From p.j.a.cock at googlemail.com  Tue May  3 05:24:08 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 3 May 2011 10:24:08 +0100
Subject: [BioRuby] Interesting BLAST 2.2.25+ XML behaviour
In-Reply-To: <BANLkTi=6_2bFpGhOwxtdjy-DzxUotVWxEg@mail.gmail.com>
References: <BANLkTi=6_2bFpGhOwxtdjy-DzxUotVWxEg@mail.gmail.com>
Message-ID: <BANLkTinH0y4KQ7_AXt7Ly3TgN9fXxErUzA@mail.gmail.com>

Hello all,

I've CC'd the BioPerl, BioRuby, BioJava and Biopython development mailing
lists to make sure you're aware of this, but can we continue any discussion
on the cross-project open-bio-l mailing list please?

I noticed that recent versions of BLAST are not using a single <iteration>
block for each query, which was the historical behaviour and assumed
by the Biopython BLAST XML parser. This may be a bug in BLAST.
See link below for an example.

Has anyone else noticed this, and has it been reported to the NCBI yet?

Thanks,

Peter

(Not for the first time, I wish there was a public bug tracker for BLAST,
or at least a private bug tracker so we could talk about issues with an
NCBI assigned reference number.)

---------- Forwarded message ----------
From: Peter Cock <p.j.a.cock at googlemail.com>
Date: Wed, Apr 20, 2011 at 6:08 PM
Subject: Interesting BLAST 2.2.25+ XML behaviour
To: Biopython-Dev Mailing List <biopython-dev at biopython.org>


Hi all,

Have a look at this XML file from a FASTA vs FASTA search
using blastp from ?BLAST 2.2.25+ (current release), which
is a test file I created for the BLAST+ wrappers in Galaxy:

https://bitbucket.org/galaxy/galaxy-central/src/8eaf07a46623/test-data/blastp_four_human_vs_rhodopsin.xml

I just put it though the Biopython BLAST XML parser, and
was surprised not to get four records back (since as you
might guess from the filename, there were four queries).

It appears this version of BLAST+ is incrementing the
iteration counter for each match... or something like that.

Has anyone else noticed this? I wonder if it is accidental...

Peter


From cjfields at illinois.edu  Tue May  3 09:31:55 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 3 May 2011 08:31:55 -0500
Subject: [BioRuby] Interesting BLAST 2.2.25+ XML behaviour
In-Reply-To: <BANLkTinH0y4KQ7_AXt7Ly3TgN9fXxErUzA@mail.gmail.com>
References: <BANLkTi=6_2bFpGhOwxtdjy-DzxUotVWxEg@mail.gmail.com>
	<BANLkTinH0y4KQ7_AXt7Ly3TgN9fXxErUzA@mail.gmail.com>
Message-ID: <398303E2-1195-4CC2-8B73-09C6C1117892@illinois.edu>

Haven't tried this using the latest BLAST+ myself, but it doesn't surprise me too much.  Also agree re: some kind of bug tracking with NCBI; I believe they have an internal one, but it would be nice to have a public interface to it.

chris

On May 3, 2011, at 4:24 AM, Peter Cock wrote:

> Hello all,
> 
> I've CC'd the BioPerl, BioRuby, BioJava and Biopython development mailing
> lists to make sure you're aware of this, but can we continue any discussion
> on the cross-project open-bio-l mailing list please?
> 
> I noticed that recent versions of BLAST are not using a single <iteration>
> block for each query, which was the historical behaviour and assumed
> by the Biopython BLAST XML parser. This may be a bug in BLAST.
> See link below for an example.
> 
> Has anyone else noticed this, and has it been reported to the NCBI yet?
> 
> Thanks,
> 
> Peter
> 
> (Not for the first time, I wish there was a public bug tracker for BLAST,
> or at least a private bug tracker so we could talk about issues with an
> NCBI assigned reference number.)
> 
> ---------- Forwarded message ----------
> From: Peter Cock <p.j.a.cock at googlemail.com>
> Date: Wed, Apr 20, 2011 at 6:08 PM
> Subject: Interesting BLAST 2.2.25+ XML behaviour
> To: Biopython-Dev Mailing List <biopython-dev at biopython.org>
> 
> 
> Hi all,
> 
> Have a look at this XML file from a FASTA vs FASTA search
> using blastp from  BLAST 2.2.25+ (current release), which
> is a test file I created for the BLAST+ wrappers in Galaxy:
> 
> https://bitbucket.org/galaxy/galaxy-central/src/8eaf07a46623/test-data/blastp_four_human_vs_rhodopsin.xml
> 
> I just put it though the Biopython BLAST XML parser, and
> was surprised not to get four records back (since as you
> might guess from the filename, there were four queries).
> 
> It appears this version of BLAST+ is incrementing the
> iteration counter for each match... or something like that.
> 
> Has anyone else noticed this? I wonder if it is accidental...
> 
> Peter
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby



From pjotr.public14 at thebird.nl  Wed May  4 07:51:51 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Wed, 4 May 2011 13:51:51 +0200
Subject: [BioRuby] Interesting BLAST 2.2.25+ XML behaviour
In-Reply-To: <398303E2-1195-4CC2-8B73-09C6C1117892@illinois.edu>
References: <BANLkTi=6_2bFpGhOwxtdjy-DzxUotVWxEg@mail.gmail.com>
	<BANLkTinH0y4KQ7_AXt7Ly3TgN9fXxErUzA@mail.gmail.com>
	<398303E2-1195-4CC2-8B73-09C6C1117892@illinois.edu>
Message-ID: <20110504115151.GA12003@thebird.nl>

Something also rather odd. Can you imagine that a basic BLAST
lesson would make it into PLoS Biology?

PLoS Biology states: the journal features works of exceptional
significance, originality, and relevance in all areas of biological
science, from molecules to ecosystems, including works at the
interface of other disciplines, such as chemistry, medicine, and
mathematics. 

Well, so much for that. Check out a copy of the BLAST help page, as
published in PLoS Biology:

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3032543/

I checked the date. It is not April 1st. It ticks, however, the
relevance box. But I am not sure about its significance. It is
certainly not original. Where are we heading? Can we start submitting
man pages now?

Pj.

On Tue, May 03, 2011 at 08:31:55AM -0500, Chris Fields wrote:
> Haven't tried this using the latest BLAST+ myself, but it doesn't surprise me too much.  Also agree re: some kind of bug tracking with NCBI; I believe they have an internal one, but it would be nice to have a public interface to it.
> 
> chris
> 
> On May 3, 2011, at 4:24 AM, Peter Cock wrote:
> 
> > Hello all,
> > 
> > I've CC'd the BioPerl, BioRuby, BioJava and Biopython development mailing
> > lists to make sure you're aware of this, but can we continue any discussion
> > on the cross-project open-bio-l mailing list please?
> > 
> > I noticed that recent versions of BLAST are not using a single <iteration>
> > block for each query, which was the historical behaviour and assumed
> > by the Biopython BLAST XML parser. This may be a bug in BLAST.
> > See link below for an example.
> > 
> > Has anyone else noticed this, and has it been reported to the NCBI yet?
> > 
> > Thanks,
> > 
> > Peter
> > 
> > (Not for the first time, I wish there was a public bug tracker for BLAST,
> > or at least a private bug tracker so we could talk about issues with an
> > NCBI assigned reference number.)
> > 
> > ---------- Forwarded message ----------
> > From: Peter Cock <p.j.a.cock at googlemail.com>
> > Date: Wed, Apr 20, 2011 at 6:08 PM
> > Subject: Interesting BLAST 2.2.25+ XML behaviour
> > To: Biopython-Dev Mailing List <biopython-dev at biopython.org>
> > 
> > 
> > Hi all,
> > 
> > Have a look at this XML file from a FASTA vs FASTA search
> > using blastp from  BLAST 2.2.25+ (current release), which
> > is a test file I created for the BLAST+ wrappers in Galaxy:
> > 
> > https://bitbucket.org/galaxy/galaxy-central/src/8eaf07a46623/test-data/blastp_four_human_vs_rhodopsin.xml
> > 
> > I just put it though the Biopython BLAST XML parser, and
> > was surprised not to get four records back (since as you
> > might guess from the filename, there were four queries).
> > 
> > It appears this version of BLAST+ is incrementing the
> > iteration counter for each match... or something like that.
> > 
> > Has anyone else noticed this? I wonder if it is accidental...
> > 
> > Peter
> > 
> > _______________________________________________
> > BioRuby Project - http://www.bioruby.org/
> > BioRuby mailing list
> > BioRuby at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioruby
> 
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
> 

From rutgeraldo at gmail.com  Tue May 10 09:43:22 2011
From: rutgeraldo at gmail.com (Rutger Vos)
Date: Tue, 10 May 2011 14:43:22 +0100
Subject: [BioRuby] Announcement: Registration open for Computational
	Phyloinformatics course
Message-ID: <BANLkTimmEpW+22Es4uw8-xSsiatnBx678A@mail.gmail.com>

COMPUTATIONAL PHYLOINFORMATICS
August 1 2011 through August 11 2011
Bioinformatics Center of Kyoto University
Application Deadline:  May 31, 2011

http://academy.nescent.org/wiki/Computational_phyloinformatics

Computational Phyloinformatics is an 11-day international course
(August 1-11, 2011) co-organized by the Computational Biology Research
Center (CBRC/AIST), the Bioinformatics Center of Kyoto University, the
Database Center for Life Science (DBCLS/JST), and the National
Evolutionary Synthesis Center (NESCent).  This course, which will take
place at Kyoto University directly following the SMBE Meeting
(http://smbe2011.com/), aims to give participants practical knowledge
and hands-on skills in phyloinformatics.

The venue in Kyoto is completely unaffected by the unfortunate events
in Fukushima and the power shortages in Tokyo. We encourage biologists
from other countries to participate in the SMBE meeting and/or this
special international course, in solidarity with the scientific
community of Japan in their effort to return to normalcy and to help
minimize any negative impacts that the earthquake may have on
scientific activities in Japan.

SYNOPSIS
Biologists are faced with ever-larger datasets, more complex
evolutionary models, and increasingly elaborate analytical methods.
Seldom is it sufficient to run a dataset with an off-the-shelf program
on a desktop PC; increasingly, biologists need to write scripts to
interface with internet services and databases, build analytical
pipelines, customize analyses, and distribute computation over
multiple processors.  This course is designed for graduate students,
postdocs, faculty, and researchers in phylogenetics interested in
receiving practical, hands-on training in the use of Perl and SQL for
workflows and applications in phyloinformatics.

The course is divided into four parts:

PART I: A tutorial review of Perl, including object oriented
programming and building packages.

PART II: Introduction and practical use of BioPerl and Bio::Phylo,
(e.g. scripting for large tree inference engines, automating model
testing, genomic-scale data mining and acquisition, supertree
assembly, rate smoothing and branch calibration, tree traversal, etc).

PART III: Introduction and practical use of BioRuby for molecular
evolution and functional genomics  (e.g. scripting multiple sequence
alignment, gene duplication inference, tree inference, etc.).

PART IV: Introduction to SQL and database design; computing and
querying nested sets and transitive closure; querying both large trees
(e.g. NCBI) and large collections of trees (e.g. TreeBASE).

Participants  will learn how to write basic phylogenetic or
comparative analysis scripts, parse NEXUS files, traverse and compute
over trees, and make practical use of phylogenetic software libraries.
 These skills will be learned in a biological context, touching on a
diverse array of topics such as analysis of large datasets, automation
of supertree assembly, querying for topological patterns in large
collections of trees, etc. Participants will leave the course with a
full set of installations and libraries on their computer ready to
build phyloinformatic workflows for their own research projects, as
well as continued access to a 50+ page wiki "textbook" containing
step-by-step instructions, problem sets, and examples.

INSTRUCTORS AND COURSE ORGANIZERS
Christian Zmasek, Karen Cranston, Rutger A. Vos, Susumu Goto, Toshiaki
Katayama, William H. Piel

APPLICATION DEADLINE
May 31, 2011

TUITION
?40,000 (~$500)

Participants are responsible for their own travel costs, including
transportation and accommodation -- see the website for more
information. International participants will benefit by combining
attendance with the 2011 SMBE meeting. A limited number of travel
scholarships from NESCent are available for US-based students.
Preference will be given to students from under-represented
minorities.

SUBSIDIES AND SCHOLARSHIPS
A limited number of travel scholarships from NESCent are available for
US-based students. Preference will be given to students from
under-represented minorities.

The Asia-Pacific Bioinformatics Network (APBioNet) is happy to provide
travel assistance for a limited number of students/early career
researchers from the Asia-Pacific region. Applicants are requested to
contact Dr Asif Khan, APBioNet Secretariat: asif -$- bic.nus.edu.sg
(replace -$- with @) for details.

PREREQUISITES

BIOLOGY: A good understanding of phylogenetics ? for example, having
already taken the Workshop on Molecular Evolution
(http://www.molecularevolution.org/) or equivalent coursework or
experience.

COMPUTING: Prior experience with Perl or careful study of the
suggested reading materials in advance of the class (see web site).
Participants should have some experience with basic Unix shell
commands.

EQUIPMENT: Participants are expected to bring their own Mac OSX
computer or a LINUX computer, else they will be provided with an iMac.
Participants who cannot bring their own computer and will be using a
supplied iMac, should consider bringing their own portable
firewire/usb drive so that they can also leave the course with a full
suite of phyloinformatic software tools.

