From ngoto at gen-info.osaka-u.ac.jp  Tue Mar  1 13:03:37 2011
From: ngoto at gen-info.osaka-u.ac.jp (Naohisa GOTO)
Date: Wed, 2 Mar 2011 03:03:37 +0900
Subject: [BioRuby] BestPracties for wrappers
In-Reply-To: <A3546D3B-CFB2-482A-AAEE-120F1C9058B5@ingm.it>
References: <A3546D3B-CFB2-482A-AAEE-120F1C9058B5@ingm.it>
Message-ID: <20110301180338.6EA601CBC418@idnmail.gen-info.osaka-u.ac.jp>

Hi Raoul,

There are choices about input/output data and the wrapper API.
It would depend on both desired design of the API and the
implementation of the program, and it is not easy to determine
what is really the best.

1. Input data of the wrapper API
 * Bio::* or Ruby object (e.g. Bio::Sequence object)
 * String containing data (e.g. fasta format sequence text)
 * File name as a String

2. How to pass input data to the program
 * Stdin
 * File name supplied as a command-line option
 * File name described in a configuration file

3. The way of passing optional parameters to the program
 * Stdin
 * Command-line arguments
 * Configuration file

4. How to get output data from the program
 * Stdout
 * Stderr
 * File name supplied as a command-line option
 * File name described in a configuration file
 * Fixed file name

5. Returned data type of the wrapper API
 * Bio::*::Report object for the program
 * String containing data (e.g. sequence alignment, newick tree)
 * Bio::* or Ruby object (e.g. Bio::Sequence)

For 1 and 5, input/output data format can be converted inside
the wrapper, and two or more choices can be accepted by using
separate API.

The 2,3 and 4 would depend on the program, but some program have
two or more ways to specify and to pass the input/output data.

I'd like to try to find ways to standardize and unify BioRuby
wrappers, but not yet implemented.

Naohisa Goto
ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org

On Mon, 28 Feb 2011 17:07:54 +0100
Raoul Bonnal <bonnalraoul at ingm.it> wrote:

> Dear Goto-san,
> if I would write a new wrapper for a new program, using Bio::Command libs, which are the best practies ?
> looking into the other wrappers the code is not always, let' say "standard"
> Could you give me some hints ?
> 
> --
> Ra
> 
> linkedin: http://it.linkedin.com/in/raoulbonnal
> twitter: http://twitter.com/ilpuccio
> skype: ilpuccio
> irc.freenode.net: Helius
> github: https://github.com/helios
> 
> 
> 
> 
> 
> 
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby



From donttrustben at gmail.com  Wed Mar  2 19:47:50 2011
From: donttrustben at gmail.com (Ben Woodcroft)
Date: Thu, 3 Mar 2011 11:47:50 +1100
Subject: [BioRuby] Programmatic interfaces to online-only bioinformatic tools
Message-ID: <AANLkTi=zSwQK=V5pWx70eds0kB=84uYco45tyWyos_Qj@mail.gmail.com>

Hi there,

I'm after an opinion on best practice for accessing those bioinformatic
tools that are only accessible via web-interfaces, without any way of
downloading the program itself. As I often want to throw an organisms's
whole proteome at the tool (in my case ~5500 proteins), doing it one at a
time is obviously not feasible. Do people think that writing a wrapper that
hammers the website in question is a nice thing to do, provided I wait 1
second in between each upload (1 protein/upload)? From what I can
understand, processing each protein is not computationally demanding and
results are returned almost instantaneously when querying the server
manually, unlike a blast server.

Some background:
I'm really like this bioruby plugin thing - thanks to those involved in its
creation. I've written a bioruby plugin
https://github.com/wwood/bioruby-cnls_screenscraper which queries
http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi that does what
I've described above. Not quite as well documented as it might be, but it
appears to work and isn't too complicated.

Thanks,
ben

-- 
Ben J Woodcroft, BE (Hons)

PhD Candidate
Ralph Laboratory
The University of Melbourne
Melbourne, Australia

From ktym at hgc.jp  Thu Mar  3 09:47:01 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Thu, 3 Mar 2011 23:47:01 +0900
Subject: [BioRuby] tutorial
In-Reply-To: <20110223105132.GA24543@thebird.nl>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
Message-ID: <956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>

Pj,

We just discussed about this on the IRC meeting and people agreed to
maintain the tutorial on the Wiki rather than in the source code
because people usually search for docs on the web and we can potentially
involve more people to improve/update the document. Let's see how it works!

Toshiaki

On 2011/02/23, at 19:51, Pjotr Prins wrote:

> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
>> however, I don't know there is a best way to synchronize it with
>> 
>> 	http://bioruby.open-bio.org/wiki/Tutorial
>> 
>> because Mediawiki format is also a different one from RD and rdoc... Any ideas?
> 
> we should drop the Mediawiki version - despite the nice colours.
> 
> Pj.



From cjfields at illinois.edu  Thu Mar  3 11:17:36 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 10:17:36 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
Message-ID: <7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>

All,

We are currently having a discussion related to this re: BioPerl docs and the wiki, in relation to our upcoming bioperl release and future directions.  I think our current conclusions are relevant here.

We moved the tutorial and HOWTOs over to the wiki a few years back, and I have been thinking fairly seriously about moving them back to github after the next release, then having a locked wiki page auto-generated from those (with an editable discussion page for suggestions/edits by the community).  This decision is based on several problems we found over the last few years by moving the docs over to the wiki.  

Note these apply mainly to my experiences via bioperl and are primarily my opinions (though some devs have agreed with me), so this may not apply to the bioruby community or even other bioperl devs:

  1) Simple documentation access: what recourse do users have if they can't access the wiki for some reason (server goes down, local network problems, etc)?  Installed docs are always available.

  2) By placing documentation on the wiki (tutorials, HOWTOs, etc), one effectively 'forks' the documentation from the actual distribution.  It has it's own wikified history separate from the code.  That may be okay initially, but then the tendency is that the wiki documentation becomes the 'official' one and only relates to the in-development version or last release of your project.  A way around that is to create possibly API-specific tutorials for specific releases, but they are still effectively separate from the actual versioned code.  

  3) B/c changes in code occur independently from changes in the documentation and they are stored in completely different media (github VCS vc wiki CMS), implementing some nice defensive coding measures becomes harder, if not impossible.  For instance, we're thinking about implementing inline testing for the tutorials and the HOWTOs.  This is intractable if documentation is on the wiki alone and if maintenance of that documentation occurs independently of the code it is documenting.  Not impossible, just harder to maintain long-term.

  4) Finally, we found the initial idea of wiki-fying the docs is in theory well-intentioned (allows dynamic editing of the docs by everyone), but in reality we have found that documentation placed on the wiki tends to lag behind or drift from changes in the code, simply b/c devs tend to forget about the wiki while developing code on github.  Yes, maybe it's a hassle to maintain docs in the repo, but github has mechanisms to allow anyone to make changes (fork/pull request), and if you can set up a system that converts github docs to wiki or another suitable markup, even better (believe me, POD is pretty minimal, so we have our work cut out for us on the perl end).

Again, this may be completely different in the bioruby ecosystem.  Just wanted to share my similar experience with bioperl.

chris

On Mar 3, 2011, at 8:47 AM, Toshiaki Katayama wrote:

> Pj,
> 
> We just discussed about this on the IRC meeting and people agreed to
> maintain the tutorial on the Wiki rather than in the source code
> because people usually search for docs on the web and we can potentially
> involve more people to improve/update the document. Let's see how it works!
> 
> Toshiaki
> 
> On 2011/02/23, at 19:51, Pjotr Prins wrote:
> 
>> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
>>> however, I don't know there is a best way to synchronize it with
>>> 
>>> 	http://bioruby.open-bio.org/wiki/Tutorial
>>> 
>>> because Mediawiki format is also a different one from RD and rdoc... Any ideas?
>> 
>> we should drop the Mediawiki version - despite the nice colours.
>> 
>> Pj.
> 
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby



From mail at michaelbarton.me.uk  Thu Mar  3 11:46:28 2011
From: mail at michaelbarton.me.uk (Michael Barton)
Date: Thu, 3 Mar 2011 11:46:28 -0500
Subject: [BioRuby] tutorial
In-Reply-To: <7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
Message-ID: <20110303164628.GA3667@nku069218.hh.nku.edu>

As another example the RSpec library has a nice way of converting the library
specs into html documentation. The code is then self documenting through its
specification.

E.g. http://bit.ly/fG5uNF

On Thu, Mar 03, 2011 at 10:17:36AM -0600, Chris Fields wrote:
> All,
> 
> We are currently having a discussion related to this re: BioPerl docs and the
> wiki, in relation to our upcoming bioperl release and future directions.
> I think our current conclusions are relevant here.
> 
> We moved the tutorial and HOWTOs over to the wiki a few years back, and
> I have been thinking fairly seriously about moving them back to github after
> the next release, then having a locked wiki page auto-generated from those
> (with an editable discussion page for suggestions/edits by the community).
> This decision is based on several problems we found over the last few years
> by moving the docs over to the wiki.  
> 
> Note these apply mainly to my experiences via bioperl and are primarily my
> opinions (though some devs have agreed with me), so this may not apply to the
> bioruby community or even other bioperl devs:
> 
>   1) Simple documentation access: what recourse do users have if they can't
>   access the wiki for some reason (server goes down, local network problems,
>   etc)?  Installed docs are always available.
> 
>   2) By placing documentation on the wiki (tutorials, HOWTOs, etc), one
>   effectively 'forks' the documentation from the actual distribution.  It has
>   it's own wikified history separate from the code.  That may be okay
>   initially, but then the tendency is that the wiki documentation becomes the
>   'official' one and only relates to the in-development version or last
>   release of your project.  A way around that is to create possibly
>   API-specific tutorials for specific releases, but they are still
>   effectively separate from the actual versioned code.  
> 
>   3) B/c changes in code occur independently from changes in the
>   documentation and they are stored in completely different media (github VCS
>   vc wiki CMS), implementing some nice defensive coding measures becomes
>   harder, if not impossible.  For instance, we're thinking about implementing
>   inline testing for the tutorials and the HOWTOs.  This is intractable if
>   documentation is on the wiki alone and if maintenance of that documentation
>   occurs independently of the code it is documenting.  Not impossible, just
>   harder to maintain long-term.
> 
>   4) Finally, we found the initial idea of wiki-fying the docs is in theory
>   well-intentioned (allows dynamic editing of the docs by everyone), but in
>   reality we have found that documentation placed on the wiki tends to lag
>   behind or drift from changes in the code, simply b/c devs tend to forget
>   about the wiki while developing code on github.  Yes, maybe it's a hassle
>   to maintain docs in the repo, but github has mechanisms to allow anyone to
>   make changes (fork/pull request), and if you can set up a system that
>   converts github docs to wiki or another suitable markup, even better
>   (believe me, POD is pretty minimal, so we have our work cut out for us on
>   the perl end).
> 
> Again, this may be completely different in the bioruby ecosystem.  Just
> wanted to share my similar experience with bioperl.
> 
> chris
> 
> On Mar 3, 2011, at 8:47 AM, Toshiaki Katayama wrote:
> 
> > Pj,
> > 
> > We just discussed about this on the IRC meeting and people agreed to
> > maintain the tutorial on the Wiki rather than in the source code because
> > people usually search for docs on the web and we can potentially involve
> > more people to improve/update the document. Let's see how it works!
> > 
> > Toshiaki
> > 
> > On 2011/02/23, at 19:51, Pjotr Prins wrote:
> > 
> >> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
> >>> however, I don't know there is a best way to synchronize it with
> >>> 
> >>> 	http://bioruby.open-bio.org/wiki/Tutorial
> >>> 
> >>> because Mediawiki format is also a different one from RD and rdoc... Any
> >>> ideas?
> >> 
> >> we should drop the Mediawiki version - despite the nice colours.
> >> 
> >> Pj.
> > 
> > 
> > _______________________________________________ BioRuby Project
> > - http://www.bioruby.org/ BioRuby mailing list BioRuby at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioruby
> 
> 
> _______________________________________________ BioRuby Project
> - http://www.bioruby.org/ BioRuby mailing list BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby

From cjfields at illinois.edu  Thu Mar  3 11:59:41 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 10:59:41 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <20110303164628.GA3667@nku069218.hh.nku.edu>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<20110303164628.GA3667@nku069218.hh.nku.edu>
Message-ID: <80B4C853-5046-471C-8E50-856C98AACC23@illinois.edu>

Michael,

Not sure about rspec, but with POD there are a few POD to wiki converters that generate markup, so it is feasibly possible to automate conversion and uploads to a wiki with a public API enabled (e.g. mediawiki's api.php).  There are also ways via CPAN to interpolate additional markup within POD to allow for inline tests, etc., might as well take advantage of those tools.

The ruby community should have something similar, though with the HTML conversion you showed it makes me wonder if it's even necessary :)

chris

On Mar 3, 2011, at 10:46 AM, Michael Barton wrote:

> As another example the RSpec library has a nice way of converting the library
> specs into html documentation. The code is then self documenting through its
> specification.
> 
> E.g. http://bit.ly/fG5uNF
> 
> On Thu, Mar 03, 2011 at 10:17:36AM -0600, Chris Fields wrote:
>> All,
>> 
>> We are currently having a discussion related to this re: BioPerl docs and the
>> wiki, in relation to our upcoming bioperl release and future directions.
>> I think our current conclusions are relevant here.
>> 
>> We moved the tutorial and HOWTOs over to the wiki a few years back, and
>> I have been thinking fairly seriously about moving them back to github after
>> the next release, then having a locked wiki page auto-generated from those
>> (with an editable discussion page for suggestions/edits by the community).
>> This decision is based on several problems we found over the last few years
>> by moving the docs over to the wiki.  
>> 
>> Note these apply mainly to my experiences via bioperl and are primarily my
>> opinions (though some devs have agreed with me), so this may not apply to the
>> bioruby community or even other bioperl devs:
>> 
>>  1) Simple documentation access: what recourse do users have if they can't
>>  access the wiki for some reason (server goes down, local network problems,
>>  etc)?  Installed docs are always available.
>> 
>>  2) By placing documentation on the wiki (tutorials, HOWTOs, etc), one
>>  effectively 'forks' the documentation from the actual distribution.  It has
>>  it's own wikified history separate from the code.  That may be okay
>>  initially, but then the tendency is that the wiki documentation becomes the
>>  'official' one and only relates to the in-development version or last
>>  release of your project.  A way around that is to create possibly
>>  API-specific tutorials for specific releases, but they are still
>>  effectively separate from the actual versioned code.  
>> 
>>  3) B/c changes in code occur independently from changes in the
>>  documentation and they are stored in completely different media (github VCS
>>  vc wiki CMS), implementing some nice defensive coding measures becomes
>>  harder, if not impossible.  For instance, we're thinking about implementing
>>  inline testing for the tutorials and the HOWTOs.  This is intractable if
>>  documentation is on the wiki alone and if maintenance of that documentation
>>  occurs independently of the code it is documenting.  Not impossible, just
>>  harder to maintain long-term.
>> 
>>  4) Finally, we found the initial idea of wiki-fying the docs is in theory
>>  well-intentioned (allows dynamic editing of the docs by everyone), but in
>>  reality we have found that documentation placed on the wiki tends to lag
>>  behind or drift from changes in the code, simply b/c devs tend to forget
>>  about the wiki while developing code on github.  Yes, maybe it's a hassle
>>  to maintain docs in the repo, but github has mechanisms to allow anyone to
>>  make changes (fork/pull request), and if you can set up a system that
>>  converts github docs to wiki or another suitable markup, even better
>>  (believe me, POD is pretty minimal, so we have our work cut out for us on
>>  the perl end).
>> 
>> Again, this may be completely different in the bioruby ecosystem.  Just
>> wanted to share my similar experience with bioperl.
>> 
>> chris
>> 
>> On Mar 3, 2011, at 8:47 AM, Toshiaki Katayama wrote:
>> 
>>> Pj,
>>> 
>>> We just discussed about this on the IRC meeting and people agreed to
>>> maintain the tutorial on the Wiki rather than in the source code because
>>> people usually search for docs on the web and we can potentially involve
>>> more people to improve/update the document. Let's see how it works!
>>> 
>>> Toshiaki
>>> 
>>> On 2011/02/23, at 19:51, Pjotr Prins wrote:
>>> 
>>>> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
>>>>> however, I don't know there is a best way to synchronize it with
>>>>> 
>>>>> 	http://bioruby.open-bio.org/wiki/Tutorial
>>>>> 
>>>>> because Mediawiki format is also a different one from RD and rdoc... Any
>>>>> ideas?
>>>> 
>>>> we should drop the Mediawiki version - despite the nice colours.
>>>> 
>>>> Pj.
>>> 
>>> 
>>> _______________________________________________ BioRuby Project
>>> - http://www.bioruby.org/ BioRuby mailing list BioRuby at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioruby
>> 
>> 
>> _______________________________________________ BioRuby Project
>> - http://www.bioruby.org/ BioRuby mailing list BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby



From ktym at hgc.jp  Thu Mar  3 12:41:52 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Fri, 4 Mar 2011 02:41:52 +0900
Subject: [BioRuby] tutorial
In-Reply-To: <7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
Message-ID: <A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>

Hi Chris,

Interesting. Thank you for your valuable inputs. :-)

So far, the main problem with us is not technical ones but lack of documentation itself (and man power). I personally believe that if we expose more documents on the web, it will raise chances to attract more people.

1) 99.9% of the cases, people try google first. Installed docs are usually hard to find for users and it is very rare that we can't access to the web.

2) Perhaps I don't perfectly understand what you mean, but having the latest version is probably enough in most cases... and we can also include the dump of entire wiki site at that time in the release package, if it makes sense.

3) If you have inline testing framework, it is not that hard. In our case, if I remember correctly, Pjotr have already implemented an inline testing tool for the BioRuby Tutorial (doctest?), so all we need is to run it against the output of the following script, for example.

------------------------------------------------------------
#!/usr/bin/env ruby

require 'rubygems'
require 'nokogiri'
require 'uri'
require 'open-uri'

wiki = "http://bioruby.open-bio.org/w/index.php?title=Tutorial&action=edit"
html = open(URI.encode(wiki)).read
text = Nokogiri(html).search("textarea").inner_text

puts text
------------------------------------------------------------

4) If HOWTOs are maintained as independent files, it still seems to have the same problem -- developers might forget to update the howto files when they made changes in the codes (and, this is the current situation we have now in BioRuby ;-).


Anyway, thanks again for your comments!

Toshiaki

On 2011/03/04, at 1:17, Chris Fields wrote:

> All,
> 
> We are currently having a discussion related to this re: BioPerl docs and the wiki, in relation to our upcoming bioperl release and future directions.  I think our current conclusions are relevant here.
> 
> We moved the tutorial and HOWTOs over to the wiki a few years back, and I have been thinking fairly seriously about moving them back to github after the next release, then having a locked wiki page auto-generated from those (with an editable discussion page for suggestions/edits by the community).  This decision is based on several problems we found over the last few years by moving the docs over to the wiki.  
> 
> Note these apply mainly to my experiences via bioperl and are primarily my opinions (though some devs have agreed with me), so this may not apply to the bioruby community or even other bioperl devs:
> 
>  1) Simple documentation access: what recourse do users have if they can't access the wiki for some reason (server goes down, local network problems, etc)?  Installed docs are always available.
> 
>  2) By placing documentation on the wiki (tutorials, HOWTOs, etc), one effectively 'forks' the documentation from the actual distribution.  It has it's own wikified history separate from the code.  That may be okay initially, but then the tendency is that the wiki documentation becomes the 'official' one and only relates to the in-development version or last release of your project.  A way around that is to create possibly API-specific tutorials for specific releases, but they are still effectively separate from the actual versioned code.  
> 
>  3) B/c changes in code occur independently from changes in the documentation and they are stored in completely different media (github VCS vc wiki CMS), implementing some nice defensive coding measures becomes harder, if not impossible.  For instance, we're thinking about implementing inline testing for the tutorials and the HOWTOs.  This is intractable if documentation is on the wiki alone and if maintenance of that documentation occurs independently of the code it is documenting.  Not impossible, just harder to maintain long-term.
> 
>  4) Finally, we found the initial idea of wiki-fying the docs is in theory well-intentioned (allows dynamic editing of the docs by everyone), but in reality we have found that documentation placed on the wiki tends to lag behind or drift from changes in the code, simply b/c devs tend to forget about the wiki while developing code on github.  Yes, maybe it's a hassle to maintain docs in the repo, but github has mechanisms to allow anyone to make changes (fork/pull request), and if you can set up a system that converts github docs to wiki or another suitable markup, even better (believe me, POD is pretty minimal, so we have our work cut out for us on the perl end).
> 
> Again, this may be completely different in the bioruby ecosystem.  Just wanted to share my similar experience with bioperl.
> 
> chris
> 
> On Mar 3, 2011, at 8:47 AM, Toshiaki Katayama wrote:
> 
>> Pj,
>> 
>> We just discussed about this on the IRC meeting and people agreed to
>> maintain the tutorial on the Wiki rather than in the source code
>> because people usually search for docs on the web and we can potentially
>> involve more people to improve/update the document. Let's see how it works!
>> 
>> Toshiaki
>> 
>> On 2011/02/23, at 19:51, Pjotr Prins wrote:
>> 
>>> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
>>>> however, I don't know there is a best way to synchronize it with
>>>> 
>>>> 	http://bioruby.open-bio.org/wiki/Tutorial
>>>> 
>>>> because Mediawiki format is also a different one from RD and rdoc... Any ideas?
>>> 
>>> we should drop the Mediawiki version - despite the nice colours.
>>> 
>>> Pj.
>> 
>> 
>> _______________________________________________
>> BioRuby Project - http://www.bioruby.org/
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
> 



From pjotr.public14 at thebird.nl  Thu Mar  3 13:09:08 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Thu, 3 Mar 2011 19:09:08 +0100
Subject: [BioRuby] tutorial
In-Reply-To: <A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
Message-ID: <20110303180908.GA10762@thebird.nl>

Not much to add to Chris. The main problem we have now is docs in
multiple places, and out of sync. Be good to get a coherent whole.

Wiki's tend to be more inviting, with a vibrant user community. But,
for BioRuby the Tutorial has been a wiki for years, with no edits,
that appears to not to work. Also I find Wiki's in general are rarely
maintained.

I agree with Chris docs should really be versioned against the
versioned classes, methods etc. Ideally we should also show
dependencies and whether they work for Ruby1.8/1.9, JRuby, Rubinius.

For several reasons I personally prefer generated docs. Maybe we
should think of generating the docs from Doctest files + RDoc +
Examples - and (cross)-index them nicely. Generation would help for
plugins too.

I know it is more work, and not very grateful, but if someone would
volunteer it would really pay off in the longer term. Note that
rubygems.org supports rdoc too - so we can host versioned docs there.

Pj. 


From ktym at hgc.jp  Thu Mar  3 13:10:58 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Fri, 4 Mar 2011 03:10:58 +0900
Subject: [BioRuby] tutorial
In-Reply-To: <A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
Message-ID: <54C7986C-DA6B-4A30-A163-62A36471CBFE@hgc.jp>

Hi Chris,

I forgot to mention but, okeefm started some work to sort out the current situation, thankfully.
http://bioruby.open-bio.org/wiki/DocumentationTeam

Sadly, Wiki have it's own weakness that we still have attacked everyday. This is really annoying.
I have no reaction from OBF support team yet about the idea of introducing authorization to create new wiki account.

P.S.
What is the b/c?

