 Dec 2002 14:35:43 +0100 Subject: emowse Message-ID: <200212171435.43355.grimplet@ensam.inra.fr> Hi, I want to known if it's possible to not use the partial factor (partial tryptic digest) in emowse. In many cases, the partials cleavages products add a lot of matches even when using low partial factor (0.1), so the results are very differents with mascott by example. I would like to put zero as partial factor. Another problem, I can't run emowse on an input file larger than 60,000 proteins (emowse works only on the 60,000 first). thanks for your help, Jerome -- J?r?me Grimplet Laboratoire de Biochimie M?tabolique et Technologie UMR Sciences Pour l'Oenologie 2, Place Viala 34060 Montpellier Cedex 01 Tel: 33(0)4.99.61.27.56 Fax: 33(0)4.99.61.28.57 grimplet at ensam.inra.fr From alfons at elmeuportal.net Tue Dec 17 16:28:03 2002 From: alfons at elmeuportal.net (Alfons Nonell i Canals) Date: 17 Dec 2002 22:28:03 +0100 Subject: Some informaton In-Reply-To: <200212171435.43355.grimplet@ensam.inra.fr> References: <200212171435.43355.grimplet@ensam.inra.fr> Message-ID: <1040160484.2807.19.camel@localhost.localdomain> Hi, I'm a youg person that is starting to work with bioinformatic's programs. I've read something about emboss. I have a PC with Mandrake Linux and I've tried to install Emboss on it. But, I've some problems with the installation and want some help. I only want some instructions tot start with Emboss and how to manageit. Thanks, Alfons. -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20021217/3655825b/attachment.html From charles at gizmotronics.dyndns.org Tue Dec 17 18:02:22 2002 From: charles at gizmotronics.dyndns.org (Charles Plessy) Date: Wed, 18 Dec 2002 00:02:22 +0100 Subject: Some informaton In-Reply-To: <1040160484.2807.19.camel@localhost.localdomain> References: <200212171435.43355.grimplet@ensam.inra.fr> <1040160484.2807.19.camel@localhost.localdomain> Message-ID: <20021217230222.GA3139@gizmotronics.dyndns.org> Hi Alfons, It would help if you gave more information about what you did, like : - Which version you tried to install. - The error message. Charles > I have a PC with Mandrake Linux and I've tried to install Emboss on it. But, > I've some problems with the installation and want some help. I only want some > instructions tot start with Emboss and how to manageit. > > Thanks, > Alfons. From cbonnard at isrec-sg1.unil.ch Wed Dec 18 04:14:08 2002 From: cbonnard at isrec-sg1.unil.ch (Claude Bonnard) Date: Wed, 18 Dec 2002 10:14:08 +0100 Subject: dbiflat Message-ID: <10212181014.ZM8272@isrec-sg1> Hello, I have a little problem /error during database formatting.. does someone have an idea? This error has apparently no consequence since the program terminates with a usable result, but I prefer things which goes "clean". dbiflat -idformat=SWISS -directory=/db/swiss-prot/ -dbname=swissprot -release=40 -date=17/12/02 -filenames=swiss.dat -i ndexdirectory=/db/emboss/swissprot/40 -debug Error: Bad database attribute '' Index a flat file database ---------------------------------------- Here is the head of the dbiflat.dbg (probably not userful to have all the entries..) With my best regards, Claude Debug file dbiflat.dbg buffered:No acdArgsScan acdDebug Yes acdDoHelp No ajFileNewIn '/home/emboss/EMBOSS-2.5.0/share/EMBOSS/acd/dbiflat.acd' ajNamResolve of '/home/emboss/EMBOSS-2.5.0/share/EMBOSS/acd/dbiflat.acd' EOF ajFileGetsL file /home/emboss/EMBOSS-2.5.0/share/EMBOSS/acd/dbiflat.acd closing file '/home/emboss/EMBOSS-2.5.0/share/EMBOSS/acd/dbiflat.acd' acdSetDefC auto 'N' 256a0 acdSetDefC stdout 'N' 25740 acdSetDefC filter 'N' 257e0 acdSetDefC options 'N' 25880 acdSetDefC debug 'N' 25920 acdSetDefC acdlog 'N' 259c0 acdSetDefC acdpretty 'N' 25a60 acdSetDefC acdtable 'N' 25b00 acdSetDefC help 'N' 25ba0 acdSetDefC verbose 'N' 25c40 acdSetDefC warning 'Y' 25ce0 acdSetDefC error 'Y' 25d80 acdSetDefC fatal 'Y' 25e20 acdSetDefC die 'N' 25ec0 acdSetVarDef today '17/12/02' ff25fbc8 acdNewSec 'input' acdSecList length 0 acdNewSec acdSecList push 'input' new length 1 acdSet attr 'idformat' val 'required' type '' acdSet attr 'idformat' val 'information' type '' acdSet attr 'idformat' val 'values' type '' acdSet attr 'idformat' val 'maximum' type '' acdSet attr 'idformat' val 'minimum' type '' acdSet attr 'idformat' val 'default' type '' acdSet attr 'directory' val 'required' type '' acdSet attr 'directory' val 'default' type '' acdSet attr 'directory' val 'information' type '' acdSet attr 'filenames' val 'required' type '' acdSet attr 'filenames' val 'default' type '' acdSet attr 'filenames' val 'information' type '' acdNewEndsec 'input' acdSecList length 1 Pop from acdSecList 'input' (0) new length 0 acdNewSec 'required' acdSecList length 0 acdNewSec acdSecList push 'required' new length 1 acdSet attr 'dbname' val 'parameter' type '' acdSet attr 'dbname' val 'maxlength' type '' acdSet attr 'dbname' val 'minlength' type '' acdSet attr 'dbname' val 'information' type '' acdSet attr 'release' val 'required' type '' acdSet attr 'release' val 'default' type '' acdSet attr 'release' val 'maxlength' type '' acdSet attr 'release' val 'information' type '' acdSet attr 'date' val 'required' type '' acdSet attr 'date' val 'default' type '' acdSet attr 'date' val 'valid' type '' acdSet attr 'date' val 'information' type '' acdSet attr 'date' val 'pattern' type '' acdNewEndsec 'required' acdSecList length 1 Pop from acdSecList 'required' (0) new length 0 acdNewSec 'advanced' acdSecList length 0 acdNewSec acdSecList push 'advanced' new length 1 acdSet attr 'fields' val 'required' type '' acdSet attr 'fields' val 'information' type '' acdSet attr 'fields' val 'values' type '' acdSet attr 'fields' val 'minimum' type '' acdSet attr 'fields' val 'maximum' type '' acdSet attr 'fields' val 'default' type '' acdSet attr 'exclude' val 'information' type '' acdSet attr 'indexdirectory' val 'default' type '' acdSet attr 'indexdirectory' val 'information' type '' acdSet attr 'maxindex' val 'default' type '' acdSet attr 'maxindex' val 'minimum' type '' acdSet attr 'maxindex' val 'information' type '' acdSet attr 'sortoptions' val 'default' type '' acdSet attr 'sortoptions' val 'information' type '' acdSet attr 'sortoptions' val 'help' type '' acdSet attr 'systemsort' val 'default' type '' acdSet attr 'systemsort' val 'information' type '' acdSet attr 'cleanup' val 'default' type '' acdSet attr 'cleanup' val 'information' type '' acdNewEndsec 'advanced' acdSecList length 1 Pop from acdSecList 'advanced' (0) new length 0 -- All Done : acdSecList length 0 acdSet attr 'dbname' val 'required' type '' qualifier value 'SWISS' 'idformat=SWISS' 9 .. -1 acdDef idformat 'SWISS' 26758 acdSetDef idformat 'SWISS' 26758 qualifier value '/db/swiss-prot' 'directory=/db/swiss-prot' 10 .. -1 acdDef directory '/db/swiss-prot' 267a0 acdSetDef directory '/db/swiss-prot' 267a0 qualifier value 'swissprot' 'dbname=swissprot' 7 .. -1 acdDef dbname 'swissprot' 26b40 acdSetDef dbname 'swissprot' 26b40 qualifier value '40' 'release=40' 8 .. -1 acdDef release '40' 2ff10 acdSetDef release '40' 2ff10 qualifier value '17/12/02' 'date=17/12/02' 5 .. -1 acdDef date '17/12/02' 2ffb0 acdSetDef date '17/12/02' 2ffb0 qualifier value 'swiss.dat' 'filenames=swiss.dat' 10 .. -1 acdDef filenames 'swiss.dat' 269f0 acdSetDef filenames 'swiss.dat' 269f0 qualifier value '/db/emboss/swissprot/40' 'indexdirectory=/db/emboss/swissprot/40' 15 .. -1 acdDef indexdirectory '/db/emboss/swissprot/40' 30378 acdSetDef indexdirectory '/db/emboss/swissprot/40' 30378 acdDef debug 'Y' 25920 acdSetDef debug 'Y' 25920 acdSetBool -auto def: N acdSetQualAppl 'auto' acdSetBool -auto val: No acdSetBool -stdout def: N acdSetQualAppl 'stdout' acdSetBool -stdout val: No acdSetBool -filter def: N acdSetQualAppl 'filter' acdSetBool -filter val: No acdSetBool -options def: N acdSetQualAppl 'options' acdSetBool -options val: No acdSetBool -debug def: Y acdSetQualAppl 'debug' acdSetBool -debug val: Yes acdSetBool -acdlog def: N acdSetQualAppl 'acdlog' acdSetBool -acdlog val: No acdSetBool -acdpretty def: N acdSetQualAppl 'acdpretty' acdSetBool -acdpretty val: No acdSetBool -acdtable def: N acdSetQualAppl 'acdtable' acdSetBool -acdtable val: No acdSetBool -help def: N acdSetQualAppl 'help' acdSetBool -help val: No acdHelp No acdSetBool -verbose def: N acdSetQualAppl 'verbose' acdSetBool -verbose val: No acdSetBool -warning def: Y acdSetQualAppl 'warning' acdSetBool -warning val: Yes acdSetBool -error def: Y acdSetQualAppl 'error' acdSetBool -error val: Yes acdSetBool -fatal def: Y acdSetQualAppl 'fatal' acdSetBool -fatal val: Yes acdSetBool -die def: N acdSetQualAppl 'die' acdSetBool -die val: No testing 'SWISS' Found 1 matches OK: Y min: 1 max: 1 Accept: 'SWISS' Found 1 matches Menu length now 0 before return val[0] 'SWISS' before return val[0] 'SWISS' Storing val[0] 'SWISS' testing 'acnum' Found 1 matches OK: Y min: 0 max: 5 Accept: 'acnum' Found 1 matches Menu length now 0 before return val[0] 'acnum' before return val[0] 'acnum' Storing val[0] 'acnum' acdSetBool -systemsort def: Y acdSetQualAppl 'systemsort' acdSetBool -systemsort val: Yes acdSetBool -cleanup def: Y acdSetQualAppl 'cleanup' acdSetBool -cleanup val: Yes reading '/db/swiss-prot/swiss.dat' writing '/db/emboss/swissprot/40/' embDbiFileListExc dir '/db/swiss-prot' wildfile 'swiss.dat' exclude '' dirfix '/db/swiss-prot/' ajFileTestSkip: file '.' exclude: '' include: 'swiss.dat' ajStrMatchWildCC '.' 'swiss.dat' cmp: -1 ajFileTestSkip: file '..' exclude: '' include: 'swiss.dat' ajStrMatchWildCC '..' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'swissprot_36' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swissprot_36' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'README' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'README' 'swiss.dat' cmp: -1 ajFileTestSkip: file '7tmrlist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC '7tmrlist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'aatrnasy.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'aatrnasy.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'acindex.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'acindex.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'allergen.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'allergen.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'autindex.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'autindex.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'calbican.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'calbican.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'cdlist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'cdlist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'celegans.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'celegans.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'citindex.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'citindex.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'dicty.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'dicty.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'ec2dtosp.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'ec2dtosp.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'ecoli.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'ecoli.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'embltosp.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'embltosp.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'experts.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'experts.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'extradom.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'extradom.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'glycosid.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'glycosid.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'haeinflu.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'haeinflu.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'hoxlist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'hoxlist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'humchr20.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'humchr20.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'release' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'release' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'humchr21.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'humchr21.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'humchr22.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'humchr22.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'humchrx.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'humchrx.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'humchry.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'humchry.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'jourlist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'jourlist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'keyindex.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'keyindex.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'keywlist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'keywlist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'mimtosp.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'mimtosp.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'nomlist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'nomlist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'pdbtosp.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'pdbtosp.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'peptidas.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'peptidas.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'plastid.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'plastid.