-- 
Dr. Rutger A. Vos
School of Biological Sciences
Philip Lyle Building, Level 4
University of Reading
Reading
RG6 6BX
United Kingdom
Tel: +44 (0) 118 378 7535
http://www.nexml.org
http://rutgervos.blogspot.com


From bonnal at ingm.org  Thu May 12 07:42:39 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Thu, 12 May 2011 13:42:39 +0200
Subject: [BioRuby] Update bio-ngs, bio-gem and GSoC
Message-ID: <9738531A-A9E5-4BCD-BC4F-76EAC98BE86D@ingm.org>

Dear All,
this is an update on our activities biongs, biogem and GSoC
As you already know, BioRuby has one project accepted:
bio-objects http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Represent_bio-objects_and_related_information_with_images, Michal is the student assigned to this project.
The other candidate student Ales wants to work on his proposal bioruby wrapper http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#BioRuby_Wrapper_for_Command_line_application
To optimize the time I think that we can fix a weekly meeting before or after the thursday BioRuby IRC meeting writing directly into bioruby's channel, obviously the students can write on ml and contact the mentors by irc,skype,ml etc... I think that this approach is useful also for other bioruby devs to be up to date and take part in the GSoC, because an idea/opinion is better than nothing, so your contribute is appreciated.

bio-gem: 
* I added the possibility to create an embedded database when you create a gem, some code has been borrowed from Rails and adapted to our needs
https://github.com/helios/bioruby-gem/tree/db_tasks
I'll merge this branch (db_tasks) in master, next week
Docs improved.

* rails_engines is working but not yet in master


bio-ngs & related subproject (bwa, samtools)
* wrapper is more robust now
* samtools now can be used directly from the binding https://github.com/helios/bioruby-samtools or from the wrapper. Why ? Because not all the functionalities have been bound, some time it's too complicated (see merge) So I wrote the wrapper https://github.com/helios/bioruby-ngs/blob/master/lib/bio/appl/ngs/samtools.rb
** samtools now is not shipped with precompiled library anymore, now it downloads and compiles the l library for the hist OS during the gem install ... I think that when possible we'll follow this approach.
** ricardo and dan agreed with us to have a common repository, working in that direction...
* Francesco did a great job with bwa and implementing Homology and Ontology classes and tasks to work with homology searches (i.e. blast) and Gene Ontology datasets for annotations and functional analysis. All these classes work 
with a dedicated database to store and manipulate the data.


Our abstract has been accepted for a BOSC talk, we are very happy because BioRuby will the @BOSC another time, it's a great chance to meet you and share thoughts with guys from other bio* projects.
You can download the abstract here: http://dl.dropbox.com/u/16636340/bioruby-ngs_BOSC-2011-FS-TKTYM-13-04-11-Final.pdf
They asked to talk about biogem and parallel processing as well :-) As above great chance to share ideas and experience.
We'll be @ISMB as well with 2 posters (actually we'll have a poster @BOSC too)


In these days I'm working on implementing a bio-gex class to handle gene expression datasets, it uses statsample (Claudio) to handle matrixes etc.., mostly coming from rnaseq ngs(priority) and from rtpcr, https://github.com/helios/bioruby-gex. It's an experiment but I think it could be useful, it's not a R replacement. The repo: https://github.com/helios/bioruby-gex

TODO
* write a lot of test on biongs
* refactor
* generalize some taks because we are developing them from our day by day work so it inevitably that we (mostly me, because Francesco is more precise than me :-) ) write biased code
* ....

Just a reminder for every one,  if you are going to create a new gem for bioruby please try to follow bioruby's original namespace this will help core developers to integrate plugin's code into the main repository if needed.

Cheers.

--
The only change to succeed is starting from a simple thing.


From philipp.comans at googlemail.com  Fri May 13 11:50:06 2011
From: philipp.comans at googlemail.com (Philipp Comans)
Date: Fri, 13 May 2011 17:50:06 +0200
Subject: [BioRuby] Discontiguous Megablast from BioRuby
Message-ID: <46DBDF1DDBBB429D9372E3D815A15F72@googlemail.com>

Hi everyone,

I would like to perform a discontiguous megablast against a local blast database using Bio::Blast.
As I understand, BioRuby 1.4.1 uses blastall from the legacy blast toolkit. This version does not support dc-megablast although I could be mistaken.
Is it possible to perform a dc-megablast from BioRuby? Is there a way to call blastn from the new blast+ toolkit?

Any help would be greatly appreciated!

Best,

Philipp 

From email2ants at gmail.com  Mon May 16 05:07:47 2011
From: email2ants at gmail.com (Anthony Underwood)
Date: Mon, 16 May 2011 10:07:47 +0100
Subject: [BioRuby] Bio::Sequence and Bio::Sequence::NA
Message-ID: <6226C785-DF3B-45BA-887A-DD80AAEBFACD@gmail.com>

Here's something that has alway puzzled me about BioRuby

If I start with a Bio::EMBL object and want to extract the features I can do the following

biosequence = embl_object.to_biosequence

This returns an instance of a Bio::Sequence class. I can now access the features

features = biosequence.features

However if the sequence is nucleotide and I want to translate it I have to do the following

biosequence.na 

OR

biosequence = biosequence.auto


This returns a Bio::Sequence::NA instance and I can now translate

protein = biosequence.translate(1,11)


Why can I not now get at the features

biosequence.features #=> undefined method `features' for #<Bio::Sequence::NA:0x00000100cae5f8>


I would have though that after converting to Bio::Sequence::NA or Bio::Sequence:AA the methods available to Bio::Sequence should still be available.

Can anyone tell me what's going on here. Is there another method I should use?


Thanks

Anthony

From ktym at hgc.jp  Mon May 16 21:33:41 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Tue, 17 May 2011 10:33:41 +0900
Subject: [BioRuby] Bio::Sequence and Bio::Sequence::NA
In-Reply-To: <6226C785-DF3B-45BA-887A-DD80AAEBFACD@gmail.com>
References: <6226C785-DF3B-45BA-887A-DD80AAEBFACD@gmail.com>
Message-ID: <B446AF2E-B479-48D7-B07C-8875E05A42DE@hgc.jp>

Hi Anthony,

Bio::Sequence is a generic container class for a sequence with features which was
introduced relatively recently for interconversion of Bio::GenBank, Bio::EMBL and
Bio::SQL sequence objects (and it also provides common APIs for those seq objects).

Bio::Sequence#na or #auto method extract a sequence from a Bio::Sequence object, so
you should use another variable to store (instead of overriding the object reference).

> biosequence = biosequence.auto

seq = biosequence.auto

so that you can still access to biosequence.features.

% bioruby
bioruby> embl = Bio::EMBL.new(open("http://togows.dbcls.jp/entry/embl/J00231").read)
bioruby> embl.class
  ==> Bio::EMBL
bioruby> embl_bioseq = embl.to_biosequence
bioruby> embl_bioseq.class
  ==> Bio::Sequence
bioruby> embl_seq = embl_bioseq.auto
bioruby> embl_seq.class
  ==> Bio::Sequence::NA

Toshiaki


On 2011/05/16, at 18:07, Anthony Underwood wrote:

> Here's something that has alway puzzled me about BioRuby
> 
> If I start with a Bio::EMBL object and want to extract the features I can do the following
> 
> biosequence = embl_object.to_biosequence
> 
> This returns an instance of a Bio::Sequence class. I can now access the features
> 
> features = biosequence.features
> 
> However if the sequence is nucleotide and I want to translate it I have to do the following
> 
> biosequence.na 
> 
> OR
> 
> biosequence = biosequence.auto
> 
> 
> This returns a Bio::Sequence::NA instance and I can now translate
> 
> protein = biosequence.translate(1,11)
> 
> 
> Why can I not now get at the features
> 
> biosequence.features #=> undefined method `features' for #<Bio::Sequence::NA:0x00000100cae5f8>
> 
> 
> I would have though that after converting to Bio::Sequence::NA or Bio::Sequence:AA the methods available to Bio::Sequence should still be available.
> 
> Can anyone tell me what's going on here. Is there another method I should use?
> 
> 
> Thanks
> 
> Anthony
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby



From email2ants at gmail.com  Tue May 17 16:06:37 2011
From: email2ants at gmail.com (Anthony Underwood)
Date: Tue, 17 May 2011 21:06:37 +0100
Subject: [BioRuby] Bio::Sequence and Bio::Sequence::NA
In-Reply-To: <B446AF2E-B479-48D7-B07C-8875E05A42DE@hgc.jp>
References: <6226C785-DF3B-45BA-887A-DD80AAEBFACD@gmail.com>
	<B446AF2E-B479-48D7-B07C-8875E05A42DE@hgc.jp>
Message-ID: <BANLkTim_SwZ0LKCdS8_jLdZiGBLCiOivGA@mail.gmail.com>

Dear Toshiaki

Thank you for your reply.

I have just tested your code below and all worked OK. I have
found unexpectedly that embl_bioseq.translate works even though
embl_bioseq.methods does not list translate as an available method.
What extra methods does a Bio::Sequence::NA object instantiated using the
auto method give?

Thanks again for your advice, Anthony

On 17 May 2011 02:33, Toshiaki Katayama <ktym at hgc.jp> wrote:

> Hi Anthony,
>
> Bio::Sequence is a generic container class for a sequence with features
> which was
> introduced relatively recently for interconversion of Bio::GenBank,
> Bio::EMBL and
> Bio::SQL sequence objects (and it also provides common APIs for those seq
> objects).
>
> Bio::Sequence#na or #auto method extract a sequence from a Bio::Sequence
> object, so
> you should use another variable to store (instead of overriding the object
> reference).
>
> > biosequence = biosequence.auto
>
> seq = biosequence.auto
>
> so that you can still access to biosequence.features.
>
> % bioruby
> bioruby> embl = Bio::EMBL.new(open("
> http://togows.dbcls.jp/entry/embl/J00231").read)
> bioruby> embl.class
>  ==> Bio::EMBL
> bioruby> embl_bioseq = embl.to_biosequence
> bioruby> embl_bioseq.class
>  ==> Bio::Sequence
> bioruby> embl_seq = embl_bioseq.auto
> bioruby> embl_seq.class
>  ==> Bio::Sequence::NA
>
> Toshiaki
>
>
> On 2011/05/16, at 18:07, Anthony Underwood wrote:
>
> > Here's something that has alway puzzled me about BioRuby
> >
> > If I start with a Bio::EMBL object and want to extract the features I can
> do the following
> >
> > biosequence = embl_object.to_biosequence
> >
> > This returns an instance of a Bio::Sequence class. I can now access the
> features
> >
> > features = biosequence.features
> >
> > However if the sequence is nucleotide and I want to translate it I have
> to do the following
> >
> > biosequence.na
> >
> > OR
> >
> > biosequence = biosequence.auto
> >
> >
> > This returns a Bio::Sequence::NA instance and I can now translate
> >
> > protein = biosequence.translate(1,11)
> >
> >
> > Why can I not now get at the features
> >
> > biosequence.features #=> undefined method `features' for
> #<Bio::Sequence::NA:0x00000100cae5f8>
> >
> >
> > I would have though that after converting to Bio::Sequence::NA or
> Bio::Sequence:AA the methods available to Bio::Sequence should still be
> available.
> >
> > Can anyone tell me what's going on here. Is there another method I should
> use?
> >
> >
> > Thanks
> >
> > Anthony
> > _______________________________________________
> > BioRuby Project - http://www.bioruby.org/
> > BioRuby mailing list
> > BioRuby at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioruby
>
>

From ktym at hgc.jp  Tue May 17 16:53:18 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Wed, 18 May 2011 05:53:18 +0900
Subject: [BioRuby] Bio::Sequence and Bio::Sequence::NA
In-Reply-To: <BANLkTim_SwZ0LKCdS8_jLdZiGBLCiOivGA@mail.gmail.com>
References: <6226C785-DF3B-45BA-887A-DD80AAEBFACD@gmail.com>
	<B446AF2E-B479-48D7-B07C-8875E05A42DE@hgc.jp>
	<BANLkTim_SwZ0LKCdS8_jLdZiGBLCiOivGA@mail.gmail.com>
Message-ID: <0992ED00-7DF5-4BCE-926B-8E615E77DB36@hgc.jp>

Hi Anthony,

In lib/bio/sequence.rb, you can find the definition of "method_missing".

  # Pass any unknown method calls to the wrapped sequence object.  see
  # http://www.rubycentral.com/book/ref_c_object.html#Object.method_missing
  def method_missing(sym, *args, &block) #:nodoc:
    begin
      seq.__send__(sym, *args, &block)

   :

  # The sequence object, usually Bio::Sequence::NA/AA, 
  # but could be a simple String
  attr_accessor :seq

This means any methods which are not understood by the Bio::Sequence object
are simply redirected to the internal sequence object.

Therefore, if the sequence object is a Bio::Sequence::NA instance, it will
respond to any methods implemented in the Bio::Sequence::NA class (and mix-ins).

Older versions were much simpler but the internal code gets complicated over time
to improve usability and functionality. Hopefully, it should be clearly documented.