Toshiaki

On 2011/03/04, at 2:41, Toshiaki Katayama wrote:

> Hi Chris,
> 
> Interesting. Thank you for your valuable inputs. :-)
> 
> So far, the main problem with us is not technical ones but lack of documentation itself (and man power). I personally believe that if we expose more documents on the web, it will raise chances to attract more people.
> 
> 1) 99.9% of the cases, people try google first. Installed docs are usually hard to find for users and it is very rare that we can't access to the web.
> 
> 2) Perhaps I don't perfectly understand what you mean, but having the latest version is probably enough in most cases... and we can also include the dump of entire wiki site at that time in the release package, if it makes sense.
> 
> 3) If you have inline testing framework, it is not that hard. In our case, if I remember correctly, Pjotr have already implemented an inline testing tool for the BioRuby Tutorial (doctest?), so all we need is to run it against the output of the following script, for example.
> 
> ------------------------------------------------------------
> #!/usr/bin/env ruby
> 
> require 'rubygems'
> require 'nokogiri'
> require 'uri'
> require 'open-uri'
> 
> wiki = "http://bioruby.open-bio.org/w/index.php?title=Tutorial&action=edit"
> html = open(URI.encode(wiki)).read
> text = Nokogiri(html).search("textarea").inner_text
> 
> puts text
> ------------------------------------------------------------
> 
> 4) If HOWTOs are maintained as independent files, it still seems to have the same problem -- developers might forget to update the howto files when they made changes in the codes (and, this is the current situation we have now in BioRuby ;-).
> 
> 
> Anyway, thanks again for your comments!
> 
> Toshiaki
> 
> On 2011/03/04, at 1:17, Chris Fields wrote:
> 
>> All,
>> 
>> We are currently having a discussion related to this re: BioPerl docs and the wiki, in relation to our upcoming bioperl release and future directions.  I think our current conclusions are relevant here.
>> 
>> We moved the tutorial and HOWTOs over to the wiki a few years back, and I have been thinking fairly seriously about moving them back to github after the next release, then having a locked wiki page auto-generated from those (with an editable discussion page for suggestions/edits by the community).  This decision is based on several problems we found over the last few years by moving the docs over to the wiki.  
>> 
>> Note these apply mainly to my experiences via bioperl and are primarily my opinions (though some devs have agreed with me), so this may not apply to the bioruby community or even other bioperl devs:
>> 
>> 1) Simple documentation access: what recourse do users have if they can't access the wiki for some reason (server goes down, local network problems, etc)?  Installed docs are always available.
>> 
>> 2) By placing documentation on the wiki (tutorials, HOWTOs, etc), one effectively 'forks' the documentation from the actual distribution.  It has it's own wikified history separate from the code.  That may be okay initially, but then the tendency is that the wiki documentation becomes the 'official' one and only relates to the in-development version or last release of your project.  A way around that is to create possibly API-specific tutorials for specific releases, but they are still effectively separate from the actual versioned code.  
>> 
>> 3) B/c changes in code occur independently from changes in the documentation and they are stored in completely different media (github VCS vc wiki CMS), implementing some nice defensive coding measures becomes harder, if not impossible.  For instance, we're thinking about implementing inline testing for the tutorials and the HOWTOs.  This is intractable if documentation is on the wiki alone and if maintenance of that documentation occurs independently of the code it is documenting.  Not impossible, just harder to maintain long-term.
>> 
>> 4) Finally, we found the initial idea of wiki-fying the docs is in theory well-intentioned (allows dynamic editing of the docs by everyone), but in reality we have found that documentation placed on the wiki tends to lag behind or drift from changes in the code, simply b/c devs tend to forget about the wiki while developing code on github.  Yes, maybe it's a hassle to maintain docs in the repo, but github has mechanisms to allow anyone to make changes (fork/pull request), and if you can set up a system that converts github docs to wiki or another suitable markup, even better (believe me, POD is pretty minimal, so we have our work cut out for us on the perl end).
>> 
>> Again, this may be completely different in the bioruby ecosystem.  Just wanted to share my similar experience with bioperl.
>> 
>> chris
>> 
>> On Mar 3, 2011, at 8:47 AM, Toshiaki Katayama wrote:
>> 
>>> Pj,
>>> 
>>> We just discussed about this on the IRC meeting and people agreed to
>>> maintain the tutorial on the Wiki rather than in the source code
>>> because people usually search for docs on the web and we can potentially
>>> involve more people to improve/update the document. Let's see how it works!
>>> 
>>> Toshiaki
>>> 
>>> On 2011/02/23, at 19:51, Pjotr Prins wrote:
>>> 
>>>> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
>>>>> however, I don't know there is a best way to synchronize it with
>>>>> 
>>>>> 	http://bioruby.open-bio.org/wiki/Tutorial
>>>>> 
>>>>> because Mediawiki format is also a different one from RD and rdoc... Any ideas?
>>>> 
>>>> we should drop the Mediawiki version - despite the nice colours.
>>>> 
>>>> Pj.
>>> 
>>> 
>>> _______________________________________________
>>> BioRuby Project - http://www.bioruby.org/
>>> BioRuby mailing list
>>> BioRuby at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioruby
>> 
> 



From p.j.a.cock at googlemail.com  Thu Mar  3 13:14:53 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 3 Mar 2011 18:14:53 +0000
Subject: [BioRuby] tutorial
In-Reply-To: <7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
Message-ID: <AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>

On Thu, Mar 3, 2011 at 2:47 PM, Toshiaki Katayama <ktym at hgc.jp> wrote:
> Pj,
>
> We just discussed about this on the IRC meeting and people agreed to
> maintain the tutorial on the Wiki rather than in the source code
> because people usually search for docs on the web and we can potentially
> involve more people to improve/update the document. Let's see how it works!
>
> Toshiaki



On Thu, Mar 3, 2011 at 4:17 PM, Chris Fields <cjfields at illinois.edu> wrote:
> All,
>
> We are currently having a discussion related to this re: BioPerl docs and the
> wiki, in relation to our upcoming bioperl release and future directions. ?I think
> our current conclusions are relevant here.

I've been reading that thread on the BioPerl list with interest too. My
conclusions from Biopython are similar.

I personally would keep your tutorial in the source code repository,
but try and make a nice HTML version from this which people can
read online and find with search engines. Maybe have two versions
online, the latest release and a nightly build - that's what we do:

http://biopython.org/DIST/docs/tutorial/Tutorial.html
http://biopython.org/DIST/docs/tutorial/Tutorial-dev.html

We need to do more to make the HTML version of Biopython's
API documentation pretty.

Peter


From pjotr.public14 at thebird.nl  Thu Mar  3 14:12:46 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Thu, 3 Mar 2011 20:12:46 +0100
Subject: [BioRuby] tutorial
In-Reply-To: <AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>
Message-ID: <20110303191246.GB11821@thebird.nl>

Thanks Peter and Chris. I am glad we can learn from your experience.

Toshiaki had a very cool idea today (on IRC). The implications
carry beyond BioRuby gems. 

My wish is to see whether BioRuby and plugins are running well on
different Ruby implementations, and operating systems.

The reality is that developers won't test every possibility.

On the other hand, users do ;)

Also, for every plugin and BioRuby we create tests.

Users can run those tests. 

So, what we need is a tool to report test results to some central DB

If any user can simply run a test - say bioruby/test/test_any1.rb - we
could ask them (or they can choose to do it themselves) and
automatically update the DB centrally through a web service.

  biogem --report-test test/test_any1.rb

Resulting in:

  BioRuby, test_any1.rb runs on ruby 1.9.2p136 (2010-12-25 revision 30365) [i686-linux]

or, worse scenario, fail with trace ;)

We could pass in more info (dependencies etc). 

Not too hard to implement, and a great resource for docs and feedback
to users.

This would be interesting to rubygems in general. Debian uses
something similar for packages. What do you think? I don't think
BioPerl or BioPython has that, correct?

Pj.

From cjfields at illinois.edu  Thu Mar  3 14:19:30 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 13:19:30 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <20110303191246.GB11821@thebird.nl>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>
	<20110303191246.GB11821@thebird.nl>
Message-ID: <759E3D97-2A18-4F81-968A-3214ED7E3AEF@illinois.edu>

Like a smoke server, correct?  The perl community is a bit spoiled in that regard, as we have CPAN Testers, but that is mainly for CPAN releases only; a versioned OBF smoke tester would be nice.  There isn't a centralized OBF smoke server that I know of, however.  

There is a buildbot instance being set up, but this is more akin to automated builds and test runs per code change, not sure if it can handle user-based test reports.  Peter, know the progress on open-bio's buildbot?

chris

On Mar 3, 2011, at 1:12 PM, Pjotr Prins wrote:

> Thanks Peter and Chris. I am glad we can learn from your experience.
> 
> Toshiaki had a very cool idea today (on IRC). The implications
> carry beyond BioRuby gems. 
> 
> My wish is to see whether BioRuby and plugins are running well on
> different Ruby implementations, and operating systems.
> 
> The reality is that developers won't test every possibility.
> 
> On the other hand, users do ;)
> 
> Also, for every plugin and BioRuby we create tests.
> 
> Users can run those tests. 
> 
> So, what we need is a tool to report test results to some central DB
> 
> If any user can simply run a test - say bioruby/test/test_any1.rb - we
> could ask them (or they can choose to do it themselves) and
> automatically update the DB centrally through a web service.
> 
>  biogem --report-test test/test_any1.rb
> 
> Resulting in:
> 
>  BioRuby, test_any1.rb runs on ruby 1.9.2p136 (2010-12-25 revision 30365) [i686-linux]
> 
> or, worse scenario, fail with trace ;)
> 
> We could pass in more info (dependencies etc). 
> 
> Not too hard to implement, and a great resource for docs and feedback
> to users.
> 
> This would be interesting to rubygems in general. Debian uses
> something similar for packages. What do you think? I don't think
> BioPerl or BioPython has that, correct?
> 
> Pj.
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby



From cjfields at illinois.edu  Thu Mar  3 14:25:27 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 13:25:27 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <54C7986C-DA6B-4A30-A163-62A36471CBFE@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
	<54C7986C-DA6B-4A30-A163-62A36471CBFE@hgc.jp>
Message-ID: <3D146203-1188-444B-8EF7-1CE001AD340B@illinois.edu>

On Mar 3, 2011, at 12:10 PM, Toshiaki Katayama wrote:

> Hi Chris,
> 
> I forgot to mention but, okeefm started some work to sort out the current situation, thankfully.
> http://bioruby.open-bio.org/wiki/DocumentationTeam

Good!

> Sadly, Wiki have it's own weakness that we still have attacked everyday. This is really annoying.
> I have no reaction from OBF support team yet about the idea of introducing authorization to create new wiki account.

That may be due to our current tendency to migrate services off open-bio servers to something that removes the maintenance burden from OBF, namely our current move of CVS off dev.open-bio.org to github or elsewhere, and our in-progress move of bugzilla to redmine (yes, we are switching at some point).

That being said, the plugins for authorization via mediawiki are present I believe, as well as several systems to help prevent spam.  

> P.S.
> What is the b/c?

Short for 'because'.

-c

From ktym at hgc.jp  Thu Mar  3 14:27:34 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Fri, 4 Mar 2011 04:27:34 +0900
Subject: [BioRuby] tutorial
In-Reply-To: <20110303180908.GA10762@thebird.nl>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
	<20110303180908.GA10762@thebird.nl>
Message-ID: <312EEAEC-F6EF-4E6D-A5AC-94C41A515E03@hgc.jp>

Pj,

On 2011/03/04, at 3:09, Pjotr Prins wrote:

> Not much to add to Chris. The main problem we have now is docs in
> multiple places, and out of sync. Be good to get a coherent whole.
> 
> Wiki's tend to be more inviting, with a vibrant user community. But,
> for BioRuby the Tutorial has been a wiki for years, with no edits,
> that appears to not to work. Also I find Wiki's in general are rarely
> maintained.

This is not limited to the Wiki. Unfortunately, it is also true that
we could not maintain the text version enough, too.

https://github.com/bioruby/bioruby/commits/master/doc/Tutorial.rd

I agree that we need to avoid having multiple places for documents
as long as possible.


> I agree with Chris docs should really be versioned against the
> versioned classes, methods etc. Ideally we should also show
> dependencies and whether they work for Ruby1.8/1.9, JRuby, Rubinius.

This kind of check sheet should be automatically generated (e.g.
using RVM). The results can be included in the RDoc markup of each
method in the source code during the release management procedure.
Then, it will be available via the API reference (http://bioruby.org/rdoc/)
with versioning (because it is embedded in the code).
If we do that, I can agree that it will be useful resource to have.
However, I don't think RDoc is good for beginners to start with
(actually, web interface of rdoc is not friendly even for expert).

We are not talking about these method specifications or validations,
but thinking about the way to encourage writers of the introductory
documents.

Therefore, as for the new attempt, I proposed an idea to organize
a doc team responsible to

* write new documents
* update the existing docs in sync
* maintain a list of available documents coherently

independent from coders. Finally, the team will choose most convenient
technology to use -- GitHub, Wiki or whatever. But, most important
thing is to start writing the contents (than discussing on those choices).

I'm not sure how it works for now, but let's try. Because of the
weekly IRC meeting, I have a feeling that our community is evolving
very quickly toward a right direction and developing good social
interactions as well.

Toshiaki


> For several reasons I personally prefer generated docs. Maybe we
> should think of generating the docs from Doctest files + RDoc +
> Examples - and (cross)-index them nicely. Generation would help for
> plugins too.
> 
> I know it is more work, and not very grateful, but if someone would
> volunteer it would really pay off in the longer term. Note that
> rubygems.org supports rdoc too - so we can host versioned docs there.
> 
> Pj.


From mail at michaelbarton.me.uk  Thu Mar  3 14:29:29 2011
From: mail at michaelbarton.me.uk (Michael Barton)
Date: Thu, 3 Mar 2011 14:29:29 -0500
Subject: [BioRuby] tutorial
In-Reply-To: <20110303191246.GB11821@thebird.nl>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>
	<20110303191246.GB11821@thebird.nl>
Message-ID: <AANLkTimSX-NGC-Sur0UB9QiSNQ_1rkAt+uj-bv0=YOPk@mail.gmail.com>

This has been recently created for rubygems -
http://www.engineyard.com/blog/2011/introducing-gem-testers/

On 3 March 2011 14:12, Pjotr Prins <pjotr.public14 at thebird.nl> wrote:
> Thanks Peter and Chris. I am glad we can learn from your experience.
>
> Toshiaki had a very cool idea today (on IRC). The implications
> carry beyond BioRuby gems.
>
> My wish is to see whether BioRuby and plugins are running well on
> different Ruby implementations, and operating systems.
>
> The reality is that developers won't test every possibility.
>
> On the other hand, users do ;)
>
> Also, for every plugin and BioRuby we create tests.
>
> Users can run those tests.
>
> So, what we need is a tool to report test results to some central DB
>
> If any user can simply run a test - say bioruby/test/test_any1.rb - we
> could ask them (or they can choose to do it themselves) and
> automatically update the DB centrally through a web service.
>
> ?biogem --report-test test/test_any1.rb
>
> Resulting in:
>
> ?BioRuby, test_any1.rb runs on ruby 1.9.2p136 (2010-12-25 revision 30365) [i686-linux]
>
> or, worse scenario, fail with trace ;)
>
> We could pass in more info (dependencies etc).
>
> Not too hard to implement, and a great resource for docs and feedback
> to users.
>
> This would be interesting to rubygems in general. Debian uses
> something similar for packages. What do you think? I don't think
> BioPerl or BioPython has that, correct?
>
> Pj.
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>


From cjfields at illinois.edu  Thu Mar  3 14:30:33 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 13:30:33 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
Message-ID: <97A621B2-C49D-42F1-8363-AF66A35D43C8@illinois.edu>

On Mar 3, 2011, at 11:41 AM, Toshiaki Katayama wrote:

> Hi Chris,
> 
> Interesting. Thank you for your valuable inputs. :-)
> 
> So far, the main problem with us is not technical ones but lack of documentation itself (and man power). I personally believe that if we expose more documents on the web, it will raise chances to attract more people.
> 
> 1) 99.9% of the cases, people try google first. Installed docs are usually hard to find for users and it is very rare that we can't access to the web.

Right, I agree having a nice browsable version present on the wiki or elsewhere is a good idea.  However, does that version need to be the single official one?  Could it be generated, or have a public HTML page linked to?  The RSpec example Michael pointed out could be a very nice alternative.

> 2) Perhaps I don't perfectly understand what you mean, but having the latest version is probably enough in most cases... and we can also include the dump of entire wiki site at that time in the release package, if it makes sense.

Let's say a user has an older version of bioruby installed.  The official documentation is included with that version.  If that documentation is removed from any future versions, the only thing to point to is what is on the wiki (which may or may not work, but always points to the latest version).  

The tendency then is to suggest upgrading to the latest version that matches the documentation, but that pushes the burden back on the user to upgrade (not always a bad thing, truthfully).  However, if the user is locked in to a bioruby version somehow, they may be suddenly stuck w/o documentation.  

Ex: they are stuck using an old version of ruby due to draconian sysadmins, or they are reliant on a specific piece of code that requires an old bioruby version, and thus can't use the latest shiny bioruby.  Both of these scenarios have been reported by bioperl users in the past.

Regarding including the wiki with the distribution, we had thought about this as well (maybe even including nice PDFs) but it became too much of a maintenance hassle when the PDF generation could be done directly from the wiki itself.

> 3) If you have inline testing framework, it is not that hard. In our case, if I remember correctly, Pjotr have already implemented an inline testing tool for the BioRuby Tutorial (doctest?), so all we need is to run it against the output of the following script, for example.
> 
> ------------------------------------------------------------
> #!/usr/bin/env ruby
> 
> require 'rubygems'
> require 'nokogiri'
> require 'uri'
> require 'open-uri'
> 
> wiki = "http://bioruby.open-bio.org/w/index.php?title=Tutorial&action=edit"
> html = open(URI.encode(wiki)).read
> text = Nokogiri(html).search("textarea").inner_text
> 
> puts text
> ------------------------------------------------------------

Pjotr's mentioned his thoughts on this.

> 4) If HOWTOs are maintained as independent files, it still seems to have the same problem -- developers might forget to update the howto files when they made changes in the codes (and, this is the current situation we have now in BioRuby ;-).

That is a very common community problem, though; bioperl suffers it as well.  The only way around it is to have some sort of workflow that includes tests (including in-line tests) and doc checks prior to commits or releases.  Have a way to implement smoke tests, etc so the community can help on their end.

> Anyway, thanks again for your comments!
> 
> Toshiaki

No problem, glad to give my 2c.

chris

> On 2011/03/04, at 1:17, Chris Fields wrote:
> 
>> All,
>> 
>> We are currently having a discussion related to this re: BioPerl docs and the wiki, in relation to our upcoming bioperl release and future directions.  I think our current conclusions are relevant here.
>> 
>> We moved the tutorial and HOWTOs over to the wiki a few years back, and I have been thinking fairly seriously about moving them back to github after the next release, then having a locked wiki page auto-generated from those (with an editable discussion page for suggestions/edits by the community).  This decision is based on several problems we found over the last few years by moving the docs over to the wiki.  
>> 
>> Note these apply mainly to my experiences via bioperl and are primarily my opinions (though some devs have agreed with me), so this may not apply to the bioruby community or even other bioperl devs:
>> 
>> 1) Simple documentation access: what recourse do users have if they can't access the wiki for some reason (server goes down, local network problems, etc)?  Installed docs are always available.
>> 
>> 2) By placing documentation on the wiki (tutorials, HOWTOs, etc), one effectively 'forks' the documentation from the actual distribution.  It has it's own wikified history separate from the code.  That may be okay initially, but then the tendency is that the wiki documentation becomes the 'official' one and only relates to the in-development version or last release of your project.  A way around that is to create possibly API-specific tutorials for specific releases, but they are still effectively separate from the actual versioned code.  
>> 
>> 3) B/c changes in code occur independently from changes in the documentation and they are stored in completely different media (github VCS vc wiki CMS), implementing some nice defensive coding measures becomes harder, if not impossible.  For instance, we're thinking about implementing inline testing for the tutorials and the HOWTOs.  This is intractable if documentation is on the wiki alone and if maintenance of that documentation occurs independently of the code it is documenting.  Not impossible, just harder to maintain long-term.
>> 
>> 4) Finally, we found the initial idea of wiki-fying the docs is in theory well-intentioned (allows dynamic editing of the docs by everyone), but in reality we have found that documentation placed on the wiki tends to lag behind or drift from changes in the code, simply b/c devs tend to forget about the wiki while developing code on github.  Yes, maybe it's a hassle to maintain docs in the repo, but github has mechanisms to allow anyone to make changes (fork/pull request), and if you can set up a system that converts github docs to wiki or another suitable markup, even better (believe me, POD is pretty minimal, so we have our work cut out for us on the perl end).
>> 
>> Again, this may be completely different in the bioruby ecosystem.  Just wanted to share my similar experience with bioperl.
>> 
>> chris
>> 
>> On Mar 3, 2011, at 8:47 AM, Toshiaki Katayama wrote:
>> 
>>> Pj,
>>> 
>>> We just discussed about this on the IRC meeting and people agreed to
>>> maintain the tutorial on the Wiki rather than in the source code
>>> because people usually search for docs on the web and we can potentially
>>> involve more people to improve/update the document. Let's see how it works!
>>> 
>>> Toshiaki
>>> 
>>> On 2011/02/23, at 19:51, Pjotr Prins wrote:
>>> 
>>>> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
>>>>> however, I don't know there is a best way to synchronize it with
>>>>> 
>>>>> 	http://bioruby.open-bio.org/wiki/Tutorial
>>>>> 
>>>>> because Mediawiki format is also a different one from RD and rdoc... Any ideas?
>>>> 
>>>> we should drop the Mediawiki version - despite the nice colours.
>>>> 
>>>> Pj.
>>> 
>>> 
>>> _______________________________________________
>>> BioRuby Project - http://www.bioruby.org/
>>> BioRuby mailing list
>>> BioRuby at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioruby
>> 
> 



From cjfields at illinois.edu  Thu Mar  3 14:39:56 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 13:39:56 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <312EEAEC-F6EF-4E6D-A5AC-94C41A515E03@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
	<20110303180908.GA10762@thebird.nl>
	<312EEAEC-F6EF-4E6D-A5AC-94C41A515E03@hgc.jp>
Message-ID: <2E582A20-9A8C-4CE5-9845-05F619B7B69C@illinois.edu>

On Mar 3, 2011, at 1:27 PM, Toshiaki Katayama wrote:

> Pj,
> 
> On 2011/03/04, at 3:09, Pjotr Prins wrote:
> 
>> Not much to add to Chris. The main problem we have now is docs in
>> multiple places, and out of sync. Be good to get a coherent whole.
>> 
>> Wiki's tend to be more inviting, with a vibrant user community. But,
>> for BioRuby the Tutorial has been a wiki for years, with no edits,
>> that appears to not to work. Also I find Wiki's in general are rarely
>> maintained.
> 
> This is not limited to the Wiki. Unfortunately, it is also true that
> we could not maintain the text version enough, too.
> 
> https://github.com/bioruby/bioruby/commits/master/doc/Tutorial.rd
> 
> I agree that we need to avoid having multiple places for documents
> as long as possible.
> 
> 
>> I agree with Chris docs should really be versioned against the
>> versioned classes, methods etc. Ideally we should also show
>> dependencies and whether they work for Ruby1.8/1.9, JRuby, Rubinius.
> 
> This kind of check sheet should be automatically generated (e.g.
> using RVM). The results can be included in the RDoc markup of each
> method in the source code during the release management procedure.
> Then, it will be available via the API reference (http://bioruby.org/rdoc/)
> with versioning (because it is embedded in the code).
> If we do that, I can agree that it will be useful resource to have.
> However, I don't think RDoc is good for beginners to start with
> (actually, web interface of rdoc is not friendly even for expert).
> 
> We are not talking about these method specifications or validations,
> but thinking about the way to encourage writers of the introductory
> documents.
> 
> Therefore, as for the new attempt, I proposed an idea to organize
> a doc team responsible to
> 
> * write new documents
> * update the existing docs in sync
> * maintain a list of available documents coherently
> 
> independent from coders. Finally, the team will choose most convenient
> technology to use -- GitHub, Wiki or whatever. But, most important
> thing is to start writing the contents (than discussing on those choices).
> 
> I'm not sure how it works for now, but let's try. Because of the
> weekly IRC meeting, I have a feeling that our community is evolving
> very quickly toward a right direction and developing good social
> interactions as well.
> 
> Toshiaki

I think this makes sense, as long as there is a migration path to getting important documentation back into the code repository (convert to rdoc, add tests, etc) to make it somewhat officially canonized.  I say that anything used to generate any useful documentation for users is a great thing (specifically if they lower the barrier to participation), but there is a definite need to imbed it properly within the project otherwise it may be lost or wither on the vine.

chris



From cjfields at illinois.edu  Thu Mar  3 14:42:28 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 13:42:28 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <AANLkTimSX-NGC-Sur0UB9QiSNQ_1rkAt+uj-bv0=YOPk@mail.gmail.com>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>
	<20110303191246.GB11821@thebird.nl>
	<AANLkTimSX-NGC-Sur0UB9QiSNQ_1rkAt+uj-bv0=YOPk@mail.gmail.com>
Message-ID: <4491C72E-22D9-4F2A-8209-170E132B24F6@illinois.edu>

Heh, similar to this: http://wiki.cpantesters.org/

It's good to see this for ruby!

chris

On Mar 3, 2011, at 1:29 PM, Michael Barton wrote:

> This has been recently created for rubygems -
> http://www.engineyard.com/blog/2011/introducing-gem-testers/
> 
> On 3 March 2011 14:12, Pjotr Prins <pjotr.public14 at thebird.nl> wrote:
>> Thanks Peter and Chris. I am glad we can learn from your experience.
>> 
>> Toshiaki had a very cool idea today (on IRC). The implications
>> carry beyond BioRuby gems.
>> 
>> My wish is to see whether BioRuby and plugins are running well on
>> different Ruby implementations, and operating systems.
>> 
>> The reality is that developers won't test every possibility.
>> 
>> On the other hand, users do ;)
>> 
>> Also, for every plugin and BioRuby we create tests.
>> 
>> Users can run those tests.
>> 
>> So, what we need is a tool to report test results to some central DB
>> 
>> If any user can simply run a test - say bioruby/test/test_any1.rb - we
>> could ask them (or they can choose to do it themselves) and
>> automatically update the DB centrally through a web service.
>> 
>>  biogem --report-test test/test_any1.rb
>> 
>> Resulting in:
>> 
>>  BioRuby, test_any1.rb runs on ruby 1.9.2p136 (2010-12-25 revision 30365) [i686-linux]
>> 
>> or, worse scenario, fail with trace ;)
>> 
>> We could pass in more info (dependencies etc).
>> 
>> Not too hard to implement, and a great resource for docs and feedback
>> to users.
>> 
>> This would be interesting to rubygems in general. Debian uses
>> something similar for packages. What do you think? I don't think
>> BioPerl or BioPython has that, correct?
>> 
>> Pj.
>> _______________________________________________
>> BioRuby Project - http://www.bioruby.org/
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
>> 
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby



From p.j.a.cock at googlemail.com  Thu Mar  3 14:51:09 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 3 Mar 2011 19:51:09 +0000
Subject: [BioRuby] tutorial
In-Reply-To: <20110303191246.GB11821@thebird.nl>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>
	<20110303191246.GB11821@thebird.nl>
Message-ID: <AANLkTikewrc9sG8n8uwbsP7Pz+MSq9JvYxOA0SawW01M@mail.gmail.com>

On Thu, Mar 3, 2011 at 7:12 PM, Pjotr Prins <pjotr.public14 at thebird.nl> wrote:
> Thanks Peter and Chris. I am glad we can learn from your experience.
>
> Toshiaki had a very cool idea today (on IRC). The implications
> carry beyond BioRuby gems.
>
> My wish is to see whether BioRuby and plugins are running well on
> different Ruby implementations, and operating systems.
>
> The reality is that developers won't test every possibility.
>
> On the other hand, users do ;)
>
> Also, for every plugin and BioRuby we create tests.
>
> Users can run those tests.
>
> So, what we need is a tool to report test results to some central DB
> ...
> This would be interesting to rubygems in general. Debian uses
> something similar for packages. What do you think? I don't think
> BioPerl or BioPython has that, correct?
>
> Pj.
>

No, but Biopython is now using Buildbot on http://testing.open-bio.org
with a small number of buildslaves belonging to Biopython developers
running nightly unit tests on our latest code in github.

