From haruna at sgi.com  Thu Jan  3 11:43:37 2002
From: haruna at sgi.com (Haruna Cofer)
Date: Thu, 03 Jan 2002 11:43:37 -0500
Subject: Emboss 2.1.0 on Irix
References: <3C347BA8.82B4B12@bioinfo.sickkids.on.ca>
Message-ID: <3C348A39.8F7CF7DD@sgi.com>

Thanks, Len, for your porting notes on this!  I was also trying to
figure out how to override the CFLAGS variable, and the problem seems to
be that the configure script resets CFLAGS to -O on line 11353.  So you
can either comment this line out or replace the line with your desired
CFLAGS value.

I've been building without the png drivers, so my plan is to build it
with the png drivers and then post porting notes on the SGI web site for
other SGI/IRIX users to reference.  Will keep you all posted!  

-- Haruna  :)

Len Zaifman wrote:
> 
> Finally, in the Configure script, which appears below, I needed to set
> several includes in the line setting the Compiler.  There were errors
> when I put them in the CFLAGS variable. Has anyone else seen these
> issues:
-- 
  Haruna N. Cofer                    
  SGI                                 ChemPharm Applications




From ableasby at hgmp.mrc.ac.uk  Thu Jan  3 15:24:20 2002
From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk)
Date: Thu, 3 Jan 2002 20:24:20 GMT
Subject: Emboss 2.1.0 on Irix
Message-ID: <200201032024.UAA22006@bromine.hgmp.mrc.ac.uk>

Your problem mainly stems from your configure line:

build for EMBOSS ${EMB_VER}  shared" ; \
./configure --srcdir=/src/emboss/${EMB_VER}/EMBOSS-${EMB_VER}
--prefix=/tools/emboss${EMB_VER}\
 --with-x --with-pngdriver --with-java  ;


You specified --with-pngdriver and --with-java without giving a
directory hence their values are therefore set to "yes". For 
--with-pngdriver a trailing '/lib' is assumed and should not be
specified.

Also, you must also specify --withjavaos=dir if you specify --with-java=dir.

I've emailed Len privately about the library version report
and asked him to test something so I'll wait for his reply before
commenting on that.

Cheers
Alan



From tchiang at bioinfo.sickkids.on.ca  Fri Jan  4 12:24:35 2002
From: tchiang at bioinfo.sickkids.on.ca (Ted Chiang)
Date: Fri, 4 Jan 2002 12:24:35 -0500 (EST)
Subject: problem with wildcard in emboss applications.
Message-ID: <Pine.GSO.4.05.10201041157280.20179-100000@kenny>



We are trying to iron out some issues in installing EMBOSS 2.1.0 and in
the email attached below, Len has described what he did to modify if for
IRIX.  

The applications are up and running, however I noticed that certain
applications do not take the 'wildcard' variable when retrieving
multiple database files as in EMBOSS 1.13.1.  

Here is an example using seqret (the problem also applies to the program
'stssearch'):

bash%seqret gbbct:*
Reads and writes (returns) sequences
Error: Unable to read sequence 'gbbct:*'


-->Has anyone seen this before? or have any suggestions?  (just as aside:
seqret and other applications works fine when retrieving only a single
database entry).


thanks.

-Ted


=====================================
Ted Chiang
Bioinformatics Supercomputing Centre
Hospital for Sick Children, Toronto
ext. 7028
tchiang at bioinfo.sickkids.on.ca









-------- Original Message --------
Subject: Emboss 2.1.0 on Irix
Date: Thu, 03 Jan 2002 10:41:28 -0500
From: Len Zaifman <leonardz at bioinfo.sickkids.on.ca>
To: Emboss Developer <emboss-dev at hgmp.mrc.ac.uk>

I have just built the emboss 2.1.0 suite on our Origin 3000. 

A couple of extra things were necessary because configure didn't quite
get it right. 

First off, I had always built previous emboss versions static because of
an error in configure. Due to an upgrade in our MipsPro compilers
(MisPRO 7.3.1.3m) , we can no longer build static. So I solved the
problem using sed on the Makefiles. Here are the relevant lines:

###
### This fixes the problem of building emboss shared
### Irix Compilers previous to MipsPRO 7.3.1.3m allowed static builds
### MipsPRO 7.3.1.3m and beyond do not. This fix was required to build
shared
###
f='plplot/Makefile'
sed -e 's/libplplot_la_LDFLAGS = -version-info
4:99:0/libplplot_la_LDFLAGS = /' $f > ${f}.new
mv ${f}.new $f
grep version $f
echo "$f fixed"


In otherwords, I needed to remove -version-info 4:99:0 . I am not sure
what effect this had to the resulting binaries. Hopefully, none. Please
let me know.

In addition, Configure puts in spurious -Lyes/lib lines in various
Makefiles

So : I also have the following:


###     Remove spurious yes/lib occurences
###
for f in ./ajax/Makefile ./nucleus/Makefile ./plplot/Makefile
./emboss/Makefile; do
        sed -e 's"\-Lyes/lib""' ${f} > ${f}.new
        mv ${f}.new $f
        grep -in 'yes/lib' $f
        echo "$f fixed"
done

I assume these have no effect as well on the resulting binaries.

Finally, in the Configure script, which appears below, I needed to set
several includes in the line setting the Compiler.  There were errors
when I put them in the CFLAGS variable. Has anyone else seen these
issues:

For specificity this is on an Origin 3000, Irix 6.5.14f, MipsPRO7.3.1.3m
compilers, and Java2 v1.3.1 Development Environment (Sun Java2 SDK
v1.3.1). 