Cheers,
Toshiaki

On 2011/05/18, at 5:06, Anthony Underwood wrote:

> Dear Toshiaki
> 
> Thank you for your reply.
> 
> I have just tested your code below and all worked OK. I have found unexpectedly that embl_bioseq.translate works even though embl_bioseq.methods does not list translate as an available method. 
> What extra methods does a Bio::Sequence::NA object instantiated using the auto method give?
> 
> Thanks again for your advice, Anthony
> 
> On 17 May 2011 02:33, Toshiaki Katayama <ktym at hgc.jp> wrote:
> Hi Anthony,
> 
> Bio::Sequence is a generic container class for a sequence with features which was
> introduced relatively recently for interconversion of Bio::GenBank, Bio::EMBL and
> Bio::SQL sequence objects (and it also provides common APIs for those seq objects).
> 
> Bio::Sequence#na or #auto method extract a sequence from a Bio::Sequence object, so
> you should use another variable to store (instead of overriding the object reference).
> 
> > biosequence = biosequence.auto
> 
> seq = biosequence.auto
> 
> so that you can still access to biosequence.features.
> 
> % bioruby
> bioruby> embl = Bio::EMBL.new(open("http://togows.dbcls.jp/entry/embl/J00231").read)
> bioruby> embl.class
>  ==> Bio::EMBL
> bioruby> embl_bioseq = embl.to_biosequence
> bioruby> embl_bioseq.class
>  ==> Bio::Sequence
> bioruby> embl_seq = embl_bioseq.auto
> bioruby> embl_seq.class
>  ==> Bio::Sequence::NA
> 
> Toshiaki
> 
> 
> On 2011/05/16, at 18:07, Anthony Underwood wrote:
> 
> > Here's something that has alway puzzled me about BioRuby
> >
> > If I start with a Bio::EMBL object and want to extract the features I can do the following
> >
> > biosequence = embl_object.to_biosequence
> >
> > This returns an instance of a Bio::Sequence class. I can now access the features
> >
> > features = biosequence.features
> >
> > However if the sequence is nucleotide and I want to translate it I have to do the following
> >
> > biosequence.na
> >
> > OR
> >
> > biosequence = biosequence.auto
> >
> >
> > This returns a Bio::Sequence::NA instance and I can now translate
> >
> > protein = biosequence.translate(1,11)
> >
> >
> > Why can I not now get at the features
> >
> > biosequence.features #=> undefined method `features' for #<Bio::Sequence::NA:0x00000100cae5f8>
> >
> >
> > I would have though that after converting to Bio::Sequence::NA or Bio::Sequence:AA the methods available to Bio::Sequence should still be available.
> >
> > Can anyone tell me what's going on here. Is there another method I should use?
> >
> >
> > Thanks
> >
> > Anthony
> > _______________________________________________
> > BioRuby Project - http://www.bioruby.org/
> > BioRuby mailing list
> > BioRuby at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioruby
> 
> 



From daijiendoh at gmail.com  Wed May 18 21:04:24 2011
From: daijiendoh at gmail.com (=?ISO-2022-JP?B?GyRCMXNGI0JnRnMbKEI=?=)
Date: Thu, 19 May 2011 10:04:24 +0900
Subject: [BioRuby] Disk cash on the parse genes
Message-ID: <BANLkTinYY=RjL=jSmNp6Uq0V++QjU-o_Xw@mail.gmail.com>

Dear All

I often download whole genbank data from bio at mirror ( such as
gbbct12.seq ) and parse them.
But recently, parsing the whole data became to be difficult. On some
some step, the program need a long time to select nucleic acid
sequences of genes or transcripts. It seems that selection of spliced
or partial sequences from a long (genome) nucleic acid sequence using
feature data.

Anyone have strategies or methods avoiding these heavy steps ?

Daiji Endoh
Rakuno Gakuen University

From R.A.Vos at reading.ac.uk  Thu May 19 07:22:43 2011
From: R.A.Vos at reading.ac.uk (Rutger Vos)
Date: Thu, 19 May 2011 12:22:43 +0100
Subject: [BioRuby] 10 days left to register: workshop phylogenetic pipelines,
	August 1-11
Message-ID: <BANLkTimAQZP9BiTfhZMJ4=8c0_66xb-F0A@mail.gmail.com>

COMPUTATIONAL PHYLOINFORMATICS
August 1 2011 through August 11 2011
Bioinformatics Center of Kyoto University
Application Deadline:  May 31, 2011

http://academy.nescent.org/wiki/Computational_phyloinformatics

Computational Phyloinformatics is an 11-day international course
(August 1-11, 2011) co-organized by the Computational Biology Research
Center (CBRC/AIST), the Bioinformatics Center of Kyoto University, the
Database Center for Life Science (DBCLS/JST), and the National
Evolutionary Synthesis Center (NESCent).  This course, which will take
place at Kyoto University directly following the SMBE Meeting
(http://smbe2011.com/), aims to give participants practical knowledge
and hands-on skills in phyloinformatics.

The venue in Kyoto is completely unaffected by the unfortunate events
in Fukushima and the power shortages in Tokyo. We encourage biologists
from other countries to participate in the SMBE meeting and/or this
special international course, in solidarity with the scientific
community of Japan in their effort to return to normalcy and to help
minimize any negative impacts that the earthquake may have on
scientific activities in Japan.

SYNOPSIS
Biologists are faced with ever-larger datasets, more complex
evolutionary models, and increasingly elaborate analytical methods.
Seldom is it sufficient to run a dataset with an off-the-shelf program
on a desktop PC; increasingly, biologists need to write scripts to
interface with internet services and databases, build analytical
pipelines, customize analyses, and distribute computation over
multiple processors.  This course is designed for graduate students,
postdocs, faculty, and researchers in phylogenetics interested in
receiving practical, hands-on training in the use of Perl and SQL for
workflows and applications in phyloinformatics.

The course is divided into four parts:

PART I: A tutorial review of Perl, including object oriented
programming and building packages.

PART II: Introduction and practical use of BioPerl and Bio::Phylo,
(e.g. scripting for large tree inference engines, automating model
testing, genomic-scale data mining and acquisition, supertree
assembly, rate smoothing and branch calibration, tree traversal, etc).

PART III: Introduction and practical use of BioRuby for molecular
evolution and functional genomics  (e.g. scripting multiple sequence
alignment, gene duplication inference, tree inference, etc.).

PART IV: Introduction to SQL and database design; computing and
querying nested sets and transitive closure; querying both large trees
(e.g. NCBI) and large collections of trees (e.g. TreeBASE).

Participants  will learn how to write basic phylogenetic or
comparative analysis scripts, parse NEXUS files, traverse and compute
over trees, and make practical use of phylogenetic software libraries.
 These skills will be learned in a biological context, touching on a
diverse array of topics such as analysis of large datasets, automation
of supertree assembly, querying for topological patterns in large
collections of trees, etc. Participants will leave the course with a
full set of installations and libraries on their computer ready to
build phyloinformatic workflows for their own research projects, as
well as continued access to a 50+ page wiki "textbook" containing
step-by-step instructions, problem sets, and examples.

INSTRUCTORS AND COURSE ORGANIZERS
Christian Zmasek, Karen Cranston, Rutger A. Vos, Susumu Goto, Toshiaki
Katayama, William H. Piel

APPLICATION DEADLINE
May 31, 2011

TUITION
?40,000 (~$500)

Participants are responsible for their own travel costs, including
transportation and accommodation -- see the website for more
information. International participants will benefit by combining
attendance with the 2011 SMBE meeting. A limited number of travel
scholarships from NESCent are available for US-based students.
Preference will be given to students from under-represented
minorities.

SUBSIDIES AND SCHOLARSHIPS
A limited number of travel scholarships from NESCent are available for
US-based students. Preference will be given to students from
under-represented minorities.

The Asia-Pacific Bioinformatics Network (APBioNet) is happy to provide
travel assistance for a limited number of students/early career
researchers from the Asia-Pacific region. Applicants are requested to
contact Dr Asif Khan, APBioNet Secretariat: asif -$- bic.nus.edu.sg
(replace -$- with @) for details.

PREREQUISITES

BIOLOGY: A good understanding of phylogenetics ? for example, having
already taken the Workshop on Molecular Evolution
(http://www.molecularevolution.org/) or equivalent coursework or
experience.

COMPUTING: Prior experience with Perl or careful study of the
suggested reading materials in advance of the class (see web site).
Participants should have some experience with basic Unix shell
commands.

EQUIPMENT: Participants are expected to bring their own Mac OSX
computer or a LINUX computer, else they will be provided with an iMac.
Participants who cannot bring their own computer and will be using a
supplied iMac, should consider bringing their own portable
firewire/usb drive so that they can also leave the course with a full
suite of phyloinformatic software tools.

-- 
Dr. Rutger A. Vos
School of Biological Sciences
Philip Lyle Building, Level 4
University of Reading
Reading, RG6 6BX, United Kingdom
Tel: +44 (0) 118 378 7535
http://rutgervos.blogspot.com


From ktym at hgc.jp  Fri May 20 02:31:13 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Fri, 20 May 2011 15:31:13 +0900
Subject: [BioRuby] Disk cash on the parse genes
In-Reply-To: <BANLkTinYY=RjL=jSmNp6Uq0V++QjU-o_Xw@mail.gmail.com>
References: <BANLkTinYY=RjL=jSmNp6Uq0V++QjU-o_Xw@mail.gmail.com>
Message-ID: <4DD023E9-9FBE-4A38-AE9C-A19FD4751CDF@hgc.jp>

Dear Endoh-san,

Thank you for pointing this problem out.

I tried to parse gbbct12.seq file with the example code based on
our tutorial at http://bioruby.open-bio.org/wiki/Tutorial and found
that the actual problem is in the multiple calling of the gb.naseq method.

The method is defined as shown in below and which doesn't cache
the generated Bio::Sequence::NA object, therefore, it will take
long time if called multiple times, especially for a long sequence.

bio/db/genbank/genbank.rb:
  def seq
    unless @data['SEQUENCE']
      origin
    end
    Bio::Sequence::NA.new(@data['SEQUENCE'])
  end
  alias naseq seq

If I store the object outside of the loop of feature manipulation,
it became much faster.

% ruby gbparse.rb gbbct12.seq > gbbct12.out 2> gbbct12.err
Parsed 16125 entries in 1645.838824 sec.

% ruby gbparse_new.rb gbbct12.seq > gbbct12.out_new 2> gbbct12.err_new
Parsed 16125 entries in 39.012607 sec.

Based on this observation, could you check the algorithm of your code?

Regards,
Toshiaki Katayama

-------------- next part --------------




On 2011/05/19, at 10:04, ???? wrote:

> Dear All
> 
> I often download whole genbank data from bio at mirror ( such as
> gbbct12.seq ) and parse them.
> But recently, parsing the whole data became to be difficult. On some
> some step, the program need a long time to select nucleic acid
> sequences of genes or transcripts. It seems that selection of spliced
> or partial sequences from a long (genome) nucleic acid sequence using
> feature data.
> 
> Anyone have strategies or methods avoiding these heavy steps ?
> 
> Daiji Endoh
> Rakuno Gakuen University
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby


From daijiendoh at gmail.com  Sat May 21 01:33:58 2011
From: daijiendoh at gmail.com (=?ISO-2022-JP?B?GyRCMXNGI0JnRnMbKEI=?=)
Date: Sat, 21 May 2011 14:33:58 +0900
Subject: [BioRuby] Fwd:  Disk cash on the parse genes
In-Reply-To: <4DD023E9-9FBE-4A38-AE9C-A19FD4751CDF@hgc.jp>
References: <BANLkTinYY=RjL=jSmNp6Uq0V++QjU-o_Xw@mail.gmail.com>
	<4DD023E9-9FBE-4A38-AE9C-A19FD4751CDF@hgc.jp>
Message-ID: <BANLkTik2wbsDhAG0AmMR1mVcy_2wnxfOog@mail.gmail.com>

Dear Katayama-san

I am very very grateful to your suggestion. I have been struggled on
this problem for 6 months.
Using your code, I can overcome the problem.

But, only one point the code stopped.
If the feature.position refer to the other entry such as
"join(M52614.1:1..1456,5216..5823), the code returned a error.
So I added a line below.

next if position =~ /[A-Z]+\d+\W*\d*\:/

The inserting code now working.
I attached the modified code.
Thanks again,

Daiji Endoh
************************************************************************
Dear Endoh-san,

Thank you for pointing this problem out.

I tried to parse gbbct12.seq file with the example code based on
our tutorial at http://bioruby.open-bio.org/wiki/Tutorial and found
that the actual problem is in the multiple calling of the gb.naseq method.

The method is defined as shown in below and which doesn't cache
the generated Bio::Sequence::NA object, therefore, it will take
long time if called multiple times, especially for a long sequence.

bio/db/genbank/genbank.rb:
 def seq
   unless @data['SEQUENCE']
     origin
   end
   Bio::Sequence::NA.new(@data['SEQUENCE'])
 end
 alias naseq seq

If I store the object outside of the loop of feature manipulation,
it became much faster.

% ruby gbparse.rb gbbct12.seq > gbbct12.out 2> gbbct12.err
Parsed 16125 entries in 1645.838824 sec.

% ruby gbparse_new.rb gbbct12.seq > gbbct12.out_new 2> gbbct12.err_new
Parsed 16125 entries in 39.012607 sec.

Based on this observation, could you check the algorithm of your code?

Regards,
Toshiaki Katayama
****************************************************************************************


On 2011/05/19, at 10:04, ???? wrote:

> Dear All
>
> I often download whole genbank data from bio at mirror ( such as
> gbbct12.seq ) and parse them.
> But recently, parsing the whole data became to be difficult. On some
> some step, the program need a long time to select nucleic acid
> sequences of genes or transcripts. It seems that selection of spliced
> or partial sequences from a long (genome) nucleic acid sequence using
> feature data.
>
> Anyone have strategies or methods avoiding these heavy steps ?
>
> Daiji Endoh
> Rakuno Gakuen University
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby





-- 
??????????????????
????
?069-8501????????????582
Tel: 011-388-4847
Fax:011-387-5890

From ktym at hgc.jp  Sun May 22 23:28:08 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Mon, 23 May 2011 12:28:08 +0900
Subject: [BioRuby] Fwd:  Disk cash on the parse genes
In-Reply-To: <BANLkTik2wbsDhAG0AmMR1mVcy_2wnxfOog@mail.gmail.com>
References: <BANLkTinYY=RjL=jSmNp6Uq0V++QjU-o_Xw@mail.gmail.com>
	<4DD023E9-9FBE-4A38-AE9C-A19FD4751CDF@hgc.jp>
	<BANLkTik2wbsDhAG0AmMR1mVcy_2wnxfOog@mail.gmail.com>
Message-ID: <EE8586E1-6874-4BA5-9911-5184AF541ACD@hgc.jp>

Dear Endoh-san,

> Using your code, I can overcome the problem.

Good!

> "join(M52614.1:1..1456,5216..5823), the code returned a error.