This is a very recent setup (having been prototyped on another OBF
machine late last year), and in theory other build systems could be
used too. I think BioPerl is interested in using smoke server.

Having end users submit tests would be useful too...

Peter

From ktym at hgc.jp  Thu Mar  3 15:16:52 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Fri, 4 Mar 2011 05:16:52 +0900
Subject: [BioRuby] tutorial
In-Reply-To: <3D146203-1188-444B-8EF7-1CE001AD340B@illinois.edu>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
	<54C7986C-DA6B-4A30-A163-62A36471CBFE@hgc.jp>
	<3D146203-1188-444B-8EF7-1CE001AD340B@illinois.edu>
Message-ID: <7E15D6C2-A0C4-4384-A6A0-ADAC9AA2396B@hgc.jp>

On 2011/03/04, at 4:25, Chris Fields wrote:
> On Mar 3, 2011, at 12:10 PM, Toshiaki Katayama wrote:
>> Sadly, Wiki have it's own weakness that we still have attacked everyday. This is really annoying.
>> I have no reaction from OBF support team yet about the idea of introducing authorization to create new wiki account.
> 
> That may be due to our current tendency to migrate services off open-bio servers to something that removes the maintenance burden from OBF, namely our current move of CVS off dev.open-bio.org to github or elsewhere, and our in-progress move of bugzilla to redmine (yes, we are switching at some point).
> 
> That being said, the plugins for authorization via mediawiki are present I believe, as well as several systems to help prevent spam.  

I understand they are very busy and working as volunteers, but I just requested to the OBF helpdesk again. :)
If OBF will discontinue the mediawiki service or they are so busy to support, we'll consider to setup our own.

>> P.S.
>> What is the b/c?
> 
> Short for 'because'.

Added to my dic, thanks!

I also thank for your subsequent posts on this thread, but I'd like to close the discussion (from my side) for now.
I'd like to see what happens with the doc team and I need to sleep (it's 5AM).

Toshiaki

From bonnalraoul at ingm.it  Thu Mar  3 15:29:15 2011
From: bonnalraoul at ingm.it (Raoul Bonnal)
Date: Thu, 03 Mar 2011 21:29:15 +0100
Subject: [BioRuby] tutorial
In-Reply-To: <AANLkTikewrc9sG8n8uwbsP7Pz+MSq9JvYxOA0SawW01M@mail.gmail.com>
Message-ID: <20110303202915.1d4d385c@mail.ingm.it>

Dear All,
a) this discussion is a good starting point for a workgroup during Codefest 2011 and/or BOSC (can't post to bopen-bio list cause I don't have the addr here, sorry)
a.idea) why not create a common "machine" on the cloud for testing our projects ?! It would be fun to see all the bio* with stats about testing etc...
b) testing is very important and new contributes should be accepted only with tests, which implies a problem how to check fake tests? :-)
c) usually ruby's community relies a lot on doc==tests that's completely wrong, because the newbies can't read fluently the code, also because there are different tools and sometimes a lot of mocking.
c.a) recently i had an idea, but I have no time to do that: establish a relationship between a mock and a real object and validate the mock or enable it only if the real object has been tested before. That would make mocking more sens to me, but i think this is another story.
d) I agree with Toshiaki, after this very useful brain storming start working (Impressed to see all this traffic :-) )

Cheers.
  _____  

From: Peter Cock [mailto:p.j.a.cock at googlemail.com]
To: Pjotr Prins [mailto:pjotr.public14 at thebird.nl]
Cc: BioRuby [mailto:bioruby at lists.open-bio.org]
Sent: Thu, 03 Mar 2011 20:51:09 +0100
Subject: Re: [BioRuby] tutorial

On Thu, Mar 3, 2011 at 7:12 PM, Pjotr Prins <pjotr.public14 at thebird.nl> wrote:
  > Thanks Peter and Chris. I am glad we can learn from your experience.
  >
  > Toshiaki had a very cool idea today (on IRC). The implications
  > carry beyond BioRuby gems.
  >
  > My wish is to see whether BioRuby and plugins are running well on
  > different Ruby implementations, and operating systems.
  >
  > The reality is that developers won't test every possibility.
  >
  > On the other hand, users do ;)
  >
  > Also, for every plugin and BioRuby we create tests.
  >
  > Users can run those tests.
  >
  > So, what we need is a tool to report test results to some central DB
  > ...
  > This would be interesting to rubygems in general. Debian uses
  > something similar for packages. What do you think? I don't think
  > BioPerl or BioPython has that, correct?
  >
  > Pj.
  >
  
  No, but Biopython is now using Buildbot on http://testing.open-bio.org
  with a small number of buildslaves belonging to Biopython developers
  running nightly unit tests on our latest code in github.
  
  This is a very recent setup (having been prototyped on another OBF
  machine late last year), and in theory other build systems could be
  used too. I think BioPerl is interested in using smoke server.
  
  Having end users submit tests would be useful too...
  
  Peter
  _______________________________________________
  BioRuby Project - http://www.bioruby.org/
  BioRuby mailing list
  BioRuby at lists.open-bio.org
  http://lists.open-bio.org/mailman/listinfo/bioruby
    

From cjfields at illinois.edu  Thu Mar  3 15:50:00 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 14:50:00 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <7E15D6C2-A0C4-4384-A6A0-ADAC9AA2396B@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
	<54C7986C-DA6B-4A30-A163-62A36471CBFE@hgc.jp>
	<3D146203-1188-444B-8EF7-1CE001AD340B@illinois.edu>
	<7E15D6C2-A0C4-4384-A6A0-ADAC9AA2396B@hgc.jp>
Message-ID: <144459DC-E36C-4483-AF84-7F9021987FD2@illinois.edu>

On Mar 3, 2011, at 2:16 PM, Toshiaki Katayama wrote:

> On 2011/03/04, at 4:25, Chris Fields wrote:
>> On Mar 3, 2011, at 12:10 PM, Toshiaki Katayama wrote:
>>> Sadly, Wiki have it's own weakness that we still have attacked everyday. This is really annoying.
>>> I have no reaction from OBF support team yet about the idea of introducing authorization to create new wiki account.
>> 
>> That may be due to our current tendency to migrate services off open-bio servers to something that removes the maintenance burden from OBF, namely our current move of CVS off dev.open-bio.org to github or elsewhere, and our in-progress move of bugzilla to redmine (yes, we are switching at some point).
>> 
>> That being said, the plugins for authorization via mediawiki are present I believe, as well as several systems to help prevent spam.  
> 
> I understand they are very busy and working as volunteers, but I just requested to the OBF helpdesk again. :)
> If OBF will discontinue the mediawiki service or they are so busy to support, we'll consider to setup our own.

Not sure of the status.  We (bioperl) have talked about it, mainly b/c of the hassle of wiki sysadmin maintenance.

>>> P.S.
>>> What is the b/c?
>> 
>> Short for 'because'.
> 
> Added to my dic, thanks!
> 
> I also thank for your subsequent posts on this thread, but I'd like to close the discussion (from my side) for now.
> I'd like to see what happens with the doc team and I need to sleep (it's 5AM).
> 
> Toshiaki

np (No problem).  Get some sleep.

chris

From cjfields at illinois.edu  Thu Mar  3 15:52:50 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 14:52:50 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <20110303202915.1d4d385c@mail.ingm.it>
References: <20110303202915.1d4d385c@mail.ingm.it>
Message-ID: <3DE2622D-406F-43EC-9554-BF7A8D7A38E6@illinois.edu>

On Mar 3, 2011, at 2:29 PM, Raoul Bonnal wrote:

> Dear All,
> a) this discussion is a good starting point for a workgroup during Codefest 2011 and/or BOSC (can't post to bopen-bio list cause I don't have the addr here, sorry)
> a.idea) why not create a common "machine" on the cloud for testing our projects ?! It would be fun to see all the bio* with stats about testing etc...

I think the buildbot instance covers some of that, but they are mainly automated builds:

http://testing.open-bio.org/

biopython is the only one set up currently. 

> b) testing is very important and new contributes should be accepted only with tests, which implies a problem how to check fake tests? :-)

Code review and checking the test results.  Otherwise, you have to trust your developers.

> c) usually ruby's community relies a lot on doc==tests that's completely wrong, because the newbies can't read fluently the code, also because there are different tools and sometimes a lot of mocking.
> c.a) recently i had an idea, but I have no time to do that: establish a relationship between a mock and a real object and validate the mock or enable it only if the real object has been tested before. That would make mocking more sens to me, but i think this is another story.

Yes, I've thought about that as well re: Moose-based work, haven't wrapped my head around it either.

> d) I agree with Toshiaki, after this very useful brain storming start working (Impressed to see all this traffic :-) )
> 
> Cheers.

+1.  Will be interesting to see how things progress.

chris

From bonnalraoul at ingm.it  Fri Mar  4 04:31:10 2011
From: bonnalraoul at ingm.it (Raoul Bonnal)
Date: Fri, 4 Mar 2011 10:31:10 +0100
Subject: [BioRuby] Programmatic interfaces to online-only bioinformatic
	tools
In-Reply-To: <AANLkTi=zSwQK=V5pWx70eds0kB=84uYco45tyWyos_Qj@mail.gmail.com>
References: <AANLkTi=zSwQK=V5pWx70eds0kB=84uYco45tyWyos_Qj@mail.gmail.com>
Message-ID: <18AE3D74-5120-46C9-A042-08551F90A936@ingm.it>

Dear Ben,
I'm very happy that you like the plugin system, thanks!

Yesterday we created the doc team which is charge to supervise every doc content for BioRuby.
@DocTeam: please make a public announce.

Our role is to make their life easier, so write tests, documentation in code and useful comments so,  I invite you to add your case study to the README for a better comprehension of the tool, or where the docteam will decide.

Also a reminder for all developers:
try to respect/reflect the bioruby directory tree, in this particular case:

lib/bio-cnls_screenscraper.rb
  require 'bio/cnls_screenscraper'

mkdir lib/bio 
touch lib/bio/cnls_screenscraper.rb and add your code here.

Don't forget, git add .

This would help in the future for an easier incorporation into bioruby, if we decide that a particular plugin can be assimilated (BORG)

PS: probably I need to make this concept more clear on biogem, sorry it's my fault.

On 03/mar/2011, at 01.47, Ben Woodcroft wrote:

> Hi there,
> 
> I'm after an opinion on best practice for accessing those bioinformatic
> tools that are only accessible via web-interfaces, without any way of
> downloading the program itself. As I often want to throw an organisms's
> whole proteome at the tool (in my case ~5500 proteins), doing it one at a
> time is obviously not feasible. Do people think that writing a wrapper that
> hammers the website in question is a nice thing to do, provided I wait 1
> second in between each upload (1 protein/upload)? From what I can
> understand, processing each protein is not computationally demanding and
> results are returned almost instantaneously when querying the server
> manually, unlike a blast server.
> 
> Some background:
> I'm really like this bioruby plugin thing - thanks to those involved in its
> creation. I've written a bioruby plugin
> https://github.com/wwood/bioruby-cnls_screenscraper which queries
> http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi that does what
> I've described above. Not quite as well documented as it might be, but it
> appears to work and isn't too complicated.
> 
> Thanks,
> ben
> 
> -- 
> Ben J Woodcroft, BE (Hons)
> 
> PhD Candidate
> Ralph Laboratory
> The University of Melbourne
> Melbourne, Australia
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby

--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios








From p.j.a.cock at googlemail.com  Fri Mar  4 06:45:11 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 4 Mar 2011 11:45:11 +0000
Subject: [BioRuby] Automated testing server; was  tutorial
Message-ID: <AANLkTik4LqbcQeV8qujtUTGNw0AeunRfYEtuSQR_tYHP@mail.gmail.com>

Hi all,

I've retitled this thread to reflect the current topic, and CC'd the open-bio-l
mailing list as Raoul suggested. Can we continue the discussion there?
http://lists.open-bio.org/mailman/listinfo/open-bio-l

On Thu, Mar 3, 2011 at 8:52 PM, Chris Fields <cjfields at illinois.edu> wrote:
> On Mar 3, 2011, at 2:29 PM, Raoul Bonnal wrote:
>
>> Dear All,
>> a) this discussion is a good starting point for a workgroup during Codefest
>> 2011 and/or BOSC (can't post to bopen-bio list cause I don't have the addr
>> here, sorry) a.idea) why not create a common "machine" on the cloud for
>> testing our projects ?! It would be fun to see all the bio* with stats about
>> testing etc...
>
> I think the buildbot instance covers some of that, but they are mainly
> automated builds:
>
> http://testing.open-bio.org/
>
> biopython is the only one set up currently.

Note that this is a small Amazon cloud machine, and doesn't actually run
the tests itself (that would require a more expensive machine due to the
higher load). Instead we need client machines (covering a range of OS,
Python version etc) whose run-time is donated (currently by Biopython
developers or their employers).

When setting up http://testing.open-bio.org/ the intention was to have
it host other Bio* projects too - and they don't have to be using the
buildbot software (but they could if they wanted to).

>> b) testing is very important and new contributes should be accepted
>> only with tests, which implies a problem how to check fake tests? :-)
>
> Code review and checking the test results. ?Otherwise, you have to trust
> your developers.

This is something we're pushing much more with Biopython in recent
years (a depressing amount of legacy code had no tests when I first
got involved, things are a lot better now). For any new code contributions
we do ask for tests and minimal documentation (and try and work
with the contributor to help this happen).

>> c) usually ruby's community relies a lot on doc==tests that's
>> completely wrong, because the newbies can't read fluently the
>> code, also because there are different tools and sometimes a lot
>> of mocking.

With Biopython we're starting to make more use of testable docs
(Python's doctest system) which is really good I think. But you are
right, you need proper unit tests AS WELL. With our doctests,
the primary aim is to be useful documentation (which can double
as a basic functional test).

>> c.a) recently i had an idea, but I have no time to do that: establish
>> a relationship between a mock and a real object and validate the
>> mock or enable it only if the real object has been tested before.
>> That would make mocking more sens to me, but i think this is
>> another story.
>
> Yes, I've thought about that as well re: Moose-based work, haven't
> wrapped my head around it either.

I'm not quite following - it may be a terminology difference.

>> d) I agree with Toshiaki, after this very useful brain storming
>> start working (Impressed to see all this traffic :-) )
>>
>> Cheers.
>
> +1. ?Will be interesting to see how things progress.
>
> chris

Same here :)

Peter


From hlapp at drycafe.net  Fri Mar  4 18:26:25 2011
From: hlapp at drycafe.net (Hilmar Lapp)
Date: Fri, 4 Mar 2011 18:26:25 -0500
Subject: [BioRuby] Informatics job opportunity at NESCent
Message-ID: <1878F27F-000D-4C80-B9EA-A83F7887828F@drycafe.net>

(Apologies if you receive multiple copies, and also if you are not  
interested in job opportunities.  In my defense, quite a few people on  
Bio* lists might qualify for (let alone enjoy) the position. And if  
you know someone who might be interested please forward.)

===================================================
User Interface Design and Web Application Developer
===================================================

The National Evolutionary Synthesis Center (NESCent) seeks a creative  
and enthusiastic individual to design user interfaces and web  
applications for scientific applications. The incumbent will work as  
part of a small informatics team in close collaboration with domain  
scientists.

NESCent is an NSF-funded center dedicated to cross-disciplinary  
research in evolutionary science. Our informatics team works closely  
with visiting and resident scientists to support their custom software  
and database development needs. All NESCent software products are open- 
source, and the Center has a number of initiatives to actively promote  
collaborative development of community software resources  
(informatics.nescent.org). Above all, we are enthusiastic about our  
work, about the mission of the Center, and about the contribution of  
informatics to that mission.

Job description: The incumbent will design and develop user interfaces  
and web applications for databases and other software tools for  
sponsored scientists and staff. The job responsibilities include all  
stages of the software development process, including requirements  
gathering, design, implementation, release packaging and  
documentation, as part of a small team (typically 2-3 individuals)  
following project management best practices. We expect the incumbent  
to present their work at conferences and contribute to publications  
with scientific collaborators; interact regularly with visiting and  
resident scientists, other members of the informatics team and Center  
staff; and generally serve as an expert resource for Center personnel.  
The position provides opportunities for professional development. Most  
informatics staff work at our Durham NC offices, located adjacent to  
Duke University, but we do support a wide range of technologies for  
virtual communication with off-site staff and collaborators.

Required Qualifications:
* Demonstrated success collaborating with clients on custom software  
solutions
* Experience with various stages of the software development cycle
* Expertise in development and testing of user interface designs
* Excellent communication skills, both virtual and face-to-face
* A four-year college degree in Computer Science, Bioinformatics or a  
related field

Preferred Qualifications:
* M.S. or Ph.D. in Computer Science, Bioinformatics or related field  
along with demonstrated interest in science, particularly biology
* Expertise in rapid application development and respective  
programming technologies and languages (e.g., modern scripting  
languages and web-application frameworks such as Python/Django, Ruby/ 
Ruby-on-Rails, and Perl/Catalyst), fluency in Java programming, and  
prior experience in relational database programming (PostgreSQL or  
MySQL)
* Expertise in dynamic and interactive web technologies (JavaScript,  
CGI), web service (SOAP, REST, XML, JSON) and semantic web technologies
* Experience with open-source, and collaborative, software  
development, software usability design and assessment
* Expertise in graphic design, data visualization and/or scientific  
data integration

How to apply: Please send cover letter, resume and contact information  
for three references to Dr. Karen Cranston, Training Coordinator and  
Bioinformatics Project Manager (karen.cranston at nescent.org). Review of  
applications will begin March 21, 2011. Informal inquires or requests  
for additional information may be directed to Dr. Cranston by email or  
phone (+1-919-613-2275).

-- 
===========================================================
: Hilmar Lapp -:- Durham, NC -:- hlapp at drycafe dot net :
===========================================================





From donttrustben at gmail.com  Fri Mar  4 19:09:16 2011
From: donttrustben at gmail.com (Ben Woodcroft)
Date: Sat, 5 Mar 2011 11:09:16 +1100
Subject: [BioRuby] Programmatic interfaces to online-only bioinformatic
	tools
In-Reply-To: <18AE3D74-5120-46C9-A042-08551F90A936@ingm.it>
References: <AANLkTi=zSwQK=V5pWx70eds0kB=84uYco45tyWyos_Qj@mail.gmail.com>
	<18AE3D74-5120-46C9-A042-08551F90A936@ingm.it>
Message-ID: <AANLkTi=saAb-OYMzoA_-BHqJRo9x9tR9vPaNm1p+3RT6@mail.gmail.com>

Hi Raul,

Thanks for the tips - I've added a README and moved things around in the
tree as per your suggestion, and uploaded to github.

I originally put the code in lib/bio-cnls_screenscraper.rb was because that
is the file that was created as part of the biogem process. Would changing
the default to lib/bio/cnls_screenscraper.rb be sensible? Isn't the same
true of the tests? I moved test/bio-cnls_screenscraper.rb to
test/bio/cnls_screenscraper.rb as well.

I think it unlikely that my code will make it into the bioruby main tree,
because of the dependence on the webserver (as well as the usual reasons for
not including my code!). The reason I used biogem was that it created an
environment where I could write a distinct chunk of bioruby-associated code
rapidly. The results will hopefully be published soon (how to cite biogem?)
and I wanted to make the code available. Slotting it into the bioruby main
tree isn't something I much care about.

I'm a bit confused by what you mean by "add your case study to the README".
Perhaps when the DocTeam make the public announcement that will become
clearer.

Thanks,
ben

On 4 March 2011 20:31, Raoul Bonnal <bonnalraoul at ingm.it> wrote:

> Dear Ben,
> I'm very happy that you like the plugin system, thanks!
>
> Yesterday we created the doc team which is charge to supervise every doc
> content for BioRuby.
> @DocTeam: please make a public announce.
>
> Our role is to make their life easier, so write tests, documentation in
> code and useful comments so,  I invite you to add your case study to the
> README for a better comprehension of the tool, or where the docteam will
> decide.
>
> Also a reminder for all developers:
> try to respect/reflect the bioruby directory tree, in this particular case:
>
> lib/bio-cnls_screenscraper.rb
>   require 'bio/cnls_screenscraper'
>
> mkdir lib/bio
> touch lib/bio/cnls_screenscraper.rb and add your code here.
>
> Don't forget, git add .
>
> This would help in the future for an easier incorporation into bioruby, if
> we decide that a particular plugin can be assimilated (BORG)
>
> PS: probably I need to make this concept more clear on biogem, sorry it's
> my fault.
>
> On 03/mar/2011, at 01.47, Ben Woodcroft wrote:
>
> Hi there,
>
> I'm after an opinion on best practice for accessing those bioinformatic
> tools that are only accessible via web-interfaces, without any way of
> downloading the program itself. As I often want to throw an organisms's
> whole proteome at the tool (in my case ~5500 proteins), doing it one at a
> time is obviously not feasible. Do people think that writing a wrapper that
> hammers the website in question is a nice thing to do, provided I wait 1
> second in between each upload (1 protein/upload)? From what I can
> understand, processing each protein is not computationally demanding and
> results are returned almost instantaneously when querying the server
> manually, unlike a blast server.
>
> Some background:
> I'm really like this bioruby plugin thing - thanks to those involved in its
> creation. I've written a bioruby plugin
> https://github.com/wwood/bioruby-cnls_screenscraper which queries
> http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi that does
> what
> I've described above. Not quite as well documented as it might be, but it
> appears to work and isn't too complicated.
>
> Thanks,
> ben
>
> --
> Ben J Woodcroft, BE (Hons)
>
> PhD Candidate
> Ralph Laboratory
> The University of Melbourne
> Melbourne, Australia
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>
>
> --
> Ra
>
> linkedin: http://it.linkedin.com/in/raoulbonnal
> twitter: http://twitter.com/ilpuccio
> skype: ilpuccio
> irc.freenode.net: Helius
> github: https://github.com/helios
>
>
>
>
>
>
>


-- 
Ben J Woodcroft, BE (Hons)

PhD Candidate
Ralph Laboratory
The University of Melbourne
Melbourne, Australia

tel: (+613) 8344 2319
b.woodcroft at pgrad.unimelb.edu.au

From donttrustben at gmail.com  Sat Mar  5 02:05:57 2011
From: donttrustben at gmail.com (Ben Woodcroft)
Date: Sat, 5 Mar 2011 18:05:57 +1100
Subject: [BioRuby] Programmatic interfaces to online-only bioinformatic
	tools
In-Reply-To: <AANLkTi=saAb-OYMzoA_-BHqJRo9x9tR9vPaNm1p+3RT6@mail.gmail.com>
References: <AANLkTi=zSwQK=V5pWx70eds0kB=84uYco45tyWyos_Qj@mail.gmail.com>
	<18AE3D74-5120-46C9-A042-08551F90A936@ingm.it>
	<AANLkTi=saAb-OYMzoA_-BHqJRo9x9tR9vPaNm1p+3RT6@mail.gmail.com>
Message-ID: <AANLkTikPDN2vrCoqN4_tmVDZuKWMFnOLija+wk89f26T@mail.gmail.com>

Hi again,

I now believe I'd misunderstood you, sorry. Not enough coffee, my guess is.
I take back my suggestion about changing the default to
lib/bio/cnls_screenscraper.rb. Would it be a good idea to make
lib/bio-cnls_screenscraper.rb by default have some comment about what to do
here, instead of being empty, something like below?

# Please require your code below, respecting the bioruby directory tree. For
instance,
# require 'lib/bio/sequence/awesome_sequence_thingy'
#
# It is bad practice to write other code directly into this file, because
doing so causes confusion if this biogem was ever to get merged into the
main bioruby tree.