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'pombe.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'pombe.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'relnotes.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'relnotes.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'restric.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'restric.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'ribosomp.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'ribosomp.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'salty.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'salty.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'shortdes.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'shortdes.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'speclist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'speclist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'speindex.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'speindex.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'new' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'new' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'submit.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'submit.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'subtilis.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'subtilis.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'tisslist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'tisslist.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'userman.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'userman.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast1.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast1.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast10.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast10.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast11.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast11.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast14.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast14.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast2.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast2.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast3.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast3.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast5.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast5.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast6.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast6.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast7.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast7.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast8.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast8.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast9.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast9.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss_2.idx' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss_2.idx' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss.seq' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss.seq' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss.stamp' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss.stamp' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl.dat' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl.dat' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl.idx' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl.idx' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl.seq' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl.seq' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl_new.dat' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_new.dat' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl_new.idx' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_new.idx' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl_new.seq' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_new.seq' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss.idx' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss.idx' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'pdb.seq' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'pdb.seq' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'trembl_2.idx' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_2.idx' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl.stamp' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl.stamp' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'pir.seq.Z' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'pir.seq.Z' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'nr_filter' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'nr_filter' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'trembl_new_2.idx' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_new_2.idx' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'gp_eliot_filter' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'gp_eliot_filter' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'trembl_varsplic.seq' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_varsplic.seq' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss_new.dat' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss_new.dat' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss.cix' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss.cix' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'trembl.cix' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl.cix' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl_new.cix' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_new.cix' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'new_seq.dat' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'new_seq.dat' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'trembl_new.stamp' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_new.stamp' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'README.mirror' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'README.mirror' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'swiss.dat' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss.dat' 'swiss.dat' cmp: 0 ajFileTestSkip: file 'swiss.dat' included by 'swiss.dat' accept 'swiss.dat' ajFileTestSkip: file 'swiss_varsplic.seq' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss_varsplic.seq' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss_varsplic.cix' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss_varsplic.cix' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl_varsplic.cix' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_varsplic.cix' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'sprot40.dat' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'sprot40.dat' 'swiss.dat' cmp: -1 1 files for '/db/swiss-prot' 'swiss.dat' ajFileNewIn '/db/swiss-prot/swiss.dat' ajNamResolve of '/db/swiss-prot/swiss.dat' processing filename '/db/swiss-prot/swiss.dat' ... processing file '/db/swiss-prot/swiss.dat' ... ++id '104K_THEPA' ++acc 'P15711' ++id '108_LYCES' ++acc 'Q43495' ++id '10KD_VIGUN' ++acc 'P18646' ++id '110K_PLAKN' ++acc 'P13813' ++id '11S3_HELAN' ++acc 'P19084' ...................... -- Claude Bonnard Ph.D. ISREC (Swiss Institute for Experimental Cancer Research) Bioinformatics Group Ch des Boveresses 155 CH-1066 Epalinges Switzerland phone: [41-21]-692-5891 fax: [41-21]-652-6933 From sievers at xml-biotop.de Wed Dec 18 07:59:03 2002 From: sievers at xml-biotop.de (sievers at xml-biotop.de) Date: Wed, 18 Dec 2002 13:59:03 +0100 Subject: Some informaton In-Reply-To: <1040160484.2807.19.camel@localhost.localdomain> Message-ID: Alfons Nonell i Canals schrieb am 17 Dec 2002: > I've read something about emboss. There is a good tutorial in german, that helps me a lot: http://userpage.fu-berlin.de/~sgmd/emboss-installation.html Greetings Dietmar From alfons at elmeuportal.net Wed Dec 18 08:48:49 2002 From: alfons at elmeuportal.net (Alfons Nonell i Canals) Date: 18 Dec 2002 14:48:49 +0100 Subject: Some informaton In-Reply-To: References: Message-ID: <1040219330.2806.1.camel@localhost.localdomain> Thaks everybody for your help. Thanks for the tutorial but, I need something on Engliss, Catalan or Spanish... Thanks! Alfons. El dc, 18-12-2002 a las 13:59, sievers at xml-biotop.de escribi?: Alfons Nonell i Canals schrieb am 17 Dec 2002: > I've read something about emboss. There is a good tutorial in german, that helps me a lot: http://userpage.fu-berlin.de/~sgmd/emboss-installation.html Greetings Dietmar -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.open-bio.org/pipermail/emboss/attachments/20021218/105051ed/attachment.html From p.ernst at dkfz-heidelberg.de Wed Dec 18 08:56:44 2002 From: p.ernst at dkfz-heidelberg.de (Peter Ernst) Date: Wed, 18 Dec 2002 14:56:44 +0100 (MET) Subject: Announcement: W2H version 4.1 released Message-ID: I am pleased to announce a new release (4.1) of "W2H - the WWW Interface to Sequence Analysis Software Tools". This release of W2H is capable to serve current EMBOSS releases and contains several improvements and fixes over W2H 4.0. For further details, please check the W2H homepage: http://www.w2h.dkfz-heidelberg.de/Doc/history.html or http://industry.ebi.ac.uk/w2h/Doc/history.html Availability: ftp://genome.dkfz-heidelberg.de/pub/w2h and/or ftp://ftp.ebi.ac.uk/pub/software/unix/w2h W2H homepage: http://www.w2h.dkfz-heidelberg.de/ and/or http://industry.ebi.ac.uk/w2h Peter Ernst -- ======================================================================= Peter Ernst Department of Molecular Biophysics - H0200 Deutsches Krebsforschungszentrum (German Cancer Research Center) DKFZ Im Neuenheimer Feld 580 / Technologiepark 3 69120 Heidelberg, Germany phone: +49-6221-42-2330 http://genome.dkfz-heidelberg.de/ fax: +49-6221-42-2333 ======================================================================= From jrvalverde at cnb.uam.es Wed Dec 18 08:56:53 2002 From: jrvalverde at cnb.uam.es (jrvalverde at cnb.uam.es) Date: Wed, 18 Dec 2002 14:56:53 +0100 (MET) Subject: Some informaton In-Reply-To: <1040219330.2806.1.camel@localhost.localdomain> Message-ID: <200212181356.gBIDut72381508@embnet.cnb.uam.es> Alfons Nonell i Canals wrote: > Thaks everybody for your help. Thanks for the tutorial but, I need > something on Engliss, Catalan or Spanish... What do you want, exactly? I can help you step by step in Spanish if you want. That's what I'm being paid for after all :-) j From Pranay.Bhattacharyya at cshs.org Wed Dec 18 21:20:08 2002 From: Pranay.Bhattacharyya at cshs.org (Bhattacharyya, Pranay) Date: Wed, 18 Dec 2002 18:20:08 -0800 Subject: Fuzznuc or Splitter for Windows2000 Message-ID: <3CFAA0108952D111A5BF00805FA6FB0F0478CFD0@PEDSNTAS.csmc.edu> Hi I was wondering if anyone has successfully compiled Fuzznuc or Splitter for windows 2000? We're trying to search a 160MBase file. We have tried using splitter on our SUN system to break it down into smaller pieces but it runs out of memory. Fuzznuc also runs out of memory on that file. Any help would be appreciated thanks! If you have the compiled binary we would love to receive it. Pranay From brian_osborne at cognia.com Thu Dec 19 16:09:21 2002 From: brian_osborne at cognia.com (Brian Osborne) Date: Thu, 19 Dec 2002 16:09:21 -0500 Subject: EMBOSS Message-ID: EMBOSSers, I'm pleased to report that EMBOSS 2.5.1 compiles and installs cleanly on cygwin ("CYGWIN_NT-5.0 1.3.17(0.67/3/2) 2002-11-27 18:54 i686 unknown") from www.cygwin.org. I've only used a few of the EMBOSS programs but I'd be very surprised if any didn't work, cygwin handles standard languages with no difficulty. For those of you who haven't run across cygwin it's a Unix emulator running on Windows machines. The package contains most common Unix utilities as well as a C compiler, support for Perl and Python, apache, many standard libraries, ssh, cvs, emacs, tcsh/zsh, and so on. Connecting to mysql and Oracle is also possible, I do it myself, but setting it up can be a little trickier than on Unix machines. Installing cygwin creates a set of directories in the Windows filesystem that look just like Unix directories by name but behave like regular Windows folders. Installation is very easy. It's free and its performance is very good, it should be recommended to those who want to use EMBOSS on Windows machines. Thanks once again for your excellent work, Brian O. Brian Osborne Director of Informatics Cognia http://www.cognia.com brian_osborne at cognia.com 117 E. 55th St. NYC NY USA 10022 TEL 212 331 7848 FAX 646 349 1835 From jison at hgmp.mrc.ac.uk Thu Dec 19 16:44:02 2002 From: jison at hgmp.mrc.ac.uk (Dr J.C. Ison) Date: Thu, 19 Dec 2002 21:44:02 +0000 Subject: EMBOSS References: Message-ID: <3E023DA2.E249EB2@hgmp.mrc.ac.uk> On behalf of the emboss nightshift - thanks for the nice comments ! J. : ) Brian Osborne wrote: > EMBOSSers, > > I'm pleased to report that EMBOSS 2.5.1 compiles and installs cleanly on > cygwin ("CYGWIN_NT-5.0 1.3.17(0.67/3/2) 2002-11-27 18:54 i686 unknown") from > www.cygwin.org. I've only used a few of the EMBOSS programs but I'd be very > surprised if any didn't work, cygwin handles standard languages with no > difficulty. > > For those of you who haven't run across cygwin it's a Unix emulator running > on Windows machines. The package contains most common Unix utilities as well > as a C compiler, support for Perl and Python, apache, many standard > libraries, ssh, cvs, emacs, tcsh/zsh, and so on. Connecting to mysql and > Oracle is also possible, I do it myself, but setting it up can be a little > trickier than on Unix machines. Installing cygwin creates a set of > directories in the Windows filesystem that look just like Unix directories > by name but behave like regular Windows