The configure script

#! /usr/local/bin/bash
### 
### Set up to run in batch or interactively
###
#PBS -N CONFIGUREEMBOSS
#PBS -l cput=2:00:00
#PBS -l nodes=RED
export PATH=$PATH:/usr/local/bin:/usr/java/bin
export EMB_VER='2.1.0'
###
### set directory if in PBS
###
if [ $PBS_O_WORKDIR ] ; then
        cd $PBS_O_WORKDIR
fi
###
### set up to use Irix cc 
### for some reason putting  
###             -I/usr/local/include -I/usr/java/include
-I/usr/java/include/irix
### in CFLAGS does not work so I set them here in the CC definition
###
(date ; export CC="/usr/bin/cc  -I/usr/local/include -I/usr/java/include
-I/usr/java/include/irix"; \
export CFLAGS="-n32 -mips4 -Ofast"; \
export LD="/usr/bin/ld -n32 -mips4 -IPA -L/usr/local/lib32" ;echo " SGI
build for EMBOSS ${EMB_VER}  shared" ; \
./configure --srcdir=/src/emboss/${EMB_VER}/EMBOSS-${EMB_VER}
--prefix=/tools/emboss${EMB_VER}\
 --with-x --with-pngdriver --with-java  ; \
date ) 2>&1 | tee -a Configure.log
###
### fix makefile issues created by configure - don't know how to fix
configure
###
./fixit.sh 2>&1 | tee -a Configure.log
###
### make and install 
###
(date ; gmake ; date ; gmake install ; date ) 2>&1 | tee Make.log
echo "Done"



From ableasby at hgmp.mrc.ac.uk  Fri Jan  4 15:52:16 2002
From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk)
Date: Fri, 4 Jan 2002 20:52:16 GMT
Subject: problem with wildcard in emboss applications.
Message-ID: <200201042052.UAA08720@bromine.hgmp.mrc.ac.uk>

I can neither reproduce this on an O2 nor your colleagues link
strangeness in plplot.

Try setting up the emboss_tempdata definition in emboss.default
(or your .embossrc) to point to blah/EMBOSS-2.1.0/test
and then try   seqret "tembl:*"
If that works examine your db definitions. If there are still
problems you should send a few sample entries from the database
you're trying to access, your database definition for it, how
you indexed it and the results of a 'seqret -debug' to
emboss-bug

If the above doesn't work then, after rechecking the 'set' line
for emboss_tempdata, then again send all the info you can including a
seqret -debug output to emboss-bug

Cheers
Alan



From wshui at cse.unsw.edu.au  Sun Jan  6 19:59:13 2002
From: wshui at cse.unsw.edu.au (Bill Shui)
Date: Mon, 7 Jan 2002 11:59:13 +1100
Subject: dbi* stuff.
Message-ID: <20020107005913.GA28097@nimky.cse.unsw.edu.au>

Hi,

Just wondering if applications such as dbifasta, dbiblast, etc are being
used by any other programs in the EMBOSS package?


Bill
-- 
You will be run over by a beer truck.
------------------------------------------------------
Bill Shui		Email: wshui at cse.unsw.edu.au



From tchiang at bioinfo.sickkids.on.ca  Mon Jan  7 10:33:03 2002
From: tchiang at bioinfo.sickkids.on.ca (Ted Chiang)
Date: Mon, 7 Jan 2002 10:33:03 -0500 (EST)
Subject: problem with wildcard in emboss applications.
In-Reply-To: <200201042052.UAA08720@bromine.hgmp.mrc.ac.uk>
Message-ID: <Pine.GSO.4.05.10201071019240.6806-100000@kenny>

Alan:

Thank you for you helpful suggestions.  I tried out your test by using one
of the test databases included in the package
(blah/emboss2.1.0/share/EMBOSS/test) and discovered
that the wildcard command works.

	seqret "test:*" 

Here's what's in the emboss.default:

-------------------------------------------------------------
set emboss_acdroot /tools/emboss2.1.0/share/EMBOSS/acd
set emboss_database_dir /data
set EMBOSS_DATA /tools/emboss2.1.0/share/EMBOSS/data
set emboss_logfile /tools/emboss2.1.0/logs/emboss.log


DB test [
   method: emblcd
   format: EMBL
   dir: /tools/emboss2.1.0/share/EMBOSS/test/embl
   file: "*.dat"
   comment: "test"
   type: N
   release: 126.0
   indexdir: /tools/emboss2.1.0/share/EMBOSS/test/embl
]


DB testuna127 [
   method: emblcd
   format: GB
   dir: /data/genbank/una.127
   file: "*.seq"
   comment: "Genbank Unannotated Sequences"
   type: N
   release: 126.0
   indexdir: /data/emboss/una.127
]
------------------------------------------------------------


However the bottom DB is where our problem is.  The command:

	%seqret testuna127:*
	Reads and writes (returns) sequences
	Error: Unable to read sequence 'testuna127:*'


fails even though with our previous version of EMBOSS-1.13.3, we always
got it to work. Interestingly, in retrieving a single database entry,
there is no problem, such as:


	%seqret testuna127:AA005656
	Reads and writes (returns) sequences
	Output sequence [af005656.fasta]:


Here is the debug output:

	%seqret -debug testuna127:* 
	EMBOSS An error in ajmess.c at line 1463:
	Cannot open debug file seqret.dbg


I am pretty convinced that the actual seqret program is working fine since
it works with the test database that came with the EMBOSS-2.1.0 package,
but I have run out of ideas why it can't run properly on our databases.
Do you have any suggestions?  Can it have something to do with the PLPLOT
or the configuration problems we had in installing it on our IRIX
machines?

thanks.

-Ted


=====================================
Ted Chiang
Bioinformatics Supercomputing Centre
Hospital for Sick Children, Toronto
ext. 7028
tchiang at bioinfo.sickkids.on.ca



On Fri, 4 Jan 2002 ableasby at hgmp.mrc.ac.uk wrote:

> I can neither reproduce this on an O2 nor your colleagues link
> strangeness in plplot.
> 
> Try setting up the emboss_tempdata definition in emboss.default
> (or your .embossrc) to point to blah/EMBOSS-2.1.0/test
> and then try   seqret "tembl:*"
> If that works examine your db definitions. If there are still
> problems you should send a few sample entries from the database
> you're trying to access, your database definition for it, how
> you indexed it and the results of a 'seqret -debug' to
> emboss-bug
> 
> If the above doesn't work then, after rechecking the 'set' line
> for emboss_tempdata, then again send all the info you can including a
> seqret -debug output to emboss-bug
> 
> Cheers
> Alan
> 
> 



From ableasby at hgmp.mrc.ac.uk  Mon Jan  7 11:31:40 2002
From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk)
Date: Mon, 7 Jan 2002 16:31:40 GMT
Subject: problem with wildcard in emboss applications.
Message-ID: <200201071631.QAA20720@bromine.hgmp.mrc.ac.uk>

Ted,

Ah, its a GenBank thing. Specifically the horrible header information
at the start of each distribution file. I've put a replacement
ajseqread.c file in:

  ftp://ftp.uk.embnet.org/pub/EMBOSS/patchfiles/ajseqread.c

Put that in the ajax directory and "make install" again and you
should be OK. Being good Europeans we can tend to forget about some
genbank nuances. Apologies.