Thanks,
ben

On 5 March 2011 11:09, Ben Woodcroft <donttrustben at gmail.com> wrote:

> Hi Raul,
>
> Thanks for the tips - I've added a README and moved things around in the
> tree as per your suggestion, and uploaded to github.
>
> I originally put the code in lib/bio-cnls_screenscraper.rb was because that
> is the file that was created as part of the biogem process. Would changing
> the default to lib/bio/cnls_screenscraper.rb be sensible? Isn't the same
> true of the tests? I moved test/bio-cnls_screenscraper.rb to
> test/bio/cnls_screenscraper.rb as well.
>
> I think it unlikely that my code will make it into the bioruby main tree,
> because of the dependence on the webserver (as well as the usual reasons for
> not including my code!). The reason I used biogem was that it created an
> environment where I could write a distinct chunk of bioruby-associated code
> rapidly. The results will hopefully be published soon (how to cite biogem?)
> and I wanted to make the code available. Slotting it into the bioruby main
> tree isn't something I much care about.
>
> I'm a bit confused by what you mean by "add your case study to the README".
> Perhaps when the DocTeam make the public announcement that will become
> clearer.
>
> Thanks,
> ben
>
>
> On 4 March 2011 20:31, Raoul Bonnal <bonnalraoul at ingm.it> wrote:
>
>> Dear Ben,
>> I'm very happy that you like the plugin system, thanks!
>>
>> Yesterday we created the doc team which is charge to supervise every doc
>> content for BioRuby.
>> @DocTeam: please make a public announce.
>>
>> Our role is to make their life easier, so write tests, documentation in
>> code and useful comments so,  I invite you to add your case study to the
>> README for a better comprehension of the tool, or where the docteam will
>> decide.
>>
>> Also a reminder for all developers:
>> try to respect/reflect the bioruby directory tree, in this particular
>> case:
>>
>> lib/bio-cnls_screenscraper.rb
>>   require 'bio/cnls_screenscraper'
>>
>> mkdir lib/bio
>> touch lib/bio/cnls_screenscraper.rb and add your code here.
>>
>> Don't forget, git add .
>>
>> This would help in the future for an easier incorporation into bioruby, if
>> we decide that a particular plugin can be assimilated (BORG)
>>
>> PS: probably I need to make this concept more clear on biogem, sorry it's
>> my fault.
>>
>> On 03/mar/2011, at 01.47, Ben Woodcroft wrote:
>>
>> Hi there,
>>
>> I'm after an opinion on best practice for accessing those bioinformatic
>> tools that are only accessible via web-interfaces, without any way of
>> downloading the program itself. As I often want to throw an organisms's
>> whole proteome at the tool (in my case ~5500 proteins), doing it one at a
>> time is obviously not feasible. Do people think that writing a wrapper
>> that
>> hammers the website in question is a nice thing to do, provided I wait 1
>> second in between each upload (1 protein/upload)? From what I can
>> understand, processing each protein is not computationally demanding and
>> results are returned almost instantaneously when querying the server
>> manually, unlike a blast server.
>>
>> Some background:
>> I'm really like this bioruby plugin thing - thanks to those involved in
>> its
>> creation. I've written a bioruby plugin
>> https://github.com/wwood/bioruby-cnls_screenscraper which queries
>> http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi that does
>> what
>> I've described above. Not quite as well documented as it might be, but it
>> appears to work and isn't too complicated.
>>
>> Thanks,
>> ben
>>
>> --
>> Ben J Woodcroft, BE (Hons)
>>
>> PhD Candidate
>> Ralph Laboratory
>> The University of Melbourne
>> Melbourne, Australia
>> _______________________________________________
>> BioRuby Project - http://www.bioruby.org/
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
>>
>>
>>   --
>> Ra
>>
>> linkedin: http://it.linkedin.com/in/raoulbonnal
>> twitter: http://twitter.com/ilpuccio
>> skype: ilpuccio
>> irc.freenode.net: Helius
>> github: https://github.com/helios
>>
>>
>>
>>
>>
>>
>>
>
>

From pjotr.public14 at thebird.nl  Thu Mar 10 03:24:33 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Thu, 10 Mar 2011 09:24:33 +0100
Subject: [BioRuby] BioRuby GSoC 2011 ideas?
In-Reply-To: <116E7FA5-1886-4DA0-93B1-AAB83EE34DB0@ingm.it>
References: <28297803-062D-4C40-A6F6-999A71A2D176@nescent.org>
	<9C15E792-54F7-44F7-986B-9CD413E03BE1@hgc.jp>
	<116E7FA5-1886-4DA0-93B1-AAB83EE34DB0@ingm.it>
Message-ID: <20110310082433.GA18827@thebird.nl>

What is the status of GSoC proposals for BioRuby. We should have at
least one proposal go in with OBF. It would also be good to have a
Nescent proposal.

IRC today?

Pj.

On Wed, Feb 23, 2011 at 01:10:30PM +0100, Raoul Bonnal wrote:
> Dear All,
> I remind you about the irc meeting for live discussion, I think the main topic can be GSoC 2011
> 
> I'd like to have some update about Semantic Web its reliability and if we (bioruby) are going to use it. Where?
> 
> I'm available for mentoring on OBF GSoC projects.
> 
> On 23/feb/2011, at 08.43, Toshiaki Katayama wrote:
> 
> > Hi all,
> > 
> > I just discussed with Rutger about Google Summer of Code (GSoC) 2011.
> > If you are interested in to mentor/participate GSoC this year, please put your ideas on this list.
> > 
> > Attached is an announcement from NESCent, which is focused on phloinformatics.
> > I heard that Open Bio Foundation (OBF) is also considering to organize GSoC again (not confirmed, though).
> > 
> > http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2011
> > http://www.open-bio.org/wiki/Google_Summer_of_Code
> > 
> > Some ideas from our side are:
> > 
> > for NESCent GSoC,
> > - compile phyloinfo plugins for BioRuby (based on NEXML https://github.com/rvosa/bio-nexml, forester http://code.google.com/p/forester/ etc.) to make analysis pipeline available (relevant to Bio::Phylo in Perl) - with a nice tutorial, hopefully ;)
> > 
> > for OBF GSoC,
> > - develop NGS-related plugins
> > - develop a generic framework for workflow management and parallel execution of tasks
> > - develop plugins for Semantic Web (RDF utilities, SPARQL query interface, handling ontologies etc.)
> > 
> > Regards,
> > Toshiaki Katayama
> > 
> > Begin forwarded message:
> > 
> >> From: Hilmar Lapp <hlapp at nescent.org>
> >> Date: 2011???2???22??? 03:55:52JST
> >> To: PhyloSoC Announcements <phylosoc-announce at googlegroups.com>
> >> Subject: Phyloinformatics Summer of Code 2011: Call for Mentors
> >> Reply-To: phylosoc-announce at googlegroups.com
> >> 
> >> Over the next 3 weeks we will be pulling together NESCent's application to the 2011 Google Summer of Code as a mentoring organization. This is a call for all prospective mentors, primary and secondary, to step forward.
> >> 
> >> Participating as an organization is competitive. Over the last years the acceptance rate for organizations has been around 30-35%. The most important component of organization applications is the Ideas page, and specifically the quality and suitability of the project ideas. These project ideas are contributed by you, our mentors. In the past we have had a strong, diverse and well-documented portfolio of ideas with different degrees of difficulty, from different participating open-source projects, using different programming languages.
> >> 
> >> If you can fancy yourself serving as a mentor, or helping someone else mentoring a student as a secondary mentor, or would like to help out in other capacities, please contact us as soon as you can at phylosoc-admin at nescent.org. If you have not been a mentor with us in previous years, we'll send you guidance on what doing so involves, and how you can contribute to our participation. We will also add everyone who is interested in serving to our (private) mentors mailing list (at least those who aren't already).
> >> 
> >> If you are new to Summer of Code and wonder what it takes or what it is like to be a mentor for us, don't hesitate to ask questions or to contact previous mentors (see URLs below for projects that got selected). Being a mentor does require time (see http://bit.ly/soc2011-mentortime), but our past mentors have pretty much unanimously found it a fun and rewarding experience. That's aside from the code a student could contribute to your project, and, possibly most important of all in the long run, the chance to gain a new developer.
> >> 
> >> The initial skeleton of our 2011 Ideas page is now up here and ready for adding project ideas and mentors(*).
> >> 
> >> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2011
> >> 
> >> We will send further guidance on drafting project ideas, but for now you can see examples of the format and scope of project ideas on the Ideas pages from previous years (click on "Ideas"):
> >> 
> >> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2010
> >> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2009
> >> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2008
> >> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2007
> >> 
> >> Dates:
> >> ======
> >> 
> >> Submission of organization applications starts Feb 28 and closes on March 11. For project ideas to contribute to the strength of our application they must be in reasonable shape by the morning of March 11. *If* we are accepted, ideas can be refined (or added) between March 18-27.
> >> 
> >> Students apply March 28-April 8, and selected students are announced April 25. The coding period runs from May 23 to August 22. See
> >> http://bit.ly/soc2011-timeline for a full timeline of the whole program.
> >> 
> >> Cheers, and we look forward to hearing from you!
> >> 
> >>       Karen Cranston
> >>       Hilmar Lapp
> >> 
> >> (*) Editing content on the NESCent Informatics wiki (f.k.a. Hackathon wiki) requires you to login. We had to disable local account creation due to spam getting out of control. The wiki is still open, though - just login with your OpenID. If you don't have an OpenID, the "Login with OpenID" page has information on you can easily get one, and if you have a Google account, you're all set to go.
> >> 
> >> -- 
> >> You received this message because you are subscribed to the Google
> >> Groups "Phyloinfomatics Summer of Code Announcements" group.
> >> To unsubscribe from this group, send email to
> >> phylosoc-announce+unsubscribe at googlegroups.com
> >> For more options, visit this group at
> >> http://groups.google.com/group/phylosoc-announce?hl=en
> > 
> > 
> > _______________________________________________
> > BioRuby Project - http://www.bioruby.org/
> > BioRuby mailing list
> > BioRuby at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioruby
> 
> --
> Ra
> 
> 
> 
> 
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby

From john.woods at marcottelab.org  Thu Mar 10 17:24:50 2011
From: john.woods at marcottelab.org (John Woods)
Date: Thu, 10 Mar 2011 16:24:50 -0600
Subject: [BioRuby] Google Summer of Code
Message-ID: <AANLkTin-w-JZBoEJdgAv_hQ5TXSqR9XYSzVkZr1O9u4R@mail.gmail.com>

Hey everyone,

I'm working on the application for SciRuby (not BioRuby) for GSoC. We're a
pretty new project. Any chance you all would be willing to vouch for us?

This email also serves as a reminder that we're out here. Come and join us.
=)

http://github.com/SciRuby/sciruby/wiki/The-SciRuby-Manifesto

Here's our application (not finished):
http://github.com/SciRuby/sciruby/wiki/Google-Summer-of-Code

Many thanks,
John Woods

Director, SciRuby Project
National Science Foundation Fellow | The Marcotte Lab
The University of Texas at Austin

From john.woods at marcottelab.org  Thu Mar 10 17:48:38 2011
From: john.woods at marcottelab.org (John Woods)
Date: Thu, 10 Mar 2011 16:48:38 -0600
Subject: [BioRuby] Google Summer of Code
In-Reply-To: <AANLkTin-w-JZBoEJdgAv_hQ5TXSqR9XYSzVkZr1O9u4R@mail.gmail.com>
References: <AANLkTin-w-JZBoEJdgAv_hQ5TXSqR9XYSzVkZr1O9u4R@mail.gmail.com>
Message-ID: <AANLkTi=CLEw1Jmf17iZd4JJO0tQrFDL9NrbH2cgjppYg@mail.gmail.com>

Just to clarify, to vouch for us you have to be either (1) a Googler or (2)
a past GSoC mentoring organization, such as BioRuby.

John


On Thu, Mar 10, 2011 at 4:24 PM, John Woods <john.woods at marcottelab.org>wrote:

> Hey everyone,
>
> I'm working on the application for SciRuby (not BioRuby) for GSoC. We're a
> pretty new project. Any chance you all would be willing to vouch for us?
>
> This email also serves as a reminder that we're out here. Come and join us.
> =)
>
> http://github.com/SciRuby/sciruby/wiki/The-SciRuby-Manifesto
>
> Here's our application (not finished):
> http://github.com/SciRuby/sciruby/wiki/Google-Summer-of-Code
>
> Many thanks,
> John Woods
>
> Director, SciRuby Project
> National Science Foundation Fellow | The Marcotte Lab
> The University of Texas at Austin
>

From bonnalraoul at ingm.it  Thu Mar 10 19:13:53 2011
From: bonnalraoul at ingm.it (Raoul Bonnal)
Date: Fri, 11 Mar 2011 01:13:53 +0100
Subject: [BioRuby] Google Summer of Code
In-Reply-To: <AANLkTi=CLEw1Jmf17iZd4JJO0tQrFDL9NrbH2cgjppYg@mail.gmail.com>
Message-ID: <20110311001353.c4309e55@mail.ingm.it>

We are under OBF, I don't know if you can join that organization too, but I'm not the right one to ask for.
Who can answer to vouch?
It's a pity that we can't work together because some ideas, I think, could be shared between two groups.

http://www.open-bio.org/wiki/Gsoc
  _____  

From: John Woods [mailto:john.woods at marcottelab.org]
To: bioruby at lists.open-bio.org
Sent: Thu, 10 Mar 2011 23:48:38 +0100
Subject: Re: [BioRuby] Google Summer of Code

Just to clarify, to vouch for us you have to be either (1) a Googler or (2)
  a past GSoC mentoring organization, such as BioRuby.
  
  John
  
  
  On Thu, Mar 10, 2011 at 4:24 PM, John Woods <john.woods at marcottelab.org>wrote:
  
  > Hey everyone,
  >
  > I'm working on the application for SciRuby (not BioRuby) for GSoC. We're a
  > pretty new project. Any chance you all would be willing to vouch for us?
  >
  > This email also serves as a reminder that we're out here. Come and join us.
  > =)
  >
  > http://github.com/SciRuby/sciruby/wiki/The-SciRuby-Manifesto
  >
  > Here's our application (not finished):
  > http://github.com/SciRuby/sciruby/wiki/Google-Summer-of-Code
  >
  > Many thanks,
  > John Woods
  >
  > Director, SciRuby Project
  > National Science Foundation Fellow | The Marcotte Lab
  > The University of Texas at Austin
  >
  _______________________________________________
  BioRuby Project - http://www.bioruby.org/
  BioRuby mailing list
  BioRuby at lists.open-bio.org
  http://lists.open-bio.org/mailman/listinfo/bioruby
    

From bonnalraoul at ingm.it  Thu Mar 10 21:41:02 2011
From: bonnalraoul at ingm.it (Raoul Bonnal)
Date: Fri, 11 Mar 2011 03:41:02 +0100
Subject: [BioRuby] =?iso-8859-1?q?BioRuby_GSoC_2011_ideas=3F?=
In-Reply-To: <20110310082433.GA18827@thebird.nl>
Message-ID: <20110311024102.27cd865e@mail.ingm.it>

Dear All,
I've  added proposals to our wiki page 
  http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Proposal_2011
with these titles:


* 3.1 Proposal 2011  

* 3.1.1 Support Next Generation Sequencing (NGS) in BioRuby
* 3.1.2 BioRuby Wrapper for Command line application
* 3.1.3 Represent bio-objects and related information with images
* 3.1.4 Modular annotation knowledge base for BioRuby
  
I've also update the OBF wiki page linking these proposal, 
http://www.open-bio.org/wiki/Google_Summer_of_Code#Mentors_and_Project_Ideas

As usual we have to refine many things but I hope it helped.

See you in few hours ^_^

Any modification/contribute is very appreciated.


Notes:
1) I forgot to mention the semantic web SPARQL...., please add it if you are going to support it.
2) I reduced the lims part because was too complicated probably and for NGS I did subproposal but I don't know if that is the right formant.
3) For those not cited as mentor, don't hesitate to add yourself to the list, I'm just tired.
4) I think old projects could be resubmitted, please Goto-san evaluate this possibility too.

--
Ra

From francesco.strozzi at gmail.com  Fri Mar 11 02:10:43 2011
From: francesco.strozzi at gmail.com (Francesco Strozzi)
Date: Fri, 11 Mar 2011 08:10:43 +0100
Subject: [BioRuby] BioRuby GSoC 2011 ideas?
In-Reply-To: <20110311024102.27cd865e@mail.ingm.it>
References: <20110310082433.GA18827@thebird.nl>
	<20110311024102.27cd865e@mail.ingm.it>
Message-ID: <AANLkTin8r-RFieZoHgHMJd-mOFPP3hoohG4vp3zY_Qa6@mail.gmail.com>

First of all I hope everybody in Japan are fine. Just saw right now the
breaking news about the big earthquake that hit Tokyo...

Raoul,
many thanks for the work you have done (this night), I'm reading the
proposals and making small changes....

Francesco

On Fri, Mar 11, 2011 at 03:41, Raoul Bonnal <bonnalraoul at ingm.it> wrote:

> Dear All,
> I've  added proposals to our wiki page
>  http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Proposal_2011
> with these titles:
>
>
> * 3.1 Proposal 2011
>
> * 3.1.1 Support Next Generation Sequencing (NGS) in BioRuby
> * 3.1.2 BioRuby Wrapper for Command line application
> * 3.1.3 Represent bio-objects and related information with images
> * 3.1.4 Modular annotation knowledge base for BioRuby
>
> I've also update the OBF wiki page linking these proposal,
>
> http://www.open-bio.org/wiki/Google_Summer_of_Code#Mentors_and_Project_Ideas
>
> As usual we have to refine many things but I hope it helped.
>
> See you in few hours ^_^
>
> Any modification/contribute is very appreciated.
>
>
> Notes:
> 1) I forgot to mention the semantic web SPARQL...., please add it if you
> are going to support it.
> 2) I reduced the lims part because was too complicated probably and for NGS
> I did subproposal but I don't know if that is the right formant.
> 3) For those not cited as mentor, don't hesitate to add yourself to the
> list, I'm just tired.
> 4) I think old projects could be resubmitted, please Goto-san evaluate this
> possibility too.
>
> --
> Ra
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>



-- 

Francesco

From cmzmasek at yahoo.com  Fri Mar 11 02:19:47 2011
From: cmzmasek at yahoo.com (Christian Zmasek)
Date: Thu, 10 Mar 2011 23:19:47 -0800 (PST)
Subject: [BioRuby] tsunami
Message-ID: <392600.43663.qm@web38401.mail.mud.yahoo.com>

Hi, all:

I am just seeing on TV that there was a large earthquake and the resulting 
tsuunami affecting the northern parts of Japan.
It seems that there are some damages in Odaiba, though.
I hope everybody is OK.

Christian

From ktym at hgc.jp  Fri Mar 11 02:26:28 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Fri, 11 Mar 2011 16:26:28 +0900
Subject: [BioRuby] tsunami
In-Reply-To: <392600.43663.qm@web38401.mail.mud.yahoo.com>
References: <392600.43663.qm@web38401.mail.mud.yahoo.com>
Message-ID: <BA3EA6BB-DE87-4B51-ADD6-D9DB8F0CFBC2@hgc.jp>

Hi Chris,

Thank you for your kind mail.
Fortunately, BioRuby developers (Mitsuteru, Naohisa and me) are fine.
I heard that our colleagues in DBCLS are safe (including Goran-san).
I'm also watching on TV. It looks really severe...

Thanks,
Toshiaki

On 2011/03/11, at 16:19, Christian Zmasek wrote:

> Hi, all:
> 
> I am just seeing on TV that there was a large earthquake and the resulting 
> tsuunami affecting the northern parts of Japan.
> It seems that there are some damages in Odaiba, though.
> I hope everybody is OK.
> 
> Christian
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby


From rutgeraldo at gmail.com  Fri Mar 11 04:33:01 2011
From: rutgeraldo at gmail.com (Rutger Vos)
Date: Fri, 11 Mar 2011 09:33:01 +0000
Subject: [BioRuby] tsunami
In-Reply-To: <BA3EA6BB-DE87-4B51-ADD6-D9DB8F0CFBC2@hgc.jp>
References: <392600.43663.qm@web38401.mail.mud.yahoo.com>
	<BA3EA6BB-DE87-4B51-ADD6-D9DB8F0CFBC2@hgc.jp>
Message-ID: <AANLkTimWtPjtwb3oMFmCUfC+JXD5m=TOuthRfi7qPa+t@mail.gmail.com>

All the best - my thoughts are with you all.

On Fri, Mar 11, 2011 at 7:26 AM, Toshiaki Katayama <ktym at hgc.jp> wrote:
> Hi Chris,
>
> Thank you for your kind mail.
> Fortunately, BioRuby developers (Mitsuteru, Naohisa and me) are fine.
> I heard that our colleagues in DBCLS are safe (including Goran-san).
> I'm also watching on TV. It looks really severe...
>
> Thanks,
> Toshiaki
>
> On 2011/03/11, at 16:19, Christian Zmasek wrote:
>
>> Hi, all:
>>
>> I am just seeing on TV that there was a large earthquake and the resulting
>> tsuunami affecting the northern parts of Japan.
>> It seems that there are some damages in Odaiba, though.
>> I hope everybody is OK.
>>
>> Christian
>> _______________________________________________
>> BioRuby Project - http://www.bioruby.org/
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
>
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>



-- 
Dr. Rutger A. Vos
School of Biological Sciences
Philip Lyle Building, Level 4
University of Reading
Reading
RG6 6BX
United Kingdom
Tel: +44 (0) 118 378 7535
http://www.nexml.org
http://rutgervos.blogspot.com

From francesco.strozzi at gmail.com  Fri Mar 11 04:44:37 2011
From: francesco.strozzi at gmail.com (Francesco Strozzi)
Date: Fri, 11 Mar 2011 10:44:37 +0100
Subject: [BioRuby] BioRuby GSoC 2011 ideas?
In-Reply-To: <AANLkTin8r-RFieZoHgHMJd-mOFPP3hoohG4vp3zY_Qa6@mail.gmail.com>
References: <20110310082433.GA18827@thebird.nl>
	<20110311024102.27cd865e@mail.ingm.it>
	<AANLkTin8r-RFieZoHgHMJd-mOFPP3hoohG4vp3zY_Qa6@mail.gmail.com>
Message-ID: <AANLkTinyjYfj4eby27eskUuQ0ShEB1+Gos47+BvnuOF3@mail.gmail.com>

Ok, made some changes with Raoul to the BioRuby proposals. We think this is
fine for us for now, if you have comments or want to change something let us
know...time is quite short.

Cheers
Francesco

On Fri, Mar 11, 2011 at 08:10, Francesco Strozzi <
francesco.strozzi at gmail.com> wrote:

> First of all I hope everybody in Japan are fine. Just saw right now the
> breaking news about the big earthquake that hit Tokyo...
>
> Raoul,
> many thanks for the work you have done (this night), I'm reading the
> proposals and making small changes....
>
> Francesco
>
>
> On Fri, Mar 11, 2011 at 03:41, Raoul Bonnal <bonnalraoul at ingm.it> wrote:
>
>> Dear All,
>> I've  added proposals to our wiki page
>>  http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Proposal_2011
>> with these titles:
>>
>>
>> * 3.1 Proposal 2011
>>
>> * 3.1.1 Support Next Generation Sequencing (NGS) in BioRuby
>> * 3.1.2 BioRuby Wrapper for Command line application
>> * 3.1.3 Represent bio-objects and related information with images
>> * 3.1.4 Modular annotation knowledge base for BioRuby
>>
>> I've also update the OBF wiki page linking these proposal,
>>
>> http://www.open-bio.org/wiki/Google_Summer_of_Code#Mentors_and_Project_Ideas
>>
>> As usual we have to refine many things but I hope it helped.
>>
>> See you in few hours ^_^
>>
>> Any modification/contribute is very appreciated.
>>
>>
>> Notes:
>> 1) I forgot to mention the semantic web SPARQL...., please add it if you
>> are going to support it.
>> 2) I reduced the lims part because was too complicated probably and for
>> NGS I did subproposal but I don't know if that is the right formant.
>> 3) For those not cited as mentor, don't hesitate to add yourself to the
>> list, I'm just tired.
>> 4) I think old projects could be resubmitted, please Goto-san evaluate
>> this possibility too.
>>
>> --
>> Ra
>> _______________________________________________
>> BioRuby Project - http://www.bioruby.org/
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
>>
>
>
>
> --
>
> Francesco
>
>


-- 

Francesco

From cmzmasek at yahoo.com  Fri Mar 11 06:52:15 2011
From: cmzmasek at yahoo.com (Christian Zmasek)
Date: Fri, 11 Mar 2011 03:52:15 -0800 (PST)
Subject: [BioRuby] BioRuby forester GSoC project
Message-ID: <640657.71672.qm@web38406.mail.mud.yahoo.com>

Hi,

To those interested, please have a look at:
http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2011#BioRuby_forester


Comments? Suggestions? Corrections?

Also, this project needs at least two co-mentors from BioRuby community.

Anybody interested?