External reference should be detected by the Bio::Location class
and the ID will be stored in an instance variable @xref_id,
however, how to deal with it is up to users, so you need to implement
some code to fetch external entry (in this case @xref_id="M52614.1") from
available services (local DB or web service etc.) and extract
the sub-sequence from the entry.

Please take a look at pattern (G) in the documentation.
  http://bioruby.open-bio.org/rdoc/classes/Bio/Locations.html

Unfortunately, I've got an unexplained "Exception" error from NCBI
when retrieving http://www.ncbi.nlm.nih.gov/nuccore?term=M52614.1
so, I'll use "join(U75473.1:1..293,1..216)" found in a GenBank entry
SMMFD02 (gbbct65.seq) for example.

# obtain a genbank record
bioruby> entry = getobj("genbank:SMMFD02")
 or
bioruby> entry = Bio::GenBank.new(open("http://togows.dbcls.jp/entry/ncbi-genbank/SMMFD02").read)

# cache whole sequence as we learnt in this thread :-)
bioruby> naseq = entry.naseq

# pick up "gene" features only
bioruby> genes = entry.features.select {|x| x.feature == "gene" }
  ==> [#<Bio::Feature:0x102340870
  @feature="gene",
  @position="join(U75473.1:1..293,1..216)",
  @qualifiers=
   [#<Bio::Feature::Qualifier:0x102340280 @qualifier="gene", @value="mfd">]>]

# example to handle external references in a given position
bioruby> genes.each do |gene|
  locations = Bio::Locations.new(gene.position)
  locations.each do |location|
    if xref = location.xref_id
      xref_entry = open("http://togows.dbcls.jp/entry/ncbi-genbank/#{xref}").read
      location.sequence = Bio::GenBank.new(xref_entry).naseq.subseq(location.from, location.to)
    end
  end
  gene.position = locations.to_s    # (*1)
  puts naseq.splice(gene.position)  # (*2)
end

(*1) will generate the following string

join(replace(U75473.1:1..293,"gtcttcttgttggtgatgttggttttggaaaaacggaagtagcgatgagagctgcttttaaagcagttaatgatgataaacaagttgctgttttggtgccaacaacagttcttgctcaacagcactataatacttttaaggagcgctttgaaaattttcctgtcaatgttgccatgatgagtcgttttaaaaccaagactgaacagtctgaaacgttaactaaattagctaagggacaggttgatatcattattggaacacatcgtctactttctaaagatgttacgtttaaa"),1..216)

(*2) will return 293 + 216 = 509 bp sequence

gtcttcttgttggtgatgttggttttggaaaaacggaagtagcgatgagagctgcttttaaagcagttaatgatgataaacaagttgctgttttggtgccaacaacagttcttgctcaacagcactataatacttttaaggagcgctttgaaaattttcctgtcaatgttgccatgatgagtcgttttaaaaccaagactgaacagtctgaaacgttaactaaattagctaagggacaggttgatatcattattggaacacatcgtctactttctaaagatgttacgtttaaaggggttaaacacaaggaaacattgaaagaattaaaaactaaggttgatgtcttgaccttgacagcaactcctattccacggacattacatatgtctatgcttggtatacgagatttatcagttattgaaacacctccaagtaatcgttaccctgtccagacttatgttatggaaacaaatgcaagtgtcattcgtgaagctattatgcgtgaaatt

During this trial, I found a bug in the Bio::Sequence#splice method.

bio/sequence/common.rb:
  def splice(position)
    unless position.is_a?(Locations) then
      position = Locations.new(position)
    end
    s = ''
    position.each do |location|
      if location.sequence
        s << location.sequence
      else  # <----- (*3)
        exon = self.subseq(location.from, location.to)
        begin
          exon.complement! if location.strand < 0
        rescue NameError
        end
        s << exon
      end
    end
    return self.class.new(s)
  end
  alias splicing splice

We need to fix this else block (*3) to mind if @xref_id exists or not.
Currently, "join(U75473.1:1..293,1..216)" will be treated as
"join(1..293,1..216)" and, obviously, it is not feasible.


Toshiaki

On 2011/05/21, at 14:33, ???? wrote:

> Dear Katayama-san
> 
> I am very very grateful to your suggestion. I have been struggled on
> this problem for 6 months.
> Using your code, I can overcome the problem.
> 
> But, only one point the code stopped.
> If the feature.position refer to the other entry such as
> "join(M52614.1:1..1456,5216..5823), the code returned a error.
> So I added a line below.
> 
> next if position =~ /[A-Z]+\d+\W*\d*\:/
> 
> The inserting code now working.
> I attached the modified code.
> Thanks again,
> 
> Daiji Endoh
> ************************************************************************
> Dear Endoh-san,
> 
> Thank you for pointing this problem out.
> 
> I tried to parse gbbct12.seq file with the example code based on
> our tutorial at http://bioruby.open-bio.org/wiki/Tutorial and found
> that the actual problem is in the multiple calling of the gb.naseq method.
> 
> The method is defined as shown in below and which doesn't cache
> the generated Bio::Sequence::NA object, therefore, it will take
> long time if called multiple times, especially for a long sequence.
> 
> bio/db/genbank/genbank.rb:
> def seq
>   unless @data['SEQUENCE']
>     origin
>   end
>   Bio::Sequence::NA.new(@data['SEQUENCE'])
> end
> alias naseq seq
> 
> If I store the object outside of the loop of feature manipulation,
> it became much faster.
> 
> % ruby gbparse.rb gbbct12.seq > gbbct12.out 2> gbbct12.err
> Parsed 16125 entries in 1645.838824 sec.
> 
> % ruby gbparse_new.rb gbbct12.seq > gbbct12.out_new 2> gbbct12.err_new
> Parsed 16125 entries in 39.012607 sec.
> 
> Based on this observation, could you check the algorithm of your code?
> 
> Regards,
> Toshiaki Katayama
> ****************************************************************************************
> 
> 
> On 2011/05/19, at 10:04, ???? wrote:
> 
>> Dear All
>> 
>> I often download whole genbank data from bio at mirror ( such as
>> gbbct12.seq ) and parse them.
>> But recently, parsing the whole data became to be difficult. On some
>> some step, the program need a long time to select nucleic acid
>> sequences of genes or transcripts. It seems that selection of spliced
>> or partial sequences from a long (genome) nucleic acid sequence using
>> feature data.
>> 
>> Anyone have strategies or methods avoiding these heavy steps ?
>> 
>> Daiji Endoh
>> Rakuno Gakuen University
>> _______________________________________________
>> BioRuby Project - http://www.bioruby.org/
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
> 
> 
> 
> 
> 
> -- 
> ??????????????????
> ????
> ?069-8501????????????582
> Tel: 011-388-4847
> Fax:011-387-5890
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby



From mictadlo at gmail.com  Wed May 25 17:10:26 2011
From: mictadlo at gmail.com (Michal)
Date: Thu, 26 May 2011 07:10:26 +1000
Subject: [BioRuby] BioRuby with Reia
Message-ID: <4DDD7042.9050708@gmail.com>

Hello,
would be possible to run BioRuby with Reia ( 
http://en.wikipedia.org/wiki/Reia_(programming_language) )?

From bonnal at ingm.org  Thu May 26 04:31:33 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Thu, 26 May 2011 10:31:33 +0200
Subject: [BioRuby] BioRuby with Reia
In-Reply-To: <4DDD7042.9050708@gmail.com>
References: <4DDD7042.9050708@gmail.com>
Message-ID: <10EFE5AC-BBA0-4113-9878-FD92C9ECF326@ingm.org>


On 25/mag/2011, at 23.10, Michal wrote:

> Hello,
> would be possible to run BioRuby with Reia ( http://en.wikipedia.org/wiki/Reia_(programming_language) )?
Don't know, which is the advantage ?

--
Ra


From pjotr.public14 at thebird.nl  Thu May 26 06:01:50 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Thu, 26 May 2011 12:01:50 +0200
Subject: [BioRuby] BioRuby with Reia
In-Reply-To: <10EFE5AC-BBA0-4113-9878-FD92C9ECF326@ingm.org>
References: <4DDD7042.9050708@gmail.com>
	<10EFE5AC-BBA0-4113-9878-FD92C9ECF326@ingm.org>
Message-ID: <20110526100149.GA19867@thebird.nl>

Reia is not Ruby compatible. Even if it has some similar Syntax. So,
BioRuby won't run on Reia.

Pj.

On Thu, May 26, 2011 at 10:31:33AM +0200, Raoul Bonnal wrote:
> 
> On 25/mag/2011, at 23.10, Michal wrote:
> 
> > Hello,
> > would be possible to run BioRuby with Reia ( http://en.wikipedia.org/wiki/Reia_(programming_language) )?
> Don't know, which is the advantage ?
> 
> --
> Ra
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
> 

From mictadlo at gmail.com  Sat May 28 19:47:49 2011
From: mictadlo at gmail.com (Michal)
Date: Sun, 29 May 2011 09:47:49 +1000
Subject: [BioRuby] samtools-ruby
In-Reply-To: <74EAEDFF-D8D0-42E0-93B8-51C4986CEC65@ingm.it>
References: <4D454E91.1080604@gmail.com>
	<A6CFF775-1E68-4FA1-A84F-8E489E2FCE96@ingm.it>
	<4D4A6459.5050205@gmail.com>
	<5B31A257-DDCB-4BBB-A201-B4D708E82BE0@kenroku.kanazawa-u.ac.jp>
	<4D4BB255.7030703@gmail.com>
	<A5D4BF72-1C38-4F66-A2BE-87B70A63E7F3@kenroku.kanazawa-u.ac.jp>
	<4D4BE242.2030408@gmail.com>
	<F5C4E670-1104-4FC1-A665-E5C36E31819F@kenroku.kanazawa-u.ac.jp>
	<4D4BFB7D.9070004@gmail.com>
	<74EAEDFF-D8D0-42E0-93B8-51C4986CEC65@ingm.it>
Message-ID: <4DE189A5.2010201@gmail.com>

Hello,
how is it possible to get the following pileup output with bioruby-samtools?

coverage at base 99 = 1
base in read EAS56_57:6:190:289:82 = A

coverage at base 100 = 1
base in read EAS56_57:6:190:289:82 = G

coverage at base 101 = 1
base in read EAS56_57:6:190:289:82 = G

coverage at base 102 = 2
base in read EAS56_57:6:190:289:82 = G
base in read EAS51_64:3:190:727:308 = G

I have found only a this python code :
import pysam
samfile = pysam.Samfile("ex1.bam", "rb" )
for pileupcolumn in samfile.pileup( 'chr1', 100, 120):
   print
   print 'coverage at base %s = %s' % (pileupcolumn.pos , pileupcolumn.n)
   for pileupread in pileupcolumn.pileups:
     print '\tbase in read %s = %s' % (pileupread.alignment.qname, 
pileupread.alignment.seq[pileupread.qpos])
samfile.close()

But do not know how to do it with Ruby.

Thank you in advance.



On 02/04/2011 11:57 PM, Raoul Bonnal wrote:
> In these days, w.e. too, I have no time for sam tools. From the next 
> week I could spend  more time on this project and improve test, 
> usability and platform supports.
>
>
>
> On 04/feb/2011, at 14.13, Michal wrote:
>
>> Hi,
>> I would be happy if would find out how to get on a particular 
>> position the alignment and then I could give feedback.
>>
>> Pysam http://code.google.com/p/pysam/ contains all files and tests.
>> ~/Downloads/pysam-0.3.1/tests$ ls
>> 00README.txt  ex4.sam  ex8.sam             Makefile
>> ex1.fa        ex5.sam  example.gtf.gz      pysam_test.py
>> ex1.sam.gz    ex6.sam  example.gtf.gz.tbi  segfault_tests.py
>> ex3.sam       ex7.sam  example.py          tabix_test.py
>>
>> Maybe it would be possible to test bioruby-samtools in the same way. 
>> Pysam is ship out with samtools source code and maybe could be used 
>> it for bioruby-samtools.
>>
>> Thank you in advance.
>>
>> Michal
>>
>>
>> On 02/04/2011 10:26 PM, Tomoaki NISHIYAMA wrote:
>>> Hi,
>>>
>>>> What I have forgotten to do?
>>>
>>> Now, you are at the point I reached yesterday and
>>> I don't think you have forgotten anything.
>>>
>>> From yesterday's mail:
>>>>   1) Failure:
>>>> test: BioSamtools should probably rename this file and start 
>>>> testing for real. (TestBioSamtools) [test/test_bio-samtools.rb:5]:
>>>> hey buddy, you should probably rename this file and start testing 
>>>> for real
>>>>
>>>> Loading seems ok.
>>>> I'm not sure if this is bad or ok.
>>>
>>> You could look at test/test_bio-samtools.rb
>>> $ cat test/test_bio-samtools.rb
>>> require 'helper'
>>>
>>> class TestBioSamtools < Test::Unit::TestCase
>>>   should "probably rename this file and start testing for real" do
>>>     flunk "hey buddy, you should probably rename this file and start 
>>> testing for real"
>>>   end
>>> end
>>>
>>> and guess what it means.
>>>
>>> My guess is that this is test not implemented yet.
>>> So, this error does not tell if the library function well or can not 
>>> used at all.
>>> You might just try what you wanted to do and see if it works.
>>>
>>>> I understand how difficult it is to keep track and it is a good 
>>>> idea to ship bioruby-samtools
>>>> with a working samtools version like Raoul does it.
>>>
>>> My view is the opposite.
>>> Since it potentially has many bugs and changes rapidly, bundled 
>>> shipping is ineffective.
>>> With the lack of test code, we cannot even tell which is a good 
>>> working version.
>>> --
>>> Tomoaki NISHIYAMA
>>>
>>> Advanced Science Research Center,
>>> Kanazawa University,
>>> 13-1 Takara-machi,
>>> Kanazawa, 920-0934, Japan
>>>
>>
>
> --
> R.J.P.B.
>
>
>


From p.j.a.cock at googlemail.com  Tue May  3 09:24:08 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 3 May 2011 10:24:08 +0100
Subject: [BioRuby] Interesting BLAST 2.2.25+ XML behaviour
In-Reply-To: <BANLkTi=6_2bFpGhOwxtdjy-DzxUotVWxEg@mail.gmail.com>
References: <BANLkTi=6_2bFpGhOwxtdjy-DzxUotVWxEg@mail.gmail.com>
Message-ID: <BANLkTinH0y4KQ7_AXt7Ly3TgN9fXxErUzA@mail.gmail.com>

Hello all,

I've CC'd the BioPerl, BioRuby, BioJava and Biopython development mailing
lists to make sure you're aware of this, but can we continue any discussion
on the cross-project open-bio-l mailing list please?

