From Steve_Chervitz at affymetrix.com Mon Dec 4 13:50:16 2006 From: Steve_Chervitz at affymetrix.com (Steve Chervitz) Date: Mon, 04 Dec 2006 10:50:16 -0800 Subject: [DAS2] Notes from the weekly DAS/2 teleconference, 4 Dec 2006 Message-ID: Notes from the weekly DAS/2 teleconference, 4 Dec 2006 $Id: das2-teleconf-2006-12-04.txt,v 1.1 2006/12/04 18:47:10 sac Exp $ Teleconference Info: * Schedule: Biweekly on Monday * Time of Day: 9:30 AM PST, 17:30 GMT * Dialin (US): 800-531-3250 * Dialin (Intl): 303-928-2693 * Toll-free UK: 08 00 40 49 467 * Toll-free France: 08 00 907 839 * Conference ID: 2879055 * Passcode: 1365 Note taker: Steve Chervitz Attendees: Affy: Steve Chervitz, Gregg Helt CSHL: Lincoln Stein Dalke Scientific: Andrew Dalke Action items are flagged with '[A]'. These notes are checked into the biodas.org CVS repository at das/das2/notes/2006. Instructions on how to access this repository are at http://biodas.org DISCLAIMER: The note taker aims for completeness and accuracy, but these goals are not always achievable, given the desire to get the notes out with a rapid turnaround. So don't consider these notes as complete minutes from the meeting, but rather abbreviated, summarized versions of what was discussed. There may be errors of commission and omission. Participants are welcome to post comments and/or corrections to these as they see fit. Agenda ------- * HTML retrieval spec discussion * Status reports Topic: HTML spec finalization ----------------------------- gh: has everyone had a chance to check out the revised html version of the retrieval spec since steve's changes? ad: looks clean sc: still some XXX comments here and there. [A] Gregg will add more alignment examples to html get spec, cigar string [A] All will take a final look at html get spec, paying attention to XXX flags. gh: need to spend another day editing. It's a good sign that no one has felt the need to change anything. gh: now we have other docs to do: writeback, stylesheets, etc. gh: finished the funding note for cshl sent to lincoln. ls: allen will be able to start again in a few weeks. cannot make any obligations to people now unless I can show there is money for it. had to ask him to stop working immediately. Topic: status reports ---------------------- ls: (re brian gilman, hapmap). Brian submitted a das2 pluging for caCORE and a patch to the NCICB to allow caCORE to use his plugin. has bee problematic b/c they wanted it in time for their releasse, and brian could not get their system to build for about 1 month. got code in by our deadline, but not in time for their release. uncertain when NCI will do a point release to bring this code in. people need to d/l the NCI source code, apply the diff, and re-compile it, which is not trivial as their build system is quite complex. so the code is there in principle, useable in practice? now he's working on das2 servers for hapmap and vert promoter db. has the data, using allens biopackages server, data should come up soon. I suspect they will reject what he did. he sent them uml docs and names of external libs, then started working on code, then chief s/w guy at NCI said they wrote the plugin layer based on brian's docs. once brian got the thing to compile, he realized it didn't work. so it's been tough working with NCI s/w devs, they are annoyed at us given out delay. doesn't impede das2 sources, but impedes the ability of this highly visible toolkit to use das2. gh: anything we can do to encourage? ls: we'll see in a few days the reaction to brian's work. complication - caBIG coordinator has left, new guy in place. possible a note from Tom Gingeras would help. gh: definitely. The primary way to look at affy tiling data is via IGB. It's important to be able to view hapmap data within IGB. ls: The other way around is important as well: for the core caBIG to have access to tiling data, they need the das2 client layer. gh: can get something from tom on that too. It's on the agenda for the affy server to server up tiling data eventually. [A] Gregg get letter from Tom Gingeras to support das2 in NCI caCORE ls: update on perl das2 client - still where I left it after last code sprint. needs 3-4 days of work. will go higher in priority when hapmap and vert prom db are up, for access to that data. gh: new IGB release over thanksgiving break out on 11/27, (Ed E. and I). Includes das/2 fixes and some new things: using das/2 to pull in data for affy chip data. Some background: to generate results for affy expr and exon chips is 'expression console' that generates results in CHP format, which IGB can read, problem is that it has no genomic locations, just probe set ids and p-values from experiments. So now, when IGB loads a chip file it finds the matching coord data via the netaffx das server, merges based on ids, to show results has heat maps, or graphs. integrates in nicely with das/2 client code in IGB. runs through this optimizer, doesn't reload the data for that session. can cache data for whole chromosome on your machine. uses alt file formats to retrieve in an optimize binary format. lazy loading, only for the chrm you are looking at. pretty happy as a good use of das/2 completely behind the scenes. gh: update broke the caching system that IGB is using, data retrieve via urls on local hard drive. now file names are too long using full type/segment uri's in the das/2 queries. so my url-> filename conversion got too long. using shortened versions. works for netaffx server but not with biopackages server. working on a fix soon. sc: are there java libraries to create a md5 checksum on the full long name? gh: maybe, or I may have a way to map filename to integers. need to investigate possible strategies. gh: also did some fixes on the das2 server. sc: updated the affy das servers to include the latest rat genome assembly release (ucsc rn4, Nov 2004). added to our das/1, das/2, and quickload servers. Added probe/probeset data for all exon arrays to das/2 server. Fixed a bug in the exon array names to permit gregg's genome location lookup tool to work. gh: we need to map the chip type name (which we have no control over) to the 'type' name in das2. sc: affy das/2 server has just a subset of the genomes and annotations available via quickload. das/1 server has support for 3' IVT array design data and exon arrays, not all arrays or genome versions supported due to memory limitation on the machine. gh: I'm hoping to get signoff for the new hardware order on wed. A quad opteron 32g expandable to 64g, should be nice. sc: also replied to brian osborne on discussion list re: some das1 vs 2 issues. Seems like a good candidate for a faq item. We should set up a faq, ideally on the wikified version of biodas.org. No progress on the wikification project. Need to poke open-bio.org admins again. [A] steve will set up faq on biodas.org [A] steve will look into wikification of biodas.org ad: working on proxy for translating das2 type queries into das1-style queries. on servers that are on andreas' registry. asked andreas about issues from various servers that appear to be not working. gh: can andreas detect non-operating servers via automatic server checking? ad: the segments doc on das1 text id is gene id 'located on chromsome 5' so a long string for segment id. valid xml but requires human to interpret. ad: also taking people's das1 modifications, using my handwritten code to apply their extensions, e.g., for ontologies. figuring out how to make their adaptation work nicely. mostly just saying, "there was extra data, you figure out how to use it." ad: code for proxy is in dasypus sourceforge CVS. In two parts: manual part goes to registry, updates local db. other part does proxying of das1 system. haven't documented how that works. [A] Andrew document das/1 proxy system in the faq (when faq is ready) [A] Next meeting in two weeks (18 Dec 2006) From Steve_Chervitz at affymetrix.com Mon Dec 4 16:53:33 2006 From: Steve_Chervitz at affymetrix.com (Steve Chervitz) Date: Mon, 04 Dec 2006 13:53:33 -0800 Subject: [DAS2] Updated HTML get spec doc Message-ID: I just committed some updates to the das2_get.html document, so to all editors out there, be sure to CVS update to get the latest version before modifying. I also updated the publically visible doc at http://biodas.org/documents/das2/das2_get.html which normally gets updated from CVS just once a day (not sure when). Here's a summary of my changes: * Clarified description of half-open (interbase) intervals in section 1.5 Segment ranges. Reworded and added illustrative example. This numbering system may be a foreign concept to many. * Added some in-page links to some key sections (feat filters, global seq ids). * Removed the XXX in the third para along with the ambiguous sentence it was referring to. Seemed like unnecessary complication. * Added/fixed external links (form-urlencoded, textuality link) * Fixed some typos in the text, including one html glitch. There are currently three remaining XXX comments: one pertaining to DAS registry at Sanger, and two pertaining to alignments (which Gregg said he's working on). Can someone in the know take a look at the comment re: the Sanger registry in section 3.1? Steve From bosborne11 at verizon.net Wed Dec 6 09:58:47 2006 From: bosborne11 at verizon.net (Brian Osborne) Date: Wed, 06 Dec 2006 09:58:47 -0500 Subject: [DAS2] DAS and DAS2 In-Reply-To: Message-ID: Steve, Thank you for your thorough response. One more question: what applications