Chris

From rutgeraldo at gmail.com  Fri Mar 11 06:58:45 2011
From: rutgeraldo at gmail.com (Rutger Vos)
Date: Fri, 11 Mar 2011 11:58:45 +0000
Subject: [BioRuby] BioRuby forester GSoC project
In-Reply-To: <640657.71672.qm@web38406.mail.mud.yahoo.com>
References: <640657.71672.qm@web38406.mail.mud.yahoo.com>
Message-ID: <AANLkTimt=NEf7n=ZfH9Ga+SARWcYd0kt7yn=BQ9q1RO+@mail.gmail.com>

Hi Chris,

I think this looks like a great project (I was just looking at it
apparently before you hit submit, because it looks more polished now).
The only thing I don't understand - but that's just me being a newbie
- is whether or not there might be problems depending on where objects
that are passed into forrester come from. I.e. could any subclass of
Bio::Tree be passed into that? Is it simply a matter of following the
advertised "interfaces" (sorry, that's java-esque) or are there other
things to take into account. Other than that, this would be a very
cool advance if this became possible.

Cheers,

Rutger

On Fri, Mar 11, 2011 at 11:52 AM, Christian Zmasek <cmzmasek at yahoo.com> wrote:
> Hi,
>
> To those interested, please have a look at:
> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2011#BioRuby_forester
>
>
> Comments? Suggestions? Corrections?
>
> Also, this project needs at least two co-mentors from BioRuby community.
>
> Anybody interested?
>
> Chris
>



-- 
Dr. Rutger A. Vos
School of Biological Sciences
Philip Lyle Building, Level 4
University of Reading
Reading
RG6 6BX
United Kingdom
Tel: +44 (0) 118 378 7535
http://www.nexml.org
http://rutgervos.blogspot.com

From pjotr.public14 at thebird.nl  Fri Mar 11 08:27:02 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Fri, 11 Mar 2011 14:27:02 +0100
Subject: [BioRuby] BioRuby forester GSoC project
In-Reply-To: <640657.71672.qm@web38406.mail.mud.yahoo.com>
References: <640657.71672.qm@web38406.mail.mud.yahoo.com>
Message-ID: <20110311132702.GB25440@thebird.nl>

Looks good Chris

On Fri, Mar 11, 2011 at 03:52:15AM -0800, Christian Zmasek wrote:
> Hi,
> 
> To those interested, please have a look at:
> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2011#BioRuby_forester
> 
> 
> Comments? Suggestions? Corrections?
> 
> Also, this project needs at least two co-mentors from BioRuby community.
> 
> Anybody interested?
> 
> Chris
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
> 

From cmzmasek at yahoo.com  Fri Mar 11 16:35:14 2011
From: cmzmasek at yahoo.com (Christian Zmasek)
Date: Fri, 11 Mar 2011 13:35:14 -0800 (PST)
Subject: [BioRuby] BioRuby GSoC 2011 ideas?
In-Reply-To: <AANLkTinyjYfj4eby27eskUuQ0ShEB1+Gos47+BvnuOF3@mail.gmail.com>
References: <20110310082433.GA18827@thebird.nl>
	<20110311024102.27cd865e@mail.ingm.it>
	<AANLkTin8r-RFieZoHgHMJd-mOFPP3hoohG4vp3zY_Qa6@mail.gmail.com>
	<AANLkTinyjYfj4eby27eskUuQ0ShEB1+Gos47+BvnuOF3@mail.gmail.com>
Message-ID: <214609.20340.qm@web38404.mail.mud.yahoo.com>

Hi, Francesco and Raoul:

I looked at your proposals and made some minor changes in hope to make them more 
clear.

In the NGS proposal, what do you mean with "and due the high number of unknown 
data generated"?

Also, you now have four projects, all of which have Raoul as the (apparent) 
primary mentor.
I wonder if this could a problem.

Chris





----- Original Message ----
> From: Francesco Strozzi <francesco.strozzi at gmail.com>
> To: Raoul Bonnal <bonnalraoul at ingm.it>
> Cc: BioRuby ML <bioruby at lists.open-bio.org>
> Sent: Fri, March 11, 2011 1:44:37 AM
> Subject: Re: [BioRuby] BioRuby GSoC 2011 ideas?
> 
> Ok, made some changes with Raoul to the BioRuby proposals. We think this  is
> fine for us for now, if you have comments or want to change something let  us
> know...time is quite short.
> 
> Cheers
> Francesco
> 
> On Fri, Mar  11, 2011 at 08:10, Francesco Strozzi <
> francesco.strozzi at gmail.com>  wrote:
> 
> > First of all I hope everybody in Japan are fine. Just saw  right now the
> > breaking news about the big earthquake that hit  Tokyo...
> >
> > Raoul,
> > many thanks for the work you have done  (this night), I'm reading the
> > proposals and making small  changes....
> >
> > Francesco
> >
> >
> > On Fri, Mar 11,  2011 at 03:41, Raoul Bonnal <bonnalraoul at ingm.it>  wrote:
> >
> >> Dear All,
> >> I've  added proposals to  our wiki page
> >>   http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Proposal_2011
> >>  with these titles:
> >>
> >>
> >> * 3.1 Proposal  2011
> >>
> >> * 3.1.1 Support Next Generation Sequencing (NGS) in  BioRuby
> >> * 3.1.2 BioRuby Wrapper for Command line  application
> >> * 3.1.3 Represent bio-objects and related information  with images
> >> * 3.1.4 Modular annotation knowledge base for  BioRuby
> >>
> >> I've also update the OBF wiki page linking these  proposal,
> >>
> >>  
>http://www.open-bio.org/wiki/Google_Summer_of_Code#Mentors_and_Project_Ideas
> >>
> >>  As usual we have to refine many things but I hope it  helped.
> >>
> >> See you in few hours ^_^
> >>
> >>  Any modification/contribute is very  appreciated.
> >>
> >>
> >> Notes:
> >> 1) I forgot  to mention the semantic web SPARQL...., please add it if you
> >> are  going to support it.
> >> 2) I reduced the lims part because was too  complicated probably and for
> >> NGS I did subproposal but I don't know  if that is the right formant.
> >> 3) For those not cited as mentor,  don't hesitate to add yourself to the
> >> list, I'm just  tired.
> >> 4) I think old projects could be resubmitted, please Goto-san  evaluate
> >> this possibility too.
> >>
> >>  --
> >> Ra
> >>  _______________________________________________
> >> BioRuby Project -  http://www.bioruby.org/
> >> BioRuby mailing list
> >> BioRuby at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioruby
> >>
> >
> >
> >
> > ; --
> >
> > Francesco
> >
> >
> 
> 
> -- 
> 
> Francesco
> _______________________________________________
> BioRuby  Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
> 

From bonnalraoul at ingm.it  Fri Mar 11 19:54:48 2011
From: bonnalraoul at ingm.it (Raoul Bonnal)
Date: Sat, 12 Mar 2011 01:54:48 +0100
Subject: [BioRuby] =?iso-8859-1?q?BioRuby_GSoC_2011_ideas=3F?=
In-Reply-To: <214609.20340.qm@web38404.mail.mud.yahoo.com>
Message-ID: <20110312005448.2fa997a1@mail.ingm.it>

Dear Chris,
sorry I was away, and now is quite late in the night.
  _____  

From: Christian Zmasek [mailto:cmzmasek at yahoo.com]
To: Francesco Strozzi [mailto:francesco.strozzi at gmail.com], Raoul Bonnal [mailto:bonnalraoul at ingm.it]
Cc: bioruby at lists.open-bio.org
Sent: Fri, 11 Mar 2011 22:35:14 +0100
Subject: Re: BioRuby GSoC 2011 ideas?

Hi, Francesco and Raoul:
  
  I looked at your proposals and made some minor changes in hope to make them more 
  clear.Thanks
  
  In the NGS proposal, what do you mean with "and due the high number of unknown 
  data generated"?
  
  Also, you now have four projects, all of which have Raoul as the (apparent) 
  primary mentor.
  I wonder if this could a problem.Hope no...Last night I put me as first mentor just because I was writing and because were my ideas, It looked weird also to me.
If we can mix ourself for better chances is fine, no problem at all. But I supposed the time is over. Sorry guys, yesterday have been a long day for me too.

  
  Chris
  
  
  
  
  
  ----- Original Message ----
  > From: Francesco Strozzi <francesco.strozzi at gmail.com>
  > To: Raoul Bonnal <bonnalraoul at ingm.it>
  > Cc: BioRuby ML <bioruby at lists.open-bio.org>
  > Sent: Fri, March 11, 2011 1:44:37 AM
  > Subject: Re: [BioRuby] BioRuby GSoC 2011 ideas?
  > 
  > Ok, made some changes with Raoul to the BioRuby proposals. We think this  is
  > fine for us for now, if you have comments or want to change something let  us
  > know...time is quite short.
  > 
  > Cheers
  > Francesco
  > 
  > On Fri, Mar  11, 2011 at 08:10, Francesco Strozzi <
  > francesco.strozzi at gmail.com>  wrote:
  > 
  > > First of all I hope everybody in Japan are fine. Just saw  right now the
  > > breaking news about the big earthquake that hit  Tokyo...
  > >
  > > Raoul,
  > > many thanks for the work you have done  (this night), I'm reading the
  > > proposals and making small  changes....
  > >
  > > Francesco
  > >
  > >
  > > On Fri, Mar 11,  2011 at 03:41, Raoul Bonnal <bonnalraoul at ingm.it>  wrote:
  > >
  > >> Dear All,
  > >> I've  added proposals to  our wiki page
  > >>   http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Proposal_2011
  > >>  with these titles:
  > >>
  > >>
  > >> * 3.1 Proposal  2011
  > >>
  > >> * 3.1.1 Support Next Generation Sequencing (NGS) in  BioRuby
  > >> * 3.1.2 BioRuby Wrapper for Command line  application
  > >> * 3.1.3 Represent bio-objects and related information  with images
  > >> * 3.1.4 Modular annotation knowledge base for  BioRuby
  > >>
  > >> I've also update the OBF wiki page linking these  proposal,
  > >>
  > >>  
  >http://www.open-bio.org/wiki/Google_Summer_of_Code#Mentors_and_Project_Ideas
  > >>
  > >>  As usual we have to refine many things but I hope it  helped.
  > >>
  > >> See you in few hours ^_^
  > >>
  > >>  Any modification/contribute is very  appreciated.
  > >>
  > >>
  > >> Notes:
  > >> 1) I forgot  to mention the semantic web SPARQL...., please add it if you
  > >> are  going to support it.
  > >> 2) I reduced the lims part because was too  complicated probably and for
  > >> NGS I did subproposal but I don't know  if that is the right formant.
  > >> 3) For those not cited as mentor,  don't hesitate to add yourself to the
  > >> list, I'm just  tired.
  > >> 4) I think old projects could be resubmitted, please Goto-san  evaluate
  > >> this possibility too.
  > >>
  > >>  --
  > >> Ra
  > >>  _______________________________________________
  > >> BioRuby Project -  http://www.bioruby.org/
  > >> BioRuby mailing list
  > >> BioRuby at lists.open-bio.org
  > >> http://lists.open-bio.org/mailman/listinfo/bioruby
  > >>
  > >
  > >
  > >
  > > ; --
  > >
  > > Francesco
  > >
  > >
  > 
  > 
  > -- 
  > 
  > Francesco
  > _______________________________________________
  > BioRuby  Project - http://www.bioruby.org/
  > BioRuby mailing list
  > BioRuby at lists.open-bio.org
  > http://lists.open-bio.org/mailman/listinfo/bioruby
  > 
    

From rutgeraldo at gmail.com  Mon Mar 14 09:47:01 2011
From: rutgeraldo at gmail.com (Rutger Vos)
Date: Mon, 14 Mar 2011 13:47:01 +0000
Subject: [BioRuby] Fwd: Reminder: deadline ievobio @ Fri Mar 18,
	2011 (Rutger Vos)
In-Reply-To: <0015174763185c34ab049e4c15f5@google.com>
References: <0015174763185c34ab049e4c15f5@google.com>
Message-ID: <AANLkTi=i8q-AHxeYYtRB3e5S_2zeog_AdCZLnH_6bLUc@mail.gmail.com>

---------- Forwarded message ----------
From: Google Calendar <calendar-notification at google.com>
Date: Sat, Mar 12, 2011 at 5:05 PM
Subject: Reminder: deadline ievobio @ Fri Mar 18, 2011 (Rutger Vos)
To: Rutger Vos <rutgeraldo at gmail.com>


more details ?<https://www.google.com/calendar/event?action=VIEW&eid=N2hhbzJlczNjY2cyNDJuMHVxZzM5dG9rN2cgcnV0Z2VyYWxkb0Bt&tok=MjAjcnV0Z2VyYWxkb0BnbWFpbC5jb21mMDFlMTZhMWRiYWM0YmI1MmM0MWZmODY4OTJiNDdmMzEzYzZmYmE3&ctz=Europe%2FLondon&hl=en>
deadline ievobio
The Call for Abstracts for full talks is now open for the 2011
conference on Informatics for Phylogenetics, Evolution, and
Biodiversity (iEvoBio), at
http://ievobio.org/ocs/index.php/ievobio/2011<http://www.google.com/url?q=http%3A%2F%2Fievobio.org%2Focs%2Findex.php%2Fievobio%2F2011&usd=2&usg=AFQjCNFZGQoslfCZQYgSiwMP06MbXWh-SQ>.
See below for
instructions.

Accepted talks will be about 15-20 minutes in length and will be
presented during the full talk sessions in the morning of each of the
two conference days, following the day's keynote presentation.

Submitted talks should be in the area of informatics aimed at
advancing research in phylogenetics, evolution, and biodiversity,
including new tools, cyberinfrastructure development, large-scale data
analysis, and visualization.

Submissions consist of a title and an abstract at most 1 page long.
The abstract should provide an overview of the talk's subject. As the
number of program slots for full talks is limited, the abstract should
give enough detail so reviewers can decide whether the submission
merits a full talk or whether it should be moved to one of the
Lightning Talk sessions. If the subject of the talk is a specific
software component for use by the research community, the abstract
must state the license and give the URL where the source code is
available so reviewers can verify that the open-source requirement(*)
is met.

The deadline for submission is March 18, 2011. We intend to notify
authors of accepted talks before early registration for iEvoBio (and
Evolution) ends. Further instructions for submission are at the
following URL:

http://ievobio.org/ocs/index.php/ievobio/2011/schedConf/cfp<http://www.google.com/url?q=http%3A%2F%2Fievobio.org%2Focs%2Findex.php%2Fievobio%2F2011%2FschedConf%2Fcfp&usd=2&usg=AFQjCNG7VXo3RDOBRllz0TiKqiQMvcY4lw>

Full talks are 1 of 5 kinds of contributed content that iEvoBio will
feature. The other 4 are: 1) Lightning talks (5 mins long), 2)
Challenge entries, 3) Software bazaar demonstrations, and 4) Birds-of-
a-Feather gatherings. The Call for Challenge entries is already open
(see http://ievobio.org/challenge.html<http://www.google.com/url?q=http%3A%2F%2Fievobio.org%2Fchallenge.html&usd=2&usg=AFQjCNGQqx6QuPTXhi4JmKWe3v7IzP8ngw>).
The calls for contribution to
the other 3 sessions will open later, and will remain open until
shortly before the conference or until the respective track fills up.

More details about the program and guidelines for contributing content
are available at
http://ievobio.org<http://www.google.com/url?q=http%3A%2F%2Fievobio.org&usd=2&usg=AFQjCNGuGGRgD7Y66tr9YUHcOVpxhmsgKw>.
You can also find continuous
updates on the conference's Twitter feed at
http://twitter.com/<http://www.google.com/url?q=http%3A%2F%2Ftwitter.com%2F&usd=2&usg=AFQjCNFrw0bIBFXMJOynirJL5Eyikc0YuA>
iEvoBio , or subscribe to the low-traffic iEvoBio announcements
mailing list at http://groups.google.com/group/ievobio-announce

iEvoBio is sponsored by the US National Evolutionary Synthesis Center
(NESCent) in partnership with the Society for the Study of Ecolution
(SSE) and the Society of Systematic Biologists (SSB). Additional
support has been provided by the Encyclopedia of Life (EOL).


The iEvoBio 2011 Organizing Committee:
Rob Guralnick (University of Colorado at Boulder) (Co-chair)
Cynthia Parr (Encyclopedia of Life) (Co-chair)
Dawn Field (UK National Environmental Research Center)
Mark Holder (University of Kansas)
Hilmar Lapp (NESCent)
Rod Page (University of Glasgow)

(*) iEvoBio and its sponsors are dedicated to promoting the practice
and philosophy of Open Source software development (see
http://www.opensource.org/docs/definition.php<http://www.google.com/url?q=http%3A%2F%2Fwww.opensource.org%2Fdocs%2Fdefinition.php&usd=2&usg=AFQjCNEQcWgwBoO0kepsI4YHIpT7ADgy9Q>
)
and reuse within the research community. For this reason, if a
submitted talk concerns a specific software system for use by the
research community, that software must be licensed with a recognized
Open Source License (see
http://www.opensource.org/licenses/<http://www.google.com/url?q=http%3A%2F%2Fwww.opensource.org%2Flicenses%2F&usd=2&usg=AFQjCNFvM-2dvS0ruUQBpdGyvnFxG0MA5g>),
and be
available for download, including source code, by a tar/zip file
accessed through ftp/http or through a widely used version control
system like cvs, Subversion, git, Bazaar, or Mercurial. Authors of
full talks who cannot meet this requirement at the time of submission
should state their intentions, and are advised that the requirement
must be met by June 19, 2011, at the latest.

*When*
Fri Mar 18, 2011
*Calendar*
Rutger Vos
*Who*
?
Rutger Vos - organizer

Invitation from Google Calendar <https://www.google.com/calendar/>

You are receiving this email at the account rutgeraldo at gmail.com because you
set a reminder for this event on the calendar Rutger Vos.

You can change your reminders for specific events in the event details page
in https://www.google.com/calendar/.



-- 
Dr. Rutger A. Vos
School of Biological Sciences
Philip Lyle Building, Level 4
University of Reading
Reading
RG6 6BX
United Kingdom
Tel: +44 (0) 118 378 7535
http://www.nexml.org
http://rutgervos.blogspot.com


From cjfields at illinois.edu  Wed Mar 16 13:58:23 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 16 Mar 2011 12:58:23 -0500
Subject: [BioRuby] [ANNOUNCEMENT] Bugzilla to Redmine migration
Message-ID: <34C8C0CB-9273-468E-86D7-74B22464F181@illinois.edu>

(apologies if you receive multiple copies of this)

All,

We are currently about 95% done with a transition over to our new Redmine tracking system, to the point where we feel comfortable in going ahead with opening it to developers:

http://redmine.open-bio.org/

All edits to bugzilla reports on our old system (http://bugzilla.open-bio.org/) are now disabled and the system is now read-only.  Any new bugs and comments to old ones should be reported on the new Redmine server.

For current Bugzilla users, we have migrated login IDs to Redmine (this is normally an email address), but we have reset user passwords for security reasons.  There are two ways to access your account:

1) When logging in (http://redmine.open-bio.org/login), click on the 'Lost password' link.  You will be prompted for your email address (this should be the same as your bugzilla login).  An new email will be sent out containing directions for resetting your password and logging in.

2) It is possible the above may be automatically detected as spam.  If the above doesn't work or the reset email isn't received within a day, contact support at helpdesk.open-bio.org to receive your new password.

Also, note that Redmine has a different syntax for those who want to add links to their reports; see http://www.redmine.org/projects/redmine/wiki/RedmineTextFormatting.

Let us know if you have any questions.  

chris

Christopher Fields
IGB Postdoctoral Fellow
Genomics of Neural & Behavioral Plasticity
University of Illinois Urbana-Champaign
Institute for Genomic Biology
1206 W. Gregory Dr. , MC-195
Urbana, IL 61801

From mail at michaelbarton.me.uk  Wed Mar 16 17:12:01 2011
From: mail at michaelbarton.me.uk (Michael Barton)
Date: Wed, 16 Mar 2011 17:12:01 -0400
Subject: [BioRuby] Remote blast not working?
Message-ID: <20110316211201.GA2640@nku069218.hh.nku.edu>

Hi,

I'm struggling to use the remote blast part of bioruby. I get errors using
either the ddbj or genomenet versions. With genomenet I get an error about
a nil response and with genomenet I get an error for 'cannot understand
response'. I've tried different combinations of databases and options but keep
getting the same problems.

Bio::Blast::Remote.ddbj('blastp', 'nr-aa', '-e 0.001')

Can anyone offer any suggestions?

Cheers

Mike

From rutgeraldo at gmail.com  Wed Mar 16 17:40:08 2011
From: rutgeraldo at gmail.com (Rutger Vos)
Date: Wed, 16 Mar 2011 21:40:08 +0000
Subject: [BioRuby] Remote blast not working?
In-Reply-To: <20110316211201.GA2640@nku069218.hh.nku.edu>
References: <20110316211201.GA2640@nku069218.hh.nku.edu>
Message-ID: <AANLkTin2N5YeHoVyOqfUSkqNCMapAWJ12BsT2CjqDDXc@mail.gmail.com>

DDBJ is offline due to the earthquake

On Wednesday, March 16, 2011, Michael Barton <mail at michaelbarton.me.uk> wrote:
> Hi,
>
> I'm struggling to use the remote blast part of bioruby. I get errors using
> either the ddbj or genomenet versions. With genomenet I get an error about
> a nil response and with genomenet I get an error for 'cannot understand
> response'. I've tried different combinations of databases and options but keep
> getting the same problems.
>
> Bio::Blast::Remote.ddbj('blastp', 'nr-aa', '-e 0.001')
>
> Can anyone offer any suggestions?
>
> Cheers
>
> Mike
>

-- 
Dr. Rutger A. Vos
School of Biological Sciences
Philip Lyle Building, Level 4
University of Reading
Reading
RG6 6BX
United Kingdom
Tel: +44 (0) 118 378 7535
http://www.nexml.org
http://rutgervos.blogspot.com

From tomoakin at kenroku.kanazawa-u.ac.jp  Wed Mar 16 20:35:24 2011
From: tomoakin at kenroku.kanazawa-u.ac.jp (Tomoaki NISHIYAMA)
Date: Thu, 17 Mar 2011 09:35:24 +0900
Subject: [BioRuby] DDBJ services suspension schedule
In-Reply-To: <AANLkTin2N5YeHoVyOqfUSkqNCMapAWJ12BsT2CjqDDXc@mail.gmail.com>
References: <20110316211201.GA2640@nku069218.hh.nku.edu>
	<AANLkTin2N5YeHoVyOqfUSkqNCMapAWJ12BsT2CjqDDXc@mail.gmail.com>
Message-ID: <7576BC8A-F079-465B-882F-7A88CA73BADC@kenroku.kanazawa-u.ac.jp>

Hi

> DDBJ is offline due to the earthquake


That's right.

The announcement by DDBJ/NIG can be found at
http://www.ddbj.nig.ac.jp/whatsnew/2011/110314-e.html#today
http://www.evernote.com/pub/ddbj/topics#v=t&n=def64d51-08b0-4f54-a27b- 
f2701b74a77a&b=0

Essentially its due to electricity shortage in Eastern Honshu Island  
caused by the earthquake on March 11.
Many power stations are stopped, not only the Fukushima nuclear power  
plant.
There are many more internet services that are suspended due to the  
same reason
and not by any problem in the computers.

Sincerely
-- 
Tomoaki NISHIYAMA

Advanced Science Research Center,
Kanazawa University,
13-1 Takara-machi,
Kanazawa, 920-0934, Japan


From ktym at hgc.jp  Wed Mar 16 21:28:21 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Thu, 17 Mar 2011 10:28:21 +0900
Subject: [BioRuby] Remote blast not working?
In-Reply-To: <20110316211201.GA2640@nku069218.hh.nku.edu>
References: <20110316211201.GA2640@nku069218.hh.nku.edu>
Message-ID: <540CCF1E-2F3B-441A-9C44-2F36BB7D2035@hgc.jp>

As for the GenomeNet part, it is already fixed but not yet released.

https://github.com/bioruby/bioruby/blob/master/lib/bio/appl/blast/genomenet.rb#L241

You can replace your installation with the above file for quick fix.

Thanks,
Toshiaki

On 2011/03/17, at 6:12, Michael Barton wrote:

> Hi,
> 
> I'm struggling to use the remote blast part of bioruby. I get errors using
> either the ddbj or genomenet versions. With genomenet I get an error about
> a nil response and with genomenet I get an error for 'cannot understand
> response'. I've tried different combinations of databases and options but keep
> getting the same problems.
> 
> Bio::Blast::Remote.ddbj('blastp', 'nr-aa', '-e 0.001')
> 
> Can anyone offer any suggestions?
> 
> Cheers
> 
> Mike
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby



From rutgeraldo at gmail.com  Fri Mar 18 10:16:25 2011
From: rutgeraldo at gmail.com (Rutger Vos)
Date: Fri, 18 Mar 2011 14:16:25 +0000
Subject: [BioRuby] Please forward: collecting support for Japanese scientists
Message-ID: <AANLkTiksWdna1MLpbBWk2nDv0LAyrXdU7xV3Fs5gSHkF@mail.gmail.com>

Dear colleagues,

A web page has been launched to collect support for Japanese
(bio-)scientists: http://biohelpathon.org - please forward this
address widely.

The purpose of the web page is to establish a knowledge base of
available support for our colleagues in Japan. You are invited to
submit any tips, ideas and offers including accommodation, funding
resources, exchange schemes, lab space, server space and open
positions for visiting students and research personnel from Japan.

We will collect your suggestions and offers and will share them with
whoever is best placed to disseminate them. This initiative originates
with the attendees of the BioHackathons (the Japanese website
http://hackathon.dbcls.jp is offline due to the earthquake), but
anyone is very welcome to contribute. To get in touch, join
http://groups.google.com/group/biohelpathon.