I noticed that recent versions of BLAST are not using a single <iteration>
block for each query, which was the historical behaviour and assumed
by the Biopython BLAST XML parser. This may be a bug in BLAST.
See link below for an example.

Has anyone else noticed this, and has it been reported to the NCBI yet?

Thanks,

Peter

(Not for the first time, I wish there was a public bug tracker for BLAST,
or at least a private bug tracker so we could talk about issues with an
NCBI assigned reference number.)

---------- Forwarded message ----------
From: Peter Cock <p.j.a.cock at googlemail.com>
Date: Wed, Apr 20, 2011 at 6:08 PM
Subject: Interesting BLAST 2.2.25+ XML behaviour
To: Biopython-Dev Mailing List <biopython-dev at biopython.org>


Hi all,

Have a look at this XML file from a FASTA vs FASTA search
using blastp from ?BLAST 2.2.25+ (current release), which
is a test file I created for the BLAST+ wrappers in Galaxy:

https://bitbucket.org/galaxy/galaxy-central/src/8eaf07a46623/test-data/blastp_four_human_vs_rhodopsin.xml

I just put it though the Biopython BLAST XML parser, and
was surprised not to get four records back (since as you
might guess from the filename, there were four queries).

It appears this version of BLAST+ is incrementing the
iteration counter for each match... or something like that.

Has anyone else noticed this? I wonder if it is accidental...

Peter



From cjfields at illinois.edu  Tue May  3 13:31:55 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 3 May 2011 08:31:55 -0500
Subject: [BioRuby] Interesting BLAST 2.2.25+ XML behaviour
In-Reply-To: <BANLkTinH0y4KQ7_AXt7Ly3TgN9fXxErUzA@mail.gmail.com>
References: <BANLkTi=6_2bFpGhOwxtdjy-DzxUotVWxEg@mail.gmail.com>
	<BANLkTinH0y4KQ7_AXt7Ly3TgN9fXxErUzA@mail.gmail.com>
Message-ID: <398303E2-1195-4CC2-8B73-09C6C1117892@illinois.edu>

Haven't tried this using the latest BLAST+ myself, but it doesn't surprise me too much.  Also agree re: some kind of bug tracking with NCBI; I believe they have an internal one, but it would be nice to have a public interface to it.

chris

On May 3, 2011, at 4:24 AM, Peter Cock wrote:

> Hello all,
> 
> I've CC'd the BioPerl, BioRuby, BioJava and Biopython development mailing
> lists to make sure you're aware of this, but can we continue any discussion
> on the cross-project open-bio-l mailing list please?
> 
> I noticed that recent versions of BLAST are not using a single <iteration>
> block for each query, which was the historical behaviour and assumed
> by the Biopython BLAST XML parser. This may be a bug in BLAST.
> See link below for an example.
> 
> Has anyone else noticed this, and has it been reported to the NCBI yet?
> 
> Thanks,
> 
> Peter
> 
> (Not for the first time, I wish there was a public bug tracker for BLAST,
> or at least a private bug tracker so we could talk about issues with an
> NCBI assigned reference number.)
> 
> ---------- Forwarded message ----------
> From: Peter Cock <p.j.a.cock at googlemail.com>
> Date: Wed, Apr 20, 2011 at 6:08 PM
> Subject: Interesting BLAST 2.2.25+ XML behaviour
> To: Biopython-Dev Mailing List <biopython-dev at biopython.org>
> 
> 
> Hi all,
> 
> Have a look at this XML file from a FASTA vs FASTA search
> using blastp from  BLAST 2.2.25+ (current release), which
> is a test file I created for the BLAST+ wrappers in Galaxy:
> 
> https://bitbucket.org/galaxy/galaxy-central/src/8eaf07a46623/test-data/blastp_four_human_vs_rhodopsin.xml
> 
> I just put it though the Biopython BLAST XML parser, and
> was surprised not to get four records back (since as you
> might guess from the filename, there were four queries).
> 
> It appears this version of BLAST+ is incrementing the
> iteration counter for each match... or something like that.
> 
> Has anyone else noticed this? I wonder if it is accidental...
> 
> Peter
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby




From pjotr.public14 at thebird.nl  Wed May  4 11:51:51 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Wed, 4 May 2011 13:51:51 +0200
Subject: [BioRuby] Interesting BLAST 2.2.25+ XML behaviour
In-Reply-To: <398303E2-1195-4CC2-8B73-09C6C1117892@illinois.edu>
References: <BANLkTi=6_2bFpGhOwxtdjy-DzxUotVWxEg@mail.gmail.com>
	<BANLkTinH0y4KQ7_AXt7Ly3TgN9fXxErUzA@mail.gmail.com>
	<398303E2-1195-4CC2-8B73-09C6C1117892@illinois.edu>
Message-ID: <20110504115151.GA12003@thebird.nl>

Something also rather odd. Can you imagine that a basic BLAST
lesson would make it into PLoS Biology?

PLoS Biology states: the journal features works of exceptional
significance, originality, and relevance in all areas of biological
science, from molecules to ecosystems, including works at the
interface of other disciplines, such as chemistry, medicine, and
mathematics. 

Well, so much for that. Check out a copy of the BLAST help page, as
published in PLoS Biology:

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3032543/

I checked the date. It is not April 1st. It ticks, however, the
relevance box. But I am not sure about its significance. It is
certainly not original. Where are we heading? Can we start submitting
man pages now?

Pj.

On Tue, May 03, 2011 at 08:31:55AM -0500, Chris Fields wrote:
> Haven't tried this using the latest BLAST+ myself, but it doesn't surprise me too much.  Also agree re: some kind of bug tracking with NCBI; I believe they have an internal one, but it would be nice to have a public interface to it.
> 
> chris
> 
> On May 3, 2011, at 4:24 AM, Peter Cock wrote:
> 
> > Hello all,
> > 
> > I've CC'd the BioPerl, BioRuby, BioJava and Biopython development mailing
> > lists to make sure you're aware of this, but can we continue any discussion
> > on the cross-project open-bio-l mailing list please?
> > 
> > I noticed that recent versions of BLAST are not using a single <iteration>
> > block for each query, which was the historical behaviour and assumed
> > by the Biopython BLAST XML parser. This may be a bug in BLAST.
> > See link below for an example.
> > 
> > Has anyone else noticed this, and has it been reported to the NCBI yet?
> > 
> > Thanks,
> > 
> > Peter
> > 
> > (Not for the first time, I wish there was a public bug tracker for BLAST,
> > or at least a private bug tracker so we could talk about issues with an
> > NCBI assigned reference number.)
> > 
> > ---------- Forwarded message ----------
> > From: Peter Cock <p.j.a.cock at googlemail.com>
> > Date: Wed, Apr 20, 2011 at 6:08 PM
> > Subject: Interesting BLAST 2.2.25+ XML behaviour
> > To: Biopython-Dev Mailing List <biopython-dev at biopython.org>
> > 
> > 
> > Hi all,
> > 
> > Have a look at this XML file from a FASTA vs FASTA search
> > using blastp from  BLAST 2.2.25+ (current release), which
> > is a test file I created for the BLAST+ wrappers in Galaxy:
> > 
> > https://bitbucket.org/galaxy/galaxy-central/src/8eaf07a46623/test-data/blastp_four_human_vs_rhodopsin.xml
> > 
> > I just put it though the Biopython BLAST XML parser, and
> > was surprised not to get four records back (since as you
> > might guess from the filename, there were four queries).
> > 
> > It appears this version of BLAST+ is incrementing the
> > iteration counter for each match... or something like that.
> > 
> > Has anyone else noticed this? I wonder if it is accidental...
> > 
> > Peter
> > 
> > _______________________________________________
> > BioRuby Project - http://www.bioruby.org/
> > BioRuby mailing list
> > BioRuby at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioruby
> 
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
> 


From rutgeraldo at gmail.com  Tue May 10 13:43:22 2011
From: rutgeraldo at gmail.com (Rutger Vos)
Date: Tue, 10 May 2011 14:43:22 +0100
Subject: [BioRuby] Announcement: Registration open for Computational
	Phyloinformatics course
Message-ID: <BANLkTimmEpW+22Es4uw8-xSsiatnBx678A@mail.gmail.com>

COMPUTATIONAL PHYLOINFORMATICS
August 1 2011 through August 11 2011
Bioinformatics Center of Kyoto University
Application Deadline:  May 31, 2011

http://academy.nescent.org/wiki/Computational_phyloinformatics

Computational Phyloinformatics is an 11-day international course
(August 1-11, 2011) co-organized by the Computational Biology Research
Center (CBRC/AIST), the Bioinformatics Center of Kyoto University, the
Database Center for Life Science (DBCLS/JST), and the National
Evolutionary Synthesis Center (NESCent).  This course, which will take
place at Kyoto University directly following the SMBE Meeting
(http://smbe2011.com/), aims to give participants practical knowledge
and hands-on skills in phyloinformatics.

The venue in Kyoto is completely unaffected by the unfortunate events
in Fukushima and the power shortages in Tokyo. We encourage biologists
from other countries to participate in the SMBE meeting and/or this
special international course, in solidarity with the scientific
community of Japan in their effort to return to normalcy and to help
minimize any negative impacts that the earthquake may have on
scientific activities in Japan.

SYNOPSIS
Biologists are faced with ever-larger datasets, more complex
evolutionary models, and increasingly elaborate analytical methods.
Seldom is it sufficient to run a dataset with an off-the-shelf program
on a desktop PC; increasingly, biologists need to write scripts to
interface with internet services and databases, build analytical
pipelines, customize analyses, and distribute computation over
multiple processors.  This course is designed for graduate students,
postdocs, faculty, and researchers in phylogenetics interested in
receiving practical, hands-on training in the use of Perl and SQL for
workflows and applications in phyloinformatics.

The course is divided into four parts:

PART I: A tutorial review of Perl, including object oriented
programming and building packages.

PART II: Introduction and practical use of BioPerl and Bio::Phylo,
(e.g. scripting for large tree inference engines, automating model
testing, genomic-scale data mining and acquisition, supertree
assembly, rate smoothing and branch calibration, tree traversal, etc).

PART III: Introduction and practical use of BioRuby for molecular
evolution and functional genomics  (e.g. scripting multiple sequence
alignment, gene duplication inference, tree inference, etc.).

PART IV: Introduction to SQL and database design; computing and
querying nested sets and transitive closure; querying both large trees
(e.g. NCBI) and large collections of trees (e.g. TreeBASE).

Participants  will learn how to write basic phylogenetic or
comparative analysis scripts, parse NEXUS files, traverse and compute
over trees, and make practical use of phylogenetic software libraries.
 These skills will be learned in a biological context, touching on a
diverse array of topics such as analysis of large datasets, automation
of supertree assembly, querying for topological patterns in large
collections of trees, etc. Participants will leave the course with a
full set of installations and libraries on their computer ready to
build phyloinformatic workflows for their own research projects, as
well as continued access to a 50+ page wiki "textbook" containing
step-by-step instructions, problem sets, and examples.

INSTRUCTORS AND COURSE ORGANIZERS
Christian Zmasek, Karen Cranston, Rutger A. Vos, Susumu Goto, Toshiaki
Katayama, William H. Piel

APPLICATION DEADLINE
May 31, 2011

TUITION
?40,000 (~$500)

Participants are responsible for their own travel costs, including
transportation and accommodation -- see the website for more
information. International participants will benefit by combining
attendance with the 2011 SMBE meeting. A limited number of travel
scholarships from NESCent are available for US-based students.
Preference will be given to students from under-represented
minorities.

SUBSIDIES AND SCHOLARSHIPS
A limited number of travel scholarships from NESCent are available for
US-based students. Preference will be given to students from
under-represented minorities.

The Asia-Pacific Bioinformatics Network (APBioNet) is happy to provide
travel assistance for a limited number of students/early career
researchers from the Asia-Pacific region. Applicants are requested to
contact Dr Asif Khan, APBioNet Secretariat: asif -$- bic.nus.edu.sg
(replace -$- with @) for details.

PREREQUISITES

BIOLOGY: A good understanding of phylogenetics ? for example, having
already taken the Workshop on Molecular Evolution
(http://www.molecularevolution.org/) or equivalent coursework or
experience.

COMPUTING: Prior experience with Perl or careful study of the
suggested reading materials in advance of the class (see web site).
Participants should have some experience with basic Unix shell
commands.

EQUIPMENT: Participants are expected to bring their own Mac OSX
computer or a LINUX computer, else they will be provided with an iMac.
Participants who cannot bring their own computer and will be using a
supplied iMac, should consider bringing their own portable
firewire/usb drive so that they can also leave the course with a full
suite of phyloinformatic software tools.