are the actual "DAS clients" these days? Thanks again, Brian O. On 11/30/06 5:59 PM, "Steve Chervitz" wrote: > Hi Brian, > > Brian Osborne wrote on Mon, 27 Nov 2006: > >> My name is Brian Osborne, I?m working on documentation for GMOD and >> GMOD-related packages as part of the newly created GMOD Help Desk position. > > Great. Looking forward to more quality documentation for GMOD, a la your > excellent contributions to Bioperl documentation. > >> Some of my colleagues here in the GMOD community are recommending that we >> consider DAS, 1 or 2, as important GMOD-related software so I?m joining your >> list in order to learn more about DAS. > > DAS is definitely appropriate for GMOD. Providing a DAS-compatible interface > to MOD data would help write software tools and perform data analyses that > integrate data from different sources. > > In fact, a DAS/2 server reference implementation is being developed within > the GMOD sourceforge CVS, though it's not officially been released as part > of GMOD. Here are the CVS commit logs for it. > http://sourceforge.net/mailarchive/forum.php?forum_id=42210 > > Other DAS/2 software is also being developed under open source licenses. See > links on http://biodas.org in the About section, look for "The DAS/2 code > base". > >> I have some initial questions, I was >> wondering if someone could help me out with them (I did read the DAS >> Overview and browsed most of the specs at biodas.org). >> >> 1. Are DAS1 and DAS2 designed to inter-operate? For example, will I be able >> to use a DAS2 client and a DAS1 server? > > DAS/2 is a complete redesign of the spec, so direct interoperation is not > possible. However, DAS/2 has all of the capabilities of the DAS/1 spec (and > more!). > > As proof of this, Andrew Dalke is developing a proxy adapter that will allow > you to put a DAS/2 interface around an existing DAS/1 server, allowing DAS/2 > clients to interact with existing DAS/1 servers: > http://lists.open-bio.org/pipermail/das2/2006-October/000867.html > > To fully realize 1 <-> 2 interoperation, one would also need to write a > DAS/1 proxy adapter for DAS/2 servers, to permit DAS/1 clients to interact > with DAS/2 servers. I don't know of any plans for that yet. > >> 2. Do you think DAS2 is going to replace DAS1 or co-exist with it? Yes, this >> may not be easy to answer. > > The proxy adapter approach should enable some degree of peaceful > co-existence between DAS/1 and DAS/2 systems, and should facilitate the > transition to DAS/2, which has many niceties not present in DAS/1. As far as > replacing DAS/1, the proof will be in the pudding. > >> 3. Is there a DAS2 release date? > > The DAS/2 schema for retrieval of genomic annotations has been officially > frozen since mid-November (das2_schemas.rnc and das2_schemas.xsd in the > biodas/das/das2 CVS repository). > > The corresponding html version of this spec, viewable from biodas.org, is > soon to be finalized as well (probably by end of next week). When that > happens, DAS/2 for genome retrieval will be considered released. Stay tuned > to this list for an announcement. > > The DAS/2 writeback spec is still under development and I don't believe a > timeframe for it's release has been set. > > Steve > From Steve_Chervitz at affymetrix.com Thu Dec 7 13:41:57 2006 From: Steve_Chervitz at affymetrix.com (Steve Chervitz) Date: Thu, 07 Dec 2006 10:41:57 -0800 Subject: [DAS2] DAS and DAS2 In-Reply-To: Message-ID: DAS applications generally take the form of graphical genome browsers, protein feature/structure browsers, and even gene information browsers. I don't necessarily have a comprehensive list of DAS clients in current use today, but here are a few of the major ones I know of (anyone else: feel free to chime in here): IGB: http://genoviz.sourceforge.net Gbrowse: http://www.gmod.org/gbrowse_installation Ensembl: http://www.ensembl.org/info/data/external_data/das/ensembl_das.html Spice: http://www.efamily.org.uk/software/dasclients/spice/ Dasty: http://www.ebi.ac.uk/das-srv/uniprot/dasty/content?ID=:dis=BioSapiens Dasty2: http://www.ebi.ac.uk/~rafael/pre_dasty2/ For an example of how Ensembl acts as a DAS client for gene information browsing, see the "Gene DAS Report" section of this page: http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000165029 Here's an insteresting review of EBI DAS clients: http://www.ebi.ac.uk/~rafael/das/index.php?display=clients When the wiki version of biodas.org gets set up, a page devoted to various clients and their DAS/1 vs DAS/2 support status would be a good idea. Steve > From: Brian Osborne > Date: Wed, 06 Dec 2006 09:58:47 -0500 > To: Steve Chervitz , DAS/2 Discussion > > Cc: GMOD Helpdesk > Conversation: [DAS2] DAS and DAS2 > Subject: Re: [DAS2] DAS and DAS2 > > Steve, > > Thank you for your thorough response. One more question: what applications > are the actual "DAS clients" these days? > > Thanks again, > > Brian O. > > > On 11/30/06 5:59 PM, "Steve Chervitz" wrote: > >> Hi Brian, >> >> Brian Osborne wrote on Mon, 27 Nov 2006: >> >>> My name is Brian Osborne, I?m working on documentation for GMOD and >>> GMOD-related packages as part of the newly created GMOD Help Desk position. >> >> Great. Looking forward to more quality documentation for GMOD, a la your >> excellent contributions to Bioperl documentation. >> >>> Some of my colleagues here in the GMOD community are recommending that we >>> consider DAS, 1 or 2, as important GMOD-related software so I?m joining your >>> list in order to learn more about DAS. >> >> DAS is definitely appropriate for GMOD. Providing a DAS-compatible interface >> to MOD data would help write software tools and perform data analyses that >> integrate data from different sources. >> >> In fact, a DAS/2 server reference implementation is being developed within >> the GMOD sourceforge CVS, though it's not officially been released as part >> of GMOD. Here are the CVS commit logs for it. >> http://sourceforge.net/mailarchive/forum.php?forum_id=42210 >> >> Other DAS/2 software is also being developed under open source licenses. See >> links on http://biodas.org in the About section, look for "The DAS/2 code >> base". >> >>> I have some initial questions, I was >>> wondering if someone could help me out with them (I did read the DAS >>> Overview and browsed most of the specs at biodas.org). >>> >>> 1. Are DAS1 and DAS2 designed to inter-operate? For example, will I be able >>> to use a DAS2 client and a DAS1 server? >> >> DAS/2 is a complete redesign of the spec, so direct interoperation is not >> possible. However, DAS/2 has all of the capabilities of the DAS/1 spec (and >> more!). >> >> As proof of this, Andrew Dalke is developing a proxy adapter that will allow >> you to put a DAS/2 interface around an existing DAS/1 server, allowing DAS/2 >> clients to interact with existing DAS/1 servers: >> http://lists.open-bio.org/pipermail/das2/2006-October/000867.html >> >> To fully realize 1 <-> 2 interoperation, one would also need to write a >> DAS/1 proxy adapter for DAS/2 servers, to permit DAS/1 clients to interact >> with DAS/2 servers. I don't know of any plans for that yet. >> >>> 2. Do you think DAS2 is going to replace DAS1 or co-exist with it? Yes, this >>> may not be easy to answer. >> >> The proxy adapter approach should enable some degree of peaceful >> co-existence between DAS/1 and DAS/2 systems, and should facilitate the >> transition to DAS/2, which has many niceties not present in DAS/1. As far as >> replacing DAS/1, the proof will be in the pudding. >> >>> 3. Is there a DAS2 release date? >> >> The DAS/2 schema for retrieval of genomic annotations has been officially >> frozen since mid-November (das2_schemas.rnc and das2_schemas.xsd in the >> biodas/das/das2 CVS repository). >> >> The corresponding html version of this spec, viewable from biodas.org, is >> soon to be finalized as well (probably by end of next week). When that >> happens, DAS/2 for genome retrieval will be considered released. Stay tuned >> to this list for an announcement. >> >> The DAS/2 writeback spec is still under development and I don't believe a >> timeframe for it's release has been set. >> >> Steve >> > > From bosborne11 at verizon.net Thu Dec 7 14:59:11 2006 From: bosborne11 at verizon.net (Brian Osborne) Date: Thu, 07 Dec 2006 14:59:11 -0500 Subject: [DAS2] DAS and DAS2 In-Reply-To: Message-ID: Suzi, That's good to know - do you mean one could both read and write through DAS if the code was updated? By the way I don't think this is mentioned in the Apollo user documentation, the HTML files in Apollo/doc/html, though the Chado adaptor is mentioned. Brian O. On 12/7/06 2:27 PM, "Suzanna Lewis" wrote: > Might add apollo to the list. I'm sure it's das client is in need of > an update, but it is there in a basic form that would give a leg up > to a developer who was interested. > > > On Dec 7, 2006, at 10:41 AM, Steve Chervitz wrote: > >> DAS applications generally take the form of graphical genome browsers, >> protein feature/structure browsers, and even gene information >> browsers. >> >> I don't necessarily have a comprehensive list of DAS clients in >> current use >> today, but here are a few of the major ones I know of (anyone else: >> feel >> free to chime in here): >> >> IGB: http://genoviz.sourceforge.net >> Gbrowse: http://www.gmod.org/gbrowse_installation >> Ensembl: http://www.ensembl.org/info/data/external_data/das/ >> ensembl_das.html >> Spice: http://www.efamily.org.uk/software/dasclients/spice/ >> Dasty: http://www.ebi.ac.uk/das-srv/uniprot/dasty/content? >> ID=:dis=BioSapiens >> Dasty2: http://www.ebi.ac.uk/~rafael/pre_dasty2/ >> >> For an example of how Ensembl acts as a DAS client for gene >> information >> browsing, see the "Gene DAS Report" section of this page: >> http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000165029 >> >> Here's an insteresting review of EBI DAS clients: >> http://www.ebi.ac.uk/~rafael/das/index.php?display=clients >> >> When the wiki version of biodas.org gets set up, a page devoted to >> various >> clients and their DAS/1 vs DAS/2 support status would be a good idea. >> >> Steve >> >> >>> From: Brian Osborne >>> Date: Wed, 06 Dec 2006 09:58:47 -0500 >>> To: Steve Chervitz , DAS/2 Discussion >>> >>> Cc: GMOD Helpdesk >>> Conversation: [DAS2] DAS and DAS2 >>> Subject: Re: [DAS2] DAS and DAS2 >>> >>> Steve, >>> >>> Thank you for your thorough response. One more question: what >>> applications >>> are the actual "DAS clients" these days? >>> >>> Thanks again, >>> >>> Brian O. >>> >>> >>> On 11/30/06 5:59 PM, "Steve Chervitz" >>> wrote: >>> >>>> Hi Brian, >>>> >>>> Brian Osborne wrote on Mon, 27 Nov 2006: >>>> >>>>> My name is Brian Osborne, I?m working on documentation for GMOD and >>>>> GMOD-related packages as part of the newly created GMOD Help >>>>> Desk position. >>>> >>>> Great. Looking forward to more quality documentation for GMOD, a >>>> la your >>>> excellent contributions to Bioperl documentation. >>>> >>>>> Some of my colleagues here in the GMOD community are >>>>> recommending that we >>>>> consider DAS, 1 or 2, as important GMOD-related software so I?m >>>>> joining your >>>>> list in order to learn more about DAS. >>>> >>>> DAS is definitely appropriate for GMOD. Providing a DAS- >>>> compatible interface >>>> to MOD data would help write software tools and perform data >>>> analyses that >>>> integrate data from different sources. >>>> >>>> In fact, a DAS/2 server reference implementation is being >>>> developed within >>>> the GMOD sourceforge CVS, though it's not officially been >>>> released as part >>>> of GMOD. Here are the CVS commit logs for it. >>>> http://sourceforge.net/mailarchive/forum.php?forum_id=42210 >>>> >>>> Other DAS/2 software is also being developed under open source >>>> licenses. See >>>> links on http://biodas.org in the About section, look for "The >>>> DAS/2 code >>>> base". >>>> >>>>> I have some initial questions, I was >>>>> wondering if someone could help me out with them (I did read the >>>>> DAS >>>>> Overview and browsed most of the specs at biodas.org). >>>>> >>>>> 1. Are DAS1 and DAS2 designed to inter-operate? For example, >>>>> will I be able >>>>> to use a DAS2 client and a DAS1 server? >>>> >>>> DAS/2 is a complete redesign of the spec, so direct >>>> interoperation is not >>>> possible. However, DAS/2 has all of the capabilities of the DAS/1 >>>> spec (and >>>> more!). >>>> >>>> As proof of this, Andrew Dalke is developing a proxy adapter that >>>> will allow >>>> you to put a DAS/2 interface around an existing DAS/1 server, >>>> allowing DAS/2 >>>> clients to interact with existing DAS/1 servers: >>>> http://lists.open-bio.org/pipermail/das2/2006-October/000867.html >>>> >>>> To fully realize 1 <-> 2 interoperation, one would also need to >>>> write a >>>> DAS/1 proxy adapter for DAS/2 servers, to permit DAS/1 clients to >>>> interact >>>> with DAS/2 servers. I don't know of any plans for that yet. >>>> >>>>> 2. Do you think DAS2 is going to replace DAS1 or co-exist with >>>>> it? Yes, this >>>>> may not be easy to answer. >>>> >>>> The proxy adapter approach should enable some degree of peaceful >>>> co-existence between DAS/1 and DAS/2 systems, and should >>>> facilitate the >>>> transition to DAS/2, which has many niceties not present in DAS/ >>>> 1. As far as >>>> replacing DAS/1, the proof will be in the pudding. >>>> >>>>> 3. Is there a DAS2 release date? >>>> >>>> The DAS/2 schema for retrieval of genomic annotations has been >>>> officially >>>> frozen since mid-November (das2_schemas.rnc and das2_schemas.xsd >>>> in the >>>> biodas/das/das2 CVS repository). >>>> >>>> The corresponding html version of this spec, viewable from >>>> biodas.org, is >>>> soon to be finalized as well (probably by end of next week). When >>>> that >>>> happens, DAS/2 for genome retrieval will be considered released. >>>> Stay tuned >>>> to this list for an announcement. >>>> >>>> The DAS/2 writeback spec is still under development and I don't >>>> believe a >>>> timeframe for it's release has been set. >>>> >>>> Steve >>>> >>> >>> >> >> >> _______________________________________________ >> DAS2 mailing list >> DAS2 at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/das2 >> > From bosborne11 at verizon.net Thu Dec 7 13:56:52 2006 From: bosborne11 at verizon.net (Brian Osborne) Date: Thu, 07 Dec 2006 13:56:52 -0500 Subject: [DAS2] DAS and DAS2 In-Reply-To: Message-ID: Steve, Perfect, thank you. You mentioned a DAS Wiki - do you know when this will make its first appearance? Brian O. On 12/7/06 1:41 PM, "Steve Chervitz" wrote: > DAS applications generally take the form of graphical genome browsers, > protein feature/structure browsers, and even gene information browsers. > > I don't necessarily have a comprehensive list of DAS clients in current use > today, but here are a few of the major ones I know of (anyone else: feel > free to chime in here): > > IGB: http://genoviz.sourceforge.net > Gbrowse: http://www.gmod.org/gbrowse_installation > Ensembl: http://www.ensembl.org/info/data/external_data/das/ensembl_das.html > Spice: http://www.efamily.org.uk/software/dasclients/spice/ > Dasty: http://www.ebi.ac.uk/das-srv/uniprot/dasty/content?ID=:dis=BioSapiens > Dasty2: http://www.ebi.ac.uk/~rafael/pre_dasty2/ > > For an example of how Ensembl acts as a DAS client for gene information > browsing, see the "Gene DAS Report" section of this page: > http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000165029 > > Here's an insteresting review of EBI DAS clients: > http://www.ebi.ac.uk/~rafael/das/index.php?display=clients > > When the wiki version of biodas.org gets set up, a page devoted to various > clients and their DAS/1 vs DAS/2 support status would be a good idea. > > Steve > > >> From: Brian Osborne >> Date: Wed, 06 Dec 2006 09:58:47 -0500 >> To: Steve Chervitz , DAS/2 Discussion >> >> Cc: GMOD Helpdesk >> Conversation: [DAS2] DAS and DAS2 >> Subject: Re: [DAS2] DAS and DAS2 >> >> Steve, >> >> Thank you for your thorough response. One more question: what applications >> are the actual "DAS clients" these days? >> >> Thanks again, >> >> Brian O. >> >> >> On 11/30/06 5:59 PM, "Steve Chervitz" wrote: >> >>> Hi Brian, >>> >>> Brian Osborne wrote on Mon, 27 Nov 2006: >>> >>>> My name is Brian Osborne, I?m working on documentation for GMOD and >>>> GMOD-related packages as part of the newly created GMOD Help Desk position. >>> >>> Great. Looking forward to more quality documentation for GMOD, a la your >>> excellent contributions to Bioperl documentation. >>> >>>> Some of my colleagues here in the GMOD community are recommending that we >>>> consider DAS, 1 or 2, as important GMOD-related software so I?m joining >>>> your >>>> list in order to learn more about DAS. >>> >>> DAS is definitely appropriate for GMOD. Providing a DAS-compatible interface >>> to MOD data would help write software tools and perform data analyses that >>> integrate data from different sources. >>> >>> In fact, a DAS/2 server reference implementation is being developed within >>> the GMOD sourceforge CVS, though it's not officially been released as part >>> of GMOD. Here are the CVS commit logs for it. >>> http://sourceforge.net/mailarchive/forum.php?forum_id=42210 >>> >>> Other DAS/2 software is also being developed under open source licenses. See >>> links on http://biodas.org in the About section, look for "The DAS/2 code >>> base". >>> >>>> I have some initial questions, I was >>>> wondering if someone could help me out with them (I did read the DAS >>>> Overview and browsed most of the specs at biodas.org). >>>> >>>> 1. Are DAS1 and DAS2 designed to inter-operate? For example, will I be able >>>> to use a DAS2 client and a DAS1 server? >>> >>> DAS/2 is a complete redesign of the spec, so direct interoperation is not >>> possible. However, DAS/2 has all of the capabilities of the DAS/1 spec (and >>> more!). >>> >>> As proof of this, Andrew Dalke is developing a proxy adapter that will allow >>> you to put a DAS/2 interface around an existing DAS/1 server, allowing DAS/2 >>> clients to interact with existing DAS/1 servers: >>> http://lists.open-bio.org/pipermail/das2/2006-October/000867.html >>> >>> To fully realize 1 <-> 2 interoperation, one would also need to write a >>> DAS/1 proxy adapter for DAS/2 servers, to permit DAS/1 clients to interact >>> with DAS/2 servers. I don't know of any plans for that yet. >>> >>>> 2. Do you think DAS2 is going to replace DAS1 or co-exist with it? Yes, >>>> this >>>> may not be easy to answer. >>> >>> The proxy adapter approach should enable some degree of peaceful >>> co-existence between DAS/1 and DAS/2 systems, and should facilitate the >>> transition to DAS/2, which has many niceties not present in DAS/1. As far as >>> replacing DAS/1, the proof will be in the pudding. >>> >>>> 3. Is there a DAS2 release date? >>> >>> The DAS/2 schema for retrieval of genomic annotations has been officially >>> frozen since mid-November (das2_schemas.rnc and das2_schemas.xsd in the >>> biodas/das/das2 CVS repository). >>> >>> The corresponding html version of this spec, viewable from biodas.org, is >>> soon to be finalized as well (probably by end of next week). When that >>> happens, DAS/2 for genome retrieval will be considered released. Stay tuned >>> to this list for an announcement. >>> >>> The DAS/2 writeback spec is still under development and I don't believe a >>> timeframe for it's release has been set. >>> >>> Steve >>> >> >> > From suzi at berkeleybop.org Thu Dec 7 15:38:21 2006 From: suzi at berkeleybop.org (Suzanna Lewis) Date: Thu, 7 Dec 2006 12:38:21 -0800 Subject: [DAS2] DAS and DAS2 In-Reply-To: References: Message-ID: <219D54C7-5144-47C6-AA7D-F3D6288D7B54@berkeleybop.org> On Dec 7, 2006, at 11:59 AM, Brian Osborne wrote: > Suzi, > > That's good to know - do you mean one could both read and write > through DAS > if the code was updated? Reading was working, but not writing. Nomi would know if any progress was made on writing or not (but I'm guessing the answer is no). > > By the way I don't think this is mentioned in the Apollo user > documentation, > the HTML files in Apollo/doc/html, though the Chado adaptor is > mentioned. That's an oversight. Probably because it never got driven to completion by a group of users who needed it at the time. > > Brian O. > > > On 12/7/06 2:27 PM, "Suzanna Lewis" wrote: > >> Might add apollo to the list. I'm sure it's das client is in need of >> an update, but it is there in a basic form that would give a leg up >> to a developer who was interested. >> >> >> On Dec 7, 2006, at 10:41 AM, Steve Chervitz wrote: >> >>> DAS applications generally take the form of graphical genome >>> browsers, >>> protein feature/structure browsers, and even gene information >>> browsers. >>> >>> I don't necessarily have a comprehensive list of DAS clients in >>> current use >>> today, but here are a few of the major ones I know of (anyone else: >>> feel >>> free to chime in here): >>> >>> IGB: http://genoviz.sourceforge.net >>> Gbrowse: http://www.gmod.org/gbrowse_installation >>> Ensembl: http://www.ensembl.org/info/data/external_data/das/ >>> ensembl_das.html >>> Spice: http://www.efamily.org.uk/software/dasclients/spice/ >>> Dasty: http://www.ebi.ac.uk/das-srv/uniprot/dasty/content? >>> ID=:dis=BioSapiens >>> Dasty2: http://www.ebi.ac.uk/~rafael/pre_dasty2/ >>> >>> For an example of how Ensembl acts as a DAS client for gene >>> information >>> browsing, see the "Gene DAS Report" section of this page: >>> http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000165029 >>> >>> Here's an insteresting review of EBI DAS clients: >>> http://www.ebi.ac.uk/~rafael/das/index.php?display=clients >>> >>> When the wiki version of biodas.org gets set up, a page devoted to >>> various >>> clients and their DAS/1 vs DAS/2 support status would be a good >>> idea. >>> >>> Steve >>> >>> >>>> From: Brian Osborne >>>> Date: Wed, 06 Dec 2006 09:58:47 -0500 >>>> To: Steve Chervitz , DAS/2 >>>> Discussion >>>> >>>> Cc: GMOD Helpdesk >>>> Conversation: [DAS2] DAS and DAS2 >>>> Subject: Re: [DAS2] DAS and DAS2 >>>> >>>> Steve, >>>> >>>> Thank you for your thorough response. One more question: what >>>> applications >>>> are the actual "DAS clients" these days? >>>> >>>> Thanks again, >>>> >>>> Brian O. >>>> >>>> >>>> On 11/30/06 5:59 PM, "Steve Chervitz" >>>> wrote: >>>> >>>>> Hi Brian, >>>>> >>>>> Brian Osborne wrote on Mon, 27 Nov 2006: >>>>> >>>>>> My name is Brian Osborne, I?m working on documentation for >>>>>> GMOD and >>>>>> GMOD-related packages as part of the newly created GMOD Help >>>>>> Desk position. >>>>> >>>>> Great. Looking forward to more quality documentation for GMOD, a >>>>> la your >>>>> excellent contributions to Bioperl documentation. >>>>> >>>>>> Some of my colleagues here in the GMOD community are >>>>>> recommending that we >>>>>> consider DAS, 1 or 2, as important GMOD-related software so I?m >>>>>> joining your >>>>>> list in order to learn more about DAS. >>>>> >>>>> DAS is definitely appropriate for GMOD. Providing a DAS- >>>>> compatible interface >>>>> to MOD data would help write software tools and perform data >>>>> analyses that >>>>> integrate data from different sources. >>>>> >>>>> In fact, a DAS/2 server reference implementation is being >>>>> developed within >>>>> the GMOD sourceforge CVS, though it's not officially been >>>>> released as part >>>>> of GMOD. Here are the CVS commit logs for it. >>>>> http://sourceforge.net/mailarchive/forum.php?forum_id=42210 >>>>> >>>>> Other DAS/2 software is also being developed under open source >>>>> licenses. See >>>>> links on http://biodas.org in the About section, look for "The >>>>> DAS/2 code >>>>> base". >>>>> >>>>>> I have some initial questions, I was >>>>>> wondering if someone could help me out with them (I did read the >>>>>> DAS >>>>>> Overview and browsed most of the specs at biodas.org). >>>>>> >>>>>> 1. Are DAS1 and DAS2 designed to inter-operate? For example, >>>>>> will I be able >>>>>> to use a DAS2 client and a DAS1 server? >>>>> >>>>> DAS/2 is a complete redesign of the spec, so direct >>>>> interoperation is not >>>>> possible. However, DAS/2 has all of the capabilities of the DAS/1 >>>>> spec (and >>>>> more!). >>>>> >>>>> As proof of this, Andrew Dalke is developing a proxy adapter that >>>>> will allow >>>>> you to put a DAS/2 interface around an existing DAS/1 server, >>>>> allowing DAS/2 >>>>> clients to interact with existing DAS/1 servers: >>>>> http://lists.open-bio.org/pipermail/das2/2006-October/000867.html >>>>> >>>>> To fully realize 1 <-> 2 interoperation, one would also need to >>>>> write a >>>>> DAS/1 proxy adapter for DAS/2 servers, to permit DAS/1 clients to >>>>> interact >>>>> with DAS/2 servers. I don't know of any plans for that yet. >>>>> >>>>>> 2. Do you think DAS2 is going to replace DAS1 or co-exist with >>>>>> it? Yes, this >>>>>> may not be easy to answer. >>>>> >>>>> The proxy adapter approach should enable some degree of peaceful >>>>> co-existence between DAS/1 and DAS/2 systems, and should >>>>> facilitate the >>>>> transition to DAS/2, which has many niceties not present in DAS/ >>>>> 1. As far as >>>>> replacing DAS/1, the proof will be in the pudding. >>>>> >>>>>> 3. Is there a DAS2 release date? >>>>> >>>>> The DAS/2 schema for retrieval of genomic annotations has been >>>>> officially >>>>> frozen since mid-November (das2_schemas.rnc and das2_schemas.xsd >>>>> in the >>>>> biodas/das/das2 CVS repository). >>>>> >>>>> The corresponding html version of this spec, viewable from >>>>> biodas.org, is >>>>> soon to be finalized as well (probably by end of next week). When >>>>> that >>>>> happens, DAS/2 for genome retrieval will be considered released. >>>>> Stay tuned >>>>> to this list for an announcement. >>>>> >>>>> The DAS/2 writeback spec is still under development and I don't >>>>> believe a >>>>> timeframe for it's release has been set. >>>>> >>>>> Steve >>>>> >>>> >>>> >>> >>> >>> _______________________________________________ >>> DAS2 mailing list >>> DAS2 at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/das2 >>> >> > > > > _______________________________________________ > DAS2 mailing list > DAS2 at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/das2 > From rafael at ebi.ac.uk Thu Dec 7 14:24:18 2006 From: rafael at ebi.ac.uk (Rafael C. Jimenez) Date: Thu, 7 Dec 2006 19:24:18 +0000 Subject: [DAS2] DAS and DAS2 In-Reply-To: References: Message-ID: Hi there, I just wanted to make a remark ... On 07 Dec 2006, at 6:41 PM, Steve Chervitz wrote: > DAS applications generally take the form of graphical genome browsers, > protein feature/structure browsers, and even gene information browsers. > > I don't necessarily have a comprehensive list of DAS clients in > current use > today, but here are a few of the major ones I know of (anyone else: > feel > free to chime in here): > > IGB: http://genoviz.sourceforge.net > Gbrowse: http://www.gmod.org/gbrowse_installation > Ensembl: > http://www.ensembl.org/info/data/external_data/das/ensembl_das.html > Spice: http://www.efamily.org.uk/software/dasclients/spice/ > Dasty: > http://www.ebi.ac.uk/das-srv/uniprot/dasty/content?ID=:dis=BioSapiens > Dasty2: http://www.ebi.ac.uk/~rafael/pre_dasty2/ The EBI is currently developing Dasty2. It is simply a protein feature viewer. This version is not the final version and is continuously changing hence it might not work 100%. We expect the first release at the end of December. The content in my folder is just a testing version: http://www.ebi.ac.uk/~rafael/javascript/ If you want more information about it please don't hesitate to contact me. Cheers, Rafael. > > For an example of how Ensembl acts as a DAS client for gene information > browsing, see the "Gene DAS Report" section of this page: > http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000165029 > > Here's an insteresting review of EBI DAS clients: > http://www.ebi.ac.uk/~rafael/das/index.php?display=clients > > When the wiki version of biodas.org gets set up, a page devoted to > various > clients and their DAS/1 vs DAS/2 support status would be a good idea. > > Steve > > >> From: Brian Osborne >> Date: Wed, 06 Dec 2006 09:58:47 -0500 >> To: Steve Chervitz , DAS/2 Discussion >> >> Cc: GMOD Helpdesk >> Conversation: [DAS2] DAS and DAS2 >> Subject: Re: [DAS2] DAS and DAS2 >> >> Steve, >> >> Thank you for your thorough response. One