This initiative is no alternative to first responders who are helping
out in Japan right now. The rescue operation and food and shelter
support comes first. If you can only do one thing, it should be a
donation to something like the Red Cross. This comes later.

See also:
A different initiative, with which we're in touch:
http://www.nipponsciencesupport.net/
More info on Nature blogs:
http://blogs.nature.com/news/thegreatbeyond/2011/03/helping_hand_for_scientistrefu.html

PLEASE NOTE: WE ARE NOT HANDLING MONEY. This is simply a way to
crowdsource information about available resources.

Thank you.

Rutger Vos

From pjotr.public14 at thebird.nl  Sun Mar 20 04:51:39 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Sun, 20 Mar 2011 09:51:39 +0100
Subject: [BioRuby] More plugins
Message-ID: <20110320085139.GA12111@thebird.nl>

The rbib gem is a bibtex parser by Nick Gasson. I think it could be a
bioruby vetted plugin. See

  https://rubygems.org/gems/rbib

Pj.

From mail at michaelbarton.me.uk  Sun Mar 20 16:56:51 2011
From: mail at michaelbarton.me.uk (Michael Barton)
Date: Sun, 20 Mar 2011 16:56:51 -0400
Subject: [BioRuby] Remote blast not working?
In-Reply-To: <540CCF1E-2F3B-441A-9C44-2F36BB7D2035@hgc.jp>
References: <20110316211201.GA2640@nku069218.hh.nku.edu>
	<540CCF1E-2F3B-441A-9C44-2F36BB7D2035@hgc.jp>
Message-ID: <20110320205651.GE3954@Michael-Bartons-MacBook.local>

Hi Toshiaki,

Thank you for the patch. That worked perfectly. I sometimes get unusual parsing
errors which I think are originating from raxml. Has anyone else experienced
something similar?

Cheers

Mike

On Thu, Mar 17, 2011 at 10:28:21AM +0900, Toshiaki Katayama wrote:
> As for the GenomeNet part, it is already fixed but not yet released.
> 
> https://github.com/bioruby/bioruby/blob/master/lib/bio/appl/blast/genomenet.rb#L241
> 
> You can replace your installation with the above file for quick fix.
> 
> Thanks,
> Toshiaki
> 
> On 2011/03/17, at 6:12, Michael Barton wrote:
> 
> > Hi,
> > 
> > I'm struggling to use the remote blast part of bioruby. I get errors using
> > either the ddbj or genomenet versions. With genomenet I get an error about
> > a nil response and with genomenet I get an error for 'cannot understand
> > response'. I've tried different combinations of databases and options but keep
> > getting the same problems.
> > 
> > Bio::Blast::Remote.ddbj('blastp', 'nr-aa', '-e 0.001')
> > 
> > Can anyone offer any suggestions?
> > 
> > Cheers
> > 
> > Mike
> > _______________________________________________
> > BioRuby Project - http://www.bioruby.org/
> > BioRuby mailing list
> > BioRuby at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioruby
> 

From pjotr.public14 at thebird.nl  Thu Mar 24 05:48:07 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Thu, 24 Mar 2011 10:48:07 +0100
Subject: [BioRuby] Migrating to Ruby 1.9, the good, the bad and the ugly
Message-ID: <20110324094807.GA5697@thebird.nl>

Ruby had a major overhaul with the introduction of the 1.9 series. 
I wrote something tips for migrating from 1.8 to 1.9:

  http://blog.thebird.nl/

Tell me, if you have more.

Pj.

From mail at michaelbarton.me.uk  Thu Mar 24 11:00:38 2011
From: mail at michaelbarton.me.uk (Michael Barton)
Date: Thu, 24 Mar 2011 11:00:38 -0400
Subject: [BioRuby] Migrating to Ruby 1.9, the good, the bad and the ugly
In-Reply-To: <20110324094807.GA5697@thebird.nl>
References: <20110324094807.GA5697@thebird.nl>
Message-ID: <AANLkTikTZcxF334cO8CtVTj6RqCSxuFk1dmtdL7H7UDq@mail.gmail.com>

There's a blog post here which might also be of use -
http://www.igvita.com/2011/02/03/new-ruby-19-features-tips-tricks/

On 24 March 2011 05:48, Pjotr Prins <pjotr.public14 at thebird.nl> wrote:
> Ruby had a major overhaul with the introduction of the 1.9 series.
> I wrote something tips for migrating from 1.8 to 1.9:
>
> ?http://blog.thebird.nl/
>
> Tell me, if you have more.
>
> Pj.
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>


From pjotr.public14 at thebird.nl  Thu Mar 24 13:20:30 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Thu, 24 Mar 2011 18:20:30 +0100
Subject: [BioRuby] Migrating to Ruby 1.9, the good, the bad and the ugly
In-Reply-To: <AANLkTikTZcxF334cO8CtVTj6RqCSxuFk1dmtdL7H7UDq@mail.gmail.com>
References: <20110324094807.GA5697@thebird.nl>
	<AANLkTikTZcxF334cO8CtVTj6RqCSxuFk1dmtdL7H7UDq@mail.gmail.com>
Message-ID: <20110324172030.GA10683@thebird.nl>

On Thu, Mar 24, 2011 at 11:00:38AM -0400, Michael Barton wrote:
> There's a blog post here which might also be of use -
> http://www.igvita.com/2011/02/03/new-ruby-19-features-tips-tricks/

Only problem, it fails to point out what fails silently ;)

From andrew.j.grimm at gmail.com  Thu Mar 24 18:29:33 2011
From: andrew.j.grimm at gmail.com (Andrew Grimm)
Date: Fri, 25 Mar 2011 09:29:33 +1100
Subject: [BioRuby] Migrating to Ruby 1.9, the good, the bad and the ugly
In-Reply-To: <20110324172030.GA10683@thebird.nl>
References: <20110324094807.GA5697@thebird.nl>
	<AANLkTikTZcxF334cO8CtVTj6RqCSxuFk1dmtdL7H7UDq@mail.gmail.com>
	<20110324172030.GA10683@thebird.nl>
Message-ID: <AANLkTikimPkNiZ1GRE-Jso7Sq_G+yPXam_b6_7uJLh8-@mail.gmail.com>

I've heard that One9 lists cases where you call a method that changes
between 1.8 and 1.9. https://github.com/cldwalker/one9

Andrew

On Fri, Mar 25, 2011 at 4:20 AM, Pjotr Prins <pjotr.public14 at thebird.nl> wrote:
> On Thu, Mar 24, 2011 at 11:00:38AM -0400, Michael Barton wrote:
>> There's a blog post here which might also be of use -
>> http://www.igvita.com/2011/02/03/new-ruby-19-features-tips-tricks/
>
> Only problem, it fails to point out what fails silently ;)
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>

From mikeco57 at gmail.com  Thu Mar 24 18:34:12 2011
From: mikeco57 at gmail.com (Michael O'Keefe)
Date: Thu, 24 Mar 2011 18:34:12 -0400
Subject: [BioRuby] BioRuby tutorial
Message-ID: <4D8BC6E4.5090001@gmail.com>

Hello everyone,

I've updated the tutorial located in the Git repository to add in some 
information that was missing and update the grammar. I created a pull 
request on bioruby/bioruby from my repository at 
https://github.com/okeefm/bioruby
The pull request is at: https://github.com/bioruby/bioruby/pull/32
Please feel free to comment on it; it's my first pull request for 
BioRuby, so I would like to know what I've done well/not well.

Thank you,
Michael O'Keefe
mikeco57 at gmail.com

From bonnal at ingm.org  Fri Mar 25 12:19:36 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Fri, 25 Mar 2011 17:19:36 +0100
Subject: [BioRuby] BioRuby & Google Summer of Code 2011
Message-ID: <E9EBB93A-697D-405F-AF3F-DB8F5DE22935@ingm.org>

Dear All,
our project, is looking for students to participate at GSoC 2011, thanks to OBF and NESCENT
Please feel free to forward this message to your university-ml, lab or local ruby group.

Use our ml to discuss ideas and feel free to contact the mentors or any other member for the development team.


March 18-27: Would-be student participants discuss application ideas with mentoring organizations.
March 28: Student application period opens.
April 8 19:00 UTC Student application deadline.
from: http://www.google-melange.com/document/show/gsoc_program/google/gsoc2011/timel


Our proposals
-links-
http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Proposal_2011
http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2011#BioRuby_forester

-text-
Proposal 2011

OBF
Support Next Generation Sequencing (NGS) in BioRuby

Rationale 
The processing and analyzing of NGS data is challenging for a variety of reasons, in particular due to the fact that the data-sets are usually very large and contain a vast amount of information and a high number of unknown data. Furthermore there are many different approaches to perform NGS analyses and several software tools need to be integrated to produce reliable results. Since this topic is so important for the BioRuby community we started a sub-project bioruby-ngs for analyzing NGS data. The project is in an early stage of development but notable results have been quickly gained. Many topics need to be still addressed, in particular:
data and results reporting
workflow management
DSL for describing experimental designs
YALIMS (Yet Another LIMS), a simple web based Lims for raw datasets processing, with reporting and monitoring
Approach 
Due to the open nature of the project the student will choose which feature he/she wants to develop and to focus on. The student will learn basic concept of NGS data analysis and will work tightly with a mentor to produce a working library that will be integrated into the BioRuby NGS project.
Difficulty and needed skills 
Medium to Hard depending on the topic selected.
The project requires
Ruby
Bash programming and knowledge of the Linux environment
Ruby on Rails 3.x
Mentors 
Raoul J.P. Bonnal, Francesco Strozzi
Project overview and updates 
[1]
Source code
https://github.com/helios/bioruby-ngs
BioRuby Wrapper for Command line application

Rationale 
The main reason for this project is the need to support different stand-alone applications critical for Next Generation Sequences analyses. Direct binding to existing C/C++ source code or rewriting all the applications is impractical and a waste of resources. A quick solution is to use stand-alone applications directly, integrating them into the BioRuby API. Some work has been already done in the BioRuby NGS project with this wrapper but a better support for demanding I/O processes is required. Following this design pattern will be possible to improve also the support for other bioinformatics suites, like EMBOSS, outdated in BioRuby at the time of this proposal.
Approach 
The student will familiarize with advanced meta-programming concepts in Ruby and will contribute to the definition of a DSL for this wrapping library. He/she will build also a parser to automatically define additional wrappers for the EMBOSS suites starting from the ACD configuration files.
Difficulty and needed skills 
Medium. Good Ruby knowledge and experience with meta-programming are required to achieve the goals.
The project requires
Ruby 1.9
Ruby Metaprogramming
Mentors 
Raoul J.P. Bonnal, Francesco Strozzi
Source code
https://github.com/helios/bioruby-ngs, wrapper branch
Represent bio-objects and related information with images

Rationale 
Most of the time, after a bioinformatics analysis, the resulting data needs to be re-processed into a graphical way since we, as human-beings, are more comfortable accessing results and data visually than browsing a huge table with interconnected information. Very often it is also difficult to extrapolate the real biological meaning from a raw datasets. The main idea of this proposal is to define and attach graphical functions to BioRuby objects and consequently to the results computed from a generic process or pipeline. With this solution, it would be possible to explore them more naturally but also to export and integrate the information into a web environment, for sharing the knowledge and the results. For example, different objects storing alignments results could share the same interface and display their data in a common way. The same is true also for other kind of objects or computational procedures.
Approach 
The student and the mentor will define together a minimum set of features that need to be shared by the BioRuby objects and that could be visualized. Then the student will create a library/module to implement these graphical features within the BioRuby project. He/she will gain experience with Rubyvis as the graphical API and with Ruby on Rails for web visualization.
Difficulty and needed skills 
Medium/Hard. The student will need to define a graphical API and integrate the new code with the existing BioRuby modules. High level coding skills will be required to create a clean API with a clear documentation.
The project requires
Very good knowledge of Ruby (1.9) and pattern design
Basic concepts of graphics/visualization
Ruby on Rails basic knowledge
Mentors 
Raoul J.P. Bonnal, Christian Zmasek, Claudio Bustos (confirm)


Modular annotation knowledge base for BioRuby

Rationale 
Handling data sets coming from platforms for gene expression analysis or real time PCR requires to access the corresponding gene annotations several times during the measurements. This kind of information is normally stored into remote databases that provide the required knowledge and data. Problems arise when the available databases do not support a specific version of the data of interest or when huge queries need to be submitted. A BioRuby knowledge base, designed to be modular and expandable through time, could solve these problems. A good compromise between performances and portability could be achieved using embedded databases and accessing the data through a clean API.
Approach 
The student and the mentor will explore which platforms should be supported by their popularity. Then the student will recover the essential annotation and will design a simple database schema to support all the relevant non-redundant information. The schema will be flexible enough to allow interconnecting the dataset with external databases or resources for subsequent analyses. After this phase of discovery and design, the student will build the database using SQLite and will write a Ruby library to access the data using ORM ActiveRecord
Difficulty and needed skills 
Medium. The student will need to define the core data to be included into the database and how this information will be organized and accessed by the end-user. The Ruby library will be created using the powerful ActiveRecord paradigms, but good coding skills will be required to design an efficient API with a clear documentation.
The project requires
Minimal SQL dialect
Good knowledge of Ruby
Experience in querying biological databases
Experience with annotation data
Mentors 
Raoul J.P. Bonnal, Francesco Strozzi
--------------


NESCENT

 BioRuby forester

Rationale 
Forester is a collection of software libraries, mostly written in Java, for comparative genomics and evolutionary biology research. A prominent example of a tool based on forester is the phylogenetic tree explorer Archaeopteryx. Most of forester's use-cases are associated with the use of evolutionary trees as tools for establishing (functional) relations between genes or proteins (for example protein function prediction with RIO) and comparing genome based features between different species. Therefore, it implements objects representing evolutionary trees overlaid with biological data from other sources (e.g. protein domain architectures), as well as algorithms operating on these, such as the automated inference of ancestral taxonomies on gene trees, which has proven useful in the functional interpretation of large gene trees.
Most of these methods are currently only accessible via the command-line or through the GUI of Archaeopteryx and therefore difficult or impossible to use from other computer programs or toolkits (such as BioRuby). Although forester is mostly written in Java, it also contains components in Ruby ("evoruby"). These implement operations on multiple sequence alignments (MSAs) that are crucial in the development of workflows for automated, large scale, phylogenetic inference, including I/O, and efficient MSA manipulation (such as deletion of all columns with a gap-portion larger than a given threshold, removal of short and/or redundant sequences).
Approach 
The goal would be to develop a framework for accessing forester's central algorithms and applications from within BioRuby. It is expected that this project will be implemented in form of a BioRuby plugin in order to avoid creating additional dependencies for the main BioRuby distribution. Full two-way access between the Java and Ruby languages can be accomplished by using JRuby as the underlaying platform.
Depending on the level of experience and skills of a student, a project proposal could also include either or both of the following additional goals.
BioRuby and the "evoruby" components of forester partially overlap in functionality. You could incorporate MSA management functionality present in "evoruby" but missing in BioRuby into the BioRuby distribution. This would not only make that functionality immediately accessible to all BioRuby users, but would also allow a larger community of developers to participate in maintentence and future development of these components.
Display gene conversions. This would entail developing a parser for GENECONV output and use the newly developed BioRuby-forester link to directly display gene conversions within Archaeopteryx.
Challenges
The student needs to learn two disparate toolkits, BioRuby and forester.
The project involves two programming languages, Ruby and Java.
Need to understand the BioRuby plugin system.
Involved toolkits or projects 
BioRuby
BioRuby plugin system
RubyGems
JRuby
forester
Degree of difficulty and needed skills 
Expected difficulty: Medium. Proficiency in at least one of the two involved programming languages, Ruby and Java, is necessary. Experience/interest in molecular evolution or comparative genomics is required, and experience with BioRuby or forester will help.
Mentors 
Christian Zmasek, Pjotr Prins, Raoul J.P. Bonnal




--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios







From bonnal at ingm.org  Fri Mar 25 13:06:31 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Fri, 25 Mar 2011 18:06:31 +0100
Subject: [BioRuby] FastQ and Quality Scores
Message-ID: <A7169C4B-A433-4666-B6BD-D9F1B2EDF5C0@ingm.org>

Dear All,
probably I don't know very much this part of the bioruby library (not yet). In this days I'm playing a bit with fastq data :-) and bioruby
today I was reading a fastq file coming from Illumina HiScanSQ:
r=Bio::FlatFile.auto("spec/fixture/test.fastq")

x=r.first
 => #<Bio::Fastq:0x00000100849b20 @definition="H125:1:1108:1147:2046#0/1", @sequence_string="CGGGAAATGGCGGAAATGTGCAAGGATGTTATATGAATTGTGTTGGTTGGCCTAAAACACAGAGCCGGCTTGAAGT", @definition2="", @quality_string="[XSZGXPSKPJPP]TWQRFRHXW\\WXXX]PUX[W_^R^[XRNRYV]^Y[]UUNRT]X_BBBBBBBBBBBBBBBBBB"> 

No format specified, but by default the format of the library is sanger:

x.quality_scores
 => [58, 55, 50, 57, 38, 55, 47, 50, 42, 47, 41, 47, 47, 60, 51, 54, 48, 49, 37, 49, 39, 55, 54, 59, 54, 55, 55, 55, 60, 47, 52, 55, 58, 54, 62, 61, 49, 61, 58, 55, 49, 45, 49, 56, 53, 60, 61, 56, 58, 60, 52, 52, 45, 49, 51, 60, 55, 62, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33] 
\">"

x
 => #<Bio::Fastq:0x00000100849b20 @definition="H125:1:1108:1147:2046#0/1", @sequence_string="CGGGAAATGGCGGAAATGTGCAAGGATGTTATATGAATTGTGTTGGTTGGCCTAAAACACAGAGCCGGCTTGAAGT", @definition2="", @quality_string="[XSZGXPSKPJPP]TWQRFRHXW\\WXXX]PUX[W_^R^[XRNRYV]^Y[]UUNRT]X_BBBBBBBBBBBBBBBBBB", @format=#<Bio::Fastq::FormatData::FASTQ_SANGER:0x00000100881ea8 @name="fastq-sanger", @symbol=:fastq_sanger, @offset=33, @score_range=0..93>, @quality_scores=[58, 55, 50, 57, 38, 55, 47, 50, 42, 47, 41, 47, 47, 60, 51, 54, 48, 49, 37, 49, 39, 55, 54, 59, 54, 55, 55, 55, 60, 47, 52, 55, 58, 54, 62, 61, 49, 61, 58, 55, 49, 45, 49, 56, 53, 60, 61, 56, 58, 60, 52, 52, 45, 49, 51, 60, 55, 62, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33]> 

so the sanger is the default.

Is Illumina the right format for the newest technology/datasets ?

x.format = :fastq_illumina
 => :fastq_illumina

x.quality_scores
 => [27, 24, 19, 26, 7, 24, 16, 19, 11, 16, 10, 16, 16, 29, 20, 23, 17, 18, 6, 18, 8, 24, 23, 28, 23, 24, 24, 24, 29, 16, 21, 24, 27, 23, 31, 30, 18, 30, 27, 24, 18, 14, 18, 25, 22, 29, 30, 25, 27, 29, 21, 21, 14, 18, 20, 29, 24, 31, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2]

Note that two formats are using different offsets and ranges.

Obviously also the error_probabilities are different. I think that this behavior is misleading at least for me, using data coming from illumina using their metric and finding the phred right there.

x.error_probabilities #illumina
 => [0.001995262314968879, 0.003981071705534973, 0.012589254117941675, 0.0025118864315095794, 0.19952623149688797, 0.003981071705534973, 0.025118864315095794, 0.012589254117941675, 0.07943282347242814, 0.025118864315095794, 0.1, 0.025118864315095794, 0.025118864315095794, 0.0012589254117941675, 0.01, 0.005011872336272725, 0.0199526231496888, 0.015848931924611134, 0.251188643150958, 0.015848931924611134, 0.15848931924611134, 0.003981071705534973, 0.005011872336272725, 0.001584893192461114, 0.005011872336272725, 0.003981071705534973, 0.003981071705534973, 0.003981071705534973, 0.0012589254117941675, 0.025118864315095794, 0.007943282347242814, 0.003981071705534973, 0.001995262314968879, 0.005011872336272725, 0.0007943282347242813, 0.001, 0.015848931924611134, 0.001, 0.001995262314968879, 0.003981071705534973, 0.015848931924611134, 0.039810717055349734, 0.015848931924611134, 0.0031622776601683794, 0.00630957344480193, 0.0012589254117941675, 0.001, 0.0031622776601683794, 0.001995262314968879, 0.0012589254117941675, 0.007943282347242814, 0.007943282347242814, 0.039810717055349734, 0.015848931924611134, 0.01, 0.0012589254117941675, 0.003981071705534973, 0.0007943282347242813, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932]

x.error_probabilities #phred
 => [1.584893192461114e-06, 3.162277660168379e-06, 1.0e-05, 1.9952623149688787e-06, 0.00015848931924611142, 3.162277660168379e-06, 1.9952623149688786e-05, 1.0e-05, 6.309573444801929e-05, 1.9952623149688786e-05, 7.943282347242822e-05, 1.9952623149688786e-05, 1.9952623149688786e-05, 1.0e-06, 7.943282347242822e-06, 3.981071705534969e-06, 1.584893192461114e-05, 1.2589254117941661e-05, 0.00019952623149688788, 1.2589254117941661e-05, 0.00012589254117941674, 3.162277660168379e-06, 3.981071705534969e-06, 1.2589254117941661e-06, 3.981071705534969e-06, 3.162277660168379e-06, 3.162277660168379e-06, 3.162277660168379e-06, 1.0e-06, 1.9952623149688786e-05, 6.30957344480193e-06, 3.162277660168379e-06, 1.584893192461114e-06, 3.981071705534969e-06, 6.30957344480193e-07, 7.943282347242822e-07, 1.2589254117941661e-05, 7.943282347242822e-07, 1.584893192461114e-06, 3.162277660168379e-06, 1.2589254117941661e-05, 3.1622776601683795e-05, 1.2589254117941661e-05, 2.5118864315095823e-06, 5.011872336272725e-06, 1.0e-06, 7.943282347242822e-07, 2.5118864315095823e-06, 1.584893192461114e-06, 1.0e-06, 6.30957344480193e-06, 6.30957344480193e-06, 3.1622776601683795e-05, 1.2589254117941661e-05, 7.943282347242822e-06, 1.0e-06, 3.162277660168379e-06, 6.30957344480193e-07, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725] 

a) What do you think about specify the format right in the loading phase (initialize) ?
a.1) the problem is that illumina's documentation makes clear reference to 
NOTE
The quality scoring scheme Illumina uses is the Phred scoring scheme, encoded as an ASCII character by adding 64 to the Phred value. A Phred score of a base is:
Qphred =-10 log10(e) where e is the estimated probability of a base being wrong.
b) try to identify the format from the header of the first sequence or use a convention in the extension ?
c) ALWAYS use sanger 

I'm lost O_o


--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios








From p.j.a.cock at googlemail.com  Sat Mar 26 19:17:30 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Sat, 26 Mar 2011 23:17:30 +0000
Subject: [BioRuby] FastQ and Quality Scores
In-Reply-To: <A7169C4B-A433-4666-B6BD-D9F1B2EDF5C0@ingm.org>
References: <A7169C4B-A433-4666-B6BD-D9F1B2EDF5C0@ingm.org>
Message-ID: <AANLkTin248ZxWrf+4u8raaeTfMPkYV7NZMJxedW9Pscv@mail.gmail.com>

On Fri, Mar 25, 2011 at 5:06 PM, Raoul Bonnal <bonnal at ingm.org> wrote:
> Dear All,
> probably I don't know very much this part of the bioruby library (not yet).
> In this days I'm playing a bit with fastq data :-) and bioruby
> ...
>
> Is Illumina the right format for the newest technology/datasets ?

Right now, yes, but with the imminent release of Illumina's
CASAVA 1.8 pipeline, they will start using the standard
Sanger FASTQ encoding.
http://seqanswers.com/forums/showthread.php?t=8895

> ...
> I'm lost O_o

Hopefully this will help:
http://dx.doi.org/10.1093/nar/gkp1137

Peter

From bonnal at ingm.org  Sun Mar 27 13:11:53 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Sun, 27 Mar 2011 19:11:53 +0200
Subject: [BioRuby] FastQ and Quality Scores
In-Reply-To: <AANLkTin248ZxWrf+4u8raaeTfMPkYV7NZMJxedW9Pscv@mail.gmail.com>
References: <A7169C4B-A433-4666-B6BD-D9F1B2EDF5C0@ingm.org>
	<AANLkTin248ZxWrf+4u8raaeTfMPkYV7NZMJxedW9Pscv@mail.gmail.com>
Message-ID: <8D3CD686-7153-452F-9ADD-C962DD172FAF@ingm.org>

Thanks Peter,
seqanswer  very useful.
I still have concerns about loading by default in sanger, at least now ... btw in the near future it will re-became de facto standard. Confusion is generated from companies obviously.
The discussion in the article is still valid if we must live in a mixed world -_-'

On 27/mar/2011, at 00.17, Peter Cock wrote:

> On Fri, Mar 25, 2011 at 5:06 PM, Raoul Bonnal <bonnal at ingm.org> wrote:
>> Dear All,
>> probably I don't know very much this part of the bioruby library (not yet).
>> In this days I'm playing a bit with fastq data :-) and bioruby
>> ...
>> 
>> Is Illumina the right format for the newest technology/datasets ?
> 
> Right now, yes, but with the imminent release of Illumina's
> CASAVA 1.8 pipeline, they will start using the standard
> Sanger FASTQ encoding.
> http://seqanswers.com/forums/showthread.php?t=8895
> 
>> ...
>> I'm lost O_o
> 
> Hopefully this will help:
> http://dx.doi.org/10.1093/nar/gkp1137
> 
> Peter
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby

--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios








From bonnal at ingm.org  Mon Mar 28 11:49:37 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Mon, 28 Mar 2011 17:49:37 +0200
Subject: [BioRuby] Fastq performances
Message-ID: <D619391D-E44A-45D0-BE29-D9E1C6157423@ingm.org>

Always testing :-)

I have a fastq file,  about 95 Mb and X sequences.
I did a trimming procedure scanning all the sequences but I have a performance issue, it took too long.
The code makes a scan to identify some sequence and trim it. Then I send in output all the sequences in input.
I found that the bottleneck is the conversion process when I need to write out the sequences.