-- 
Dr. Rutger A. Vos
School of Biological Sciences
Philip Lyle Building, Level 4
University of Reading
Reading
RG6 6BX
United Kingdom
Tel: +44 (0) 118 378 7535
http://www.nexml.org
http://rutgervos.blogspot.com



From bonnal at ingm.org  Thu May 12 11:42:39 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Thu, 12 May 2011 13:42:39 +0200
Subject: [BioRuby] Update bio-ngs, bio-gem and GSoC
Message-ID: <9738531A-A9E5-4BCD-BC4F-76EAC98BE86D@ingm.org>

Dear All,
this is an update on our activities biongs, biogem and GSoC
As you already know, BioRuby has one project accepted:
bio-objects http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Represent_bio-objects_and_related_information_with_images, Michal is the student assigned to this project.
The other candidate student Ales wants to work on his proposal bioruby wrapper http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#BioRuby_Wrapper_for_Command_line_application
To optimize the time I think that we can fix a weekly meeting before or after the thursday BioRuby IRC meeting writing directly into bioruby's channel, obviously the students can write on ml and contact the mentors by irc,skype,ml etc... I think that this approach is useful also for other bioruby devs to be up to date and take part in the GSoC, because an idea/opinion is better than nothing, so your contribute is appreciated.

bio-gem: 
* I added the possibility to create an embedded database when you create a gem, some code has been borrowed from Rails and adapted to our needs
https://github.com/helios/bioruby-gem/tree/db_tasks
I'll merge this branch (db_tasks) in master, next week
Docs improved.

* rails_engines is working but not yet in master


bio-ngs & related subproject (bwa, samtools)
* wrapper is more robust now
* samtools now can be used directly from the binding https://github.com/helios/bioruby-samtools or from the wrapper. Why ? Because not all the functionalities have been bound, some time it's too complicated (see merge) So I wrote the wrapper https://github.com/helios/bioruby-ngs/blob/master/lib/bio/appl/ngs/samtools.rb
** samtools now is not shipped with precompiled library anymore, now it downloads and compiles the l library for the hist OS during the gem install ... I think that when possible we'll follow this approach.
** ricardo and dan agreed with us to have a common repository, working in that direction...
* Francesco did a great job with bwa and implementing Homology and Ontology classes and tasks to work with homology searches (i.e. blast) and Gene Ontology datasets for annotations and functional analysis. All these classes work 
with a dedicated database to store and manipulate the data.


Our abstract has been accepted for a BOSC talk, we are very happy because BioRuby will the @BOSC another time, it's a great chance to meet you and share thoughts with guys from other bio* projects.
You can download the abstract here: http://dl.dropbox.com/u/16636340/bioruby-ngs_BOSC-2011-FS-TKTYM-13-04-11-Final.pdf
They asked to talk about biogem and parallel processing as well :-) As above great chance to share ideas and experience.
We'll be @ISMB as well with 2 posters (actually we'll have a poster @BOSC too)


In these days I'm working on implementing a bio-gex class to handle gene expression datasets, it uses statsample (Claudio) to handle matrixes etc.., mostly coming from rnaseq ngs(priority) and from rtpcr, https://github.com/helios/bioruby-gex. It's an experiment but I think it could be useful, it's not a R replacement. The repo: https://github.com/helios/bioruby-gex

TODO
* write a lot of test on biongs
* refactor
* generalize some taks because we are developing them from our day by day work so it inevitably that we (mostly me, because Francesco is more precise than me :-) ) write biased code
* ....

Just a reminder for every one,  if you are going to create a new gem for bioruby please try to follow bioruby's original namespace this will help core developers to integrate plugin's code into the main repository if needed.

Cheers.

--
The only change to succeed is starting from a simple thing.



From philipp.comans at googlemail.com  Fri May 13 15:50:06 2011
From: philipp.comans at googlemail.com (Philipp Comans)
Date: Fri, 13 May 2011 17:50:06 +0200
Subject: [BioRuby] Discontiguous Megablast from BioRuby
Message-ID: <46DBDF1DDBBB429D9372E3D815A15F72@googlemail.com>

Hi everyone,

I would like to perform a discontiguous megablast against a local blast database using Bio::Blast.
As I understand, BioRuby 1.4.1 uses blastall from the legacy blast toolkit. This version does not support dc-megablast although I could be mistaken.
Is it possible to perform a dc-megablast from BioRuby? Is there a way to call blastn from the new blast+ toolkit?

Any help would be greatly appreciated!

Best,

Philipp 


From email2ants at gmail.com  Mon May 16 09:07:47 2011
From: email2ants at gmail.com (Anthony Underwood)
Date: Mon, 16 May 2011 10:07:47 +0100
Subject: [BioRuby] Bio::Sequence and Bio::Sequence::NA
Message-ID: <6226C785-DF3B-45BA-887A-DD80AAEBFACD@gmail.com>

Here's something that has alway puzzled me about BioRuby

If I start with a Bio::EMBL object and want to extract the features I can do the following

biosequence = embl_object.to_biosequence

This returns an instance of a Bio::Sequence class. I can now access the features

features = biosequence.features

However if the sequence is nucleotide and I want to translate it I have to do the following

biosequence.na 

OR

biosequence = biosequence.auto


This returns a Bio::Sequence::NA instance and I can now translate

protein = biosequence.translate(1,11)


Why can I not now get at the features

biosequence.features #=> undefined method `features' for #<Bio::Sequence::NA:0x00000100cae5f8>


I would have though that after converting to Bio::Sequence::NA or Bio::Sequence:AA the methods available to Bio::Sequence should still be available.

Can anyone tell me what's going on here. Is there another method I should use?


Thanks

Anthony


From ktym at hgc.jp  Tue May 17 01:33:41 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Tue, 17 May 2011 10:33:41 +0900
Subject: [BioRuby] Bio::Sequence and Bio::Sequence::NA
In-Reply-To: <6226C785-DF3B-45BA-887A-DD80AAEBFACD@gmail.com>
References: <6226C785-DF3B-45BA-887A-DD80AAEBFACD@gmail.com>
Message-ID: <B446AF2E-B479-48D7-B07C-8875E05A42DE@hgc.jp>

Hi Anthony,

Bio::Sequence is a generic container class for a sequence with features which was
introduced relatively recently for interconversion of Bio::GenBank, Bio::EMBL and
Bio::SQL sequence objects (and it also provides common APIs for those seq objects).

Bio::Sequence#na or #auto method extract a sequence from a Bio::Sequence object, so
you should use another variable to store (instead of overriding the object reference).

> biosequence = biosequence.auto

seq = biosequence.auto

so that you can still access to biosequence.features.

% bioruby
bioruby> embl = Bio::EMBL.new(open("http://togows.dbcls.jp/entry/embl/J00231").read)
bioruby> embl.class
  ==> Bio::EMBL
bioruby> embl_bioseq = embl.to_biosequence
bioruby> embl_bioseq.class
  ==> Bio::Sequence
bioruby> embl_seq = embl_bioseq.auto
bioruby> embl_seq.class
  ==> Bio::Sequence::NA

Toshiaki


On 2011/05/16, at 18:07, Anthony Underwood wrote:

> Here's something that has alway puzzled me about BioRuby
> 
> If I start with a Bio::EMBL object and want to extract the features I can do the following
> 
> biosequence = embl_object.to_biosequence
> 
> This returns an instance of a Bio::Sequence class. I can now access the features
> 
> features = biosequence.features
> 
> However if the sequence is nucleotide and I want to translate it I have to do the following
> 
> biosequence.na 
> 
> OR
> 
> biosequence = biosequence.auto
> 
> 
> This returns a Bio::Sequence::NA instance and I can now translate
> 
> protein = biosequence.translate(1,11)
> 
> 
> Why can I not now get at the features
> 
> biosequence.features #=> undefined method `features' for #<Bio::Sequence::NA:0x00000100cae5f8>
> 
> 
> I would have though that after converting to Bio::Sequence::NA or Bio::Sequence:AA the methods available to Bio::Sequence should still be available.
> 
> Can anyone tell me what's going on here. Is there another method I should use?
> 
> 
> Thanks
> 
> Anthony
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby




From email2ants at gmail.com  Tue May 17 20:06:37 2011
From: email2ants at gmail.com (Anthony Underwood)
Date: Tue, 17 May 2011 21:06:37 +0100
Subject: [BioRuby] Bio::Sequence and Bio::Sequence::NA
In-Reply-To: <B446AF2E-B479-48D7-B07C-8875E05A42DE@hgc.jp>
References: <6226C785-DF3B-45BA-887A-DD80AAEBFACD@gmail.com>
	<B446AF2E-B479-48D7-B07C-8875E05A42DE@hgc.jp>
Message-ID: <BANLkTim_SwZ0LKCdS8_jLdZiGBLCiOivGA@mail.gmail.com>

Dear Toshiaki

Thank you for your reply.

I have just tested your code below and all worked OK. I have
found unexpectedly that embl_bioseq.translate works even though
embl_bioseq.methods does not list translate as an available method.
What extra methods does a Bio::Sequence::NA object instantiated using the
auto method give?

Thanks again for your advice, Anthony

On 17 May 2011 02:33, Toshiaki Katayama <ktym at hgc.jp> wrote:

> Hi Anthony,
>
> Bio::Sequence is a generic container class for a sequence with features
> which was
> introduced relatively recently for interconversion of Bio::GenBank,
> Bio::EMBL and
> Bio::SQL sequence objects (and it also provides common APIs for those seq
> objects).
>
> Bio::Sequence#na or #auto method extract a sequence from a Bio::Sequence
> object, so
> you should use another variable to store (instead of overriding the object
> reference).
>
> > biosequence = biosequence.auto
>
> seq = biosequence.auto
>
> so that you can still access to biosequence.features.
>
> % bioruby
> bioruby> embl = Bio::EMBL.new(open("
> http://togows.dbcls.jp/entry/embl/J00231").read)
> bioruby> embl.class
>  ==> Bio::EMBL
> bioruby> embl_bioseq = embl.to_biosequence
> bioruby> embl_bioseq.class
>  ==> Bio::Sequence
> bioruby> embl_seq = embl_bioseq.auto
> bioruby> embl_seq.class
>  ==> Bio::Sequence::NA
>
> Toshiaki
>
>
> On 2011/05/16, at 18:07, Anthony Underwood wrote:
>
> > Here's something that has alway puzzled me about BioRuby
> >
> > If I start with a Bio::EMBL object and want to extract the features I can
> do the following
> >
> > biosequence = embl_object.to_biosequence
> >
> > This returns an instance of a Bio::Sequence class. I can now access the
> features
> >
> > features = biosequence.features
> >
> > However if the sequence is nucleotide and I want to translate it I have
> to do the following
> >
> > biosequence.na
> >
> > OR
> >
> > biosequence = biosequence.auto
> >
> >
> > This returns a Bio::Sequence::NA instance and I can now translate
> >
> > protein = biosequence.translate(1,11)
> >
> >
> > Why can I not now get at the features
> >
> > biosequence.features #=> undefined method `features' for
> #<Bio::Sequence::NA:0x00000100cae5f8>
> >
> >
> > I would have though that after converting to Bio::Sequence::NA or
> Bio::Sequence:AA the methods available to Bio::Sequence should still be
> available.
> >
> > Can anyone tell me what's going on here. Is there another method I should
> use?
> >
> >
> > Thanks
> >
> > Anthony
> > _______________________________________________
> > BioRuby Project - http://www.bioruby.org/
> > BioRuby mailing list
> > BioRuby at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioruby
>
>


From ktym at hgc.jp  Tue May 17 20:53:18 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Wed, 18 May 2011 05:53:18 +0900
Subject: [BioRuby] Bio::Sequence and Bio::Sequence::NA
In-Reply-To: <BANLkTim_SwZ0LKCdS8_jLdZiGBLCiOivGA@mail.gmail.com>
References: <6226C785-DF3B-45BA-887A-DD80AAEBFACD@gmail.com>
	<B446AF2E-B479-48D7-B07C-8875E05A42DE@hgc.jp>
	<BANLkTim_SwZ0LKCdS8_jLdZiGBLCiOivGA@mail.gmail.com>
Message-ID: <0992ED00-7DF5-4BCE-926B-8E615E77DB36@hgc.jp>

Hi Anthony,

In lib/bio/sequence.rb, you can find the definition of "method_missing".

  # Pass any unknown method calls to the wrapped sequence object.  see
  # http://www.rubycentral.com/book/ref_c_object.html#Object.method_missing
  def method_missing(sym, *args, &block) #:nodoc:
    begin
      seq.__send__(sym, *args, &block)

   :

  # The sequence object, usually Bio::Sequence::NA/AA, 
  # but could be a simple String
  attr_accessor :seq

This means any methods which are not understood by the Bio::Sequence object
are simply redirected to the internal sequence object.

Therefore, if the sequence object is a Bio::Sequence::NA instance, it will
respond to any methods implemented in the Bio::Sequence::NA class (and mix-ins).

Older versions were much simpler but the internal code gets complicated over time
to improve usability and functionality. Hopefully, it should be clearly documented.