folders. Installation is very easy. > It's free and its performance is very good, it should be recommended to > those who want to use EMBOSS on Windows machines. > > Thanks once again for your excellent work, > > Brian O. > > Brian Osborne > Director of Informatics > Cognia http://www.cognia.com > brian_osborne at cognia.com > 117 E. 55th St. > NYC NY USA 10022 > TEL 212 331 7848 > FAX 646 349 1835 From asen.nenov at metalife.de Fri Dec 20 04:08:08 2002 From: asen.nenov at metalife.de (Asen Nenov) Date: Fri, 20 Dec 2002 11:08:08 +0200 Subject: EMBOSS under win2000 References: Message-ID: <003201c2a807$629b5660$3801a8c0@metalife.bg> Hi Brian, Actually I tested the compiling of EMBOSS 2.5.1 under CYGWIN [WIN2000 Professional] last week. It crashed 30 secs after running MAKE. Is there something special that you change to run the process? Second question is: Did you plan to run some benchmarking on EMBOSS under win2000 vs. EMBOSS under Linux server. It will be interesting, exaclty how slower it is running. :-) Regards Asen p.s. Out of subject: I wanted to test some of your tools on Cognia website, but the demo link gave me Error 500: http://nt.cognia.com/demopcdb/index.jsp Any ideas how to access this demo? METALIFE AG - Sofia, Bulgaria asen.nenov at metalife.de www.metalife.de ++359 2 950 1802 ----- Original Message ----- From: "Brian Osborne" To: Sent: Thursday, December 19, 2002 11:09 PM Subject: EMBOSS > EMBOSSers, > > I'm pleased to report that EMBOSS 2.5.1 compiles and installs cleanly on > cygwin ("CYGWIN_NT-5.0 1.3.17(0.67/3/2) 2002-11-27 18:54 i686 unknown") from > www.cygwin.org. I've only used a few of the EMBOSS programs but I'd be very > surprised if any didn't work, cygwin handles standard languages with no > difficulty. > > For those of you who haven't run across cygwin it's a Unix emulator running > on Windows machines. The package contains most common Unix utilities as well > as a C compiler, support for Perl and Python, apache, many standard > libraries, ssh, cvs, emacs, tcsh/zsh, and so on. Connecting to mysql and > Oracle is also possible, I do it myself, but setting it up can be a little > trickier than on Unix machines. Installing cygwin creates a set of > directories in the Windows filesystem that look just like Unix directories > by name but behave like regular Windows folders. Installation is very easy. > It's free and its performance is very good, it should be recommended to > those who want to use EMBOSS on Windows machines. > > Thanks once again for your excellent work, > > Brian O. > > Brian Osborne > Director of Informatics > Cognia http://www.cognia.com > brian_osborne at cognia.com > 117 E. 55th St. > NYC NY USA 10022 > TEL 212 331 7848 > FAX 646 349 1835 > > > From brian_osborne at cognia.com Fri Dec 20 08:12:43 2002 From: brian_osborne at cognia.com (Brian Osborne) Date: Fri, 20 Dec 2002 08:12:43 -0500 Subject: EMBOSS under win2000 In-Reply-To: <003201c2a807$629b5660$3801a8c0@metalife.bg> Message-ID: Asen, No, cygwin is all standard on my machine, cygwin_nt-5.0 on Windows 2000 Pro. If you'd like I can take a look at the make errors, send them my way. First suggestion: make sure you have all the libraries, I noticed EMBOSS used libpng.a and a bunch of others. Cygwin should have them all, you just have to figure out which packages have them, the descriptions aren't always clear. Does EMBOSS use libgd.a? I don't think so, but that one doesn't come with cygwin. libfreetype.a is a part of one of the Xfree fonts packages but this isn't at all clear just reading the descriptions in setup.exe. Does EMBOSS use it? The problem with benchmarking is I don't have 2 identical machines, or a double-booting machine, set up here. I would bet that the executables would run at about the same speed on cygwin as they do native on Windows. Cygwin is a very "thin" emulator, just a bash shell using 2 M of memory, and it's using gcc, just as in Linux. Cygwin bash is just as fast as Windows Command Prompt, I'm sure of it, I just ran some different Perl one-liners, cygwin was slightly better (so that's cygwin tcsh and Perl versus Command Prompt and ActiveState Perl). But I agree, one should do the test, you'd like to test the OS's, not the emulator. I can run a test for you if you'd like, just tell me what to do. That URL for the demo is old, it shouldn't work. What you can do is call up Sales at 212.331.7842, or write sales at cognia.com, they would be happy to show Cognia Molecular to you. Brian O. -----Original Message----- From: Asen Nenov [mailto:asen.nenov at metalife.de] Sent: Friday, December 20, 2002 4:08 AM To: Brian Osborne; emboss at embnet.org Subject: Re: EMBOSS under win2000 Hi Brian, Actually I tested the compiling of EMBOSS 2.5.1 under CYGWIN [WIN2000 Professional] last week. It crashed 30 secs after running MAKE. Is there something special that you change to run the process? Second question is: Did you plan to run some benchmarking on EMBOSS under win2000 vs. EMBOSS under Linux server. It will be interesting, exaclty how slower it is running. :-) Regards Asen p.s. Out of subject: I wanted to test some of your tools on Cognia website, but the demo link gave me Error 500: http://nt.cognia.com/demopcdb/index.jsp Any ideas how to access this demo? METALIFE AG - Sofia, Bulgaria asen.nenov at metalife.de www.metalife.de ++359 2 950 1802 ----- Original Message ----- From: "Brian Osborne" To: Sent: Thursday, December 19, 2002 11:09 PM Subject: EMBOSS > EMBOSSers, > > I'm pleased to report that EMBOSS 2.5.1 compiles and installs cleanly on > cygwin ("CYGWIN_NT-5.0 1.3.17(0.67/3/2) 2002-11-27 18:54 i686 unknown") from > www.cygwin.org. I've only used a few of the EMBOSS programs but I'd be very > surprised if any didn't work, cygwin handles standard languages with no > difficulty. > > For those of you who haven't run across cygwin it's a Unix emulator running > on Windows machines. The package contains most common Unix utilities as well > as a C compiler, support for Perl and Python, apache, many standard > libraries, ssh, cvs, emacs, tcsh/zsh, and so on. Connecting to mysql and > Oracle is also possible, I do it myself, but setting it up can be a little > trickier than on Unix machines. Installing cygwin creates a set of > directories in the Windows filesystem that look just like Unix directories > by name but behave like regular Windows folders. Installation is very easy. > It's free and its performance is very good, it should be recommended to > those who want to use EMBOSS on Windows machines. > > Thanks once again for your excellent work, > > Brian O. > > Brian Osborne > Director of Informatics > Cognia http://www.cognia.com > brian_osborne at cognia.com > 117 E. 55th St. > NYC NY USA 10022 > TEL 212 331 7848 > FAX 646 349 1835 > > > From hamsa_t at yahoo.com Mon Dec 2 06:20:41 2002 From: hamsa_t at yahoo.com (Hamsa Tadepally) Date: Sun, 1 Dec 2002 22:20:41 -0800 (PST) Subject: Reg:emboss Message-ID: <20021202062041.89078.qmail@web14410.mail.yahoo.com> Sir, I am a student of Bioinformatics. I need help regarding the EMBOSS software..How can I randomize teo sequences and compare them using EMBOSS? Is there an option available. It would be kind of you if you could kindly help me. Thanking you and with regards, Hamsa __________________________________________________ Do you Yahoo!? Yahoo! Mail Plus - Powerful. Affordable. Sign up now. http://mailplus.yahoo.com From gbottu at ben.vub.ac.be Mon Dec 2 09:48:02 2002 From: gbottu at ben.vub.ac.be (Guy Bottu) Date: Mon, 2 Dec 2002 10:48:02 +0100 (CET) Subject: comparing randomized sequences Message-ID: <200212020948.gB29m26F1059818@black.vub.ac.be> from : Belgian EMBnet Node Dear student, You can run the program shuffleseq with parameter -shuffle=n on sequence B to obtain n randomized versions. Then you can run needle or water on sequence A and the shuffleseq output. (or some variation of this scheme). Guy Bottu From marcus at chah.ucc.ie Mon Dec 2 14:42:56 2002 From: marcus at chah.ucc.ie (Marcus Claesson) Date: Mon, 2 Dec 2002 14:42:56 +0000 (GMT) Subject: DBIBLAST error when creating blast database Message-ID: Hello, When I try to create a blast database for use within emboss (I have EMBOSS-2.5.1), it won't work. I created the ecoli.aa db using 'formatdb'. This is what I'm doing: ............. [marcus at nsfm39 db]$ ls -l ecoli.aa* -rw-rw-r-- 1 marcus marcus 563415 Nov 11 17:08 ecoli.aa.phr -rw-rw-r-- 1 marcus marcus 34376 Nov 11 17:08 ecoli.aa.pin -rw-rw-r-- 1 marcus marcus 34312 Nov 11 17:08 ecoli.aa.pnd -rw-rw-r-- 1 marcus marcus 180 Nov 11 17:08 ecoli.aa.pni -rw-rw-r-- 1 marcus marcus 354726 Nov 11 17:08 ecoli.aa.psd -rw-rw-r-- 1 marcus marcus 8287 Nov 11 17:08 ecoli.aa.psi -rw-rw-r-- 1 marcus marcus 1363280 Nov 11 17:08 ecoli.aa.psq [marcus at nsfm39 db]$ dbiblast Index a BLAST database Database name: ecoli.aa Database directory [.]: Wildcard database filename [ecoli.aa]: Release number [0.0]: Index date [00/00/00]: N : nucleic P : protein ? : unknown Sequence type [unknown]: P 1 : wublast and setdb/pressdb 2 : formatdb 0 : unknown Blast index version [unknown]: 2 EMBOSS An error in dbiblast.c at line 351: No files selected ........................ Could anyone help me with this? Thanx in advance! Marcus From peter.rice at uk.lionbioscience.com Mon Dec 2 13:55:22 2002 From: peter.rice at uk.lionbioscience.com (Peter Rice) Date: Mon, 02 Dec 2002 13:55:22 +0000 Subject: DBIBLAST error when creating blast database References: Message-ID: <3DEB664A.1030901@uk.lionbioscience.com> Marcus Claesson wrote: > Hello, > > When I try to create a blast database for use within emboss (I have > EMBOSS-2.5.1), it won't work. I created the ecoli.aa db using 'formatdb'. > This is what I'm doing: > > Wildcard database filename [ecoli.aa]: > > EMBOSS An error in dbiblast.c at line 351: > No files selected > ........................ > > Could anyone help me with this? Your wildcard filename fails to find any files. If you still had the ecoli.aa fasta file (the one formatdb was used on) this would work - the wildcard filename check finds that file and then tries the formatdb index extensions. You should specify ecoli.aa.* (in quotes if on the command line because of the '*') Hope this helps Peter -- ------------------------------------------------ Peter Rice, LION Bioscience Ltd, Cambridge, UK peter.rice at uk.lionbioscience.com +44 1223 224723 From marcus at chah.ucc.ie Mon Dec 2 15:45:53 2002 From: marcus at chah.ucc.ie (Marcus Claesson) Date: Mon, 2 Dec 2002 15:45:53 +0000 (GMT) Subject: DBIBLAST error when creating blast database In-Reply-To: <3DEB664A.1030901@uk.lionbioscience.com> Message-ID: > Your wildcard filename fails to find any files. > If you still had the ecoli.aa fasta file (the one formatdb was used on) > this would work - the wildcard filename check finds that file and then > tries the formatdb index extensions. > > You should specify ecoli.aa.* (in quotes if on the command line because of > the '*') > Tried it, but it will still not fully work. Looks like this now: [marcus at nsfm39 db]$ ls -l ecoli.aa.* -rw------- 1 marcus marcus 1774183 Dec 2 14:15 ecoli.aa.fasta -rw-rw-r-- 1 marcus marcus 563415 Nov 11 17:08 ecoli.aa.phr -rw-rw-r-- 1 marcus marcus 34376 Nov 11 17:08 ecoli.aa.pin -rw-rw-r-- 1 marcus marcus 34312 Nov 11 17:08 ecoli.aa.pnd -rw-rw-r-- 1 marcus marcus 180 Nov 11 17:08 ecoli.aa.pni -rw-rw-r-- 1 marcus marcus 354726 Nov 11 17:08 ecoli.aa.psd -rw-rw-r-- 1 marcus marcus 8287 Nov 11 17:08 ecoli.aa.psi -rw-rw-r-- 1 marcus marcus 1363280 Nov 11 17:08 ecoli.aa.psq [marcus at nsfm39 db]$ dbiblast Index a BLAST database Database name: ecoli.aa Database directory [.]: Wildcard database filename [ecoli.aa]: ecoli.aa.* Release number [0.0]: Index date [00/00/00]: N : nucleic P : protein ? : unknown Sequence type [unknown]: P 1 : wublast and setdb/pressdb 2 : formatdb 0 : unknown Blast index version [unknown]:2 Warning: Duplicate ID skipped: '0?0???7(AE000312)' All hits will point to first ID found Warning: Duplicate ID skipped: '0?0???7(AE000312)' All hits will point to first ID found Warning: Duplicate ID skipped: '0?0???7(AE000312)' All hits will point to first ID found Warning: Duplicate ID skipped: '0?0???7(AE000312)' All hits will point to first ID found Warning: Duplicate ID skipped: '0?0???7(AE000314)' All hits will point to first ID found .. .. .. and so on... Am I almost there? Regards Marcus From peter.rice at uk.lionbioscience.com Mon Dec 2 14:46:53 2002 From: peter.rice at uk.lionbioscience.com (Peter Rice) Date: Mon, 02 Dec 2002 14:46:53 +0000 Subject: DBIBLAST error when creating blast database References: Message-ID: <3DEB725D.6010604@uk.lionbioscience.com> Marcus Claesson wrote: > Tried it, but it will still not fully work. > Looks like this now: > Warning: Duplicate ID skipped: '0?0???7(AE000312)' All hits will point to > first ID found > .. > and so on... > > Am I almost there? Yes - almost !!! The latest formatdb from NCBI creates "version 4" blast index files. NCBI have not provided any documentation on this format, so it is not supported by EMBOSS. To produce the 'old' (non-ASN.1) index files, use: formatdb -A F That should fix it. Peter -- ------------------------------------------------ Peter Rice, LION Bioscience Ltd, Cambridge, UK peter.rice at uk.lionbioscience.com +44 1223 224723 From marcus at chah.ucc.ie Mon Dec 2 16:49:17 2002 From: marcus at chah.ucc.ie (Marcus Claesson) Date: Mon, 2 Dec 2002 16:49:17 +0000 (GMT) Subject: DBIBLAST error when creating blast database In-Reply-To: <3DEB725D.6010604@uk.lionbioscience.com> Message-ID: > The latest formatdb from NCBI creates "version 4" blast index files. NCBI > have not provided any documentation on this format, so it is not supported > by EMBOSS. To produce the 'old' (non-ASN.1) index files, use: > > formatdb -A F > > That should fix it. Not fully, but at least I don't get any error messages. The ecoli.aa db won't show up when I run 'showdb'. Here's what I did: [marcus at nsfm39 db]$ formatdb -A F -i ecoli.aa -p T -o T [marcus at nsfm39 db]$ ll|grep "Dec 2" -rw------- 1 marcus marcus 1774183 Dec 2 14:15 ecoli.aa -rw-rw-r-- 1 marcus marcus 387530 Dec 2 15:29 ecoli.aa.phr -rw-rw-r-- 1 marcus marcus 34372 Dec 2 15:29 ecoli.aa.pin -rw-rw-r-- 1 marcus marcus 34312 Dec 2 15:29 ecoli.aa.pnd -rw-rw-r-- 1 marcus marcus 180 Dec 2 15:29 ecoli.aa.pni -rw-rw-r-- 1 marcus marcus 354726 Dec 2 15:29 ecoli.aa.psd -rw-rw-r-- 1 marcus marcus 8287 Dec 2 15:29 ecoli.aa.psi -rw-rw-r-- 1 marcus marcus 1363280 Dec 2 15:29 ecoli.aa.psq -rw-rw-r-- 1 marcus marcus 642786 Dec 2 15:29 formatdb.log [marcus at nsfm39 db]$ dbiblast Index a BLAST database Database name: ecoli.aa Database directory [.]: Wildcard database filename [ecoli.aa]: ecoli.aa.