Total number of sequences 514299.


THIS TASK IS USING FULL CONVERSION
if read.to_trim?
   trim sequence and quality string, create a (new fastq obj).to_biosequence.output(:fastq_illumina) 
else 
  read.to_biosequence.output(:fastq_illumina)
end 

MacBook-Pro-RaoulB:bioruby-ngs bonnalraoul$ time ./bin/biongs convert:illumina:fastq:trim_b /Users/bonnalraoul/Desktop/s_1_1_1108_qseq.fastq
WARNING: no program is associated with BCLQSEQ task, does not make sense to create a thor task.

real	2m1.749s
user	1m58.079s
sys	0m3.038s


THIS TASK IS USING RAW CONVERSION (formatting fastq sequence on the fly)
same above, but I don't create the biosequence object.
MacBook-Pro-RaoulB:bioruby-ngs bonnalraoul$ time ./bin/biongs convert:illumina:fastq:trim_b /Users/bonnalraoul/Desktop/s_1_1_1108_qseq.fastq
WARNING: no program is associated with BCLQSEQ task, does not make sense to create a thor task.

real	0m43.546s
user	0m41.611s
sys	0m1.133s


The difference in term of time is quite huge, if you consider that this is a tiny dataset. I can gain other 10 seconds If I don't wrap the output string to 70 chars (see below)

Note: output from to_biosequence.output(:fastq_illumina) is not equal to the input (still from illumina)
the sequence(na and quality is wrapped to 70 chas) and the header is repeated. Is it my fault is some part of the code ? I'll put the code in github asap.

--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios








From daijiendoh at gmail.com  Mon Mar 28 19:45:55 2011
From: daijiendoh at gmail.com (=?ISO-2022-JP?B?GyRCMXNGI0JnRnMbKEI=?=)
Date: Tue, 29 Mar 2011 08:45:55 +0900
Subject: [BioRuby] mask on Ilumina-format
Message-ID: <AANLkTikj=qPyQ_yCqYESJd3Gef8WGydDpHnDAF9JQOru@mail.gmail.com>

Dear All
I start to use illumina-formated data.

On the start, data was parsed as below.

Data*****
@ILLUMINA-554790:34:6:107:18082:1570#0/1
AATCGTTGTAGATTCATTACTGCTCCTGAGCGGTTTACAGGAGTAAGTGTAGACGTTGAGAAATGATATTTGTGAA
+ILLUMINA-554790:34:6:107:18082:1570#0/1
efgggfffffffffffggaggggggggg[ggg[gggggagfdfafffaff_aadc^dfYaffcffKaca_^aXcBB
@ILLUMINA-554790:34:6:107:18268:1571#0/1
AGCAAGCAATCGCCAGCAGCAGAGTGCCAAGACGCCCCAGCGCAAACCACAGTCTGCCCGCTTTGCTGTTGCTGGT
+ILLUMINA-554790:34:6:107:18268:1571#0/1
cccSc]\LYSaYYbKcc[ccccccacY_c^aRaZSca\\OYaaaaJR`X\]]FHX^aQaHR\PWSaaccaaaILca
@ILLUMINA-554790:34:6:107:18774:1566#0/1
CCAGGCAAAGAGATCGCGCATAGCGGTAAATTTATTCGACAACAGCAGCCAGATAGCAAAATCACGCAGCAGCCAG
+ILLUMINA-554790:34:6:107:18774:1566#0/1
hhhhhhhhhhhghggghfhhhehhhhffhfhhhhhhhdahghchfaggafhcah[ffhefhcehffahhaffdh_a

Parsing script*****

require 'bio'
quality_threshold = 60
Bio::FlatFile.open('text.txt').each do |entry|
       p entry.format
       p entry.entry_id
       p entry.seq
       hq_seq = entry.mask(quality_threshold, mask_char='n')
end

*******************

But,
p entry.format   returns nil
and
entry.mask    returns    undefined method `mask' for
#<Bio::Fastq:0x7f1eb5d9dc28> (NoMethodError)

How I set format to FASTQ_ILLUMINA and use 'mask' method.
'http://bioruby.open-bio.org/rdoc/'  is so difficult for me and need
help to use it.

With best wishes,
Daiji Endoh

From tomoakin at kenroku.kanazawa-u.ac.jp  Tue Mar 29 00:36:05 2011
From: tomoakin at kenroku.kanazawa-u.ac.jp (Tomoaki NISHIYAMA)
Date: Tue, 29 Mar 2011 13:36:05 +0900
Subject: [BioRuby] mask on Ilumina-format
In-Reply-To: <AANLkTikj=qPyQ_yCqYESJd3Gef8WGydDpHnDAF9JQOru@mail.gmail.com>
References: <AANLkTikj=qPyQ_yCqYESJd3Gef8WGydDpHnDAF9JQOru@mail.gmail.com>
Message-ID: <35F444DE-CF2A-4FD1-B727-097CD236B30F@kenroku.kanazawa-u.ac.jp>

Hi Endoh-san,

What version of bioruby library are you using?

> entry.mask    returns    undefined method `mask' for
> #<Bio::Fastq:0x7f1eb5d9dc28> (NoMethodError)


Based on the history at github
https://github.com/bioruby/bioruby/commits/master/lib/bio/db/fastq.rb
the mask method was defined on August 11, 2010.
So, any prior version does not define the method mask, but later  
versions
like 1.4.1 should have the method.

> p entry.format   returns nil


In the rdoc you mentioned, select Bio::Fastq
in the upper middle column and you will find the following explanation:

format()
Format name. One of ?fastq-sanger?, ?fastq-solexa?, ?fastq- 
illumina?, or nil (when not specified).

Returns:(String or nil) format name

So, getting nil for unspecified format seems what is expected.
-- 
Tomoaki NISHIYAMA

Advanced Science Research Center,
Kanazawa University,
13-1 Takara-machi,
Kanazawa, 920-0934, Japan



From bonnal at ingm.org  Tue Mar 29 03:51:26 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Tue, 29 Mar 2011 09:51:26 +0200
Subject: [BioRuby] mask on Ilumina-format
In-Reply-To: <AANLkTikj=qPyQ_yCqYESJd3Gef8WGydDpHnDAF9JQOru@mail.gmail.com>
References: <AANLkTikj=qPyQ_yCqYESJd3Gef8WGydDpHnDAF9JQOru@mail.gmail.com>
Message-ID: <9004D78D-858A-44A2-94B9-646F1EC7CDE7@ingm.org>

>From a Goto-san's mail:
 q = Bio::Fastq.new("@test\natgcgataatgc\n+test\nCCCCDDDDBXXX\n")
 q.format = :fastq_illumina
 puts q.mask(your_quality_threshold, your_masking_char)
keep in mind mask masks the bases < your_quality_threshold

by default the format is :fastq_sanger if you call q.quality_scores ( without specify q.format)
On 29/mar/2011, at 01.45, ???? wrote:

> Dear All
> I start to use illumina-formated data.
> 
> On the start, data was parsed as below.
> 
> Data*****
> @ILLUMINA-554790:34:6:107:18082:1570#0/1
> AATCGTTGTAGATTCATTACTGCTCCTGAGCGGTTTACAGGAGTAAGTGTAGACGTTGAGAAATGATATTTGTGAA
> +ILLUMINA-554790:34:6:107:18082:1570#0/1
> efgggfffffffffffggaggggggggg[ggg[gggggagfdfafffaff_aadc^dfYaffcffKaca_^aXcBB
> @ILLUMINA-554790:34:6:107:18268:1571#0/1
> AGCAAGCAATCGCCAGCAGCAGAGTGCCAAGACGCCCCAGCGCAAACCACAGTCTGCCCGCTTTGCTGTTGCTGGT
> +ILLUMINA-554790:34:6:107:18268:1571#0/1
> cccSc]\LYSaYYbKcc[ccccccacY_c^aRaZSca\\OYaaaaJR`X\]]FHX^aQaHR\PWSaaccaaaILca
> @ILLUMINA-554790:34:6:107:18774:1566#0/1
> CCAGGCAAAGAGATCGCGCATAGCGGTAAATTTATTCGACAACAGCAGCCAGATAGCAAAATCACGCAGCAGCCAG
> +ILLUMINA-554790:34:6:107:18774:1566#0/1
> hhhhhhhhhhhghggghfhhhehhhhffhfhhhhhhhdahghchfaggafhcah[ffhefhcehffahhaffdh_a
> 
> Parsing script*****
> 
> require 'bio'
> quality_threshold = 60
> Bio::FlatFile.open('text.txt').each do |entry|
>       p entry.format
>       p entry.entry_id
>       p entry.seq
>       hq_seq = entry.mask(quality_threshold, mask_char='n')
> end
> 
> *******************
> 
> But,
> p entry.format   returns nil
> and
> entry.mask    returns    undefined method `mask' for
> #<Bio::Fastq:0x7f1eb5d9dc28> (NoMethodError)
> 
> How I set format to FASTQ_ILLUMINA and use 'mask' method.
> 'http://bioruby.open-bio.org/rdoc/'  is so difficult for me and need
> help to use it.
> 
> With best wishes,
> Daiji Endoh
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby

--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios








From daijiendoh at gmail.com  Tue Mar 29 05:51:25 2011
From: daijiendoh at gmail.com (=?ISO-2022-JP?B?GyRCMXNGI0JnRnMbKEI=?=)
Date: Tue, 29 Mar 2011 18:51:25 +0900
Subject: [BioRuby] Fwd:  mask on Ilumina-format
In-Reply-To: <9004D78D-858A-44A2-94B9-646F1EC7CDE7@ingm.org>
References: <AANLkTikj=qPyQ_yCqYESJd3Gef8WGydDpHnDAF9JQOru@mail.gmail.com>
	<9004D78D-858A-44A2-94B9-646F1EC7CDE7@ingm.org>
Message-ID: <AANLkTi=91GwDiGLQcNQF7h8CkfbjbCs7d6A9CkcZBspR@mail.gmail.com>

Thank you Nishiyama-san and Bonnal-san

1 I use bioruby on Ubuntu10.10 with synnaptic-mediated installation.
The version is 1.40-2. So I cannot use mask. And I will install
bioruby manually.
2 To setup fastq_illumina -format I had not been know. The scripts below.

q = Bio::Fastq.new("@test\natgcgataatgc\n+test\nCCCCDDDDBXXX\n")
 q.format = :fastq_illumina

As it is very difficult for me how to make a new object with certain
format. Mr Bonnal's suggestion is very helpful for me.

Thanks again

---------- ??????? ----------
From: Raoul Bonnal <bonnal at ingm.org>
??: 2011?3?29?16:51
??: Re: [BioRuby] mask on Ilumina-format
To: ???? <daijiendoh at gmail.com>
Cc: bioruby at lists.open-bio.org


>From a Goto-san's mail:
 q = Bio::Fastq.new("@test\natgcgataatgc\n+test\nCCCCDDDDBXXX\n")
 q.format = :fastq_illumina
 puts q.mask(your_quality_threshold, your_masking_char)
keep in mind mask masks the bases < your_quality_threshold
by default the format is :fastq_sanger if you call q.quality_scores (
without specify q.format)
On 29/mar/2011, at 01.45, ???? wrote:

Dear All
I start to use illumina-formated data.

On the start, data was parsed as below.

Data*****
@ILLUMINA-554790:34:6:107:18082:1570#0/1
AATCGTTGTAGATTCATTACTGCTCCTGAGCGGTTTACAGGAGTAAGTGTAGACGTTGAGAAATGATATTTGTGAA
+ILLUMINA-554790:34:6:107:18082:1570#0/1
efgggfffffffffffggaggggggggg[ggg[gggggagfdfafffaff_aadc^dfYaffcffKaca_^aXcBB
@ILLUMINA-554790:34:6:107:18268:1571#0/1
AGCAAGCAATCGCCAGCAGCAGAGTGCCAAGACGCCCCAGCGCAAACCACAGTCTGCCCGCTTTGCTGTTGCTGGT
+ILLUMINA-554790:34:6:107:18268:1571#0/1
cccSc]\LYSaYYbKcc[ccccccacY_c^aRaZSca\\OYaaaaJR`X\]]FHX^aQaHR\PWSaaccaaaILca
@ILLUMINA-554790:34:6:107:18774:1566#0/1
CCAGGCAAAGAGATCGCGCATAGCGGTAAATTTATTCGACAACAGCAGCCAGATAGCAAAATCACGCAGCAGCCAG
+ILLUMINA-554790:34:6:107:18774:1566#0/1
hhhhhhhhhhhghggghfhhhehhhhffhfhhhhhhhdahghchfaggafhcah[ffhefhcehffahhaffdh_a

Parsing script*****

require 'bio'
quality_threshold = 60
Bio::FlatFile.open('text.txt').each do |entry|
      p entry.format
      p entry.entry_id
      p entry.seq
      hq_seq = entry.mask(quality_threshold, mask_char='n')
end

*******************

But,
p entry.format   returns nil
and
entry.mask    returns    undefined method `mask' for
#<Bio::Fastq:0x7f1eb5d9dc28> (NoMethodError)

How I set format to FASTQ_ILLUMINA and use 'mask' method.
'http://bioruby.open-bio.org/rdoc/'  is so difficult for me and need
help to use it.

With best wishes,
Daiji Endoh
_______________________________________________
BioRuby Project - http://www.bioruby.org/
BioRuby mailing list
BioRuby at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioruby

--
Ra
linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios

From p.j.a.cock at googlemail.com  Tue Mar 29 05:56:19 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 29 Mar 2011 10:56:19 +0100
Subject: [BioRuby] Fastq performances
In-Reply-To: <D619391D-E44A-45D0-BE29-D9E1C6157423@ingm.org>
References: <D619391D-E44A-45D0-BE29-D9E1C6157423@ingm.org>
Message-ID: <AANLkTinR1zFCVVGAgOqx6ZgMpjJjXbdqT4kkVcCPAm7X@mail.gmail.com>

On Mon, Mar 28, 2011 at 4:49 PM, Raoul Bonnal <bonnal at ingm.org> wrote:
> Note: output from to_biosequence.output(:fastq_illumina) is not equal to the
> input (still from illumina) the sequence(na and quality is wrapped to 70 chas)
> and the header is repeated. Is it my fault is some part of the code ? I'll put
> the code in github asap.

When writing FASTQ, I would expect BioRuby to omit the repeated header
on the plus line, and NOT to line wrap the sequence and quality lines. This
is deliberate, see http://dx.doi.org/10.1093/nar/gkp1137 for details.

So, if your input did have the repeated header and/or wrapping, then yes,
the input would not match the output.

Peter

From bonnal at ingm.org  Tue Mar 29 06:16:11 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Tue, 29 Mar 2011 12:16:11 +0200
Subject: [BioRuby] Fastq performances
In-Reply-To: <AANLkTinR1zFCVVGAgOqx6ZgMpjJjXbdqT4kkVcCPAm7X@mail.gmail.com>
References: <D619391D-E44A-45D0-BE29-D9E1C6157423@ingm.org>
	<AANLkTinR1zFCVVGAgOqx6ZgMpjJjXbdqT4kkVcCPAm7X@mail.gmail.com>
Message-ID: <0DA2D81C-3CCE-4252-910E-F977AD4C8077@ingm.org>


On 29/mar/2011, at 11.56, Peter Cock wrote:

> On Mon, Mar 28, 2011 at 4:49 PM, Raoul Bonnal <bonnal at ingm.org> wrote:
>> Note: output from to_biosequence.output(:fastq_illumina) is not equal to the
>> input (still from illumina) the sequence(na and quality is wrapped to 70 chas)
>> and the header is repeated. Is it my fault is some part of the code ? I'll put
>> the code in github asap.
> 
> When writing FASTQ, I would expect BioRuby to omit the repeated header
> on the plus line, and NOT to line wrap the sequence and quality lines. This
> is deliberate, see http://dx.doi.org/10.1093/nar/gkp1137 for details.
I did a little  mistake in the previous e-mail, when I was talking about repeated header it was the first line @H125:1:1108:1188:2036#0/1 H125:1:1108:1188:2036#0/1

Input:
@H125:1:1108:1188:2036#0/1
CTTGTATGCAGCATCCCCTTCTTGCCTAGGGACTTGAAGGGCCAGGCTTCCTGTCATTGCCTCACTCAAATGTAGC
+
gggggggggggggegggggffggeggegggeagge^ggdbcgggcdgedegfggffff^ffffefdeeZefccceg

Output created with fastq_read.to_biosequence.output(:fastq_illumina), same with sanger format.
@H125:1:1108:1188:2036#0/1 H125:1:1108:1188:2036#0/1
CTTGTATGCAGCATCCCCTTCTTGCCTAGGGACTTGAAGGGCCAGGCTTCCTGTCATTGCCTCACTCAAA
TGTAGC
+
gggggggggggggegggggffggeggegggeagge^ggdbcgggcdgedegfggffff^ffffefdeeZe
fccceg

> 
> So, if your input did have the repeated header and/or wrapping, then yes,
> the input would not match the output.
My input is not wrapped and has no repeated header.

Thanks Peter.
--
Ra









From bonnal at ingm.org  Thu Mar 31 05:17:27 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Thu, 31 Mar 2011 11:17:27 +0200
Subject: [BioRuby] Reminder BioRuby Irc Meeting Today at GMT 14:00
Message-ID: <6028112A-EBFF-40D6-9059-50ADCC9BD6E3@ingm.org>

server: irc.freenode.net
channel: #bioruby
time: 14:00 GMT

topics: 
* samtools
* fastq performances ?
* gsoc 
* bioruby-ngs
* docs
* general updates

this is not a priority list, just a bunch of topics.

see you later.

--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios







From ngoto at gen-info.osaka-u.ac.jp  Tue Mar  1 18:03:37 2011
From: ngoto at gen-info.osaka-u.ac.jp (Naohisa GOTO)
Date: Wed, 2 Mar 2011 03:03:37 +0900
Subject: [BioRuby] BestPracties for wrappers
In-Reply-To: <A3546D3B-CFB2-482A-AAEE-120F1C9058B5@ingm.it>
References: <A3546D3B-CFB2-482A-AAEE-120F1C9058B5@ingm.it>
Message-ID: <20110301180338.6EA601CBC418@idnmail.gen-info.osaka-u.ac.jp>

Hi Raoul,

There are choices about input/output data and the wrapper API.
It would depend on both desired design of the API and the
implementation of the program, and it is not easy to determine
what is really the best.

1. Input data of the wrapper API
 * Bio::* or Ruby object (e.g. Bio::Sequence object)
 * String containing data (e.g. fasta format sequence text)
 * File name as a String

2. How to pass input data to the program
 * Stdin
 * File name supplied as a command-line option
 * File name described in a configuration file

3. The way of passing optional parameters to the program
 * Stdin
 * Command-line arguments
 * Configuration file

4. How to get output data from the program
 * Stdout
 * Stderr
 * File name supplied as a command-line option
 * File name described in a configuration file
 * Fixed file name

5. Returned data type of the wrapper API
 * Bio::*::Report object for the program
 * String containing data (e.g. sequence alignment, newick tree)
 * Bio::* or Ruby object (e.g. Bio::Sequence)

For 1 and 5, input/output data format can be converted inside
the wrapper, and two or more choices can be accepted by using
separate API.

The 2,3 and 4 would depend on the program, but some program have
two or more ways to specify and to pass the input/output data.

I'd like to try to find ways to standardize and unify BioRuby
wrappers, but not yet implemented.

Naohisa Goto
ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org

On Mon, 28 Feb 2011 17:07:54 +0100
Raoul Bonnal <bonnalraoul at ingm.it> wrote:

> Dear Goto-san,
> if I would write a new wrapper for a new program, using Bio::Command libs, which are the best practies ?
> looking into the other wrappers the code is not always, let' say "standard"
> Could you give me some hints ?
> 
> --
> Ra
> 
> linkedin: http://it.linkedin.com/in/raoulbonnal
> twitter: http://twitter.com/ilpuccio
> skype: ilpuccio
> irc.freenode.net: Helius
> github: https://github.com/helios
> 
> 
> 
> 
> 
> 
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby




From donttrustben at gmail.com  Thu Mar  3 00:47:50 2011
From: donttrustben at gmail.com (Ben Woodcroft)
Date: Thu, 3 Mar 2011 11:47:50 +1100
Subject: [BioRuby] Programmatic interfaces to online-only bioinformatic tools
Message-ID: <AANLkTi=zSwQK=V5pWx70eds0kB=84uYco45tyWyos_Qj@mail.gmail.com>

Hi there,

I'm after an opinion on best practice for accessing those bioinformatic
tools that are only accessible via web-interfaces, without any way of
downloading the program itself. As I often want to throw an organisms's
whole proteome at the tool (in my case ~5500 proteins), doing it one at a
time is obviously not feasible. Do people think that writing a wrapper that
hammers the website in question is a nice thing to do, provided I wait 1
second in between each upload (1 protein/upload)? From what I can
understand, processing each protein is not computationally demanding and
results are returned almost instantaneously when querying the server
manually, unlike a blast server.

Some background:
I'm really like this bioruby plugin thing - thanks to those involved in its
creation. I've written a bioruby plugin
https://github.com/wwood/bioruby-cnls_screenscraper which queries
http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi that does what
I've described above. Not quite as well documented as it might be, but it
appears to work and isn't too complicated.

Thanks,
ben

-- 
Ben J Woodcroft, BE (Hons)

PhD Candidate
Ralph Laboratory
The University of Melbourne
Melbourne, Australia


From ktym at hgc.jp  Thu Mar  3 14:47:01 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Thu, 3 Mar 2011 23:47:01 +0900
Subject: [BioRuby] tutorial
In-Reply-To: <20110223105132.GA24543@thebird.nl>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
Message-ID: <956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>

Pj,

We just discussed about this on the IRC meeting and people agreed to
maintain the tutorial on the Wiki rather than in the source code
because people usually search for docs on the web and we can potentially
involve more people to improve/update the document. Let's see how it works!

Toshiaki

On 2011/02/23, at 19:51, Pjotr Prins wrote:

> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
>> however, I don't know there is a best way to synchronize it with
>> 
>> 	http://bioruby.open-bio.org/wiki/Tutorial
>> 
>> because Mediawiki format is also a different one from RD and rdoc... Any ideas?
> 
> we should drop the Mediawiki version - despite the nice colours.
> 
> Pj.




From cjfields at illinois.edu  Thu Mar  3 16:17:36 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 10:17:36 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
Message-ID: <7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>

All,

We are currently having a discussion related to this re: BioPerl docs and the wiki, in relation to our upcoming bioperl release and future directions.  I think our current conclusions are relevant here.

We moved the tutorial and HOWTOs over to the wiki a few years back, and I have been thinking fairly seriously about moving them back to github after the next release, then having a locked wiki page auto-generated from those (with an editable discussion page for suggestions/edits by the community).  This decision is based on several problems we found over the last few years by moving the docs over to the wiki.  

Note these apply mainly to my experiences via bioperl and are primarily my opinions (though some devs have agreed with me), so this may not apply to the bioruby community or even other bioperl devs:

  1) Simple documentation access: what recourse do users have if they can't access the wiki for some reason (server goes down, local network problems, etc)?  Installed docs are always available.

  2) By placing documentation on the wiki (tutorials, HOWTOs, etc), one effectively 'forks' the documentation from the actual distribution.  It has it's own wikified history separate from the code.  That may be okay initially, but then the tendency is that the wiki documentation becomes the 'official' one and only relates to the in-development version or last release of your project.  A way around that is to create possibly API-specific tutorials for specific releases, but they are still effectively separate from the actual versioned code.  

  3) B/c changes in code occur independently from changes in the documentation and they are stored in completely different media (github VCS vc wiki CMS), implementing some nice defensive coding measures becomes harder, if not impossible.  For instance, we're thinking about implementing inline testing for the tutorials and the HOWTOs.  This is intractable if documentation is on the wiki alone and if maintenance of that documentation occurs independently of the code it is documenting.  Not impossible, just harder to maintain long-term.