Alan

PS: This probably means a new distribution soon incorporating the
    patch and the srs patch.



From tchiang at bioinfo.sickkids.on.ca  Tue Jan  8 10:52:11 2002
From: tchiang at bioinfo.sickkids.on.ca (Ted Chiang)
Date: Tue, 8 Jan 2002 10:52:11 -0500 (EST)
Subject: problem with wildcard in emboss applications.
In-Reply-To: <200201071631.QAA20720@bromine.hgmp.mrc.ac.uk>
Message-ID: <Pine.GSO.4.05.10201081032430.10993-100000@kenny>

Alan,

Thanks for the patch.  We've installed and tested the 'wildcard' function
for seqret and a number of other emboss applications and it seems to work
well.

We've conducted some further tests of emboss2.1.0 after our recent
installation, and I noticed some bugs that might be of interest.

1. I noticed that emboss2.1.0 has a few new applications not present in
earlier version (1.13), however 'wossname' does not seem to be able to
pick them up. ie.

	%wossname -alphabet

fails to list the following programs which are in the
/blah/emboss2.1.0/bin directory:

> acdc
> contacts
> extractfeat
> infoalign
> listor
> mwfilter
  (prima (1.13)--> primer3(2.1) -->this is a program replacement, I guess)
> runJemboss.csh
> seqretallfeat
> swissparse
> trimest


2. In executing some of the above programs, I've encountered some of the
following errors:


======================================================================
$/tools/emboss2.1.0/bin/acdc

   EMBOSS An error in acdc.c at line 36:
Error - must specify an application to compile
=======================================================================
$/tools/emboss2.1.0/bin/contacts

   EMBOSS An error in ajacd.c at line 1207:
acdfile '/tools/emboss2.1.0/share/EMBOSS/acd/contacts.acd' not opened
=========+============================================================
$/tools/emboss2.1.0/bin/extractfeat
Warning: Efeatures.embl: tag note (feature 3'clip) not in Etags file
Warning: Efeatures.embl: tag partial (feature 3'clip) not in Etags file
Warning: Efeatures.embl: tag standard_name (feature 3'clip) not in Etags
file
======================================================================
$/tools/emboss2.1.0/bin/primer3
Picks PCR primers and hybridization oligos
Input sequence(s): AF104304
Output file [af104304.primer3]: 

   EMBOSS An error in primer3.c at line 316:
The program 'primer3_core' must be on the path.
It is part of the 'primer3' package,
available from the Whitehead Institute.
See: http://www-genome.wi.mit.edu/
Broken pipe
======================================================================
$/tools/emboss2.1.0/bin/swissparse   

   EMBOSS An error in ajacd.c at line 1207:
acdfile '/tools/emboss2.1.0/share/EMBOSS/acd/swissparse.acd' not opened
======================================================================



---->If you could please help us in solving some of these problems, we
would really appreciate it.  I presume some of them may be due to
installation nuances on our side...

thanks.

-Ted


=====================================
Ted Chiang
Bioinformatics Supercomputing Centre
Hospital for Sick Children, Toronto
ext. 7028
tchiang at bioinfo.sickkids.on.ca



On Mon, 7 Jan 2002 ableasby at hgmp.mrc.ac.uk wrote:

> Ted,
> 
> Ah, its a GenBank thing. Specifically the horrible header information
> at the start of each distribution file. I've put a replacement
> ajseqread.c file in:
> 
>   ftp://ftp.uk.embnet.org/pub/EMBOSS/patchfiles/ajseqread.c
> 
> Put that in the ajax directory and "make install" again and you
> should be OK. Being good Europeans we can tend to forget about some
> genbank nuances. Apologies.
> 
> Alan
> 
> PS: This probably means a new distribution soon incorporating the
>     patch and the srs patch.
> 
> 



From ableasby at hgmp.mrc.ac.uk  Wed Jan  9 10:35:56 2002
From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk)
Date: Wed, 9 Jan 2002 15:35:56 GMT
Subject: problem with wildcard in emboss applications.
Message-ID: <200201091535.PAA11121@bromine.hgmp.mrc.ac.uk>

Ted,

Thanks for the message. It would probably be best posted to emboss-bug
but as its here I'd probably best clarify to all this group which are
bugs and which aren't.

1.  As far as I could see only 'contacts' and 'swissparse' weren't
shown by wossname -alpha and that is fixed in the next release. acdc
will not show up as its a developers application and doesn't have an
acd file.  Similarly runJemboss.csh is not an EMBOSS application but a
Jemboss script so again doesn't appear. Yes, prima is now made
obsolete, thankfully.
The rest of them are now programs so I expect you may have and
emboss_acd definition lying around in an emboss.default or .embossrc
file which is pointing to an old installation. 

2. In executing some of the above programs, I've encountered some of the
following errors:

a) acd: Error - must specify an application to compile
That's an informative message. The syntax should be "acdc applicationname"
which enables developers to test their acd files.

b) contacts: yes, see above, fixed for the next release
   If you install the contacts.acd file manually it will fix it.

c) extractfeat
   Can't reproduce this. Is this an old emboss_data definition you
   have somewhere?

d) primer3. That's not a bug and again is informative. Primer3 in
   EMBOSS is a wrapper to make the original program easier to use.
   You must have that program installed and in your path. The message
   is telling you where to get it.

e) swissparse: yes, see above, fixed for the next release


Cheers
Alan



From bauer at genprofile.com  Fri Jan 11 10:48:29 2002
From: bauer at genprofile.com (David Bauer)
Date: Fri, 11 Jan 2002 16:48:29 +0100
Subject: matcher output bug ?
Message-ID: <3C3F094D.270ACE50@genprofile.com>

Hi,

it seems that matcher somtimes forgets to label the matches with the
usual ":" in the output if the matching region is very short.
Example1 shows no label at all and Example2 the labeling starts somwhere
in the middle of the matching region.