* Release number [0.0]: Index date [00/00/00]: N : nucleic P : protein ? : unknown Sequence type [unknown]: P 1 : wublast and setdb/pressdb 2 : formatdb 0 : unknown Blast index version [unknown]: 2 [marcus at nsfm39 db]$ showdb Displays information on the currently available databases # Name Type ID Qry All Comment # ==== ==== == === === ======= tpir P OK OK OK PIR using NBRF access for 4 files tsw P OK OK OK Swissprot native format with EMBL CD-ROM index tswnew P OK OK OK Swissnew as 3 files in native format with EMBL CD-ROM index twp P OK OK OK EMBL new in native format with EMBL CD-ROM index gb N OK - - Genbank IDs gba N OK - - Genbank ACs tembl N OK OK OK EMBL in native format with EMBL CD-ROM index tgb N OK - - Genbank IDs tgenbank N OK OK OK GenBank in native format with EMBL CD-ROM index [marcus at nsfm39 db]$ ll|grep "Dec 2" -rw-rw-r-- 1 marcus marcus 300 Dec 2 15:30 acnum.hit -rw-rw-r-- 1 marcus marcus 300 Dec 2 15:30 acnum.trg -rw-rw-r-- 1 marcus marcus 322 Dec 2 15:30 division.lkp -rw------- 1 marcus marcus 1774183 Dec 2 14:15 ecoli.aa -rw-rw-r-- 1 marcus marcus 387530 Dec 2 15:29 ecoli.aa.phr -rw-rw-r-- 1 marcus marcus 34372 Dec 2 15:29 ecoli.aa.pin -rw-rw-r-- 1 marcus marcus 34312 Dec 2 15:29 ecoli.aa.pnd -rw-rw-r-- 1 marcus marcus 180 Dec 2 15:29 ecoli.aa.pni -rw-rw-r-- 1 marcus marcus 354726 Dec 2 15:29 ecoli.aa.psd -rw-rw-r-- 1 marcus marcus 8287 Dec 2 15:29 ecoli.aa.psi -rw-rw-r-- 1 marcus marcus 1363280 Dec 2 15:29 ecoli.aa.psq -rw-rw-r-- 1 marcus marcus 86080 Dec 2 15:30 entrynam.idx -rw-rw-r-- 1 marcus marcus 642786 Dec 2 15:29 formatdb.log Thus, nothing new in showdb... Thanks for helping me Peter! /Marcus From peter.rice at uk.lionbioscience.com Mon Dec 2 15:41:42 2002 From: peter.rice at uk.lionbioscience.com (Peter Rice) Date: Mon, 02 Dec 2002 15:41:42 +0000 Subject: DBIBLAST error when creating blast database References: Message-ID: <3DEB7F36.2050601@uk.lionbioscience.com> Marcus Claesson wrote: > Not fully, but at least I don't get any error messages. The ecoli.aa db > won't show up when I run 'showdb'. You need to add the database to your site-wide emboss.defaults file (or your own ~/.embossrc file). We had a suggestion last week to generate the emboss.defaults lines in dbiblast - that will help you, but I don't expect to have time until the New Year. The database definition will look like this: DB ecoliaa [ type: P format: ncbi method: blast dir: /user/claesson/data indexdir: /user/classon/data comment: "E.coli protein data" ] -- ------------------------------------------------ Peter Rice, LION Bioscience Ltd, Cambridge, UK peter.rice at uk.lionbioscience.com +44 1223 224723 From maximtel at ibpm.pushchino.ru Tue Dec 3 23:22:06 2002 From: maximtel at ibpm.pushchino.ru (Maxim A. Telegin) Date: Tue, 3 Dec 2002 15:22:06 -0800 Subject: SHOWDB Message-ID: <004e01c29b22$cbc51780$300213c3@ibpm.serpukhov.su> Dear colleagues! After the compiling of EMBOSS package I've executed the showdb program. I think it must show the available databases as explain in Users Guide, but it shown nothing. Also such commands as "localhost$ seqret embl:bla-bla-bla" doesn't work. What does it mean? Sincerely yours, Maxim A. Telegin -------------- next part -------------- An HTML attachment was scrubbed... URL: From dbasalam at caramail.com Tue Dec 3 14:50:18 2002 From: dbasalam at caramail.com (basalam duru) Date: Tue, 03 Dec 2002 14:50:18 GMT+1 Subject: IN GOOD FAITH. Message-ID: <1038923418021128@caramail.com> My Dear, I am well confident of your capability to assist me in a transaction for mutual benefit of both parties, ie (me and you) I am also believing that you will not expose or betray the trust and confidence I am about to establish with you. I have decided to contact you with greatest delight and personal respect. I am ALHAJI DURU BASALAM. Former Director of National Union of hotels Sierra Leon presently now in Cote d?Ivoire because of Political Problem in my Country Sierra Leon. During my stay in Office I acquired $25 million Dollars, through money being mapped out for hotels Renovation in my Country Sierra Leon. Now due to war, I and the entire management could not be able to utilise the money being mapped out for the project. Now I diverted this money to a nearby Country Cote d?Ivoire and deposited the money into a BANK here in Abidjan for immediate transfer, for investment. Now the war in my country is over with the help of ECOMOG soldiers, the present goverment of sierra leone has revoked the passport of all officers who served under the former regime and now asked countries to expel such person at the same time freeze their account and confiscate their asset, It is on this note that Iam contacting you, all I needed from you is to furnish me with your bank particulars: 1)Account name 2)Account number 3)Bank address,telephone fax number. Now I would like to use your company account to transfer the money for investment. If my wish to invest in your Company is accepted with you as the manager, please contact me for more clarification. Thanks and God bless. NOTE: YOUR PERCENTAGE IS HIGHLY NEGOCIATED FOR YOUR NOBLE ASSISTANCE. HOPING TO HEAR FROM YOU SOONEST. ALHAJI DURU BASALAM Director National Union of hotels Sierra Leone _________________________________________________________ Gagne une PS2 ! Envoie un SMS avec le code PS au 61166 (0,35? Hors co?t du SMS) From Wiepert.Mathieu at mayo.edu Wed Dec 4 16:42:55 2002 From: Wiepert.Mathieu at mayo.edu (Wiepert, Mathieu) Date: Wed, 4 Dec 2002 10:42:55 -0600 Subject: emma or clustalw problem? Message-ID: <2F41CC6C9777D311ACBD009027B108EA0541BFFC@excsrv32.mayo.edu> Hi, Not sure if I have an SUE, or reached a limit in the software or hardware. I have a file with 457 fasta formatted sequences, that I want an MSF for, so I can prettyplot it. I tried emma (see command line following). Can I use a file of sequences, or do I need separate sequences, or have I broken the USA formatting required? My file is like the example file, only with many more sequences? The segmentation fault at the end concerns me... COMMAND LINE: ~/sequences $ emma -inseqs seqs.fa Multiple alignment program - interface to ClustalW program Output sequence [1001501.aln]: Output file [1001501.dnd]: ..clustalw -infile=5511A -outfile=5511B -align -type=dna -output=gcg -pwdnamatrix=iub -pwgapopen=10.000 -pwgapext=0.100 -newtree=5511C -dnamatrix= -gapopen=10.000 -gapext=5.000 -gapdist=8 -hgapresidues=GPSNDQEKR -maxdiv=30.. CLUSTAL W (1.82) Multiple Sequence Alignments Sequence type explicitly set to DNA ERROR: Could not open sequence file 5511A No. of seqs. read = -1. No alignment! Error: failed to open filename 5511B Problem writing out EMBOSS alignment fileSegmentation fault -mat -------------- next part -------------- An HTML attachment was scrubbed... URL: From starksb at ebi.ac.uk Wed Dec 4 16:49:24 2002 From: starksb at ebi.ac.uk (David Starks-Browning) Date: Wed, 4 Dec 2002 16:49:24 +0000 Subject: emma or clustalw problem? In-Reply-To: <2F41CC6C9777D311ACBD009027B108EA0541BFFC@excsrv32.mayo.edu> References: <2F41CC6C9777D311ACBD009027B108EA0541BFFC@excsrv32.mayo.edu> Message-ID: <484-Wed04Dec2002164924+0000-starksb@ebi.ac.uk> On Wednesday 4 Dec 02, Wiepert, Mathieu writes: > Hi, > > Not sure if I have an SUE SUE? > , or reached a limit in the software or > hardware. Clustalw is rather badly broken. The patch below provides a workaround suitable for Linux. (Was that your platform? You didn't say.) Regards, David *** emboss/emma.c.orig Thu Aug 22 16:09:03 2002 --- emboss/emma.c Wed Oct 30 12:18:17 2002 *************** *** 440,446 **** static AjPStr emma_getUniqueFileName() { ! static char ext[2] = "A"; AjPStr filename = NULL; --- 440,446 ---- static AjPStr emma_getUniqueFileName() { ! static char ext[6] = "A0000"; AjPStr filename = NULL; From Wiepert.Mathieu at mayo.edu Wed Dec 4 16:52:47 2002 From: Wiepert.Mathieu at mayo.edu (Wiepert, Mathieu) Date: Wed, 4 Dec 2002 10:52:47 -0600 Subject: emma or clustalw problem? Message-ID: <2F41CC6C9777D311ACBD009027B108EA0541BFFE@excsrv32.mayo.edu> > SUE? Stupid User Error I'll apply the patch. You are correct, I didn't really provide enough information, thx, -Mat From sebastian.bassi at ar.advantaseeds.com Thu Dec 5 13:04:59 2002 From: sebastian.bassi at ar.advantaseeds.com (Sebastian Bassi) Date: Thu, 5 Dec 2002 14:04:59 +0100 Subject: emma or clustalw problem? Message-ID: Hi, Sometimes the problems like this occurs when the program is expecting a UNIX formated text file and you put a windows style text file. I have had the inverse problem, I have downloaded a genome fasta file from the NCBI and the program I was using to handle it was unable to open it, since it expected a windows style text file and the downloaded file was with Unix format. The EOL character is different. There's a Windows program called CONVERT, it works as a pop up menu, just click the file with secondary button and select CONVERT TO (3 options, UNIX, PC or MAC). If you are using UNIX, there are some comand line utilities to do this (in Solaris is already built in). I don't know if EMBOSS have problem with this. ERROR: Could not open sequence file 5511A No. of seqs. read = -1. No alignment! Error: failed to open filename 5511B Problem writing out EMBOSS alignment fileSegmentation fault -mat -------------- next part -------------- An HTML attachment was scrubbed... URL: From Wiepert.Mathieu at mayo.edu Thu Dec 5 13:25:40 2002 From: Wiepert.Mathieu at mayo.edu (Wiepert, Mathieu) Date: Thu, 5 Dec 2002 07:25:40 -0600 Subject: emma or clustalw problem? Message-ID: <2F41CC6C9777D311ACBD009027B108EA0541C00B@excsrv32.mayo.edu> Hi, Thanks for the tip. I tried the code change to emma as suggested by David Starks-Browning, and that seemed to fix my problem. Always good to keep an eye on the EOL types though. In fact, many editors have built in functions to do that conversion, and have little reminders in the status bar. I configured my Ultraedit toolbar, making that function more readily accessible in my toolbar ;-) -Mat -----Original Message----- From: Sebastian Bassi [mailto:sebastian.bassi at ar.advantaseeds.com] Sent: Thursday, December 05, 2002 7:05 AM To: Wiepert, Mathieu; emboss at embnet.org Subject: RE: emma or clustalw problem? Hi, Sometimes the problems like this occurs when the program is expecting a UNIX formated text file and you put a windows style text file. I have had the inverse problem, I have downloaded a genome fasta file from the NCBI and the program I was using to handle it was unable to open it, since it expected a windows style text file and the downloaded file was with Unix format. The EOL character is different. There's a Windows program called CONVERT, it works as a pop up menu, just click the file with secondary button and select CONVERT TO (3 options, UNIX, PC or MAC). If you are using UNIX, there are some comand line utilities to do this (in Solaris is already built in). I don't know if EMBOSS have problem with this. ERROR: Could not open sequence file 5511A No. of seqs. read = -1. No alignment! Error: failed to open filename 5511B Problem writing out EMBOSS alignment fileSegmentation fault -mat -------------- next part -------------- An HTML attachment was scrubbed... URL: From starksb at ebi.ac.uk Thu Dec 5 14:21:30 2002 From: starksb at ebi.ac.uk (David Starks-Browning) Date: Thu, 5 Dec 2002 14:21:30 +0000 Subject: emma or clustalw problem? In-Reply-To: References: Message-ID: <1406-Thu05Dec2002142130+0000-starksb@ebi.ac.uk> On Thursday 5 Dec 02, Sebastian Bassi writes: > Hi, > > Sometimes the problems like this occurs when the program is > expecting a UNIX formated text file and you put a windows style text > file. ... Mathieu's problem was that clustalw is quite broken when it comes to string buffer management. Emma provides it the command line argument "5511A" and clustalw screws up the string buffer containing the filename, and attempts to open something different. In fact it's the string with an extra "garbage" character at the end. Although the error message says that 5511A was missing, in fact it was looking for 5511A^Y (where ^Y is ctrl-Y), or something like that. You don't see the extra ^Y in the error message. You see it in the open() system call when you study it with strace. (Which is how I determined this.) This only seems to be a problem on Linux, and only when the filename is 5 characters, which happens whenever Emma's PID is 4 characters. Hence the nature of my suggested workaround, which pads the filename to > 5 characters, no matter what the PID is. On the other hand, I know folks who have found clustalw to also break, on other platforms, when the filename is too long. I don't know what the limits are, so I don't know if it's safe to apply my Linux workaround to emma.c in general, for all