Cheers,
Toshiaki

On 2011/05/18, at 5:06, Anthony Underwood wrote:

> Dear Toshiaki
> 
> Thank you for your reply.
> 
> I have just tested your code below and all worked OK. I have found unexpectedly that embl_bioseq.translate works even though embl_bioseq.methods does not list translate as an available method. 
> What extra methods does a Bio::Sequence::NA object instantiated using the auto method give?
> 
> Thanks again for your advice, Anthony
> 
> On 17 May 2011 02:33, Toshiaki Katayama <ktym at hgc.jp> wrote:
> Hi Anthony,
> 
> Bio::Sequence is a generic container class for a sequence with features which was
> introduced relatively recently for interconversion of Bio::GenBank, Bio::EMBL and
> Bio::SQL sequence objects (and it also provides common APIs for those seq objects).
> 
> Bio::Sequence#na or #auto method extract a sequence from a Bio::Sequence object, so
> you should use another variable to store (instead of overriding the object reference).
> 
> > biosequence = biosequence.auto
> 
> seq = biosequence.auto
> 
> so that you can still access to biosequence.features.
> 
> % bioruby
> bioruby> embl = Bio::EMBL.new(open("http://togows.dbcls.jp/entry/embl/J00231").read)
> bioruby> embl.class
>  ==> Bio::EMBL
> bioruby> embl_bioseq = embl.to_biosequence
> bioruby> embl_bioseq.class
>  ==> Bio::Sequence
> bioruby> embl_seq = embl_bioseq.auto
> bioruby> embl_seq.class
>  ==> Bio::Sequence::NA
> 
> Toshiaki
> 
> 
> On 2011/05/16, at 18:07, Anthony Underwood wrote:
> 
> > Here's something that has alway puzzled me about BioRuby
> >
> > If I start with a Bio::EMBL object and want to extract the features I can do the following
> >
> > biosequence = embl_object.to_biosequence
> >
> > This returns an instance of a Bio::Sequence class. I can now access the features
> >
> > features = biosequence.features
> >
> > However if the sequence is nucleotide and I want to translate it I have to do the following
> >
> > biosequence.na
> >
> > OR
> >
> > biosequence = biosequence.auto
> >
> >
> > This returns a Bio::Sequence::NA instance and I can now translate
> >
> > protein = biosequence.translate(1,11)
> >
> >
> > Why can I not now get at the features
> >
> > biosequence.features #=> undefined method `features' for #<Bio::Sequence::NA:0x00000100cae5f8>
> >
> >
> > I would have though that after converting to Bio::Sequence::NA or Bio::Sequence:AA the methods available to Bio::Sequence should still be available.
> >
> > Can anyone tell me what's going on here. Is there another method I should use?
> >
> >
> > Thanks
> >
> > Anthony
> > _______________________________________________
> > BioRuby Project - http://www.bioruby.org/
> > BioRuby mailing list
> > BioRuby at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioruby
> 
> 




From daijiendoh at gmail.com  Thu May 19 01:04:24 2011
From: daijiendoh at gmail.com (=?ISO-2022-JP?B?GyRCMXNGI0JnRnMbKEI=?=)
Date: Thu, 19 May 2011 10:04:24 +0900
Subject: [BioRuby] Disk cash on the parse genes
Message-ID: <BANLkTinYY=RjL=jSmNp6Uq0V++QjU-o_Xw@mail.gmail.com>

Dear All

I often download whole genbank data from bio at mirror ( such as
gbbct12.seq ) and parse them.
But recently, parsing the whole data became to be difficult. On some
some step, the program need a long time to select nucleic acid
sequences of genes or transcripts. It seems that selection of spliced
or partial sequences from a long (genome) nucleic acid sequence using
feature data.

Anyone have strategies or methods avoiding these heavy steps ?

Daiji Endoh
Rakuno Gakuen University


From R.A.Vos at reading.ac.uk  Thu May 19 11:22:43 2011
From: R.A.Vos at reading.ac.uk (Rutger Vos)
Date: Thu, 19 May 2011 12:22:43 +0100
Subject: [BioRuby] 10 days left to register: workshop phylogenetic pipelines,
	August 1-11
Message-ID: <BANLkTimAQZP9BiTfhZMJ4=8c0_66xb-F0A@mail.gmail.com>

COMPUTATIONAL PHYLOINFORMATICS
August 1 2011 through August 11 2011
Bioinformatics Center of Kyoto University
Application Deadline:  May 31, 2011

http://academy.nescent.org/wiki/Computational_phyloinformatics

Computational Phyloinformatics is an 11-day international course
(August 1-11, 2011) co-organized by the Computational Biology Research
Center (CBRC/AIST), the Bioinformatics Center of Kyoto University, the
Database Center for Life Science (DBCLS/JST), and the National
Evolutionary Synthesis Center (NESCent).  This course, which will take
place at Kyoto University directly following the SMBE Meeting
(http://smbe2011.com/), aims to give participants practical knowledge
and hands-on skills in phyloinformatics.

The venue in Kyoto is completely unaffected by the unfortunate events
in Fukushima and the power shortages in Tokyo. We encourage biologists
from other countries to participate in the SMBE meeting and/or this
special international course, in solidarity with the scientific
community of Japan in their effort to return to normalcy and to help
minimize any negative impacts that the earthquake may have on
scientific activities in Japan.

SYNOPSIS
Biologists are faced with ever-larger datasets, more complex
evolutionary models, and increasingly elaborate analytical methods.
Seldom is it sufficient to run a dataset with an off-the-shelf program
on a desktop PC; increasingly, biologists need to write scripts to
interface with internet services and databases, build analytical
pipelines, customize analyses, and distribute computation over
multiple processors.  This course is designed for graduate students,
postdocs, faculty, and researchers in phylogenetics interested in
receiving practical, hands-on training in the use of Perl and SQL for
workflows and applications in phyloinformatics.

The course is divided into four parts:

PART I: A tutorial review of Perl, including object oriented
programming and building packages.

PART II: Introduction and practical use of BioPerl and Bio::Phylo,
(e.g. scripting for large tree inference engines, automating model
testing, genomic-scale data mining and acquisition, supertree
assembly, rate smoothing and branch calibration, tree traversal, etc).

PART III: Introduction and practical use of BioRuby for molecular
evolution and functional genomics  (e.g. scripting multiple sequence
alignment, gene duplication inference, tree inference, etc.).

PART IV: Introduction to SQL and database design; computing and
querying nested sets and transitive closure; querying both large trees
(e.g. NCBI) and large collections of trees (e.g. TreeBASE).

Participants  will learn how to write basic phylogenetic or
comparative analysis scripts, parse NEXUS files, traverse and compute
over trees, and make practical use of phylogenetic software libraries.
 These skills will be learned in a biological context, touching on a
diverse array of topics such as analysis of large datasets, automation
of supertree assembly, querying for topological patterns in large
collections of trees, etc. Participants will leave the course with a
full set of installations and libraries on their computer ready to
build phyloinformatic workflows for their own research projects, as
well as continued access to a 50+ page wiki "textbook" containing
step-by-step instructions, problem sets, and examples.

INSTRUCTORS AND COURSE ORGANIZERS
Christian Zmasek, Karen Cranston, Rutger A. Vos, Susumu Goto, Toshiaki
Katayama, William H. Piel

APPLICATION DEADLINE
May 31, 2011

TUITION
?40,000 (~$500)

Participants are responsible for their own travel costs, including
transportation and accommodation -- see the website for more
information. International participants will benefit by combining
attendance with the 2011 SMBE meeting. A limited number of travel
scholarships from NESCent are available for US-based students.
Preference will be given to students from under-represented
minorities.

SUBSIDIES AND SCHOLARSHIPS
A limited number of travel scholarships from NESCent are available for
US-based students. Preference will be given to students from
under-represented minorities.

The Asia-Pacific Bioinformatics Network (APBioNet) is happy to provide
travel assistance for a limited number of students/early career
researchers from the Asia-Pacific region. Applicants are requested to
contact Dr Asif Khan, APBioNet Secretariat: asif -$- bic.nus.edu.sg
(replace -$- with @) for details.

PREREQUISITES

BIOLOGY: A good understanding of phylogenetics ? for example, having
already taken the Workshop on Molecular Evolution
(http://www.molecularevolution.org/) or equivalent coursework or
experience.

COMPUTING: Prior experience with Perl or careful study of the
suggested reading materials in advance of the class (see web site).
Participants should have some experience with basic Unix shell
commands.

EQUIPMENT: Participants are expected to bring their own Mac OSX
computer or a LINUX computer, else they will be provided with an iMac.
Participants who cannot bring their own computer and will be using a
supplied iMac, should consider bringing their own portable
firewire/usb drive so that they can also leave the course with a full
suite of phyloinformatic software tools.

-- 
Dr. Rutger A. Vos
School of Biological Sciences
Philip Lyle Building, Level 4
University of Reading
Reading, RG6 6BX, United Kingdom
Tel: +44 (0) 118 378 7535
http://rutgervos.blogspot.com



From ktym at hgc.jp  Fri May 20 06:31:13 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Fri, 20 May 2011 15:31:13 +0900
Subject: [BioRuby] Disk cash on the parse genes
In-Reply-To: <BANLkTinYY=RjL=jSmNp6Uq0V++QjU-o_Xw@mail.gmail.com>
References: <BANLkTinYY=RjL=jSmNp6Uq0V++QjU-o_Xw@mail.gmail.com>
Message-ID: <4DD023E9-9FBE-4A38-AE9C-A19FD4751CDF@hgc.jp>

Dear Endoh-san,

Thank you for pointing this problem out.

I tried to parse gbbct12.seq file with the example code based on
our tutorial at http://bioruby.open-bio.org/wiki/Tutorial and found
that the actual problem is in the multiple calling of the gb.naseq method.

The method is defined as shown in below and which doesn't cache
the generated Bio::Sequence::NA object, therefore, it will take
long time if called multiple times, especially for a long sequence.

bio/db/genbank/genbank.rb:
  def seq
    unless @data['SEQUENCE']
      origin
    end
    Bio::Sequence::NA.new(@data['SEQUENCE'])
  end
  alias naseq seq

If I store the object outside of the loop of feature manipulation,
it became much faster.

% ruby gbparse.rb gbbct12.seq > gbbct12.out 2> gbbct12.err
Parsed 16125 entries in 1645.838824 sec.

% ruby gbparse_new.rb gbbct12.seq > gbbct12.out_new 2> gbbct12.err_new
Parsed 16125 entries in 39.012607 sec.

Based on this observation, could you check the algorithm of your code?

Regards,
Toshiaki Katayama

-------------- next part --------------




On 2011/05/19, at 10:04, ???? wrote:

> Dear All
> 
> I often download whole genbank data from bio at mirror ( such as
> gbbct12.seq ) and parse them.
> But recently, parsing the whole data became to be difficult. On some
> some step, the program need a long time to select nucleic acid
> sequences of genes or transcripts. It seems that selection of spliced
> or partial sequences from a long (genome) nucleic acid sequence using
> feature data.
> 
> Anyone have strategies or methods avoiding these heavy steps ?
> 
> Daiji Endoh
> Rakuno Gakuen University
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby


From daijiendoh at gmail.com  Sat May 21 05:33:58 2011
From: daijiendoh at gmail.com (=?ISO-2022-JP?B?GyRCMXNGI0JnRnMbKEI=?=)
Date: Sat, 21 May 2011 14:33:58 +0900
Subject: [BioRuby] Fwd:  Disk cash on the parse genes
In-Reply-To: <4DD023E9-9FBE-4A38-AE9C-A19FD4751CDF@hgc.jp>
References: <BANLkTinYY=RjL=jSmNp6Uq0V++QjU-o_Xw@mail.gmail.com>
	<4DD023E9-9FBE-4A38-AE9C-A19FD4751CDF@hgc.jp>
Message-ID: <BANLkTik2wbsDhAG0AmMR1mVcy_2wnxfOog@mail.gmail.com>

Dear Katayama-san

I am very very grateful to your suggestion. I have been struggled on
this problem for 6 months.
Using your code, I can overcome the problem.

But, only one point the code stopped.
If the feature.position refer to the other entry such as
"join(M52614.1:1..1456,5216..5823), the code returned a error.
So I added a line below.

next if position =~ /[A-Z]+\d+\W*\d*\:/

The inserting code now working.
I attached the modified code.
Thanks again,

Daiji Endoh
************************************************************************
Dear Endoh-san,

Thank you for pointing this problem out.

I tried to parse gbbct12.seq file with the example code based on
our tutorial at http://bioruby.open-bio.org/wiki/Tutorial and found
that the actual problem is in the multiple calling of the gb.naseq method.

The method is defined as shown in below and which doesn't cache
the generated Bio::Sequence::NA object, therefore, it will take
long time if called multiple times, especially for a long sequence.

bio/db/genbank/genbank.rb:
 def seq
   unless @data['SEQUENCE']
     origin
   end
   Bio::Sequence::NA.new(@data['SEQUENCE'])
 end
 alias naseq seq

If I store the object outside of the loop of feature manipulation,
it became much faster.

% ruby gbparse.rb gbbct12.seq > gbbct12.out 2> gbbct12.err
Parsed 16125 entries in 1645.838824 sec.

% ruby gbparse_new.rb gbbct12.seq > gbbct12.out_new 2> gbbct12.err_new
Parsed 16125 entries in 39.012607 sec.

Based on this observation, could you check the algorithm of your code?

Regards,
Toshiaki Katayama
****************************************************************************************


On 2011/05/19, at 10:04, ???? wrote:

> Dear All
>
> I often download whole genbank data from bio at mirror ( such as
> gbbct12.seq ) and parse them.
> But recently, parsing the whole data became to be difficult. On some
> some step, the program need a long time to select nucleic acid
> sequences of genes or transcripts. It seems that selection of spliced
> or partial sequences from a long (genome) nucleic acid sequence using
> feature data.
>
> Anyone have strategies or methods avoiding these heavy steps ?
>
> Daiji Endoh
> Rakuno Gakuen University
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby





-- 
??????????????????
????
?069-8501????????????582
Tel: 011-388-4847
Fax:011-387-5890

From ktym at hgc.jp  Mon May 23 03:28:08 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Mon, 23 May 2011 12:28:08 +0900
Subject: [BioRuby] Fwd:  Disk cash on the parse genes
In-Reply-To: <BANLkTik2wbsDhAG0AmMR1mVcy_2wnxfOog@mail.gmail.com>
References: <BANLkTinYY=RjL=jSmNp6Uq0V++QjU-o_Xw@mail.gmail.com>
	<4DD023E9-9FBE-4A38-AE9C-A19FD4751CDF@hgc.jp>
	<BANLkTik2wbsDhAG0AmMR1mVcy_2wnxfOog@mail.gmail.com>
Message-ID: <EE8586E1-6874-4BA5-9911-5184AF541ACD@hgc.jp>

Dear Endoh-san,

> Using your code, I can overcome the problem.

Good!

> "join(M52614.1:1..1456,5216..5823), the code returned a error.