Example1:
########################################
# Program:  matcher
# Rundate:  Fri Jan 11 16:40:50 2002
# Report_file: 
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: c1
# 2: AW370204
# Matrix: EDNAFULL
# Gap_penalty: 12
# Extend_penalty: 4
#
# Length: 166
# Identity:     165/166 (99.4%)
# Similarity:     1/166 ( 0.6%)
# Gaps:         165/166 (99.4%)
# Score: 809
# 
#
#=======================================


      200       210       220       230       240        
    c1 GTGTCCGAGTTGGAGAGTGCTCTGCAGATGGAGCCAGCTGCCTTCCAGGC
                                                         
AW3702 GTGTCCGAGTTGGAGAGTGCTCTGCAGATGGAGCCAGCTGCCTTCCAGGC
          40        50        60        70        80     

      250       260       270       280       290        
    c1 TTTATATTCTGCTGAGAAGCCAAAGCTGGAAGATGAGCATCTCGTTTTCT
                                                         
AW3702 TTTATATTCTGCTGAGAAGCCAAAGCTGGAAGATGAGCATCTCGTTTTCT
          90       100       110       120       130     

      300       310       320        330       340       
    c1 TCTGTCAGATGGGCAAGCGGGGCCTCCA-GGCCACGCAGCTGGCCCGGAG
                                                         
AW3702 TCTGTCAGATGGGCAAGCGGGGCCTCCAAGGCCACGCAGCTGGCCCGGAG
         140       150       160       170       180     

       350       360   
    c1 TCTTGGATACACTGGG
                       
AW3702 TCTTGGATACACTGGG
         190       200 

#---------------------------------------
#---------------------------------------

Example 2:
########################################
# Program:  matcher
# Rundate:  Fri Jan 11 16:43:55 2002
# Report_file: 
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: c1
# 2: BE695392
# Matrix: EDNAFULL
# Gap_penalty: 12
# Extend_penalty: 4
#
# Length: 230
# Identity:     222/230 (96.5%)
# Similarity:     4/230 ( 1.7%)
# Gaps:         222/230 (96.5%)
# Score: 1030
# 
#
#=======================================


         140       150       160       170       180     
    c1 TTCGACGTGCGCTCTCGCGAGGAGGCGGCAGCTGGGACCATCCCAGGGGC
                                                         
BE6953 TGCGATGTGCGCTCTCGCGAGGAG-CGGCAGCTGGGACCATCCCAGGG-C
        20        30        40         50        60      

         190       200       210       220       230     
    c1 GCTCAACATCCCGGTGTCCGAGTTGGAGAGTGCTCTGCAGATGGAGCCAG
                                                         
BE6953 GCTCAACATCCCGGTGTCCGAGTTGGAGAGTGCTCTGCAGACTGAGCCAG
          70        80        90       100       110     

         240       250        260       270       280    
    c1 CTGCCTTCCAGGCTTTATATTCT-GCTGAGAAGCCAAAGCTGGAAGATGA
                                            :::::::::::::
BE6953 CTGCCTTCCAGGCTTTATATTCTCGCTGAGAAGCCAAAGCTGGAAGATGA
         120       130       140       150       160     

          290       300       310       320       330    
    c1 GCATCTCGTTTTCTTCTGTCAGATGGGCAAGCGGGGCCTCCAGGCCACGC
       ::::::::::::::::::::::::::::::::::::::::::::::::::
BE6953 GCATCTCGTTTTCTTCTGTCAGATGGGCAAGCGGGGCCTCCAGGCCACGC
         170       180       190       200       210     

          340        350       360   
    c1 AGCTGGCCCGGA-GTCTTGGATACACTGGG
       :::::::::::: :::::::::::::::::
BE6953 AGCTGGCCCGGAAGTCTTGGATACACTGGG
         220       230       240     

#---------------------------------------
#---------------------------------------

-- 
Dr. David Bauer
GenProfile AG, Max-Delbrueck-Center, Erwin-Negelein-Haus 
Robert-Roessle-Str. 10, D-13125 Berlin, Germany
bauer at genprofile.com, Tel:49-30-94892165, FAX:49-30-94892151



From peter.rice at uk.lionbioscience.com  Fri Jan 11 10:50:50 2002
From: peter.rice at uk.lionbioscience.com (Peter Rice)
Date: Fri, 11 Jan 2002 15:50:50 +0000
Subject: matcher output bug ?
References: <3C3F094D.270ACE50@genprofile.com>
Message-ID: <3C3F09DA.9981386C@uk.lionbioscience.com>

David Bauer wrote:
> 
> it seems that matcher somtimes forgets to label the matches with the
> usual ":" in the output if the matching region is very short.
> Example1 shows no label at all and Example2 the labeling starts somwhere
> in the middle of the matching region.

Depends on the start position(s). Fixed in the next release.

Peter

-- 
------------------------------------------------
Peter Rice, LION Bioscience Ltd, Cambridge, UK
peter.rice at uk.lionbioscience.com +44 1223 224723



From ableasby at hgmp.mrc.ac.uk  Fri Jan 11 20:11:27 2002
From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk)
Date: Sat, 12 Jan 2002 01:11:27 GMT
Subject: EMBOSS 2.2.0 released
Message-ID: <200201120111.BAA29642@bromine.hgmp.mrc.ac.uk>

EMBOSS 2.2.0 has several additional programs in the protein structure
area. Contacts, Dichet, Psiblasts, Scopalign, Siggen and Sigscan are
now made by default. A small utility, Biosed, has also been added to
allow simple deletion or replacement of subsequences or
residues. Documentation for some other new programs (e.g. Alignwrap)
is being prepared.

Routines to allow EMBOSS to read sequences from the latest SRS
servers has been incorporated in this release.

Bugfixes: Sequential access of GenBank flatfiles is again possible.
Problems with alignment reports have been fixed. est2genome now
works with unindexed sequence files. Other minor fixes and changes
have been incorporated.

Alan



From ableasby at hgmp.mrc.ac.uk  Mon Jan 14 10:19:05 2002
From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk)
Date: Mon, 14 Jan 2002 15:19:05 GMT
Subject: EMBOSS 2.2.0 patchfiles
Message-ID: <200201141519.PAA11675@bromine.hgmp.mrc.ac.uk>

A couple of minor bugs have been noticed in 2.2.0
One is that on some alignment reports the gap and similarity
scores are transposed. The other is a case sensitivity in
patmatdb.

There are fixes for both problems in the

   ftp://ftp.uk.embnet.org/pub/EMBOSS/patchfiles/

directory. Just replace the existing ajax/ajalign.c and
emboss/patmatdb.c files with the new ones and recompile.