platforms. > ERROR: Could not open sequence file 5511A > > > No. of seqs. read = -1. No alignment! > Error: failed to open filename 5511B > Problem writing out EMBOSS alignment fileSegmentation fault > > -mat From stefanielager at fastmail.ca Fri Dec 6 16:02:21 2002 From: stefanielager at fastmail.ca (Stefanie Lager) Date: Fri, 6 Dec 2002 11:02:21 -0500 (EST) Subject: reverse numbering Message-ID: <3DF0CA0D.0000BB.68670@ns.interchange.ca> Hi, I saw that GCG and EMBOSS use different numbering system when reversing sequences. If I align 2 sequences, using water from EMBOOS and bestfit from GCG, and ask to use the reverse strand of sequence 2. All EMBOSS programs reverse and complements sequence 2, giving it a new numbering. While bestfit (and other GCG programs) just compares the opposite strand but keeps the numbering according to the ORIGINAL strand. Is it possible to keep the numbering according to the original strand also in EMBOSS programs, when comparing the reverse strand? Stefanie ######################################## # Program: water # Rundate: Fri Dec 06 16:50:52 2002 # Report_file: A_B.water ######################################## #======================================= # # Aligned_sequences: 2 # 1: A.seq # 2: B.seq # Matrix: EDNAFULL # Gap_penalty: 10.0 # Extend_penalty: 0.5 # # Length: 33 # Identity: 33/33 (100.0%) # Similarity: 33/33 (100.0%) # Gaps: 0/33 ( 0.0%) # Score: 165.0 # # #======================================= A.seq 268 gcccaggagagccaaaaagccgagctggaaggc 300 ||||||||||||||||||||||||||||||||| B.seq 1 gcccaggagagccaaaaagccgagctggaaggc 33 #--------------------------------------- #--------------------------------------- BESTFIT of: A.gcg check: 5728 from: 1 to: 420 A.seq to reverse of: B.gcg2 check: 1476 from: 1 to: 33 B.seq Symbol comparison table: /disk4/gcg/gcgcore/data/rundata/swgapdna.cmp CompCheck: 2335 Gap Weight: 50 Average Match: 10.000 Length Weight: 3 Average Mismatch: -9.000 Quality: 330 Length: 33 Ratio: 10.000 Gaps: 0 Percent Similarity: 100.000 Percent Identity: 100.000 Match display thresholds for the alignment(s): | = IDENTITY : = 5 . = 1 A.gcg x B.gcg2 December 6, 2002 16:51 .. . . . 268 gcccaggagagccaaaaagccgagctggaaggc 300 ||||||||||||||||||||||||||||||||| 33 gcccaggagagccaaaaagccgagctggaaggc 1 _________________________________________________________________ http://fastmail.ca/ - Fast Secure Web Email for Canadians From ald at novozymesbiotech.com Fri Dec 6 19:16:47 2002 From: ald at novozymesbiotech.com (ALLO (Alfredo Lopez De Leon)) Date: Fri, 6 Dec 2002 11:16:47 -0800 Subject: Upgrade? Message-ID: Hi, I have been using EMBOSS version 2.4.1 and I would like to upgrade to version 2.5.1. I read all the 2.5.1 documentation (I believe I have) and there are no instructions on how to install 2.5.1. on top of an older version. Am I supposed to wipe out 2.4.1 and start from square number 1 with 2.5.1? Thanks in advance for you help and comments. Sincerely, Alfredo Lopez De Leon Ph.D. Postdoctoral Fellow, Molecular Biology and Bioinformatics Department Novozymes Biotech , Inc. 1445 Drew Avenue, Davis, CA 95616 From gearh006 at umn.edu Fri Dec 6 21:00:04 2002 From: gearh006 at umn.edu (Micah Gearhart) Date: Fri, 6 Dec 2002 15:00:04 -0600 Subject: siRNA applications Message-ID: I just started using EMBOSS and subscribed to this list today. 1) Does anyone know where I can get the sirna application since it does not appear to be in the latest distribution? 2) Is there an archive of this mailing list that I could consult for answers to my future questions? Thanks, Micah Gearhart University of Minnesota From gwilliam at hgmp.mrc.ac.uk Mon Dec 9 09:15:20 2002 From: gwilliam at hgmp.mrc.ac.uk (Gary Williams, Tel 01223 494522) Date: Mon, 09 Dec 2002 09:15:20 +0000 Subject: siRNA applications References: Message-ID: <3DF45F28.23A753E@hgmp.mrc.ac.uk> I'm still developing sirna. It should be in the next release. Regards, Gary Micah Gearhart wrote: > > I just started using EMBOSS and subscribed to this list today. > > 1) Does anyone know where I can get the sirna application since it does not > appear to be in the latest distribution? > > 2) Is there an archive of this mailing list that I could consult for answers > to my future questions? > > Thanks, > > Micah Gearhart > University of Minnesota -- Gary Williams Tel: +44 1223 494522 Fax: +44 1223 494512 mailto:G.Williams at hgmp.mrc.ac.uk http://www.hgmp.mrc.ac.uk/ Bioinformatics,MRC HGMP Resource Centre,Hinxton,Cambridge, CB10 1SB,UK From pdas at caltech.edu Wed Dec 11 04:27:45 2002 From: pdas at caltech.edu (pradeep das) Date: Tue, 10 Dec 2002 20:27:45 -0800 Subject: emboss for mac os x Message-ID: hi all, i'm an almost complete unix dummy. i've tried a few times to set up an emboss installation on my powerbook, but have never succeded. i'm happy using the command line, though, so i don't need to know how to set up jemboss and such. each time i've tried, i go through the compilation process described in the readme file (". /configure" followed by "make install"), but then i have no idea what to do next. actually, i just tried this again and this time, the 'make install' didn't complete - gave me errors. should i move the compiled files to a particular directory? do i need to edit the makefile (or whatever) and speficy the target directory before compiling? i'm a serious gcg addict (much prefer it to macvector and other programs like that) and i'm going to lose telnet (and thereby gcg) access at my old university pretty soon. hence the desperation! i would appreciate any help in the matter. thanks, pradeep p.s. if i can get it to work, i'd be more than happy to help write a thorugh installation guide for macs. From grsvc at mucc.mahidol.ac.th Wed Dec 11 06:50:11 2002 From: grsvc at mucc.mahidol.ac.th (Suksiri Vichasri) Date: Wed, 11 Dec 2002 13:50:11 +0700 (ICT) Subject: emboss for mac os x In-Reply-To: Message-ID: <20021211132700.D16801-100000@mucc.mahidol.ac.th> The installation of EMBOSS on MacOS 10.1.x and newer works fine thanks to the efforts of Alan Bleasby. Just follow the instructions given in the admin guide. After extracting the .gz file, changing to the correct emboss directory, ./configure, make and sudo make install should be all that is necessary to get emboss installed in /usr/local. Take care that your PATH variable contains /usr/local/bin and that you add the PLPLOT_LIB variable (setenv PLPLOT_LIB='/usr/local/share/EMBOSS') to your tcsh settings. This variable is necessary for graphics output. Please let me know whether this works for you. Kindly, Rudi On Tue, 10 Dec 2002, pradeep das wrote: > hi all, > i'm an almost complete unix dummy. i've tried a few times to set up an > emboss installation on my powerbook, but have never succeded. i'm happy > using the command line, though, so i don't need to know how to set up > jemboss and such. > > each time i've tried, i go through the compilation process described in the > readme file (". /configure" followed by "make install"), but then i have no > idea what to do next. actually, i just tried this again and this time, the > 'make install' didn't complete - gave me errors. > > should i move the compiled files to a particular directory? do i need to > edit the makefile (or whatever) and speficy the target directory before > compiling? > > i'm a serious gcg addict (much prefer it to macvector and other programs > like that) and i'm going to lose telnet (and thereby gcg) access at my old > university pretty soon. hence the desperation! > > i would appreciate any help in the matter. > > thanks, > pradeep > > p.s. if i can get it to work, i'd be more than happy to help write a thorugh > installation guide for macs. > > > From abrown at nimr.mrc.ac.uk Wed Dec 11 09:27:39 2002 From: abrown at nimr.mrc.ac.uk (Alex Brown) Date: Wed, 11 Dec 2002 09:27:39 +0000 Subject: emboss for mac os x In-Reply-To: Message-ID: 'morning Pradeep. I am also a bit of unix grasshopper, but I managed to install EMBOSS on my G4 under Darwin. There is great set of instructions from a William Van Etten of the Blackstone Tecnology Group at the following web site: http://gnu-darwin.sourceforge.net/gdc/emboss.txt This got me up and running. You will need to install X-windows - have a look at XDarwin (http://www.xdarwin.org/) or XFree86 (http://www.xfree86.org/). By the way - there are some good books on unix and Macs in the O'Reilly series, aimed at us novices. They are well worth having a look at. You could also look at the gnu-Darwin pages (http://gnu- darwin.sourceforge.net/) which has loads of unix soteware (scientific and other) which is quite easy to install. Once you've installed X Windows and EMBOSS, you'll get the hang of things. Good luck, Alex Brown MRC-T, London On Wednesday, December 11, 2002, at 04:27 am, pradeep das wrote: > hi all, > i'm an almost complete unix dummy. i've tried a few times to set up an > emboss installation on my powerbook, but have never succeded. i'm happy > using the command line, though, so i don't need to know how to set up > jemboss and such. > > each time i've tried, i go through the compilation process described in > the > readme file (". /configure" followed by "make install"), but then i > have no > idea what to do next. actually, i just tried this again and this time, > the > 'make install' didn't complete - gave me errors. > > should i move the compiled files to a particular directory? do i need to > edit the makefile (or whatever) and speficy the target directory before > compiling? > > i'm a serious gcg addict (much prefer it to macvector and other programs > like that) and i'm going to lose telnet (and thereby gcg) access at my > old > university pretty soon. hence the desperation! > > i would appreciate any help in the matter. > > thanks, > pradeep > > p.s. if i can get it to work, i'd be more than happy to help write a > thorugh > installation guide for macs. > > From rpg at mrc-lmb.cam.ac.uk Wed Dec 11 09:34:46 2002 From: rpg at mrc-lmb.cam.ac.uk (rpg at mrc-lmb.cam.ac.uk) Date: Wed, 11 Dec 2002 09:34:46 +0000 (GMT) Subject: emboss for mac os x In-Reply-To: from Alex Brown at "Dec 11, 2002 09:27:39 am" Message-ID: <200212110934.JAA17077@alf1.mrc-lmb.cam.ac.uk> Check out http://fink.sourceforge.net/ for a fantastic way of getting all sorts of unixy goodness for your Macs. I obtained EMBOSS this way, too. My personal experience (in brief) is at http://www.rg-d.com/BioLOG/archive/nov02.html#20021120ah and there are useful links therein. r -- Richard P. Grant http://www2.mrc-lmb.cam.ac.uk/personal/rpg/ MRC-LMB, Cambridge, UK PGP: 0x5F9559B1 weblog: http://www.rg-d.com/BioLOG/ From ruediger at sanbi.ac.za Thu Dec 12 09:36:07 2002 From: ruediger at sanbi.ac.za (Ruediger Braeuning) Date: Thu, 12 Dec 2002 11:36:07 +0200 (SAST) Subject: seqret & getz Message-ID: <20021212112959.X63135-100000@fling.sanbi.ac.za> Hi, I've aliased the SRS getz command: getz: aliased to /kraal/srs/bin/solaris8/getz I wanted to use SRS for the seqret command but seqret couldn't find getz. Putting a symbolic link to getz in /emboss/bin worked but it is not the nicest thing. Does anyone have a good solution for that problem (eg environment variables)? Thanks Ruediger ------------------------------------------------------------------------- Ruediger Braeuning / South African National Bioinformatics Institute (=) University of the Western Cape Ph. +27 21 959 3645 / Private Bag X17 Fax +27 21 959 2512 (=) Bellville, 7535 www.sanbi.ac.za / South Africa From btiwari at molbiol.ox.ac.uk Thu Dec 12 10:05:40 2002 From: btiwari at molbiol.ox.ac.uk (Bela Tiwari) Date: Thu, 12 Dec 2002 10:05:40 +0000 (GMT) Subject: seqret & getz In-Reply-To: <20021212112959.X63135-100000@fling.sanbi.ac.za> Message-ID: > >I wanted to use SRS for the seqret command but seqret couldn't find getz. > >Putting a symbolic link to getz in /emboss/bin worked but it is not >the nicest thing. Does anyone have a good solution for that problem (eg >environment variables)? > Hello, Are you sourcing the prep_srs script, which comes with the srs release, in your environment to set all the SRS variables before running seqret? In addition to setting variables, this script should add the relevant SRS directories to your PATH. Maybe rely on getz being found because it is in a directory on your PATH, insteady using an alias? Note that by default, prep_srs puts the SRS directories at the start of the PATH, so if you don't want them there, you might want to edit the script. I hope this helps. Bela .-.-.-.-.-.-.-.-.-.-.-.-.-.-.-. Dr. Bela Tiwari Acting Manager OU Bioinformatics Centre SWD School of Pathology South Parks Road Oxford OX1 3RE 01865 (2)75507 http://www.molbiol.ox.ac.uk .-.-.-.-.-.-.-.-.-.-.-.-.-.-.