External reference should be detected by the Bio::Location class
and the ID will be stored in an instance variable @xref_id,
however, how to deal with it is up to users, so you need to implement
some code to fetch external entry (in this case @xref_id="M52614.1") from
available services (local DB or web service etc.) and extract
the sub-sequence from the entry.

Please take a look at pattern (G) in the documentation.
  http://bioruby.open-bio.org/rdoc/classes/Bio/Locations.html

Unfortunately, I've got an unexplained "Exception" error from NCBI
when retrieving http://www.ncbi.nlm.nih.gov/nuccore?term=M52614.1
so, I'll use "join(U75473.1:1..293,1..216)" found in a GenBank entry
SMMFD02 (gbbct65.seq) for example.

# obtain a genbank record
bioruby> entry = getobj("genbank:SMMFD02")
 or
bioruby> entry = Bio::GenBank.new(open("http://togows.dbcls.jp/entry/ncbi-genbank/SMMFD02").read)

# cache whole sequence as we learnt in this thread :-)
bioruby> naseq = entry.naseq

# pick up "gene" features only
bioruby> genes = entry.features.select {|x| x.feature == "gene" }
  ==> [#<Bio::Feature:0x102340870
  @feature="gene",
  @position="join(U75473.1:1..293,1..216)",
  @qualifiers=
   [#<Bio::Feature::Qualifier:0x102340280 @qualifier="gene", @value="mfd">]>]

# example to handle external references in a given position
bioruby> genes.each do |gene|
  locations = Bio::Locations.new(gene.position)
  locations.each do |location|
    if xref = location.xref_id
      xref_entry = open("http://togows.dbcls.jp/entry/ncbi-genbank/#{xref}").read
      location.sequence = Bio::GenBank.new(xref_entry).naseq.subseq(location.from, location.to)
    end
  end
  gene.position = locations.to_s    # (*1)
  puts naseq.splice(gene.position)  # (*2)
end

(*1) will generate the following string

join(replace(U75473.1:1..293,"gtcttcttgttggtgatgttggttttggaaaaacggaagtagcgatgagagctgcttttaaagcagttaatgatgataaacaagttgctgttttggtgccaacaacagttcttgctcaacagcactataatacttttaaggagcgctttgaaaattttcctgtcaatgttgccatgatgagtcgttttaaaaccaagactgaacagtctgaaacgttaactaaattagctaagggacaggttgatatcattattggaacacatcgtctactttctaaagatgttacgtttaaa"),1..216)

(*2) will return 293 + 216 = 509 bp sequence

gtcttcttgttggtgatgttggttttggaaaaacggaagtagcgatgagagctgcttttaaagcagttaatgatgataaacaagttgctgttttggtgccaacaacagttcttgctcaacagcactataatacttttaaggagcgctttgaaaattttcctgtcaatgttgccatgatgagtcgttttaaaaccaagactgaacagtctgaaacgttaactaaattagctaagggacaggttgatatcattattggaacacatcgtctactttctaaagatgttacgtttaaaggggttaaacacaaggaaacattgaaagaattaaaaactaaggttgatgtcttgaccttgacagcaactcctattccacggacattacatatgtctatgcttggtatacgagatttatcagttattgaaacacctccaagtaatcgttaccctgtccagacttatgttatggaaacaaatgcaagtgtcattcgtgaagctattatgcgtgaaatt

During this trial, I found a bug in the Bio::Sequence#splice method.

bio/sequence/common.rb:
  def splice(position)
    unless position.is_a?(Locations) then
      position = Locations.new(position)
    end
    s = ''
    position.each do |location|
      if location.sequence
        s << location.sequence
      else  # <----- (*3)
        exon = self.subseq(location.from, location.to)
        begin
          exon.complement! if location.strand < 0
        rescue NameError
        end
        s << exon
      end
    end
    return self.class.new(s)
  end
  alias splicing splice

We need to fix this else block (*3) to mind if @xref_id exists or not.
Currently, "join(U75473.1:1..293,1..216)" will be treated as
"join(1..293,1..216)" and, obviously, it is not feasible.


Toshiaki

On 2011/05/21, at 14:33, ???? wrote:

> Dear Katayama-san
> 
> I am very very grateful to your suggestion. I have been struggled on
> this problem for 6 months.
> Using your code, I can overcome the problem.
> 
> But, only one point the code stopped.
> If the feature.position refer to the other entry such as
> "join(M52614.1:1..1456,5216..5823), the code returned a error.
> So I added a line below.
> 
> next if position =~ /[A-Z]+\d+\W*\d*\:/
> 
> The inserting code now working.
> I attached the modified code.
> Thanks again,
> 
> Daiji Endoh
> ************************************************************************
> Dear Endoh-san,
> 
> Thank you for pointing this problem out.
> 
> I tried to parse gbbct12.seq file with the example code based on
> our tutorial at http://bioruby.open-bio.org/wiki/Tutorial and found
> that the actual problem is in the multiple calling of the gb.naseq method.
> 
> The method is defined as shown in below and which doesn't cache
> the generated Bio::Sequence::NA object, therefore, it will take
> long time if called multiple times, especially for a long sequence.
> 
> bio/db/genbank/genbank.rb:
> def seq
>   unless @data['SEQUENCE']
>     origin
>   end
>   Bio::Sequence::NA.new(@data['SEQUENCE'])
> end
> alias naseq seq
> 
> If I store the object outside of the loop of feature manipulation,
> it became much faster.
> 
> % ruby gbparse.rb gbbct12.seq > gbbct12.out 2> gbbct12.err
> Parsed 16125 entries in 1645.838824 sec.
> 
> % ruby gbparse_new.rb gbbct12.seq > gbbct12.out_new 2> gbbct12.err_new
> Parsed 16125 entries in 39.012607 sec.
> 
> Based on this observation, could you check the algorithm of your code?
> 
> Regards,
> Toshiaki Katayama
> ****************************************************************************************
> 
> 
> On 2011/05/19, at 10:04, ???? wrote:
> 
>> Dear All
>> 
>> I often download whole genbank data from bio at mirror ( such as
>> gbbct12.seq ) and parse them.
>> But recently, parsing the whole data became to be difficult. On some
>> some step, the program need a long time to select nucleic acid
>> sequences of genes or transcripts. It seems that selection of spliced
>> or partial sequences from a long (genome) nucleic acid sequence using
>> feature data.
>> 
>> Anyone have strategies or methods avoiding these heavy steps ?
>> 
>> Daiji Endoh
>> Rakuno Gakuen University
>> _______________________________________________
>> BioRuby Project - http://www.bioruby.org/
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
> 
> 
> 
> 
> 
> -- 
> ??????????????????
> ????
> ?069-8501????????????582
> Tel: 011-388-4847
> Fax:011-387-5890
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby




From mictadlo at gmail.com  Wed May 25 21:10:26 2011
From: mictadlo at gmail.com (Michal)
Date: Thu, 26 May 2011 07:10:26 +1000
Subject: [BioRuby] BioRuby with Reia
Message-ID: <4DDD7042.9050708@gmail.com>

Hello,
would be possible to run BioRuby with Reia ( 
http://en.wikipedia.org/wiki/Reia_(programming_language) )?


From bonnal at ingm.org  Thu May 26 08:31:33 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Thu, 26 May 2011 10:31:33 +0200
Subject: [BioRuby] BioRuby with Reia
In-Reply-To: <4DDD7042.9050708@gmail.com>
References: <4DDD7042.9050708@gmail.com>
Message-ID: <10EFE5AC-BBA0-4113-9878-FD92C9ECF326@ingm.org>


On 25/mag/2011, at 23.10, Michal wrote:

> Hello,
> would be possible to run BioRuby with Reia ( http://en.wikipedia.org/wiki/Reia_(programming_language) )?
Don't know, which is the advantage ?

--
Ra



From pjotr.public14 at thebird.nl  Thu May 26 10:01:50 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Thu, 26 May 2011 12:01:50 +0200
Subject: [BioRuby] BioRuby with Reia
In-Reply-To: <10EFE5AC-BBA0-4113-9878-FD92C9ECF326@ingm.org>
References: <4DDD7042.9050708@gmail.com>
	<10EFE5AC-BBA0-4113-9878-FD92C9ECF326@ingm.org>
Message-ID: <20110526100149.GA19867@thebird.nl>

Reia is not Ruby compatible. Even if it has some similar Syntax. So,
BioRuby won't run on Reia.

Pj.

On Thu, May 26, 2011 at 10:31:33AM +0200, Raoul Bonnal wrote:
> 
> On 25/mag/2011, at 23.10, Michal wrote:
> 
> > Hello,
> > would be possible to run BioRuby with Reia ( http://en.wikipedia.org/wiki/Reia_(programming_language) )?
> Don't know, which is the advantage ?
> 
> --
> Ra
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
> 


From mictadlo at gmail.com  Sat May 28 23:47:49 2011
From: mictadlo at gmail.com (Michal)
Date: Sun, 29 May 2011 09:47:49 +1000
Subject: [BioRuby] samtools-ruby
In-Reply-To: <74EAEDFF-D8D0-42E0-93B8-51C4986CEC65@ingm.it>
References: <4D454E91.1080604@gmail.com>
	<A6CFF775-1E68-4FA1-A84F-8E489E2FCE96@ingm.it>
	<4D4A6459.5050205@gmail.com>
	<5B31A257-DDCB-4BBB-A201-B4D708E82BE0@kenroku.kanazawa-u.ac.jp>
	<4D4BB255.7030703@gmail.com>
	<A5D4BF72-1C38-4F66-A2BE-87B70A63E7F3@kenroku.kanazawa-u.ac.jp>
	<4D4BE242.2030408@gmail.com>
	<F5C4E670-1104-4FC1-A665-E5C36E31819F@kenroku.kanazawa-u.ac.jp>
	<4D4BFB7D.9070004@gmail.com>
	<74EAEDFF-D8D0-42E0-93B8-51C4986CEC65@ingm.it>
Message-ID: <4DE189A5.2010201@gmail.com>

Hello,
how is it possible to get the following pileup output with bioruby-samtools?

coverage at base 99 = 1
base in read EAS56_57:6:190:289:82 = A

coverage at base 100 = 1
base in read EAS56_57:6:190:289:82 = G

coverage at base 101 = 1
base in read EAS56_57:6:190:289:82 = G

coverage at base 102 = 2
base in read EAS56_57:6:190:289:82 = G
base in read EAS51_64:3:190:727:308 = G

I have found only a this python code :
import pysam
samfile = pysam.Samfile("ex1.bam", "rb" )
for pileupcolumn in samfile.pileup( 'chr1', 100, 120):
   print
   print 'coverage at base %s = %s' % (pileupcolumn.pos , pileupcolumn.n)
   for pileupread in pileupcolumn.pileups:
     print '\tbase in read %s = %s' % (pileupread.alignment.qname, 
pileupread.alignment.seq[pileupread.qpos])
samfile.close()

But do not know how to do it with Ruby.

Thank you in advance.



On 02/04/2011 11:57 PM, Raoul Bonnal wrote:
> In these days, w.e. too, I have no time for sam tools. From the next 
> week I could spend  more time on this project and improve test, 
> usability and platform supports.
>
>
>
> On 04/feb/2011, at 14.13, Michal wrote:
>
>> Hi,
>> I would be happy if would find out how to get on a particular 
>> position the alignment and then I could give feedback.
>>
>> Pysam http://code.google.com/p/pysam/ contains all files and tests.
>> ~/Downloads/pysam-0.3.1/tests$ ls
>> 00README.txt  ex4.sam  ex8.sam             Makefile
>> ex1.fa        ex5.sam  example.gtf.gz      pysam_test.py
>> ex1.sam.gz    ex6.sam  example.gtf.gz.tbi  segfault_tests.py
>> ex3.sam       ex7.sam  example.py          tabix_test.py
>>
>> Maybe it would be possible to test bioruby-samtools in the same way. 
>> Pysam is ship out with samtools source code and maybe could be used 
>> it for bioruby-samtools.
>>
>> Thank you in advance.
>>
>> Michal
>>
>>
>> On 02/04/2011 10:26 PM, Tomoaki NISHIYAMA wrote:
>>> Hi,
>>>
>>>> What I have forgotten to do?
>>>
>>> Now, you are at the point I reached yesterday and
>>> I don't think you have forgotten anything.
>>>
>>> From yesterday's mail:
>>>>   1) Failure:
>>>> test: BioSamtools should probably rename this file and start 
>>>> testing for real. (TestBioSamtools) [test/test_bio-samtools.rb:5]:
>>>> hey buddy, you should probably rename this file and start testing 
>>>> for real
>>>>
>>>> Loading seems ok.
>>>> I'm not sure if this is bad or ok.
>>>
>>> You could look at test/test_bio-samtools.rb
>>> $ cat test/test_bio-samtools.rb
>>> require 'helper'
>>>
>>> class TestBioSamtools < Test::Unit::TestCase
>>>   should "probably rename this file and start testing for real" do
>>>     flunk "hey buddy, you should probably rename this file and start 
>>> testing for real"
>>>   end
>>> end
>>>
>>> and guess what it means.
>>>
>>> My guess is that this is test not implemented yet.
>>> So, this error does not tell if the library function well or can not 
>>> used at all.
>>> You might just try what you wanted to do and see if it works.
>>>
>>>> I understand how difficult it is to keep track and it is a good 
>>>> idea to ship bioruby-samtools
>>>> with a working samtools version like Raoul does it.
>>>
>>> My view is the opposite.
>>> Since it potentially has many bugs and changes rapidly, bundled 
>>> shipping is ineffective.
>>> With the lack of test code, we cannot even tell which is a good 
>>> working version.
>>> --
>>> Tomoaki NISHIYAMA
>>>
>>> Advanced Science Research Center,
>>> Kanazawa University,
>>> 13-1 Takara-machi,
>>> Kanazawa, 920-0934, Japan
>>>
>>
>
> --
> R.J.P.B.
>
>
>