Alan




From haruna at sgi.com  Thu Jan  3 16:43:37 2002
From: haruna at sgi.com (Haruna Cofer)
Date: Thu, 03 Jan 2002 11:43:37 -0500
Subject: Emboss 2.1.0 on Irix
References: <3C347BA8.82B4B12@bioinfo.sickkids.on.ca>
Message-ID: <3C348A39.8F7CF7DD@sgi.com>

Thanks, Len, for your porting notes on this!  I was also trying to
figure out how to override the CFLAGS variable, and the problem seems to
be that the configure script resets CFLAGS to -O on line 11353.  So you
can either comment this line out or replace the line with your desired
CFLAGS value.

I've been building without the png drivers, so my plan is to build it
with the png drivers and then post porting notes on the SGI web site for
other SGI/IRIX users to reference.  Will keep you all posted!  

-- Haruna  :)

Len Zaifman wrote:
> 
> Finally, in the Configure script, which appears below, I needed to set
> several includes in the line setting the Compiler.  There were errors
> when I put them in the CFLAGS variable. Has anyone else seen these
> issues:
-- 
  Haruna N. Cofer                    
  SGI                                 ChemPharm Applications




From ableasby at hgmp.mrc.ac.uk  Thu Jan  3 20:24:20 2002
From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk)
Date: Thu, 3 Jan 2002 20:24:20 GMT
Subject: Emboss 2.1.0 on Irix
Message-ID: <200201032024.UAA22006@bromine.hgmp.mrc.ac.uk>

Your problem mainly stems from your configure line:

build for EMBOSS ${EMB_VER}  shared" ; \
./configure --srcdir=/src/emboss/${EMB_VER}/EMBOSS-${EMB_VER}
--prefix=/tools/emboss${EMB_VER}\
 --with-x --with-pngdriver --with-java  ;


You specified --with-pngdriver and --with-java without giving a
directory hence their values are therefore set to "yes". For 
--with-pngdriver a trailing '/lib' is assumed and should not be
specified.

Also, you must also specify --withjavaos=dir if you specify --with-java=dir.

I've emailed Len privately about the library version report
and asked him to test something so I'll wait for his reply before
commenting on that.

Cheers
Alan



From tchiang at bioinfo.sickkids.on.ca  Fri Jan  4 17:24:35 2002
From: tchiang at bioinfo.sickkids.on.ca (Ted Chiang)
Date: Fri, 4 Jan 2002 12:24:35 -0500 (EST)
Subject: problem with wildcard in emboss applications.
Message-ID: <Pine.GSO.4.05.10201041157280.20179-100000@kenny>



We are trying to iron out some issues in installing EMBOSS 2.1.0 and in
the email attached below, Len has described what he did to modify if for
IRIX.  

The applications are up and running, however I noticed that certain
applications do not take the 'wildcard' variable when retrieving
multiple database files as in EMBOSS 1.13.1.  

Here is an example using seqret (the problem also applies to the program
'stssearch'):

bash%seqret gbbct:*
Reads and writes (returns) sequences
Error: Unable to read sequence 'gbbct:*'


-->Has anyone seen this before? or have any suggestions?  (just as aside:
seqret and other applications works fine when retrieving only a single
database entry).


thanks.

-Ted


=====================================
Ted Chiang
Bioinformatics Supercomputing Centre
Hospital for Sick Children, Toronto
ext. 7028
tchiang at bioinfo.sickkids.on.ca









-------- Original Message --------
Subject: Emboss 2.1.0 on Irix
Date: Thu, 03 Jan 2002 10:41:28 -0500
From: Len Zaifman <leonardz at bioinfo.sickkids.on.ca>
To: Emboss Developer <emboss-dev at hgmp.mrc.ac.uk>

I have just built the emboss 2.1.0 suite on our Origin 3000. 

A couple of extra things were necessary because configure didn't quite
get it right. 

First off, I had always built previous emboss versions static because of
an error in configure. Due to an upgrade in our MipsPro compilers
(MisPRO 7.3.1.3m) , we can no longer build static. So I solved the
problem using sed on the Makefiles. Here are the relevant lines:

###
### This fixes the problem of building emboss shared
### Irix Compilers previous to MipsPRO 7.3.1.3m allowed static builds
### MipsPRO 7.3.1.3m and beyond do not. This fix was required to build
shared
###
f='plplot/Makefile'
sed -e 's/libplplot_la_LDFLAGS = -version-info
4:99:0/libplplot_la_LDFLAGS = /' $f > ${f}.new
mv ${f}.new $f
grep version $f
echo "$f fixed"


In otherwords, I needed to remove -version-info 4:99:0 . I am not sure
what effect this had to the resulting binaries. Hopefully, none. Please
let me know.

In addition, Configure puts in spurious -Lyes/lib lines in various
Makefiles

So : I also have the following:


###     Remove spurious yes/lib occurences
###
for f in ./ajax/Makefile ./nucleus/Makefile ./plplot/Makefile
./emboss/Makefile; do
        sed -e 's"\-Lyes/lib""' ${f} > ${f}.new
        mv ${f}.new $f
        grep -in 'yes/lib' $f
        echo "$f fixed"
done

I assume these have no effect as well on the resulting binaries.

Finally, in the Configure script, which appears below, I needed to set
several includes in the line setting the Compiler.  There were errors
when I put them in the CFLAGS variable. Has anyone else seen these
issues:

For specificity this is on an Origin 3000, Irix 6.5.14f, MipsPRO7.3.1.3m
compilers, and Java2 v1.3.1 Development Environment (Sun Java2 SDK
v1.3.1). 