-. From peter.rice at uk.lionbioscience.com Thu Dec 12 10:29:12 2002 From: peter.rice at uk.lionbioscience.com (Peter Rice) Date: Thu, 12 Dec 2002 10:29:12 +0000 Subject: seqret & getz References: <20021212112959.X63135-100000@fling.sanbi.ac.za> Message-ID: <3DF864F8.9020705@uk.lionbioscience.com> Ruediger Braeuning wrote: > Hi, > > I've aliased the SRS getz command: > > getz: aliased to /kraal/srs/bin/solaris8/getz > > I wanted to use SRS for the seqret command but seqret couldn't find getz. EMBOSS can use an alternative (or full) name for getz. I did this when running SRS5 and SRS6 at Sanger, but it works for you too. Add this line to your database definition in EMBOSS: app: "/kraal/srs/bin/solaris8/getz" Hope this helps, Peter -- ------------------------------------------------ Peter Rice, LION Bioscience Ltd, Cambridge, UK peter.rice at uk.lionbioscience.com +44 1223 224723 From squiresb at macrogenics.com Thu Dec 12 19:41:33 2002 From: squiresb at macrogenics.com (Burke Squires) Date: Thu, 12 Dec 2002 13:41:33 -0600 Subject: Genbank in extractfeat? In-Reply-To: Message-ID: Hello, I am trying to test out extractfeat but I am having trouble using a genbank file. Is it possible to extract from a genbank file and am I just doing something stupid? Burke Squires From David.Bauer at SCHERING.DE Fri Dec 13 06:45:21 2002 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Fri, 13 Dec 2002 07:45:21 +0100 Subject: Antwort: Genbank in extractfeat? Message-ID: Hi, which version do you use ? In older versions of EMBOSS this used to work only with EMBL format and not with GenBank. As far as I remember the feature reading libraries support GenBank format at least since version 2.4. David. Hello, I am trying to test out extractfeat but I am having trouble using a genbank file. Is it possible to extract from a genbank file and am I just doing something stupid? Burke Squires From asen.nenov at metalife.de Mon Dec 16 08:40:29 2002 From: asen.nenov at metalife.de (Asen Nenov) Date: Mon, 16 Dec 2002 10:40:29 +0200 Subject: EMBOSS under WIN2000 Message-ID: <001501c2a4de$da24e060$3801a8c0@metalife.bg> Hi, I am using EMBOSS undex Mandrake Linux and the package is working properly. Now I have to run a web-based system including EMBOSS package under WIN2000 server platform. My question is: Is it possible to run the package under windows. I know it is possible to recompile selected program and also that copliling under CYGWIN is not working at all. Any help appreciated. Regards Asen Nenov METALIFE AG - Sofia, Bulgaria asen.nenov at metalife.de www.metalife.de ++359 2 950 1802 From David.Bauer at SCHERING.DE Mon Dec 16 09:24:13 2002 From: David.Bauer at SCHERING.DE (David.Bauer at SCHERING.DE) Date: Mon, 16 Dec 2002 10:24:13 +0100 Subject: EMBOSS under WIN2000 Message-ID: Hello Asen, just throw away the Win2000 :-) But seriously, why not leaving the EMBOSS on a Linux server with Apache and one of the WWW interfaces: (http://www.hgmp.mrc.ac.uk/Software/EMBOSS/interfaces.html) You could install Luke's EMBOSS GUI which is very emboss specific but easy to set up. If you need an interface for other sequence analysis programs I would suggest Cathrine Letondal's PISE. This you can use for emboss and dozens other sequence analysis programs. Sincerely, David. Hi, I am using EMBOSS undex Mandrake Linux and the package is working properly. Now I have to run a web-based system including EMBOSS package under WIN2000 server platform. My question is: Is it possible to run the package under windows. I know it is possible to recompile selected program and also that copliling under CYGWIN is not working at all. Any help appreciated. Regards Asen Nenov METALIFE AG - Sofia, Bulgaria asen.nenov at metalife.de www.metalife.de ++359 2 950 1802 From sharmila at ebi.ac.uk Mon Dec 16 13:52:56 2002 From: sharmila at ebi.ac.uk (Sharmila Pillai) Date: Mon, 16 Dec 2002 13:52:56 +0000 (GMT) Subject: EMBOSS under WIN2000 Message-ID: Hello Asen, On the same note, as David's, if you are interested, I have a SOAP interface to EMBOSS - a client (your windows machine) can talk (SOAP) to a remote machine running a webserver/AXIS and has EMBOSS installed in it. For now, you can access most of teh EMBOSS applications excluding graphical ones. Regards, Sharmila. > > Hello Asen, > > just throw away the Win2000 :-) > But seriously, why not leaving the EMBOSS on a Linux server with Apache and > one > of the WWW interfaces: > (http://www.hgmp.mrc.ac.uk/Software/EMBOSS/interfaces.html) > You could install Luke's EMBOSS GUI which is very emboss specific but easy to > set up. > If you need an interface for other sequence analysis programs I would suggest > Cathrine Letondal's PISE. > This you can use for emboss and dozens other sequence analysis programs. > > Sincerely, > David. > > > Hi, > > I am using EMBOSS undex Mandrake Linux and the package is working properly. > Now I have to run a web-based system including EMBOSS package under WIN2000 > server platform. My question is: Is it possible to run the package under > windows. I know it is possible to recompile selected program and also that > copliling under CYGWIN is not working at all. > Any help appreciated. > > Regards > Asen Nenov > > METALIFE AG - Sofia, Bulgaria > asen.nenov at metalife.de > www.metalife.de > ++359 2 950 1802 From cbonnard at isrec-sg1.unil.ch Mon Dec 16 14:28:03 2002 From: cbonnard at isrec-sg1.unil.ch (Claude Bonnard) Date: Mon, 16 Dec 2002 15:28:03 +0100 Subject: Warning: Cannot open division file '' Message-ID: <10212161528.ZM5934@isrec-sg1> Hello, Trying to use a database indexed with dbiflat, I have the followind result: > pepinfo swissprot:104K_THEPA Plots simple amino acid properties in parallel Warning: Cannot open division file '' for database 'swissprot' Warning: seqCdQry failed Error: Unable to read sequence 'swissprot:104K_THEPA' The formatting is made with those parameters -------------------------------- dbiflat -idformat=SWISS -directory=/db/swiss-prot/ -dbname=swissprot \ -release=$SW_RELEASE -date=$DATE \ -filenames=swiss.dat -indexdirectory=/db/emboss/swissprot/$SW_RELEASE -------------------------------- In emboss.default, this base is defined as: ---------------------------------- DB swissprot [ type: P comment: "SWISSPROT sequences" method: emblcd format: swiss dbalias: swissprot dir: /db/emboss/swissprot/40/ file: swiss.dat indexdir: /db/emboss/swissprot/40/ ] ---------------------------------- The content of this directory is: ---------------------------------- drwxr-sr-x 2 emboss sib 1024 Dec 16 15:17 . drwxr-sr-x 3 emboss sib 512 Dec 16 14:50 .. -rw-r--r-- 1 emboss sib 583792 Dec 16 14:54 acnum.hit -rw-r--r-- 1 emboss sib 2040590 Dec 16 14:54 acnum.trg -rw-r--r-- 1 emboss sib 327 Dec 16 14:54 division.lkp -rw-r--r-- 1 emboss sib 2407300 Dec 16 14:54 entrynam.idx -rw-r--r-- 1 emboss sib 0 Dec 16 14:54 INDEX_DATE lrwxrwxrwx 1 emboss sib 24 Dec 16 15:17 swiss.dat -> /db/swiss-prot/swiss.dat ---------------------------------- Any idea? Thanks Cheers Claude -- Claude Bonnard Ph.D. ISREC (Swiss Institute for Experimental Cancer Research) Bioinformatics Group Ch des Boveresses 155 CH-1066 Epalinges Switzerland phone: [41-21]-692-5891 fax: [41-21]-652-6933 From ableasby at hgmp.mrc.ac.uk Mon Dec 16 21:33:50 2002 From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk) Date: Mon, 16 Dec 2002 21:33:50 GMT Subject: Clustalw fix for EMBOSS Message-ID: <200212162133.VAA29519@bromine.hgmp.mrc.ac.uk> There is a patched clustalw available for download as: ftp://ftp.uk.embnet.org/pub/EMBOSS/clustal/clustalw1.83.UNIX.tar.gz This fixes a couple of memory corruption errors and replaces the gets() function with fgets() to tidy up the compilation a bit. It is to be regarded as both unofficial and "use at your own risk". I'll be reporting my fixes to Des et al so, hopefully there'll be an official 1.8.3 out soon. In the meantime it ought to solve problems Linux people have been having with 'emma'. Alan From grimplet at ensam.inra.fr Tue Dec 17 13:35:43 2002 From: grimplet at ensam.inra.fr (=?iso-8859-1?q?j=E9r=F4me=20Grimplet?=) Date: Tue, 17 Dec 2002 14:35:43 +0100 Subject: emowse Message-ID: <200212171435.43355.grimplet@ensam.inra.fr> Hi, I want to known if it's possible to not use the partial factor (partial tryptic digest) in emowse. In many cases, the partials cleavages products add a lot of matches even when using low partial factor (0.1), so the results are very differents with mascott by example. I would like to put zero as partial factor. Another problem, I can't run emowse on an input file larger than 60,000 proteins (emowse works only on the 60,000 first). thanks for your help, Jerome -- J?r?me Grimplet Laboratoire de Biochimie M?tabolique et Technologie UMR Sciences Pour l'Oenologie 2, Place Viala 34060 Montpellier Cedex 01 Tel: 33(0)4.99.61.27.56 Fax: 33(0)4.99.61.28.57 grimplet at ensam.inra.fr From alfons at elmeuportal.net Tue Dec 17 21:28:03 2002 From: alfons at elmeuportal.net (Alfons Nonell i Canals) Date: 17 Dec 2002 22:28:03 +0100 Subject: Some informaton In-Reply-To: <200212171435.43355.grimplet@ensam.inra.fr> References: <200212171435.43355.grimplet@ensam.inra.fr> Message-ID: <1040160484.2807.19.camel@localhost.localdomain> Hi, I'm a youg person that is starting to work with bioinformatic's programs. I've read something about emboss. I have a PC with Mandrake Linux and I've tried to install Emboss on it. But, I've some problems with the installation and want some help. I only want some instructions tot start with Emboss and how to manageit. Thanks, Alfons. -------------- next part -------------- An HTML attachment was scrubbed... URL: From charles at gizmotronics.dyndns.org Tue Dec 17 23:02:22 2002 From: charles at gizmotronics.dyndns.org (Charles Plessy) Date: Wed, 18 Dec 2002 00:02:22 +0100 Subject: Some informaton In-Reply-To: <1040160484.2807.19.camel@localhost.localdomain> References: <200212171435.43355.grimplet@ensam.inra.fr> <1040160484.2807.19.camel@localhost.localdomain> Message-ID: <20021217230222.GA3139@gizmotronics.dyndns.org> Hi Alfons, It would help if you gave more information about what you did, like : - Which version you tried to install. - The error message. Charles > I have a PC with Mandrake Linux and I've tried to install Emboss on it. But, > I've some problems with the installation and want some help. I only want some > instructions tot start with Emboss and how to manageit. > > Thanks, > Alfons. From cbonnard at isrec-sg1.unil.ch Wed Dec 18 09:14:08 2002 From: cbonnard at isrec-sg1.unil.ch (Claude Bonnard) Date: Wed, 18 Dec 2002 10:14:08 +0100 Subject: dbiflat Message-ID: <10212181014.ZM8272@isrec-sg1> Hello, I have a little problem /error during database formatting.. does someone have an idea? This error has apparently no consequence since the program terminates with a usable result, but I prefer things which goes "clean". dbiflat -idformat=SWISS -directory=/db/swiss-prot/ -dbname=swissprot -release=40 -date=17/12/02 -filenames=swiss.dat -i ndexdirectory=/db/emboss/swissprot/40 -debug Error: Bad database attribute '' Index a flat file database ---------------------------------------- Here is the head of the dbiflat.dbg (probably not userful to have all the entries..) With my best regards, Claude Debug file dbiflat.dbg buffered:No acdArgsScan acdDebug Yes acdDoHelp No ajFileNewIn '/home/emboss/EMBOSS-2.5.0/share/EMBOSS/acd/dbiflat.acd' ajNamResolve of '/home/emboss/EMBOSS-2.5.0/share/EMBOSS/acd/dbiflat.acd' EOF ajFileGetsL file /home/emboss/EMBOSS-2.5.0/share/EMBOSS/acd/dbiflat.acd closing file '/home/emboss/EMBOSS-2.5.0/share/EMBOSS/acd/dbiflat.acd' acdSetDefC auto 'N' 256a0 acdSetDefC stdout 'N' 25740 acdSetDefC filter 'N' 257e0 acdSetDefC options 'N' 25880 acdSetDefC debug 'N' 25920 acdSetDefC acdlog 'N' 259c0 acdSetDefC acdpretty 'N' 25a60 acdSetDefC acdtable 'N' 25b00 acdSetDefC help 'N' 25ba0 acdSetDefC verbose 'N' 25c40 acdSetDefC warning 'Y' 25ce0 acdSetDefC error 'Y' 25d80 acdSetDefC fatal 'Y' 25e20 acdSetDefC die 'N' 25ec0 acdSetVarDef today '17/12/02' ff25fbc8 acdNewSec 'input' acdSecList length 0 acdNewSec acdSecList push 'input' new length 1 acdSet attr 'idformat' val 'required' type '' acdSet attr 'idformat' val 'information' type '' acdSet attr 'idformat' val 'values' type '' acdSet attr 'idformat' val 'maximum' type '' acdSet attr 'idformat' val 'minimum' type '' acdSet attr 'idformat' val 'default' type '' acdSet attr 'directory' val 'required' type '' acdSet attr 'directory' val 'default' type '' acdSet attr 'directory' val 'information' type '' acdSet attr 'filenames' val 'required' type '' acdSet attr 'filenames' val 'default' type '' acdSet attr 'filenames' val 'information' type '' acdNewEndsec 'input' acdSecList length 1 Pop from acdSecList 'input' (0) new length 0 acdNewSec 'required' acdSecList length 0 acdNewSec acdSecList push 'required' new length 1 acdSet attr 'dbname' val 'parameter' type '' acdSet attr 'dbname' val 'maxlength' type '' acdSet attr 'dbname' val 'minlength' type '' acdSet attr 'dbname' val 'information' type '' acdSet attr 'release' val 'required' type '' acdSet attr 'release' val 'default' type '' acdSet attr 'release' val 'maxlength' type '' acdSet attr 'release' val 'information' type '' acdSet attr 'date' val 'required' type '' acdSet attr 'date' val 'default' type '' acdSet attr 'date' val 'valid' type '' acdSet attr 'date' val 'information' type '' acdSet attr 'date' val 'pattern' type '' acdNewEndsec 'required' acdSecList length 1 Pop from acdSecList 'required' (0) new length 0 acdNewSec 'advanced' acdSecList length 0 acdNewSec acdSecList push 'advanced' new length 1 acdSet attr 'fields' val 'required' type '' acdSet attr 'fields' val 'information' type '' acdSet attr 'fields' val 'values' type '' acdSet attr 'fields' val 'minimum' type '' acdSet attr 'fields' val 'maximum' type '' acdSet attr 'fields' val 'default' type '' acdSet attr 'exclude' val 'information' type '' acdSet attr 'indexdirectory' val 'default' type '' acdSet attr 'indexdirectory' val 'information' type '' acdSet attr 'maxindex' val 'default' type '' acdSet attr 'maxindex' val 'minimum' type '' acdSet attr 'maxindex' val 'information' type '' acdSet attr 'sortoptions' val 'default' type '' acdSet attr 'sortoptions' val 'information' type '' acdSet attr 'sortoptions' val 'help' type '' acdSet attr 'systemsort' val 'default' type '' acdSet attr 'systemsort' val 'information' type '' acdSet attr 'cleanup' val 'default' type '' acdSet attr 'cleanup' val 'information' type '' acdNewEndsec 'advanced' acdSecList length 1 Pop from acdSecList 'advanced' (0) new length 0 -- All Done : acdSecList length 0 acdSet attr 'dbname' val 'required' type '' qualifier value 'SWISS' 'idformat=SWISS' 9 .. -1 acdDef idformat 'SWISS' 26758 acdSetDef idformat 'SWISS' 26758 qualifier value '/db/swiss-prot' 