more question: what >> applications >> are the actual "DAS clients" these days? >> >> Thanks again, >> >> Brian O. >> >> >> On 11/30/06 5:59 PM, "Steve Chervitz" >> wrote: >> >>> Hi Brian, >>> >>> Brian Osborne wrote on Mon, 27 Nov 2006: >>> >>>> My name is Brian Osborne, I?m working on documentation for GMOD and >>>> GMOD-related packages as part of the newly created GMOD Help Desk >>>> position. >>> >>> Great. Looking forward to more quality documentation for GMOD, a la >>> your >>> excellent contributions to Bioperl documentation. >>> >>>> Some of my colleagues here in the GMOD community are recommending >>>> that we >>>> consider DAS, 1 or 2, as important GMOD-related software so I?m >>>> joining your >>>> list in order to learn more about DAS. >>> >>> DAS is definitely appropriate for GMOD. Providing a DAS-compatible >>> interface >>> to MOD data would help write software tools and perform data >>> analyses that >>> integrate data from different sources. >>> >>> In fact, a DAS/2 server reference implementation is being developed >>> within >>> the GMOD sourceforge CVS, though it's not officially been released >>> as part >>> of GMOD. Here are the CVS commit logs for it. >>> http://sourceforge.net/mailarchive/forum.php?forum_id=42210 >>> >>> Other DAS/2 software is also being developed under open source >>> licenses. See >>> links on http://biodas.org in the About section, look for "The DAS/2 >>> code >>> base". >>> >>>> I have some initial questions, I was >>>> wondering if someone could help me out with them (I did read the DAS >>>> Overview and browsed most of the specs at biodas.org). >>>> >>>> 1. Are DAS1 and DAS2 designed to inter-operate? For example, will I >>>> be able >>>> to use a DAS2 client and a DAS1 server? >>> >>> DAS/2 is a complete redesign of the spec, so direct interoperation >>> is not >>> possible. However, DAS/2 has all of the capabilities of the DAS/1 >>> spec (and >>> more!). >>> >>> As proof of this, Andrew Dalke is developing a proxy adapter that >>> will allow >>> you to put a DAS/2 interface around an existing DAS/1 server, >>> allowing DAS/2 >>> clients to interact with existing DAS/1 servers: >>> http://lists.open-bio.org/pipermail/das2/2006-October/000867.html >>> >>> To fully realize 1 <-> 2 interoperation, one would also need to >>> write a >>> DAS/1 proxy adapter for DAS/2 servers, to permit DAS/1 clients to >>> interact >>> with DAS/2 servers. I don't know of any plans for that yet. >>> >>>> 2. Do you think DAS2 is going to replace DAS1 or co-exist with it? >>>> Yes, this >>>> may not be easy to answer. >>> >>> The proxy adapter approach should enable some degree of peaceful >>> co-existence between DAS/1 and DAS/2 systems, and should facilitate >>> the >>> transition to DAS/2, which has many niceties not present in DAS/1. >>> As far as >>> replacing DAS/1, the proof will be in the pudding. >>> >>>> 3. Is there a DAS2 release date? >>> >>> The DAS/2 schema for retrieval of genomic annotations has been >>> officially >>> frozen since mid-November (das2_schemas.rnc and das2_schemas.xsd in >>> the >>> biodas/das/das2 CVS repository). >>> >>> The corresponding html version of this spec, viewable from >>> biodas.org, is >>> soon to be finalized as well (probably by end of next week). When >>> that >>> happens, DAS/2 for genome retrieval will be considered released. >>> Stay tuned >>> to this list for an announcement. >>> >>> The DAS/2 writeback spec is still under development and I don't >>> believe a >>> timeframe for it's release has been set. >>> >>> Steve >>> >> >> > > > _______________________________________________ > DAS2 mailing list > DAS2 at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/das2 From Steve_Chervitz at affymetrix.com Thu Dec 7 18:42:46 2006 From: Steve_Chervitz at affymetrix.com (Steve Chervitz) Date: Thu, 07 Dec 2006 15:42:46 -0800 Subject: [DAS2] DAS and DAS2 In-Reply-To: Message-ID: Brian, > You mentioned a DAS Wiki - do you know when this will make its first > appearance? I'm targetting mid-late January for completing the transition to the wiki site. But as for making an appearance, you can check it out now at: http://biodas.org/wiki/Main_Page There's literally nothing there yet, except for a new BioDAS icon I threw together in a few minutes. If anyone is interested in helping with the migration, let me know. Anyone who has suggestions for how to organize the site, just post them to this list. Steve > On 12/7/06 1:41 PM, "Steve Chervitz" wrote: > >> DAS applications generally take the form of graphical genome browsers, >> protein feature/structure browsers, and even gene information browsers. >> >> I don't necessarily have a comprehensive list of DAS clients in current use >> today, but here are a few of the major ones I know of (anyone else: feel >> free to chime in here): >> >> IGB: http://genoviz.sourceforge.net >> Gbrowse: http://www.gmod.org/gbrowse_installation >> Ensembl: http://www.ensembl.org/info/data/external_data/das/ensembl_das.html >> Spice: http://www.efamily.org.uk/software/dasclients/spice/ >> Dasty: http://www.ebi.ac.uk/das-srv/uniprot/dasty/content?ID=:dis=BioSapiens >> Dasty2: http://www.ebi.ac.uk/~rafael/pre_dasty2/ >> >> For an example of how Ensembl acts as a DAS client for gene information >> browsing, see the "Gene DAS Report" section of this page: >> http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000165029 >> >> Here's an insteresting review of EBI DAS clients: >> http://www.ebi.ac.uk/~rafael/das/index.php?display=clients >> >> When the wiki version of biodas.org gets set up, a page devoted to various >> clients and their DAS/1 vs DAS/2 support status would be a good idea. >> >> Steve >> >> >>> From: Brian Osborne >>> Date: Wed, 06 Dec 2006 09:58:47 -0500 >>> To: Steve Chervitz , DAS/2 Discussion >>> >>> Cc: GMOD Helpdesk >>> Conversation: [DAS2] DAS and DAS2 >>> Subject: Re: [DAS2] DAS and DAS2 >>> >>> Steve, >>> >>> Thank you for your thorough response. One more question: what applications >>> are the actual "DAS clients" these days? >>> >>> Thanks again, >>> >>> Brian O. >>> >>> >>> On 11/30/06 5:59 PM, "Steve Chervitz" wrote: >>> >>>> Hi Brian, >>>> >>>> Brian Osborne wrote on Mon, 27 Nov 2006: >>>> >>>>> My name is Brian Osborne, I?m working on documentation for GMOD and >>>>> GMOD-related packages as part of the newly created GMOD Help Desk >>>>> position. >>>> >>>> Great. Looking forward to more quality documentation for GMOD, a la your >>>> excellent contributions to Bioperl documentation. >>>> >>>>> Some of my colleagues here in the GMOD community are recommending that we >>>>> consider DAS, 1 or 2, as important GMOD-related software so I?m joining >>>>> your >>>>> list in order to learn more about DAS. >>>> >>>> DAS is definitely appropriate for GMOD. Providing a DAS-compatible >>>> interface >>>> to MOD data would help write software tools and perform data analyses that >>>> integrate data from different sources. >>>> >>>> In fact, a DAS/2 server reference implementation is being developed within >>>> the GMOD sourceforge CVS, though it's not officially been released as part >>>> of GMOD. Here are the CVS commit logs for it. >>>> http://sourceforge.net/mailarchive/forum.php?forum_id=42210 >>>> >>>> Other DAS/2 software is also being developed under open source licenses. >>>> See >>>> links on http://biodas.org in the About section, look for "The DAS/2 code >>>> base". >>>> >>>>> I have some initial questions, I was >>>>> wondering if someone could help me out with them (I did read the DAS >>>>> Overview and browsed most of the specs at biodas.org). >>>>> >>>>> 1. Are DAS1 and DAS2 designed to inter-operate? For example, will I be >>>>> able >>>>> to use a DAS2 client and a DAS1 server? >>>> >>>> DAS/2 is a complete redesign of the spec, so direct interoperation is not >>>> possible. However, DAS/2 has all of the capabilities of the DAS/1 spec (and >>>> more!). >>>> >>>> As proof of this, Andrew Dalke is developing a proxy adapter that will >>>> allow >>>> you to put a DAS/2 interface around an existing DAS/1 server, allowing >>>> DAS/2 >>>> clients to interact with existing DAS/1 servers: >>>> http://lists.open-bio.org/pipermail/das2/2006-October/000867.html >>>> >>>> To fully realize 1 <-> 2 interoperation, one would also need to write a >>>> DAS/1 proxy adapter for DAS/2 servers, to permit DAS/1 clients to interact >>>> with DAS/2 servers. I don't know of any plans for that yet. >>>> >>>>> 2. Do you think DAS2 is going to replace DAS1 or co-exist with it? Yes, >>>>> this >>>>> may not be easy to answer. >>>> >>>> The proxy adapter approach should enable some degree of peaceful >>>> co-existence between DAS/1 and DAS/2 systems, and should facilitate the >>>> transition to DAS/2, which has many niceties not present in DAS/1. As far >>>> as >>>> replacing DAS/1, the proof will be in the pudding. >>>> >>>>> 3. Is there a DAS2 release date? >>>> >>>> The DAS/2 schema for retrieval of genomic annotations has been officially >>>> frozen since mid-November (das2_schemas.rnc and das2_schemas.xsd in the >>>> biodas/das/das2 CVS repository). >>>> >>>> The corresponding html version of this spec, viewable from biodas.org, is >>>> soon to be finalized as well (probably by end of next week). When that >>>> happens, DAS/2 for genome retrieval will be considered released. Stay tuned >>>> to this list for an announcement. >>>> >>>> The DAS/2 writeback spec is still under development and I don't believe a >>>> timeframe for