The configure script

#! /usr/local/bin/bash
### 
### Set up to run in batch or interactively
###
#PBS -N CONFIGUREEMBOSS
#PBS -l cput=2:00:00
#PBS -l nodes=RED
export PATH=$PATH:/usr/local/bin:/usr/java/bin
export EMB_VER='2.1.0'
###
### set directory if in PBS
###
if [ $PBS_O_WORKDIR ] ; then
        cd $PBS_O_WORKDIR
fi
###
### set up to use Irix cc 
### for some reason putting  
###             -I/usr/local/include -I/usr/java/include
-I/usr/java/include/irix
### in CFLAGS does not work so I set them here in the CC definition
###
(date ; export CC="/usr/bin/cc  -I/usr/local/include -I/usr/java/include
-I/usr/java/include/irix"; \
export CFLAGS="-n32 -mips4 -Ofast"; \
export LD="/usr/bin/ld -n32 -mips4 -IPA -L/usr/local/lib32" ;echo " SGI
build for EMBOSS ${EMB_VER}  shared" ; \
./configure --srcdir=/src/emboss/${EMB_VER}/EMBOSS-${EMB_VER}
--prefix=/tools/emboss${EMB_VER}\
 --with-x --with-pngdriver --with-java  ; \
date ) 2>&1 | tee -a Configure.log
###
### fix makefile issues created by configure - don't know how to fix
configure
###
./fixit.sh 2>&1 | tee -a Configure.log
###
### make and install 
###
(date ; gmake ; date ; gmake install ; date ) 2>&1 | tee Make.log
echo "Done"



From ableasby at hgmp.mrc.ac.uk  Fri Jan  4 20:52:16 2002
From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk)
Date: Fri, 4 Jan 2002 20:52:16 GMT
Subject: problem with wildcard in emboss applications.
Message-ID: <200201042052.UAA08720@bromine.hgmp.mrc.ac.uk>

I can neither reproduce this on an O2 nor your colleagues link
strangeness in plplot.

Try setting up the emboss_tempdata definition in emboss.default
(or your .embossrc) to point to blah/EMBOSS-2.1.0/test
and then try   seqret "tembl:*"
If that works examine your db definitions. If there are still
problems you should send a few sample entries from the database
you're trying to access, your database definition for it, how
you indexed it and the results of a 'seqret -debug' to
emboss-bug

If the above doesn't work then, after rechecking the 'set' line
for emboss_tempdata, then again send all the info you can including a
seqret -debug output to emboss-bug

Cheers
Alan



From wshui at cse.unsw.edu.au  Mon Jan  7 00:59:13 2002
From: wshui at cse.unsw.edu.au (Bill Shui)
Date: Mon, 7 Jan 2002 11:59:13 +1100
Subject: dbi* stuff.
Message-ID: <20020107005913.GA28097@nimky.cse.unsw.edu.au>

Hi,

Just wondering if applications such as dbifasta, dbiblast, etc are being
used by any other programs in the EMBOSS package?


Bill
-- 
You will be run over by a beer truck.
------------------------------------------------------
Bill Shui		Email: wshui at cse.unsw.edu.au



From tchiang at bioinfo.sickkids.on.ca  Mon Jan  7 15:33:03 2002
From: tchiang at bioinfo.sickkids.on.ca (Ted Chiang)
Date: Mon, 7 Jan 2002 10:33:03 -0500 (EST)
Subject: problem with wildcard in emboss applications.
In-Reply-To: <200201042052.UAA08720@bromine.hgmp.mrc.ac.uk>
Message-ID: <Pine.GSO.4.05.10201071019240.6806-100000@kenny>

Alan:

Thank you for you helpful suggestions.  I tried out your test by using one
of the test databases included in the package
(blah/emboss2.1.0/share/EMBOSS/test) and discovered
that the wildcard command works.

	seqret "test:*" 

Here's what's in the emboss.default:

-------------------------------------------------------------
set emboss_acdroot /tools/emboss2.1.0/share/EMBOSS/acd
set emboss_database_dir /data
set EMBOSS_DATA /tools/emboss2.1.0/share/EMBOSS/data
set emboss_logfile /tools/emboss2.1.0/logs/emboss.log


DB test [
   method: emblcd
   format: EMBL
   dir: /tools/emboss2.1.0/share/EMBOSS/test/embl
   file: "*.dat"
   comment: "test"
   type: N
   release: 126.0
   indexdir: /tools/emboss2.1.0/share/EMBOSS/test/embl
]


DB testuna127 [
   method: emblcd
   format: GB
   dir: /data/genbank/una.127
   file: "*.seq"
   comment: "Genbank Unannotated Sequences"
   type: N
   release: 126.0
   indexdir: /data/emboss/una.127
]
------------------------------------------------------------


However the bottom DB is where our problem is.  The command:

	%seqret testuna127:*
	Reads and writes (returns) sequences
	Error: Unable to read sequence 'testuna127:*'


fails even though with our previous version of EMBOSS-1.13.3, we always
got it to work. Interestingly, in retrieving a single database entry,
there is no problem, such as:


	%seqret testuna127:AA005656
	Reads and writes (returns) sequences
	Output sequence [af005656.fasta]:


Here is the debug output:

	%seqret -debug testuna127:* 
	EMBOSS An error in ajmess.c at line 1463:
	Cannot open debug file seqret.dbg


I am pretty convinced that the actual seqret program is working fine since
it works with the test database that came with the EMBOSS-2.1.0 package,
but I have run out of ideas why it can't run properly on our databases.
Do you have any suggestions?  Can it have something to do with the PLPLOT
or the configuration problems we had in installing it on our IRIX
machines?

thanks.

-Ted


=====================================
Ted Chiang
Bioinformatics Supercomputing Centre
Hospital for Sick Children, Toronto
ext. 7028
tchiang at bioinfo.sickkids.on.ca



On Fri, 4 Jan 2002 ableasby at hgmp.mrc.ac.uk wrote:

> I can neither reproduce this on an O2 nor your colleagues link
> strangeness in plplot.
> 
> Try setting up the emboss_tempdata definition in emboss.default
> (or your .embossrc) to point to blah/EMBOSS-2.1.0/test
> and then try   seqret "tembl:*"
> If that works examine your db definitions. If there are still
> problems you should send a few sample entries from the database
> you're trying to access, your database definition for it, how
> you indexed it and the results of a 'seqret -debug' to
> emboss-bug
> 
> If the above doesn't work then, after rechecking the 'set' line
> for emboss_tempdata, then again send all the info you can including a
> seqret -debug output to emboss-bug
> 
> Cheers
> Alan
> 
> 



From ableasby at hgmp.mrc.ac.uk  Mon Jan  7 16:31:40 2002
From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk)
Date: Mon, 7 Jan 2002 16:31:40 GMT
Subject: problem with wildcard in emboss applications.
Message-ID: <200201071631.QAA20720@bromine.hgmp.mrc.ac.uk>

Ted,

Ah, its a GenBank thing. Specifically the horrible header information
at the start of each distribution file. I've put a replacement
ajseqread.c file in:

  ftp://ftp.uk.embnet.org/pub/EMBOSS/patchfiles/ajseqread.c

Put that in the ajax directory and "make install" again and you
should be OK. Being good Europeans we can tend to forget about some
genbank nuances. Apologies.