'directory=/db/swiss-prot' 10 .. -1 acdDef directory '/db/swiss-prot' 267a0 acdSetDef directory '/db/swiss-prot' 267a0 qualifier value 'swissprot' 'dbname=swissprot' 7 .. -1 acdDef dbname 'swissprot' 26b40 acdSetDef dbname 'swissprot' 26b40 qualifier value '40' 'release=40' 8 .. -1 acdDef release '40' 2ff10 acdSetDef release '40' 2ff10 qualifier value '17/12/02' 'date=17/12/02' 5 .. -1 acdDef date '17/12/02' 2ffb0 acdSetDef date '17/12/02' 2ffb0 qualifier value 'swiss.dat' 'filenames=swiss.dat' 10 .. -1 acdDef filenames 'swiss.dat' 269f0 acdSetDef filenames 'swiss.dat' 269f0 qualifier value '/db/emboss/swissprot/40' 'indexdirectory=/db/emboss/swissprot/40' 15 .. -1 acdDef indexdirectory '/db/emboss/swissprot/40' 30378 acdSetDef indexdirectory '/db/emboss/swissprot/40' 30378 acdDef debug 'Y' 25920 acdSetDef debug 'Y' 25920 acdSetBool -auto def: N acdSetQualAppl 'auto' acdSetBool -auto val: No acdSetBool -stdout def: N acdSetQualAppl 'stdout' acdSetBool -stdout val: No acdSetBool -filter def: N acdSetQualAppl 'filter' acdSetBool -filter val: No acdSetBool -options def: N acdSetQualAppl 'options' acdSetBool -options val: No acdSetBool -debug def: Y acdSetQualAppl 'debug' acdSetBool -debug val: Yes acdSetBool -acdlog def: N acdSetQualAppl 'acdlog' acdSetBool -acdlog val: No acdSetBool -acdpretty def: N acdSetQualAppl 'acdpretty' acdSetBool -acdpretty val: No acdSetBool -acdtable def: N acdSetQualAppl 'acdtable' acdSetBool -acdtable val: No acdSetBool -help def: N acdSetQualAppl 'help' acdSetBool -help val: No acdHelp No acdSetBool -verbose def: N acdSetQualAppl 'verbose' acdSetBool -verbose val: No acdSetBool -warning def: Y acdSetQualAppl 'warning' acdSetBool -warning val: Yes acdSetBool -error def: Y acdSetQualAppl 'error' acdSetBool -error val: Yes acdSetBool -fatal def: Y acdSetQualAppl 'fatal' acdSetBool -fatal val: Yes acdSetBool -die def: N acdSetQualAppl 'die' acdSetBool -die val: No testing 'SWISS' Found 1 matches OK: Y min: 1 max: 1 Accept: 'SWISS' Found 1 matches Menu length now 0 before return val[0] 'SWISS' before return val[0] 'SWISS' Storing val[0] 'SWISS' testing 'acnum' Found 1 matches OK: Y min: 0 max: 5 Accept: 'acnum' Found 1 matches Menu length now 0 before return val[0] 'acnum' before return val[0] 'acnum' Storing val[0] 'acnum' acdSetBool -systemsort def: Y acdSetQualAppl 'systemsort' acdSetBool -systemsort val: Yes acdSetBool -cleanup def: Y acdSetQualAppl 'cleanup' acdSetBool -cleanup val: Yes reading '/db/swiss-prot/swiss.dat' writing '/db/emboss/swissprot/40/' embDbiFileListExc dir '/db/swiss-prot' wildfile 'swiss.dat' exclude '' dirfix '/db/swiss-prot/' ajFileTestSkip: file '.' exclude: '' include: 'swiss.dat' ajStrMatchWildCC '.' 'swiss.dat' cmp: -1 ajFileTestSkip: file '..' exclude: '' include: 'swiss.dat' ajStrMatchWildCC '..' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'swissprot_36' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swissprot_36' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'README' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'README' 'swiss.dat' cmp: -1 ajFileTestSkip: file '7tmrlist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC '7tmrlist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'aatrnasy.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'aatrnasy.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'acindex.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'acindex.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'allergen.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'allergen.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'autindex.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'autindex.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'calbican.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'calbican.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'cdlist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'cdlist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'celegans.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'celegans.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'citindex.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'citindex.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'dicty.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'dicty.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'ec2dtosp.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'ec2dtosp.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'ecoli.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'ecoli.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'embltosp.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'embltosp.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'experts.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'experts.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'extradom.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'extradom.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'glycosid.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'glycosid.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'haeinflu.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'haeinflu.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'hoxlist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'hoxlist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'humchr20.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'humchr20.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'release' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'release' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'humchr21.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'humchr21.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'humchr22.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'humchr22.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'humchrx.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'humchrx.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'humchry.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'humchry.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'jourlist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'jourlist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'keyindex.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'keyindex.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'keywlist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'keywlist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'mimtosp.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'mimtosp.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'nomlist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'nomlist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'pdbtosp.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'pdbtosp.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'peptidas.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'peptidas.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'plastid.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'plastid.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'pombe.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'pombe.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'relnotes.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'relnotes.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'restric.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'restric.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'ribosomp.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'ribosomp.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'salty.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'salty.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'shortdes.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'shortdes.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'speclist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'speclist.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'speindex.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'speindex.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'new' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'new' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'submit.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'submit.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'subtilis.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'subtilis.txt' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'tisslist.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'tisslist.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'userman.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'userman.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast1.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast1.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast10.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast10.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast11.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast11.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast14.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast14.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast2.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast2.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast3.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast3.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast5.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast5.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast6.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast6.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast7.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast7.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast8.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast8.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'yeast9.txt' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'yeast9.txt' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss_2.idx' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss_2.idx' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss.seq' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss.seq' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss.stamp' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss.stamp' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl.dat' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl.dat' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl.idx' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl.idx' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl.seq' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl.seq' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl_new.dat' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_new.dat' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl_new.idx' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_new.idx' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl_new.seq' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_new.seq' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss.idx' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss.idx' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'pdb.seq' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'pdb.seq' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'trembl_2.idx' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_2.idx' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl.stamp' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl.stamp' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'pir.seq.Z' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'pir.seq.Z' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'nr_filter' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'nr_filter' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'trembl_new_2.idx' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_new_2.idx' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'gp_eliot_filter' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'gp_eliot_filter' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'trembl_varsplic.seq' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_varsplic.seq' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss_new.dat' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss_new.dat' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss.cix' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss.cix' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'trembl.cix' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl.cix' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl_new.cix' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_new.cix' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'new_seq.dat' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'new_seq.dat' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'trembl_new.stamp' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_new.stamp' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'README.mirror' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'README.mirror' 'swiss.dat' cmp: -1 ajFileTestSkip: file 'swiss.dat' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss.dat' 'swiss.dat' cmp: 0 ajFileTestSkip: file 'swiss.dat' included by 'swiss.dat' accept 'swiss.dat' ajFileTestSkip: file 'swiss_varsplic.seq' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss_varsplic.seq' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'swiss_varsplic.cix' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'swiss_varsplic.cix' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'trembl_varsplic.cix' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'trembl_varsplic.cix' 'swiss.dat' cmp: 1 ajFileTestSkip: file 'sprot40.dat' exclude: '' include: 'swiss.dat' ajStrMatchWildCC 'sprot40.dat' 'swiss.dat' cmp: -1 1 files for '/db/swiss-prot' 'swiss.dat' ajFileNewIn '/db/swiss-prot/swiss.dat' ajNamResolve of '/db/swiss-prot/swiss.dat' processing filename '/db/swiss-prot/swiss.dat' ... processing file '/db/swiss-prot/swiss.dat' ... ++id '104K_THEPA' ++acc 'P15711' ++id '108_LYCES' ++acc 'Q43495' ++id '10KD_VIGUN' ++acc 'P18646' ++id '110K_PLAKN' ++acc 'P13813' ++id '11S3_HELAN' ++acc 'P19084' ...................... -- Claude Bonnard Ph.D. ISREC (Swiss Institute for Experimental Cancer Research) Bioinformatics Group Ch des Boveresses 155 CH-1066 Epalinges Switzerland phone: [41-21]-692-5891 fax: [41-21]-652-6933 From sievers at xml-biotop.de Wed Dec 18 12:59:03 2002 From: sievers at xml-biotop.de (sievers at xml-biotop.de) Date: Wed, 18 Dec 2002 13:59:03 +0100 Subject: Some informaton In-Reply-To: <1040160484.2807.19.camel@localhost.localdomain> Message-ID: Alfons Nonell i Canals schrieb am 17 Dec 2002: > I've read something about emboss. There is a good tutorial in german, that helps me a lot: http://userpage.fu-berlin.de/~sgmd/emboss-installation.html Greetings Dietmar From alfons at elmeuportal.net Wed Dec 18 13:48:49 2002 From: alfons at elmeuportal.net (Alfons Nonell i Canals) Date: 18 Dec 2002 14:48:49 +0100 Subject: Some informaton In-Reply-To: References: Message-ID: <1040219330.2806.1.camel@localhost.localdomain> Thaks everybody for your help. Thanks for the tutorial but, I need something on Engliss, Catalan or Spanish... Thanks! Alfons. El dc, 18-12-2002 a las 13:59, sievers at xml-biotop.de escribi?: Alfons Nonell i Canals schrieb am 17 Dec 2002: > I've read something about emboss. There is a good tutorial in german, that helps me a lot: http://userpage.fu-berlin.de/~sgmd/emboss-installation.html Greetings Dietmar -------------- next part -------------- An HTML attachment was scrubbed... URL: From p.ernst at dkfz-heidelberg.de Wed Dec 18 13:56:44 2002 From: p.ernst at dkfz-heidelberg.de (Peter Ernst) Date: Wed, 18 Dec 2002 14:56:44 +0100 (MET) Subject: Announcement: W2H version 4.1 released Message-ID: I am pleased to announce a new release (4.1) of "W2H - the WWW Interface to Sequence Analysis Software Tools". This release of W2H is capable to serve current EMBOSS releases and contains several improvements and fixes over W2H 4.0. For further details, please check the W2H homepage: http://www.w2h.dkfz-heidelberg.de/Doc/history.html or http://industry.ebi.ac.uk/w2h/Doc/history.html Availability: ftp://genome.dkfz-heidelberg.de/pub/w2h and/or ftp://ftp.ebi.ac.uk/pub/software/unix/w2h W2H homepage: http://www.w2h.dkfz-heidelberg.de/ and/or http://industry.ebi.ac.uk/w2h Peter Ernst -- ======================================================================= Peter Ernst Department of Molecular Biophysics - H0200 Deutsches Krebsforschungszentrum (German Cancer Research Center) DKFZ Im Neuenheimer Feld 580 / Technologiepark 3 69120 Heidelberg, Germany phone: +49-6221-42-2330 http://genome.dkfz-heidelberg.de/ fax: +49-6221-42-2333 ======================================================================= From jrvalverde at cnb.uam.es Wed Dec 18 13:56:53 2002 From: jrvalverde at cnb.uam.es (jrvalverde at cnb.uam.es) Date: Wed, 18 Dec 2002 14:56:53 +0100 (MET) Subject: Some informaton In-Reply-To: <1040219330.2806.1.camel@localhost.localdomain> Message-ID: <200212181356.gBIDut72381508@embnet.cnb.uam.es> Alfons Nonell i Canals wrote: > Thaks everybody for your help. Thanks for the tutorial but, I need > something on Engliss, Catalan or Spanish... What do you want, exactly? I can help you step by step in Spanish if you want. That's what I'm being paid for after all :-) j From Pranay.Bhattacharyya at cshs.org Thu Dec 19 02:20:08 2002 From: Pranay.Bhattacharyya at cshs.org (Bhattacharyya, Pranay) Date: Wed, 18 Dec 2002 18:20:08 -0800 Subject: Fuzznuc or Splitter for Windows2000 Message-ID: <3CFAA0108952D111A5BF00805FA6FB0F0478CFD0@PEDSNTAS.csmc.edu> Hi I was wondering if anyone has successfully compiled Fuzznuc or Splitter for windows 2000? We're trying to search a 160MBase file. We have tried using splitter on our SUN system to break it down into smaller pieces but it runs out of memory. Fuzznuc also runs out of memory on that file. Any help would be appreciated thanks! If you have the compiled binary we would love to receive it. Pranay From brian_osborne at cognia.com Thu Dec 19 21:09:21 2002 From: brian_osborne at cognia.com (Brian Osborne) Date: Thu, 19 Dec 2002 16:09:21 -0500 Subject: EMBOSS Message-ID: EMBOSSers, I'm pleased to report that EMBOSS 2.5.1 compiles and installs cleanly on cygwin ("CYGWIN_NT-5.0 1.3.17(0.67/3/2) 2002-11-27 18:54 i686 unknown") from www.cygwin.org. I've only used a few of the EMBOSS programs but I'd be very surprised if any didn't work, cygwin handles standard languages with no difficulty. For those of you who haven't run across cygwin it's a Unix emulator running on Windows machines. The package contains most common Unix utilities as well as a C compiler, support for Perl and Python, apache, many standard libraries, ssh, cvs, emacs, tcsh/zsh, and so on. Connecting to mysql and Oracle is also possible, I do it myself, but setting it up can be a little trickier than on Unix machines. Installing cygwin creates a set of directories in the Windows filesystem that look just like Unix directories by name but behave like regular Windows folders. Installation is very easy. It's free and its performance is very good, it should be recommended to those who want to use EMBOSS on Windows machines. Thanks once again for your excellent work, Brian O. Brian Osborne Director of Informatics Cognia http://www.cognia.com brian_osborne at cognia.com 117 E. 55th St. NYC NY USA 10022 TEL 212 331 7848 FAX 646 349 1835 From jison at hgmp.mrc.ac.uk Thu Dec 19 21:44:02 2002 From: jison at hgmp.mrc.ac.uk (Dr J.C. Ison) Date: Thu, 19 Dec 2002 21:44:02 +0000 Subject: EMBOSS References: Message-ID: <3E023DA2.E249EB2@hgmp.mrc.ac.uk> On behalf of the emboss nightshift - thanks for the nice comments ! J. : ) Brian Osborne wrote: > EMBOSSers, > > I'm pleased to report that EMBOSS 2.5.1 compiles and installs cleanly on > cygwin ("CYGWIN_NT-5.0 1.3.17(0.67/3/2) 2002-11-27 18:54 i686 unknown") from > www.cygwin.org. I've only used a few of the EMBOSS programs but I'd be very > surprised if any didn't work, cygwin handles standard languages with no > difficulty. > > For those of you who haven't run across cygwin it's a Unix emulator running > on Windows machines. The package contains most common Unix utilities as well > as a C compiler, support for Perl and Python, apache, many standard > libraries, ssh, cvs, emacs, tcsh/zsh, and so on. Connecting to mysql and > Oracle is also possible, I do it myself, but setting it up can be a little > trickier than on Unix machines. Installing cygwin creates a set of > directories in the Windows filesystem that look just like Unix directories > by name but behave like regular Windows folders. Installation is very easy. > It's free and its performance is very good, it should be recommended to > those who want to use EMBOSS on Windows machines. > > Thanks once again for your excellent work, > > Brian O. > > Brian Osborne > Director of Informatics > Cognia http://www.cognia.com > brian_osborne at cognia.com > 117 E. 55th St. > NYC NY USA 10022 > TEL 212 331 7848 > FAX 646 349 1835 From asen.nenov at metalife.de Fri Dec 20 09:08:08 2002 From: asen.nenov at metalife.de (Asen Nenov) Date: Fri, 20 Dec 2002 11:08:08 +0200 Subject: EMBOSS under win2000 References: Message-ID: <003201c2a807$629b5660$3801a8c0@metalife.bg> Hi Brian, Actually I tested the compiling of EMBOSS 2.5.1 under CYGWIN [WIN2000 Professional] last week. It crashed 30 secs after running MAKE. Is there something special that you change to run the process? Second question is: Did you plan to run some benchmarking on EMBOSS under win2000 vs. EMBOSS under Linux server. It will be interesting, exaclty how slower it is running. :-) Regards Asen p.s. Out of subject: I wanted to test some of your tools on Cognia website, but the demo link gave me Error 500: http://nt.cognia.com/demopcdb/index.jsp Any ideas how to access this demo? METALIFE AG - Sofia, Bulgaria asen.nenov at metalife.de www.metalife.de ++359 2 950 1802 ----- Original Message ----- From: "Brian Osborne" To: Sent: Thursday, December 19, 2002 11:09 PM Subject: EMBOSS > EMBOSSers, > > I'm pleased to report that EMBOSS 2.5.1 compiles and installs cleanly on > cygwin ("CYGWIN_NT-5.0 1.3.17(0.67/3/2) 2002-11-27 18:54 i686 unknown") from > www.cygwin.org. I've only used a few of the EMBOSS programs but I'd be very > surprised if any didn't work, cygwin handles standard languages with no > difficulty. > > For those of you who haven't run across cygwin it's a Unix emulator running > on Windows machines. The package contains most common Unix utilities as well > as a C compiler, support for Perl and Python, apache, many standard > libraries, ssh, cvs, emacs, tcsh/zsh, and so on. Connecting to mysql and > Oracle is also possible, I do it myself, but setting it up can be a little > trickier than on Unix machines. Installing cygwin creates a set of > directories in the Windows filesystem that look just like Unix directories > by name but behave like regular Windows folders. Installation is very easy. > It's free and its performance is very good, it should be recommended to > those who want to use EMBOSS on Windows machines. > > Thanks once again for your excellent work, > > Brian O. > > Brian Osborne > Director of Informatics > Cognia http://www.cognia.com > brian_osborne at cognia.com > 117 E. 55th St. > NYC NY USA 10022 > TEL 212 331 7848 > FAX 646 349 1835 > > > From brian_osborne at cognia.com Fri Dec 20 13:12:43 2002 From: brian_osborne at cognia.com (Brian Osborne) Date: Fri, 20 Dec 2002 08:12:43 -0500 Subject: EMBOSS under win2000 In-Reply-To: <003201c2a807$629b5660$3801a8c0@metalife.bg> Message-ID: Asen, No, cygwin is all standard on my machine, cygwin_nt-5.0 on Windows 2000 Pro. If you'd like I can take a look at the make errors, send them my way. First suggestion: make sure you have all the libraries, I noticed EMBOSS used libpng.a and a bunch of others. Cygwin should have them all, you just have to figure out which packages have them, the descriptions aren't always clear. Does EMBOSS use libgd.a? I don't think so, but that one doesn't come with cygwin. libfreetype.a is a part of one of the Xfree fonts packages but this isn't at all clear just reading the descriptions in setup.exe. Does EMBOSS use it? The problem with benchmarking is I don't have 2 identical machines, or a double-booting machine, set up here. I would bet that the executables would run at about the same speed on cygwin as they do native on Windows. Cygwin is a very "thin" emulator, just a bash shell using 2 M of memory, and it's using gcc, just as in Linux. Cygwin bash is just as fast as Windows Command Prompt, I'm sure of it, I just ran some different Perl one-liners, cygwin was slightly better (so that's cygwin tcsh and Perl versus Command Prompt and ActiveState Perl). But I agree, one should do the test, you'd like to test the OS's, not the emulator. I can run a test for you if you'd like, just tell me what to do. That URL for the demo is old, it shouldn't work. What you can do is call up Sales at 212.331.7842, or write sales at cognia.com, they would be happy to show Cognia Molecular to you. Brian O. -----Original Message----- From: Asen Nenov [mailto:asen.nenov at metalife.de] Sent: Friday, December 20, 2002 4:08 AM To: Brian Osborne; emboss at embnet.org Subject: Re: EMBOSS under win2000 Hi Brian, Actually I tested the compiling of EMBOSS 2.5.1 under CYGWIN [WIN2000 Professional] last week. It crashed 30 secs after running MAKE. Is there something special that you change to run the process? Second question is: Did you plan to run some benchmarking on EMBOSS under win2000 vs. EMBOSS under Linux server. It will be interesting, exaclty how slower it is running. :-) Regards Asen p.s. Out of subject: I wanted to test some of your tools on Cognia website, but the demo link gave me Error 500: http://nt.cognia.com/demopcdb/index.jsp Any ideas how to access this demo? METALIFE AG - Sofia, Bulgaria asen.nenov at metalife.de www.metalife.de ++359 2 950 1802 ----- Original Message ----- From: "Brian Osborne" To: Sent: Thursday, December 19, 2002 11:09 PM Subject: EMBOSS > EMBOSSers, > > I'm pleased to report that EMBOSS 2.5.1 compiles and installs cleanly on > cygwin ("CYGWIN_NT-5.0 1.3.17(0.67/3/2) 2002-11-27 18:54 i686 unknown") from > www.cygwin.org. I've only used a few of the EMBOSS programs but I'd be very > surprised if any didn't work, cygwin handles standard languages with no > difficulty. > > For those of you who haven't run across cygwin it's a Unix emulator running > on Windows machines. The package contains most common Unix utilities as well > as a C compiler, support for Perl and Python, apache, many standard > libraries, ssh, cvs, emacs, tcsh/zsh, and so on. Connecting to mysql and > Oracle is also possible, I do it myself, but setting it up can be a little > trickier than on Unix machines. Installing cygwin creates a set of > directories in the Windows filesystem that look just like Unix directories > by name but behave like regular Windows folders. Installation is very easy. > It's free and its performance is very good, it should be recommended to > those who want to use EMBOSS on Windows machines. > > Thanks once again for your excellent work, > > Brian O. > > Brian Osborne > Director of Informatics > Cognia http://www.cognia.com > brian_osborne at cognia.com > 117 E. 55th St. > NYC NY USA 10022 > TEL 212 331 7848 > FAX 646 349 1835 > > >