it's release has been set. >>>> >>>> Steve >>>> >>> >>> >> > > From Steve_Chervitz at affymetrix.com Thu Dec 7 22:11:00 2006 From: Steve_Chervitz at affymetrix.com (Steve Chervitz) Date: Thu, 07 Dec 2006 19:11:00 -0800 Subject: [DAS2] Notes from the weekly DAS/2 teleconference, 13 Nov 2006 Message-ID: [These are notes from a critical meeting last month. In the frenzy of activity surrounding the freezing of the retrieval spec schema, I had lost track of the notes I took.... until today. -Steve] Notes from the weekly DAS/2 teleconference, 13 Nov 2006 $Id: das2-teleconf-2006-11-13.txt,v 1.1 2006/12/08 03:02:58 sac Exp $ Teleconference Info: * Schedule: Biweekly on Monday * Time of Day: 9:30 AM PST, 17:30 GMT * Dialin (US): 800-531-3250 * Dialin (Intl): 303-928-2693 * Toll-free UK: 08 00 40 49 467 * Toll-free France: 08 00 907 839 * Conference ID: 2879055 * Passcode: 1365 Attendees: Affy: Steve Chervitz, Ed E., Gregg Helt CSHL: Lincoln Stein Dalke Scientific: Andrew Dalke Sanger: Andreas Prlic UAB: Ann Loraine UCLA: Brian O'connor Note taker: Steve Chervitz Action items are flagged with '[A]'. These notes are checked into the biodas.org CVS repository at das/das2/notes/2006. Instructions on how to access this repository are at http://biodas.org DISCLAIMER: The note taker aims for completeness and accuracy, but these goals are not always achievable, given the desire to get the notes out with a rapid turnaround. So don't consider these notes as complete minutes from the meeting, but rather abbreviated, summarized versions of what was discussed. There may be errors of commission and omission. Participants are welcome to post comments and/or corrections to these as they see fit. Agenda: ------- Specification Status of schema (das2_schemas.rnc) Ratification of schema freeze Status of XML Schema translation (das2_schemas.xsd) Formalizing query syntax? Status of genome retrieval specification doc (das2_get.html) Review of remaining issues in genome retrieval spec. Coordinates URIs Segment reference URIs Ontology URIs Revising example queries / responses Timeline for DAS/2 genome retrieval spec freeze. Other docs? Implementation status Validator Genome retrieval servers NetAffx queries responses biopackages queries responses DAS/1 --> DAS/2 conversion server cgi.biodas.org test server Sanger registry others? Example queries Biopackages ontology server Genome retrieval clients IGB queries responses others? Topic: Specification ----------------------- gh: regarding the xid/link changes - no servers were using that, therefore not a major issue. ee: can't use ucla server gh: compliance issues with both servers. sc: was working on re-organizing the html das2 document but got stuck in CVS commit hell (lots of commit activity going on...) gh: we'll focus on that in a few mins. gh: edits to das2 schema except andrew and I. ls: looked over things. questions about html doc, but schema looks good. ee: draft3 dir? ad: draft3 dir are old, should be removed. gh: those are the ones that got combined before creating the das_schemas.rnc ee: did good bit of work on style sheet. not ready to freeze. gh: not concerned about freezing stylesheet gh: any objections? sc: can you reiterate the xid/link stuff? ad: xid element had lots of "should haves". no feedback on this yet. referring to other datatbase, 'false positive'. decided better to not have this, pulled it out. recommend html attribs for link element. gh: human readable tag is important to igb. ad: rnc has examples for reasons to use. features result 'link to rss feed' so you can get new results for that feature. gives freedom to add new kind of links to it. ad: allen here? no bo: no feedback re: freezing the spec. final doc is das2_schemas.rnc? ad: yes. [A] clean out old, obsolete docs in that dir [A] add a link near top of html doc to the schema doc. gh: schemas document is now frozen! opinions on how long it should stay frozen? ad: depends on feedback we get. bo: don't change it at all. ad: errata, 2.1, community gh: can we agree that no changes to it unless discussed on the conf call. all: yes. gh: would like to discuss XML schema translation of the rnc and query syntax when Brian Gilman joins in. Topic: Review status of genome retrieval spec (das2_get.html) -------------------------------------------------------------- gh: looking at CVS commit log from prev week. most of this was to reflect changes in the rnc. gh: 1.35 - done by capabilities now 1.36 - remove reqt to return seq in fasta fmt. want to be able to specify a segments doc but not have to return the residues. also did polishing error responses, server decides when response is too large and sends error messages. 1.38 - started putting in ontology URIs. we had discussions with chris Mungall discussing how to refer to ontology entries via URIs. he said it would happen via NCBO but not until next year. Updated to refer to ontology server that allen and brian (UCLA) are working on. [A] brian/allen (ucla) will work with ncbo on uri access to ontology terms when they're ready related issue: segment reference URIs. we still don't have ref uris for anything but worm and fly. lincoln created at last code sprint. ls: did human and mouse, too. on the wiki. ad: global seq ids wiki doc: http://www.open-bio.org/wiki/DAS:GlobalSeqIDs gh: I was looking at doc checked into CVS. [A] will change examples in spec to start working with these gh: how this relates to registry, uris maintained by andreas. no connection to andreas' registry. ad: ziltch ap: this is concerning the uri for coordinates. gh: this has to connect with a uri that gives these lists of sequences. right now, no way for someone to look at coord uri, or source/version/authority and see which of items in this list of global seq ids to use. they can guess, but there's no formal way to do that now. ap: ok gh: have pointer for each of these sets of segments a pointer to the coord uri at sanger. ap: uri of coord should be resolvable to additional info like organism, version of assembly, etc. ls: diff between uri and gsid gh: gsid not an id for the whole assembly. wait... it is., but is diff from the ones andreas is using. ls: so his registry needs to be updated to use all builds/releases listed on this page. ap: ok. so names can be resolved? ls: all are uri's, some can be resolved, but that's accidental. ap: fine. gh: coordinates element, like everything else, are allowed to have a doc_href, right? so you can have a pointer to a doc that does describe it. ad: nope. uri, taxid, source, auth, version, created, test range gh: some readable page describing coordinate system ad: can either use an extension, or a link ap: link is fine. ad: segments are resolvalble, but reference ones are not. ap: makes sense for the reference coordinate uris e resolvable, too. gh: don't think they need to be resolvable. but it's nice to point to the website of the authority that is owner of that assembly. getting them to put up a resolvable is problematic. ls: not nec a problem, but that it will never break is a problem. I could provide doc_href for each ncbi build, that should be fine. why must the uri resolve to anything? eg, documents to describe build statistics. ad: people only need a unique string. ls: how about a doc_href for each one, and put that in the coord system. ad: in coordinate tag where you supply uri for assembly, there is no space for doc_href. ls: withdraw gh: registry and server must agree on the names used for coordinates. that's all I need. means I need to change my server, ucla, andreas must change registry. ad: changes to that wiki page, adding new assemblies ls: can be done. this gsid page was just a starter. ap: could parse html page to get a list of uris. bo: what needs to be added to biopackages. gh: to have registry know that your ref seq is same as everyone elses, need uri for a given assembly. bo: in v source or v document. there is a coord element that has uri pointing to the assembly uri. gh: segments response, each seg type has a ref attribute to the appropriate uri using these gsids. bo: this is already in there. gh: you're good to go, but the affy server needs updating. [A] gregg/steve update affy server to use the cannonical list of global seq identifiers. Topic: other changes --------------------- gh: cigar strings, added ref to document to quote. need to put in examples of it (alignments). those are the major things that changed. todo: coord, segment, ref ontology uris. revising examples in the spec. architectural re-org of the doc. ee: some places where the lang could be clarified. not changing meaning. ad: ok. sc: doc re-org stuff. described. [A] steve will post message to list when re-org is done gh: "more examples" needed sections. I'll focus on these. target freezing html doc by end of week. aloraine: updating website with all working servers? gh: better to point to registry to say go there. people will then know to contact andreas to get their server there. al: interested in plant das servers. ap: I don't know about these. wrote an email to them to put there servers there. al: does EBI have any? there was a das site associated with ensembl (for plants). the Iowa state das server needs fixing (xml is malformed). [A] Ann will send info about Iowa state das server to Andreas Topic: Implementation status ---------------------------- gh: validator has been helping, is it on lastest rnc? ad: not yet, but it should be easy, just a cvs update. [A] andrew will update to lastest