Alan

PS: This probably means a new distribution soon incorporating the
    patch and the srs patch.



From tchiang at bioinfo.sickkids.on.ca  Tue Jan  8 15:52:11 2002
From: tchiang at bioinfo.sickkids.on.ca (Ted Chiang)
Date: Tue, 8 Jan 2002 10:52:11 -0500 (EST)
Subject: problem with wildcard in emboss applications.
In-Reply-To: <200201071631.QAA20720@bromine.hgmp.mrc.ac.uk>
Message-ID: <Pine.GSO.4.05.10201081032430.10993-100000@kenny>

Alan,

Thanks for the patch.  We've installed and tested the 'wildcard' function
for seqret and a number of other emboss applications and it seems to work
well.

We've conducted some further tests of emboss2.1.0 after our recent
installation, and I noticed some bugs that might be of interest.

1. I noticed that emboss2.1.0 has a few new applications not present in
earlier version (1.13), however 'wossname' does not seem to be able to
pick them up. ie.

	%wossname -alphabet

fails to list the following programs which are in the
/blah/emboss2.1.0/bin directory:

> acdc
> contacts
> extractfeat
> infoalign
> listor
> mwfilter
  (prima (1.13)--> primer3(2.1) -->this is a program replacement, I guess)
> runJemboss.csh
> seqretallfeat
> swissparse
> trimest


2. In executing some of the above programs, I've encountered some of the
following errors:


======================================================================
$/tools/emboss2.1.0/bin/acdc

   EMBOSS An error in acdc.c at line 36:
Error - must specify an application to compile
=======================================================================
$/tools/emboss2.1.0/bin/contacts

   EMBOSS An error in ajacd.c at line 1207:
acdfile '/tools/emboss2.1.0/share/EMBOSS/acd/contacts.acd' not opened
=========+============================================================
$/tools/emboss2.1.0/bin/extractfeat
Warning: Efeatures.embl: tag note (feature 3'clip) not in Etags file
Warning: Efeatures.embl: tag partial (feature 3'clip) not in Etags file
Warning: Efeatures.embl: tag standard_name (feature 3'clip) not in Etags
file
======================================================================
$/tools/emboss2.1.0/bin/primer3
Picks PCR primers and hybridization oligos
Input sequence(s): AF104304
Output file [af104304.primer3]: 

   EMBOSS An error in primer3.c at line 316:
The program 'primer3_core' must be on the path.
It is part of the 'primer3' package,
available from the Whitehead Institute.
See: http://www-genome.wi.mit.edu/
Broken pipe
======================================================================
$/tools/emboss2.1.0/bin/swissparse   

   EMBOSS An error in ajacd.c at line 1207:
acdfile '/tools/emboss2.1.0/share/EMBOSS/acd/swissparse.acd' not opened
======================================================================



---->If you could please help us in solving some of these problems, we
would really appreciate it.  I presume some of them may be due to
installation nuances on our side...

thanks.

-Ted


=====================================
Ted Chiang
Bioinformatics Supercomputing Centre
Hospital for Sick Children, Toronto
ext. 7028
tchiang at bioinfo.sickkids.on.ca



On Mon, 7 Jan 2002 ableasby at hgmp.mrc.ac.uk wrote:

> Ted,
> 
> Ah, its a GenBank thing. Specifically the horrible header information
> at the start of each distribution file. I've put a replacement
> ajseqread.c file in:
> 
>   ftp://ftp.uk.embnet.org/pub/EMBOSS/patchfiles/ajseqread.c
> 
> Put that in the ajax directory and "make install" again and you
> should be OK. Being good Europeans we can tend to forget about some
> genbank nuances. Apologies.
> 
> Alan
> 
> PS: This probably means a new distribution soon incorporating the
>     patch and the srs patch.
> 
> 



From ableasby at hgmp.mrc.ac.uk  Wed Jan  9 15:35:56 2002
From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk)
Date: Wed, 9 Jan 2002 15:35:56 GMT
Subject: problem with wildcard in emboss applications.
Message-ID: <200201091535.PAA11121@bromine.hgmp.mrc.ac.uk>

Ted,

Thanks for the message. It would probably be best posted to emboss-bug
but as its here I'd probably best clarify to all this group which are
bugs and which aren't.

1.  As far as I could see only 'contacts' and 'swissparse' weren't
shown by wossname -alpha and that is fixed in the next release. acdc
will not show up as its a developers application and doesn't have an
acd file.  Similarly runJemboss.csh is not an EMBOSS application but a
Jemboss script so again doesn't appear. Yes, prima is now made
obsolete, thankfully.
The rest of them are now programs so I expect you may have and
emboss_acd definition lying around in an emboss.default or .embossrc
file which is pointing to an old installation. 

2. In executing some of the above programs, I've encountered some of the
following errors:

a) acd: Error - must specify an application to compile
That's an informative message. The syntax should be "acdc applicationname"
which enables developers to test their acd files.

b) contacts: yes, see above, fixed for the next release
   If you install the contacts.acd file manually it will fix it.

c) extractfeat
   Can't reproduce this. Is this an old emboss_data definition you
   have somewhere?

d) primer3. That's not a bug and again is informative. Primer3 in
   EMBOSS is a wrapper to make the original program easier to use.
   You must have that program installed and in your path. The message
   is telling you where to get it.

e) swissparse: yes, see above, fixed for the next release


Cheers
Alan



From bauer at genprofile.com  Fri Jan 11 15:48:29 2002
From: bauer at genprofile.com (David Bauer)
Date: Fri, 11 Jan 2002 16:48:29 +0100
Subject: matcher output bug ?
Message-ID: <3C3F094D.270ACE50@genprofile.com>

Hi,

it seems that matcher somtimes forgets to label the matches with the
usual ":" in the output if the matching region is very short.
Example1 shows no label at all and Example2 the labeling starts somwhere
in the middle of the matching region.