spec gh: impl das2 servers: need changes to affy server to bring into more compliance. all responses passes validator now, but is breaking what it needs re: errors. will coordinate with steve when ready to deploy today or tomorrow. sc: error codes. gh: certain things it can't respond to, but if I throw the right error, it's considered valid. ucla: [A] run responses from biopackages server through andrew's validator when it's updated gh: segment syntax is a full uri bo: biopackages. full uri should be usable, for feat and type filter. when I updated server to fix v/source, I turned off caching. I can't clear out cache completely. there may be old response documents that need to be cleared out. Will leave it off for time being and figure out how to clear out the cache. ad: I have updated schema on the validator. bo: another issue when reading thru rnc/html under ver source. gh: capability type element has to match. would cause igb to fail. bo: will update this. gh: getting servers to pass validator is more important than freezing html spec now. time pressure for Brian doing caBio development. has not servers to hit against, so they need to be back in action ASAP. gh: andrew's das1/2 proxy? ad: das1 to das2 proxy. does it on demand. not publically accessible now. feature conversion was too slow. need to re-write to no longer using feature template. gh: would want to consider putting it on a fast machine. would be a nice thing to have to support all old das1 servers. [A] make das1-2 proxy public ee: not many client use of das2 now, so load should be bad. andreas status of sanger registry. ap: not much work for das2 since code sprint. now that spec is frozen, planning to use andrew's validator when rewriting server. also interested on the das1->2 proxy. gh: could have registry make use of the proxy gh: checked igb using sanger registry, was using recently. not sure if it's passing the validator. gh: lincoln plan for serving hapmap data? ls: import the essential part of data into a hapmap server that brian gilman is writing. then exported data will be brought into a caCore client for re-exportation into the caBig grid. gh: spec freeze helps timeline? ls: brian gilman says he will have das2 client out by later today. he should have joined this teleconf. gh: I worked on xsd schema and talked to him via phone. it is now up to date with frozen rnc spec. can use it to generate java or other programmatic bindings. gh: status of biopackages ontology server, but it is up and running. it serves uri's so it is sufficient for das/2 needs now. genome retrieval clients: [A] gregg needs to see why igb is having problems with biopackages server. am updating local server for local igb testing, will coord with steve to post on public server. ee: don't break it, am doing a presentation to cytoscape folks gh: will get a new server going and keep the old one going gh: will coord with steve Wrapup ------- gh: lots of good progress this week. igb release planned for next mon, when ed will be back. [A] meet next monday to freeze html doc. From ap3 at sanger.ac.uk Fri Dec 8 04:12:58 2006 From: ap3 at sanger.ac.uk (Andreas Prlic) Date: Fri, 8 Dec 2006 09:12:58 +0000 Subject: [DAS2] DAS and DAS2 In-Reply-To: References: Message-ID: To add to the list of DAS clients: * the multiple sequence alignment viewer Jalview now is also a DAS client http://www.jalview.org * the electron microscopy das client PeppeR http://biocomp.cnb.uam.es/das/PeppeR/ and soon the new Pfam website will be released with DAS support. Andreas ----------------------------------------------------------------------- Andreas Prlic Wellcome Trust Sanger Institute Hinxton, Cambridge CB10 1SA, UK +44 (0) 1223 49 6891 From aloraine at gmail.com Fri Dec 8 03:37:13 2006 From: aloraine at gmail.com (Ann Loraine) Date: Fri, 8 Dec 2006 02:37:13 -0600 Subject: [DAS2] question regarding unicode, biopython Seq object, DAS Message-ID: <83722dde0612080037i33884c20jafcb4b24ac7b6815@mail.gmail.com> Hello, I'm attempting to get sequence data from a DAS server (UCSC, DAS1) and am having what appears to be a unicode-related problem - if you have any insights or advice, I'd be grateful for the help. I'm running biopython v. 1.42 on Mac OS X 10.3.9. My sax parser delivers character (sequence) data as unicode, but when I make a Seq object from the unicode string and then try to reverse complement the sequence, I get an exception: TypeError: character mapping must return integer, None or unicode So I tried this: >>> from Bio.Alphabet import IUPAC >>> from Bio.Seq import Seq >>> s = Seq(u'atcg',IUPAC.unambiguous_dna) >>> s.reverse_complement() Traceback (most recent call last): File "", line 1, in ? File "/usr/local/lib/python2.4/site-packages/Bio/Seq.py", line 117, in reverse_complement s = self.data[-1::-1].translate(ttable) TypeError: character mapping must return integer, None or unicode >>> s = Seq('atcg',IUPAC.unambiguous_dna) # note: no longer unicode >>> s.reverse_complement() Seq('cgat', IUPACUnambiguousDNA()) An example access of the UCSC DAS1 site follows. In my code I'm using a SAX parser to get the data, but this demonstrates a bit of how the DAS aspect works: >>> u = 'http://genome.cse.ucsc.edu/cgi-bin/das/hg17/dna?segment=1:158288275,158302415' >>> import urllib >>> fh = urllib.urlopen(u) >>> fh.readline() '\n' >>> fh.readline() '\n' >>> fh.readline() '\n' >>> fh.readline() '\n' >>> fh.readline() 'gtctcttaaaacccactggacgttggcacagtgctgggatgactatggag\n' ...and etc. Yours, Ann -- Ann Loraine Assistant Professor Departments of Genetics, Biostatistics, and Section on Statistical Genetics University of Alabama at Birmingham http://www.ssg.uab.edu http://www.transvar.org From bosborne11 at verizon.net Sat Dec 9 12:20:12 2006 From: bosborne11 at verizon.net (Brian Osborne) Date: Sat, 09 Dec 2006 12:20:12 -0500 Subject: [DAS2] DAS and DAS2 In-Reply-To: Message-ID: Steve, DAS is one of the GMOD-related packages that I'm working on already as part of the GMOD Help Desk. So what I'm doing is putting together a proposal that will have sections like "Proposed New Documentation" and "Proposed Changes in Existing Documentation" and "Proposed Web Site Changes" for each of these GMOD-related packages. This should be done in a week or so. I will show it to you and we can talk about it. Mind you, these are _proposals_, not _dictates_. Then I can help with the Wiki as well. Brian O. On 12/7/06 6:42 PM, "Steve Chervitz" wrote: > If anyone is interested in helping with the migration, let me know. Anyone > who has suggestions for how to organize the site, just post them to this > list. From aloraine at gmail.com Sat Dec 9 13:39:16 2006 From: aloraine at gmail.com (Ann Loraine) Date: Sat, 9 Dec 2006 12:39:16 -0600 Subject: [DAS2] question about id searching Message-ID: <83722dde0612091039u2509d2d5x49713109ee376d4e@mail.gmail.com> Sorry if this is just a repeat of an older discussion - but maybe there have been some new developments? I'm working with a postdoc who wants to query a genome database using gene ids. He wants to grab all the gene ids in regions of varying sizes centered on his main gene. He needs to do this many times for a simulation study, so a click-based interface wouldn't be feasible. Is there a service that could do something like this? Yours, Ann -- Ann Loraine Assistant Professor Departments of Genetics, Biostatistics, and Section on Statistical Genetics University of Alabama at Birmingham http://www.ssg.uab.edu http://www.transvar.org From aloraine at gmail.com Sat Dec 9 13:35:23 2006 From: aloraine at gmail.com (Ann Loraine) Date: Sat, 9 Dec 2006 12:35:23 -0600 Subject: [DAS2] fyi - jalview Message-ID: <83722dde0612091035i3280440fn440420fdc87cc6c7@mail.gmail.com> Hi, Just in case you haven't seen this: www.jalview.org Apparentently jalview can talk to DAS servers. It also can run multiple alignments on a server and display results in the viewer. I just used it for a project and to make figures for a talk. It's very nice! -Ann -- Ann Loraine Assistant Professor Departments of Genetics, Biostatistics, and Section on Statistical Genetics University of Alabama at Birmingham http://www.ssg.uab.edu http://www.transvar.org From jimp at compbio.dundee.ac.uk Mon Dec 11 05:04:52 2006 From: jimp at compbio.dundee.ac.uk (James Procter) Date: Mon, 11 Dec 2006 10:04:52 +0000 Subject: [DAS2] fyi - jalview In-Reply-To: <83722dde0612091035i3280440fn440420fdc87cc6c7@mail.gmail.com> References: <83722dde0612091035i3280440fn440420fdc87cc6c7@mail.gmail.com> Message-ID: <457D2D44.6010305@compbio.dundee.ac.uk> Hi All. Just thought I'd step out of the shadows, and say Hi - since I've been lurking on the DAS/2 list for a year or so now :) Ann Loraine wrote: > www.jalview.org > > Apparentently jalview can talk to DAS servers. It also can run > multiple alignments on a server and display results in the viewer. Jalview does DAS/1 annotation retrieval using Andreas's dasobert library, and we pick up the XML registry list document from dasregistry.org. > I just used it for a project and to make figures for a talk. It's very nice! Any suggestions are very welcome! We'd like to be able to do a bit more than the basic 'visualize features on a sequence' DAS client behaviour, and that's why we are watching and learn from you guys! cheers. Jim Procter -- ------------------------------------------------------------------- J. B. Procter (VAMSAS Project) Barton Bioinformatics Research Group Phone/Fax:+44(0)1382 388734/345764 http://www.compbio.dundee.ac.uk From aloraine at gmail.com Tue Dec 12 23:11:43 2006 From: aloraine at gmail.com (Ann Loraine) Date: Tue, 12 Dec 2006 22:11:43 -0600 Subject: [DAS2] TIGR test rice DAS server Message-ID: <83722dde0612122011k76046881pde207e92125e2e68@mail.gmail.com> FYI: http://www.tigr.org/docs/tigr-scripts/tgi/das/dsn and http://rice.tigr.org/tdb/e2k1/osa1/irgsp/DAS.shtml I haven't tested it with IGB yet. -Ann -- Ann Loraine Assistant Professor Departments of Genetics, Biostatistics, and Section on Statistical Genetics University of Alabama at Birmingham http://www.ssg.uab.edu http://www.transvar.org From Steve_Chervitz at affymetrix.com Mon Dec 18 13:33:56 2006 From: Steve_Chervitz at affymetrix.com (Steve Chervitz) Date: Mon, 18 Dec 2006 10:33:56 -0800 Subject: [DAS2] Notes from the weekly DAS/2 teleconference, 18 Dec 2006 Message-ID: Notes from the weekly DAS/2 teleconference, 18 Dec 2006 $Id: das2-teleconf-2006-12-18.txt,v 1.3 2006/12/18 18:30:56 sac Exp $ Teleconference Info: * Schedule: Biweekly on Monday * Time of Day: 9:30 AM PST, 17:30 GMT * Dialin (US): 800-531-3250 * Dialin (Intl): 303-928-2693 * Toll-free UK: 08 00 40 49 467 * Toll-free France: 08 00 907 839 * Conference ID: 2879055 * Passcode: 1365 Attendees: Affy: Steve Chervitz, Gregg Helt UCLA: Allen Day, Brian O'connor Note taker: Steve Chervitz Action items are flagged with '[A]'. These notes are checked into the biodas.org CVS repository at das/das2/notes/2006. Instructions on how to access this repository are at http://biodas.org DISCLAIMER: The note taker aims for completeness and accuracy, but these goals are not always achievable, given the desire to get the notes out with a rapid turnaround. So don't consider these notes as complete minutes from the meeting, but rather abbreviated, summarized versions of what was discussed. There may be errors of commission and omission. Participants are welcome to post comments and/or corrections to these as they see fit. Agenda ------- * Global Seq IDs * Status reports Topic: Global Seq IDs: ---------------------- gh: re: global seq ids. would like a page in das2 sources as an xml format. then we could have this list in the das2 registry so you could go and look things up rather than just an HTML format. ee: good. them html could maybe be generated out of html gh: yes. now it's a wiki page, makes it complicated. aday: wanted to do a similar thing, automatically process the data. I have a wiki text parser, partially implemented. gh: autogenerates from a template somewhere? aday: a wikitext parser, given a wikitext DOM, you can do what you need to. can generate something from wikitext rather than put xml into the wiki. [A] Allen will help XMLify the das2 global seq IDs wiki page Topic: Status reports ---------------------- gh: new hardware for affy das2 server, formal paperwork done, should get it by end of this week. new year, we'll begin working on setting it up. will allow us to support more organisms, arrays, and genome versions. 32g memory. Other work: last teleconf we talked about serving up affy transcriptome data via das/2. Have talked to Tom Gingeras about getting their data as plots on a das/2 server. still need to consider what formats to support. netCDF? aday: not using now but know how. gh: currently in bar format, but would like to consider moving to another efficient format. a plugin to the das2 server that doesn't hold stuff into memory. too much data. phase 3 whole genome in 5bp resolution, 8 cell lines, 3 replicates. lots of data. indexing scheme to the bar format used internally in transcriptome group. can grab slices of the data quickly. aday: lots of programming overhead to creating a netCDF file. lots of initialization of the matrix you have to do. loading data in, have to be aware of how you created the matrix. can only grow along one dimension. loading needs to be aware of expected growth plan. gh: splicing returns a self-contained bar file for each slice. could be a self-contained netCDF file for each slice. aday: ok. in the order that makes sense for each display. a few dozen lines to get the thing set up. also, must write file to disk, can't deal with it in memory only. didn't like. especially when reading. have to grab it, download to disk, then open it. brian o'connor can elaborate re: client side. I ran into it on server side as well. bo: look in assay package for igb codebase or the hyrax client codebase. haven't been using it for a while. biggest pain is where to write a temp file given the OS/platform. gh: continuing my status: IGB release 3 weeks ago, a few problems with enhancements to read CHP files (affy std for programs that generate expression data files). need to do another release to address these problems (tomorrow expected). Also, caching problems with igb given full URIs for segments, types in das/2 feat queries, file names are now too long for some OSs. used steve's suggestion of md5 digest on it. reverse lookup won't work, but not an issue now. Can now turn back on full uri for types and segments in feat queries, so it should be able to work with biopackages server. gh: will be a different genome per server. need to resolve this (resolution of each genome). Need to move to the proper das/2 approved way. working with affy server to loosen restriction on allowed queries. also some work on editing html docs. ee: igb release. working on igb manual. now several versions out of data. First part: going thru existing manual, fixing things not currently correct. Second part: going thru release notes and incorporating new things. Working on first part now. Second part by later this week. aday: nothing to report. funding did come through to CSHL this week. fine now. gh: sorry for the lapse. sc: fixed 502 gateway error (mod_proxy tweak). HTML retrieval spec docs fixups. wikification of biodas.org with Andreas Prlic. [A] gregg will do his html das/2 retrieval spec fixes by end of week. gh: (regarding the apache complaint about a bad header from the das/2 server). Looking at the http specs, header has: http version, status code, optionally text. that's the only line that doesn't need a colon. maybe i'm not putting http version at the start of the lines. gh: on track for devoting most of Jan to das work? sc: at least half. will know more this week. bo: not much das/2 work, focussing on graduating! worked on biopackages build process. automated build process for building rpms. that has been completed. build farm fc2, fc5, sunos, i386/686. allows us to build binaries for the das server for different target platforms and managing dependencies. can do this for the das/2 server. One server, uses VMware to run various distributions as virtual hosts to do the builds. Other topics: -------------- bo: how as response been to frozen spec? gh: brian G and lincoln are happier. haven't heard from anyone else. would like to hear from folks in England. we haven't advertised it except on the list. top priority was helping brian and lincoln (NCI) statisfied that they can use it. that has gone well. lincoln was reporting 2 weeks ago that things were going well with brian's work. looking for server to serve up hapmap data. has client library in place. was having problems with feat requests, we responded, haven't heard back. Hopefully we'll hear from them next year. [A] Next das2 teleconf: 8 Jan 2007 From lstein at cshl.edu Mon Dec 18 14:10:16 2006 From: lstein at cshl.edu (Lincoln Stein) Date: Mon, 18 Dec 2006 19:10:16 +0000 Subject: [DAS2] Fwd: Can't make meeting today In-Reply-To: References: Message-ID: <6dce9a0b0612181110y1f56a320xe5ae5afec9f999b2@mail.gmail.com> Hi Folks, Doubly sorry, my apology bounced. Lincoln ---------- Forwarded message ---------- From: das2-owner at lists.open-bio.org Date: Dec 18, 2006 7:00 PM Subject: Can't make meeting today To: lincoln.stein at gmail.com You are not allowed to post to this mailing list, and your message has been automatically rejected. If you think that your messages are being rejected in error, contact the mailing list owner at das2-owner at lists.open-bio.org. ---------- Forwarded message ---------- From: "Lincoln Stein" To: "DAS/2 Discussion" Date: Mon, 18 Dec 2006 11:01:51 -0500 Subject: Can't make meeting today Hi Guys, I'm afraid I'll be missing today's meeting due to a guest seminar at noon. I have not much to report except that Brian Gilman has finished his work on the NCI DAS2 plugin and will be demoing it to the NCI folk tomorrow. Please make sure that the biopackages and affymetrix servers are up tomorrow morning (EST)! Lincoln -- Lincoln D. Stein Cold Spring Harbor Laboratory 1 Bungtown Road Cold Spring Harbor, NY 11724 (516) 367-8380 (voice) (516) 367-8389 (fax) FOR URGENT MESSAGES & SCHEDULING, PLEASE CONTACT MY ASSISTANT, SANDRA MICHELSEN, AT michelse at cshl.edu -- Lincoln D. Stein Cold Spring Harbor Laboratory 1 Bungtown Road Cold Spring Harbor, NY 11724 (516) 367-8380 (voice) (516) 367-8389 (fax) FOR URGENT MESSAGES & SCHEDULING, PLEASE CONTACT MY ASSISTANT, SANDRA MICHELSEN, AT michelse at cshl.edu From Gregg_Helt at affymetrix.com Sat Dec 30 16:43:41 2006 From: Gregg_Helt at affymetrix.com (Helt,Gregg) Date: Sat, 30 Dec 2006 13:43:41 -0800 Subject: [DAS2] No DAS/2 teleconference this Monday, rescheduled for Jan 8th Message-ID: Just wanted to let everyone know that the next DAS/2 teleconference has been rescheduled for Monday January 8th, 9:30 AM PST. It was originally scheduled for Monday Jan 1, but it's a day off for many. thanks, Gregg