Example1:
########################################
# Program:  matcher
# Rundate:  Fri Jan 11 16:40:50 2002
# Report_file: 
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: c1
# 2: AW370204
# Matrix: EDNAFULL
# Gap_penalty: 12
# Extend_penalty: 4
#
# Length: 166
# Identity:     165/166 (99.4%)
# Similarity:     1/166 ( 0.6%)
# Gaps:         165/166 (99.4%)
# Score: 809
# 
#
#=======================================


      200       210       220       230       240        
    c1 GTGTCCGAGTTGGAGAGTGCTCTGCAGATGGAGCCAGCTGCCTTCCAGGC
                                                         
AW3702 GTGTCCGAGTTGGAGAGTGCTCTGCAGATGGAGCCAGCTGCCTTCCAGGC
          40        50        60        70        80     

      250       260       270       280       290        
    c1 TTTATATTCTGCTGAGAAGCCAAAGCTGGAAGATGAGCATCTCGTTTTCT
                                                         
AW3702 TTTATATTCTGCTGAGAAGCCAAAGCTGGAAGATGAGCATCTCGTTTTCT
          90       100       110       120       130     

      300       310       320        330       340       
    c1 TCTGTCAGATGGGCAAGCGGGGCCTCCA-GGCCACGCAGCTGGCCCGGAG
                                                         
AW3702 TCTGTCAGATGGGCAAGCGGGGCCTCCAAGGCCACGCAGCTGGCCCGGAG
         140       150       160       170       180     

       350       360   
    c1 TCTTGGATACACTGGG
                       
AW3702 TCTTGGATACACTGGG
         190       200 

#---------------------------------------
#---------------------------------------

Example 2:
########################################
# Program:  matcher
# Rundate:  Fri Jan 11 16:43:55 2002
# Report_file: 
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: c1
# 2: BE695392
# Matrix: EDNAFULL
# Gap_penalty: 12
# Extend_penalty: 4
#
# Length: 230
# Identity:     222/230 (96.5%)
# Similarity:     4/230 ( 1.7%)
# Gaps:         222/230 (96.5%)
# Score: 1030
# 
#
#=======================================


         140       150       160       170       180     
    c1 TTCGACGTGCGCTCTCGCGAGGAGGCGGCAGCTGGGACCATCCCAGGGGC
                                                         
BE6953 TGCGATGTGCGCTCTCGCGAGGAG-CGGCAGCTGGGACCATCCCAGGG-C
        20        30        40         50        60      

         190       200       210       220       230     
    c1 GCTCAACATCCCGGTGTCCGAGTTGGAGAGTGCTCTGCAGATGGAGCCAG
                                                         
BE6953 GCTCAACATCCCGGTGTCCGAGTTGGAGAGTGCTCTGCAGACTGAGCCAG
          70        80        90       100       110     

         240       250        260       270       280    
    c1 CTGCCTTCCAGGCTTTATATTCT-GCTGAGAAGCCAAAGCTGGAAGATGA
                                            :::::::::::::
BE6953 CTGCCTTCCAGGCTTTATATTCTCGCTGAGAAGCCAAAGCTGGAAGATGA
         120       130       140       150       160     

          290       300       310       320       330    
    c1 GCATCTCGTTTTCTTCTGTCAGATGGGCAAGCGGGGCCTCCAGGCCACGC
       ::::::::::::::::::::::::::::::::::::::::::::::::::
BE6953 GCATCTCGTTTTCTTCTGTCAGATGGGCAAGCGGGGCCTCCAGGCCACGC
         170       180       190       200       210     

          340        350       360   
    c1 AGCTGGCCCGGA-GTCTTGGATACACTGGG
       :::::::::::: :::::::::::::::::
BE6953 AGCTGGCCCGGAAGTCTTGGATACACTGGG
         220       230       240     

#---------------------------------------
#---------------------------------------

-- 
Dr. David Bauer
GenProfile AG, Max-Delbrueck-Center, Erwin-Negelein-Haus 
Robert-Roessle-Str. 10, D-13125 Berlin, Germany
bauer at genprofile.com, Tel:49-30-94892165, FAX:49-30-94892151



From peter.rice at uk.lionbioscience.com  Fri Jan 11 15:50:50 2002
From: peter.rice at uk.lionbioscience.com (Peter Rice)
Date: Fri, 11 Jan 2002 15:50:50 +0000
Subject: matcher output bug ?
References: <3C3F094D.270ACE50@genprofile.com>
Message-ID: <3C3F09DA.9981386C@uk.lionbioscience.com>

David Bauer wrote:
> 
> it seems that matcher somtimes forgets to label the matches with the
> usual ":" in the output if the matching region is very short.
> Example1 shows no label at all and Example2 the labeling starts somwhere
> in the middle of the matching region.

Depends on the start position(s). Fixed in the next release.

Peter

-- 
------------------------------------------------
Peter Rice, LION Bioscience Ltd, Cambridge, UK
peter.rice at uk.lionbioscience.com +44 1223 224723



From ableasby at hgmp.mrc.ac.uk  Sat Jan 12 01:11:27 2002
From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk)
Date: Sat, 12 Jan 2002 01:11:27 GMT
Subject: EMBOSS 2.2.0 released
Message-ID: <200201120111.BAA29642@bromine.hgmp.mrc.ac.uk>

EMBOSS 2.2.0 has several additional programs in the protein structure
area. Contacts, Dichet, Psiblasts, Scopalign, Siggen and Sigscan are
now made by default. A small utility, Biosed, has also been added to
allow simple deletion or replacement of subsequences or
residues. Documentation for some other new programs (e.g. Alignwrap)
is being prepared.

Routines to allow EMBOSS to read sequences from the latest SRS
servers has been incorporated in this release.

Bugfixes: Sequential access of GenBank flatfiles is again possible.
Problems with alignment reports have been fixed. est2genome now
works with unindexed sequence files. Other minor fixes and changes
have been incorporated.

Alan



From ableasby at hgmp.mrc.ac.uk  Mon Jan 14 15:19:05 2002
From: ableasby at hgmp.mrc.ac.uk (ableasby at hgmp.mrc.ac.uk)
Date: Mon, 14 Jan 2002 15:19:05 GMT
Subject: EMBOSS 2.2.0 patchfiles
Message-ID: <200201141519.PAA11675@bromine.hgmp.mrc.ac.uk>

A couple of minor bugs have been noticed in 2.2.0
One is that on some alignment reports the gap and similarity
scores are transposed. The other is a case sensitivity in
patmatdb.

There are fixes for both problems in the

   ftp://ftp.uk.embnet.org/pub/EMBOSS/patchfiles/

directory. Just replace the existing ajax/ajalign.c and
emboss/patmatdb.c files with the new ones and recompile.

Alan