  4) Finally, we found the initial idea of wiki-fying the docs is in theory well-intentioned (allows dynamic editing of the docs by everyone), but in reality we have found that documentation placed on the wiki tends to lag behind or drift from changes in the code, simply b/c devs tend to forget about the wiki while developing code on github.  Yes, maybe it's a hassle to maintain docs in the repo, but github has mechanisms to allow anyone to make changes (fork/pull request), and if you can set up a system that converts github docs to wiki or another suitable markup, even better (believe me, POD is pretty minimal, so we have our work cut out for us on the perl end).

Again, this may be completely different in the bioruby ecosystem.  Just wanted to share my similar experience with bioperl.

chris

On Mar 3, 2011, at 8:47 AM, Toshiaki Katayama wrote:

> Pj,
> 
> We just discussed about this on the IRC meeting and people agreed to
> maintain the tutorial on the Wiki rather than in the source code
> because people usually search for docs on the web and we can potentially
> involve more people to improve/update the document. Let's see how it works!
> 
> Toshiaki
> 
> On 2011/02/23, at 19:51, Pjotr Prins wrote:
> 
>> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
>>> however, I don't know there is a best way to synchronize it with
>>> 
>>> 	http://bioruby.open-bio.org/wiki/Tutorial
>>> 
>>> because Mediawiki format is also a different one from RD and rdoc... Any ideas?
>> 
>> we should drop the Mediawiki version - despite the nice colours.
>> 
>> Pj.
> 
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby




From mail at michaelbarton.me.uk  Thu Mar  3 16:46:28 2011
From: mail at michaelbarton.me.uk (Michael Barton)
Date: Thu, 3 Mar 2011 11:46:28 -0500
Subject: [BioRuby] tutorial
In-Reply-To: <7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
Message-ID: <20110303164628.GA3667@nku069218.hh.nku.edu>

As another example the RSpec library has a nice way of converting the library
specs into html documentation. The code is then self documenting through its
specification.

E.g. http://bit.ly/fG5uNF

On Thu, Mar 03, 2011 at 10:17:36AM -0600, Chris Fields wrote:
> All,
> 
> We are currently having a discussion related to this re: BioPerl docs and the
> wiki, in relation to our upcoming bioperl release and future directions.
> I think our current conclusions are relevant here.
> 
> We moved the tutorial and HOWTOs over to the wiki a few years back, and
> I have been thinking fairly seriously about moving them back to github after
> the next release, then having a locked wiki page auto-generated from those
> (with an editable discussion page for suggestions/edits by the community).
> This decision is based on several problems we found over the last few years
> by moving the docs over to the wiki.  
> 
> Note these apply mainly to my experiences via bioperl and are primarily my
> opinions (though some devs have agreed with me), so this may not apply to the
> bioruby community or even other bioperl devs:
> 
>   1) Simple documentation access: what recourse do users have if they can't
>   access the wiki for some reason (server goes down, local network problems,
>   etc)?  Installed docs are always available.
> 
>   2) By placing documentation on the wiki (tutorials, HOWTOs, etc), one
>   effectively 'forks' the documentation from the actual distribution.  It has
>   it's own wikified history separate from the code.  That may be okay
>   initially, but then the tendency is that the wiki documentation becomes the
>   'official' one and only relates to the in-development version or last
>   release of your project.  A way around that is to create possibly
>   API-specific tutorials for specific releases, but they are still
>   effectively separate from the actual versioned code.  
> 
>   3) B/c changes in code occur independently from changes in the
>   documentation and they are stored in completely different media (github VCS
>   vc wiki CMS), implementing some nice defensive coding measures becomes
>   harder, if not impossible.  For instance, we're thinking about implementing
>   inline testing for the tutorials and the HOWTOs.  This is intractable if
>   documentation is on the wiki alone and if maintenance of that documentation
>   occurs independently of the code it is documenting.  Not impossible, just
>   harder to maintain long-term.
> 
>   4) Finally, we found the initial idea of wiki-fying the docs is in theory
>   well-intentioned (allows dynamic editing of the docs by everyone), but in
>   reality we have found that documentation placed on the wiki tends to lag
>   behind or drift from changes in the code, simply b/c devs tend to forget
>   about the wiki while developing code on github.  Yes, maybe it's a hassle
>   to maintain docs in the repo, but github has mechanisms to allow anyone to
>   make changes (fork/pull request), and if you can set up a system that
>   converts github docs to wiki or another suitable markup, even better
>   (believe me, POD is pretty minimal, so we have our work cut out for us on
>   the perl end).
> 
> Again, this may be completely different in the bioruby ecosystem.  Just
> wanted to share my similar experience with bioperl.
> 
> chris
> 
> On Mar 3, 2011, at 8:47 AM, Toshiaki Katayama wrote:
> 
> > Pj,
> > 
> > We just discussed about this on the IRC meeting and people agreed to
> > maintain the tutorial on the Wiki rather than in the source code because
> > people usually search for docs on the web and we can potentially involve
> > more people to improve/update the document. Let's see how it works!
> > 
> > Toshiaki
> > 
> > On 2011/02/23, at 19:51, Pjotr Prins wrote:
> > 
> >> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
> >>> however, I don't know there is a best way to synchronize it with
> >>> 
> >>> 	http://bioruby.open-bio.org/wiki/Tutorial
> >>> 
> >>> because Mediawiki format is also a different one from RD and rdoc... Any
> >>> ideas?
> >> 
> >> we should drop the Mediawiki version - despite the nice colours.
> >> 
> >> Pj.
> > 
> > 
> > _______________________________________________ BioRuby Project
> > - http://www.bioruby.org/ BioRuby mailing list BioRuby at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioruby
> 
> 
> _______________________________________________ BioRuby Project
> - http://www.bioruby.org/ BioRuby mailing list BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby

From cjfields at illinois.edu  Thu Mar  3 16:59:41 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 10:59:41 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <20110303164628.GA3667@nku069218.hh.nku.edu>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<20110303164628.GA3667@nku069218.hh.nku.edu>
Message-ID: <80B4C853-5046-471C-8E50-856C98AACC23@illinois.edu>

Michael,

Not sure about rspec, but with POD there are a few POD to wiki converters that generate markup, so it is feasibly possible to automate conversion and uploads to a wiki with a public API enabled (e.g. mediawiki's api.php).  There are also ways via CPAN to interpolate additional markup within POD to allow for inline tests, etc., might as well take advantage of those tools.

The ruby community should have something similar, though with the HTML conversion you showed it makes me wonder if it's even necessary :)

chris

On Mar 3, 2011, at 10:46 AM, Michael Barton wrote:

> As another example the RSpec library has a nice way of converting the library
> specs into html documentation. The code is then self documenting through its
> specification.
> 
> E.g. http://bit.ly/fG5uNF
> 
> On Thu, Mar 03, 2011 at 10:17:36AM -0600, Chris Fields wrote:
>> All,
>> 
>> We are currently having a discussion related to this re: BioPerl docs and the
>> wiki, in relation to our upcoming bioperl release and future directions.
>> I think our current conclusions are relevant here.
>> 
>> We moved the tutorial and HOWTOs over to the wiki a few years back, and
>> I have been thinking fairly seriously about moving them back to github after
>> the next release, then having a locked wiki page auto-generated from those
>> (with an editable discussion page for suggestions/edits by the community).
>> This decision is based on several problems we found over the last few years
>> by moving the docs over to the wiki.  
>> 
>> Note these apply mainly to my experiences via bioperl and are primarily my
>> opinions (though some devs have agreed with me), so this may not apply to the
>> bioruby community or even other bioperl devs:
>> 
>>  1) Simple documentation access: what recourse do users have if they can't
>>  access the wiki for some reason (server goes down, local network problems,
>>  etc)?  Installed docs are always available.
>> 
>>  2) By placing documentation on the wiki (tutorials, HOWTOs, etc), one
>>  effectively 'forks' the documentation from the actual distribution.  It has
>>  it's own wikified history separate from the code.  That may be okay
>>  initially, but then the tendency is that the wiki documentation becomes the
>>  'official' one and only relates to the in-development version or last
>>  release of your project.  A way around that is to create possibly
>>  API-specific tutorials for specific releases, but they are still
>>  effectively separate from the actual versioned code.  
>> 
>>  3) B/c changes in code occur independently from changes in the
>>  documentation and they are stored in completely different media (github VCS
>>  vc wiki CMS), implementing some nice defensive coding measures becomes
>>  harder, if not impossible.  For instance, we're thinking about implementing
>>  inline testing for the tutorials and the HOWTOs.  This is intractable if
>>  documentation is on the wiki alone and if maintenance of that documentation
>>  occurs independently of the code it is documenting.  Not impossible, just
>>  harder to maintain long-term.
>> 
>>  4) Finally, we found the initial idea of wiki-fying the docs is in theory
>>  well-intentioned (allows dynamic editing of the docs by everyone), but in
>>  reality we have found that documentation placed on the wiki tends to lag
>>  behind or drift from changes in the code, simply b/c devs tend to forget
>>  about the wiki while developing code on github.  Yes, maybe it's a hassle
>>  to maintain docs in the repo, but github has mechanisms to allow anyone to
>>  make changes (fork/pull request), and if you can set up a system that
>>  converts github docs to wiki or another suitable markup, even better
>>  (believe me, POD is pretty minimal, so we have our work cut out for us on
>>  the perl end).
>> 
>> Again, this may be completely different in the bioruby ecosystem.  Just
>> wanted to share my similar experience with bioperl.
>> 
>> chris
>> 
>> On Mar 3, 2011, at 8:47 AM, Toshiaki Katayama wrote:
>> 
>>> Pj,
>>> 
>>> We just discussed about this on the IRC meeting and people agreed to
>>> maintain the tutorial on the Wiki rather than in the source code because
>>> people usually search for docs on the web and we can potentially involve
>>> more people to improve/update the document. Let's see how it works!
>>> 
>>> Toshiaki
>>> 
>>> On 2011/02/23, at 19:51, Pjotr Prins wrote:
>>> 
>>>> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
>>>>> however, I don't know there is a best way to synchronize it with
>>>>> 
>>>>> 	http://bioruby.open-bio.org/wiki/Tutorial
>>>>> 
>>>>> because Mediawiki format is also a different one from RD and rdoc... Any
>>>>> ideas?
>>>> 
>>>> we should drop the Mediawiki version - despite the nice colours.
>>>> 
>>>> Pj.
>>> 
>>> 
>>> _______________________________________________ BioRuby Project
>>> - http://www.bioruby.org/ BioRuby mailing list BioRuby at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioruby
>> 
>> 
>> _______________________________________________ BioRuby Project
>> - http://www.bioruby.org/ BioRuby mailing list BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby




From ktym at hgc.jp  Thu Mar  3 17:41:52 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Fri, 4 Mar 2011 02:41:52 +0900
Subject: [BioRuby] tutorial
In-Reply-To: <7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
Message-ID: <A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>

Hi Chris,

Interesting. Thank you for your valuable inputs. :-)

So far, the main problem with us is not technical ones but lack of documentation itself (and man power). I personally believe that if we expose more documents on the web, it will raise chances to attract more people.

1) 99.9% of the cases, people try google first. Installed docs are usually hard to find for users and it is very rare that we can't access to the web.

2) Perhaps I don't perfectly understand what you mean, but having the latest version is probably enough in most cases... and we can also include the dump of entire wiki site at that time in the release package, if it makes sense.

3) If you have inline testing framework, it is not that hard. In our case, if I remember correctly, Pjotr have already implemented an inline testing tool for the BioRuby Tutorial (doctest?), so all we need is to run it against the output of the following script, for example.

------------------------------------------------------------
#!/usr/bin/env ruby

require 'rubygems'
require 'nokogiri'
require 'uri'
require 'open-uri'

wiki = "http://bioruby.open-bio.org/w/index.php?title=Tutorial&action=edit"
html = open(URI.encode(wiki)).read
text = Nokogiri(html).search("textarea").inner_text

puts text
------------------------------------------------------------

4) If HOWTOs are maintained as independent files, it still seems to have the same problem -- developers might forget to update the howto files when they made changes in the codes (and, this is the current situation we have now in BioRuby ;-).


Anyway, thanks again for your comments!

Toshiaki

On 2011/03/04, at 1:17, Chris Fields wrote:

> All,
> 
> We are currently having a discussion related to this re: BioPerl docs and the wiki, in relation to our upcoming bioperl release and future directions.  I think our current conclusions are relevant here.
> 
> We moved the tutorial and HOWTOs over to the wiki a few years back, and I have been thinking fairly seriously about moving them back to github after the next release, then having a locked wiki page auto-generated from those (with an editable discussion page for suggestions/edits by the community).  This decision is based on several problems we found over the last few years by moving the docs over to the wiki.  
> 
> Note these apply mainly to my experiences via bioperl and are primarily my opinions (though some devs have agreed with me), so this may not apply to the bioruby community or even other bioperl devs:
> 
>  1) Simple documentation access: what recourse do users have if they can't access the wiki for some reason (server goes down, local network problems, etc)?  Installed docs are always available.
> 
>  2) By placing documentation on the wiki (tutorials, HOWTOs, etc), one effectively 'forks' the documentation from the actual distribution.  It has it's own wikified history separate from the code.  That may be okay initially, but then the tendency is that the wiki documentation becomes the 'official' one and only relates to the in-development version or last release of your project.  A way around that is to create possibly API-specific tutorials for specific releases, but they are still effectively separate from the actual versioned code.  
> 
>  3) B/c changes in code occur independently from changes in the documentation and they are stored in completely different media (github VCS vc wiki CMS), implementing some nice defensive coding measures becomes harder, if not impossible.  For instance, we're thinking about implementing inline testing for the tutorials and the HOWTOs.  This is intractable if documentation is on the wiki alone and if maintenance of that documentation occurs independently of the code it is documenting.  Not impossible, just harder to maintain long-term.
> 
>  4) Finally, we found the initial idea of wiki-fying the docs is in theory well-intentioned (allows dynamic editing of the docs by everyone), but in reality we have found that documentation placed on the wiki tends to lag behind or drift from changes in the code, simply b/c devs tend to forget about the wiki while developing code on github.  Yes, maybe it's a hassle to maintain docs in the repo, but github has mechanisms to allow anyone to make changes (fork/pull request), and if you can set up a system that converts github docs to wiki or another suitable markup, even better (believe me, POD is pretty minimal, so we have our work cut out for us on the perl end).
> 
> Again, this may be completely different in the bioruby ecosystem.  Just wanted to share my similar experience with bioperl.
> 
> chris
> 
> On Mar 3, 2011, at 8:47 AM, Toshiaki Katayama wrote:
> 
>> Pj,
>> 
>> We just discussed about this on the IRC meeting and people agreed to
>> maintain the tutorial on the Wiki rather than in the source code
>> because people usually search for docs on the web and we can potentially
>> involve more people to improve/update the document. Let's see how it works!
>> 
>> Toshiaki
>> 
>> On 2011/02/23, at 19:51, Pjotr Prins wrote:
>> 
>>> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
>>>> however, I don't know there is a best way to synchronize it with
>>>> 
>>>> 	http://bioruby.open-bio.org/wiki/Tutorial
>>>> 
>>>> because Mediawiki format is also a different one from RD and rdoc... Any ideas?
>>> 
>>> we should drop the Mediawiki version - despite the nice colours.
>>> 
>>> Pj.
>> 
>> 
>> _______________________________________________
>> BioRuby Project - http://www.bioruby.org/
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
> 




From pjotr.public14 at thebird.nl  Thu Mar  3 18:09:08 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Thu, 3 Mar 2011 19:09:08 +0100
Subject: [BioRuby] tutorial
In-Reply-To: <A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
Message-ID: <20110303180908.GA10762@thebird.nl>

Not much to add to Chris. The main problem we have now is docs in
multiple places, and out of sync. Be good to get a coherent whole.

Wiki's tend to be more inviting, with a vibrant user community. But,
for BioRuby the Tutorial has been a wiki for years, with no edits,
that appears to not to work. Also I find Wiki's in general are rarely
maintained.

I agree with Chris docs should really be versioned against the
versioned classes, methods etc. Ideally we should also show
dependencies and whether they work for Ruby1.8/1.9, JRuby, Rubinius.

For several reasons I personally prefer generated docs. Maybe we
should think of generating the docs from Doctest files + RDoc +
Examples - and (cross)-index them nicely. Generation would help for
plugins too.

I know it is more work, and not very grateful, but if someone would
volunteer it would really pay off in the longer term. Note that
rubygems.org supports rdoc too - so we can host versioned docs there.

Pj. 



From ktym at hgc.jp  Thu Mar  3 18:10:58 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Fri, 4 Mar 2011 03:10:58 +0900
Subject: [BioRuby] tutorial
In-Reply-To: <A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
Message-ID: <54C7986C-DA6B-4A30-A163-62A36471CBFE@hgc.jp>

Hi Chris,

I forgot to mention but, okeefm started some work to sort out the current situation, thankfully.
http://bioruby.open-bio.org/wiki/DocumentationTeam

Sadly, Wiki have it's own weakness that we still have attacked everyday. This is really annoying.
I have no reaction from OBF support team yet about the idea of introducing authorization to create new wiki account.

P.S.
What is the b/c?

Toshiaki

On 2011/03/04, at 2:41, Toshiaki Katayama wrote:

> Hi Chris,
> 
> Interesting. Thank you for your valuable inputs. :-)
> 
> So far, the main problem with us is not technical ones but lack of documentation itself (and man power). I personally believe that if we expose more documents on the web, it will raise chances to attract more people.
> 
> 1) 99.9% of the cases, people try google first. Installed docs are usually hard to find for users and it is very rare that we can't access to the web.
> 
> 2) Perhaps I don't perfectly understand what you mean, but having the latest version is probably enough in most cases... and we can also include the dump of entire wiki site at that time in the release package, if it makes sense.
> 
> 3) If you have inline testing framework, it is not that hard. In our case, if I remember correctly, Pjotr have already implemented an inline testing tool for the BioRuby Tutorial (doctest?), so all we need is to run it against the output of the following script, for example.
> 
> ------------------------------------------------------------
> #!/usr/bin/env ruby
> 
> require 'rubygems'
> require 'nokogiri'
> require 'uri'
> require 'open-uri'
> 
> wiki = "http://bioruby.open-bio.org/w/index.php?title=Tutorial&action=edit"
> html = open(URI.encode(wiki)).read
> text = Nokogiri(html).search("textarea").inner_text
> 
> puts text
> ------------------------------------------------------------
> 
> 4) If HOWTOs are maintained as independent files, it still seems to have the same problem -- developers might forget to update the howto files when they made changes in the codes (and, this is the current situation we have now in BioRuby ;-).
> 
> 
> Anyway, thanks again for your comments!
> 
> Toshiaki
> 
> On 2011/03/04, at 1:17, Chris Fields wrote:
> 
>> All,
>> 
>> We are currently having a discussion related to this re: BioPerl docs and the wiki, in relation to our upcoming bioperl release and future directions.  I think our current conclusions are relevant here.
>> 
>> We moved the tutorial and HOWTOs over to the wiki a few years back, and I have been thinking fairly seriously about moving them back to github after the next release, then having a locked wiki page auto-generated from those (with an editable discussion page for suggestions/edits by the community).  This decision is based on several problems we found over the last few years by moving the docs over to the wiki.  
>> 
>> Note these apply mainly to my experiences via bioperl and are primarily my opinions (though some devs have agreed with me), so this may not apply to the bioruby community or even other bioperl devs:
>> 
>> 1) Simple documentation access: what recourse do users have if they can't access the wiki for some reason (server goes down, local network problems, etc)?  Installed docs are always available.
>> 
>> 2) By placing documentation on the wiki (tutorials, HOWTOs, etc), one effectively 'forks' the documentation from the actual distribution.  It has it's own wikified history separate from the code.  That may be okay initially, but then the tendency is that the wiki documentation becomes the 'official' one and only relates to the in-development version or last release of your project.  A way around that is to create possibly API-specific tutorials for specific releases, but they are still effectively separate from the actual versioned code.  
>> 
>> 3) B/c changes in code occur independently from changes in the documentation and they are stored in completely different media (github VCS vc wiki CMS), implementing some nice defensive coding measures becomes harder, if not impossible.  For instance, we're thinking about implementing inline testing for the tutorials and the HOWTOs.  This is intractable if documentation is on the wiki alone and if maintenance of that documentation occurs independently of the code it is documenting.  Not impossible, just harder to maintain long-term.
>> 
>> 4) Finally, we found the initial idea of wiki-fying the docs is in theory well-intentioned (allows dynamic editing of the docs by everyone), but in reality we have found that documentation placed on the wiki tends to lag behind or drift from changes in the code, simply b/c devs tend to forget about the wiki while developing code on github.  Yes, maybe it's a hassle to maintain docs in the repo, but github has mechanisms to allow anyone to make changes (fork/pull request), and if you can set up a system that converts github docs to wiki or another suitable markup, even better (believe me, POD is pretty minimal, so we have our work cut out for us on the perl end).
>> 
>> Again, this may be completely different in the bioruby ecosystem.  Just wanted to share my similar experience with bioperl.
>> 
>> chris
>> 
>> On Mar 3, 2011, at 8:47 AM, Toshiaki Katayama wrote:
>> 
>>> Pj,
>>> 
>>> We just discussed about this on the IRC meeting and people agreed to
>>> maintain the tutorial on the Wiki rather than in the source code
>>> because people usually search for docs on the web and we can potentially
>>> involve more people to improve/update the document. Let's see how it works!
>>> 
>>> Toshiaki
>>> 
>>> On 2011/02/23, at 19:51, Pjotr Prins wrote:
>>> 
>>>> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
>>>>> however, I don't know there is a best way to synchronize it with
>>>>> 
>>>>> 	http://bioruby.open-bio.org/wiki/Tutorial
>>>>> 
>>>>> because Mediawiki format is also a different one from RD and rdoc... Any ideas?
>>>> 
>>>> we should drop the Mediawiki version - despite the nice colours.
>>>> 
>>>> Pj.
>>> 
>>> 
>>> _______________________________________________
>>> BioRuby Project - http://www.bioruby.org/
>>> BioRuby mailing list
>>> BioRuby at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioruby
>> 
> 




From p.j.a.cock at googlemail.com  Thu Mar  3 18:14:53 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 3 Mar 2011 18:14:53 +0000
Subject: [BioRuby] tutorial
In-Reply-To: <7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
Message-ID: <AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>

On Thu, Mar 3, 2011 at 2:47 PM, Toshiaki Katayama <ktym at hgc.jp> wrote:
> Pj,
>
> We just discussed about this on the IRC meeting and people agreed to
> maintain the tutorial on the Wiki rather than in the source code
> because people usually search for docs on the web and we can potentially
> involve more people to improve/update the document. Let's see how it works!
>
> Toshiaki



On Thu, Mar 3, 2011 at 4:17 PM, Chris Fields <cjfields at illinois.edu> wrote:
> All,
>
> We are currently having a discussion related to this re: BioPerl docs and the
> wiki, in relation to our upcoming bioperl release and future directions. ?I think
> our current conclusions are relevant here.

I've been reading that thread on the BioPerl list with interest too. My
conclusions from Biopython are similar.

I personally would keep your tutorial in the source code repository,
but try and make a nice HTML version from this which people can
read online and find with search engines. Maybe have two versions
online, the latest release and a nightly build - that's what we do:

http://biopython.org/DIST/docs/tutorial/Tutorial.html
http://biopython.org/DIST/docs/tutorial/Tutorial-dev.html

We need to do more to make the HTML version of Biopython's
API documentation pretty.

Peter



From pjotr.public14 at thebird.nl  Thu Mar  3 19:12:46 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Thu, 3 Mar 2011 20:12:46 +0100
Subject: [BioRuby] tutorial
In-Reply-To: <AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>
Message-ID: <20110303191246.GB11821@thebird.nl>

Thanks Peter and Chris. I am glad we can learn from your experience.

Toshiaki had a very cool idea today (on IRC). The implications
carry beyond BioRuby gems. 

My wish is to see whether BioRuby and plugins are running well on
different Ruby implementations, and operating systems.

The reality is that developers won't test every possibility.

On the other hand, users do ;)

Also, for every plugin and BioRuby we create tests.

Users can run those tests. 

So, what we need is a tool to report test results to some central DB

If any user can simply run a test - say bioruby/test/test_any1.rb - we
could ask them (or they can choose to do it themselves) and
automatically update the DB centrally through a web service.

  biogem --report-test test/test_any1.rb

Resulting in:

  BioRuby, test_any1.rb runs on ruby 1.9.2p136 (2010-12-25 revision 30365) [i686-linux]

or, worse scenario, fail with trace ;)

We could pass in more info (dependencies etc). 

Not too hard to implement, and a great resource for docs and feedback
to users.

This would be interesting to rubygems in general. Debian uses
something similar for packages. What do you think? I don't think
BioPerl or BioPython has that, correct?

Pj.


From cjfields at illinois.edu  Thu Mar  3 19:19:30 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 13:19:30 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <20110303191246.GB11821@thebird.nl>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>
	<20110303191246.GB11821@thebird.nl>
Message-ID: <759E3D97-2A18-4F81-968A-3214ED7E3AEF@illinois.edu>

Like a smoke server, correct?  The perl community is a bit spoiled in that regard, as we have CPAN Testers, but that is mainly for CPAN releases only; a versioned OBF smoke tester would be nice.  There isn't a centralized OBF smoke server that I know of, however.  

There is a buildbot instance being set up, but this is more akin to automated builds and test runs per code change, not sure if it can handle user-based test reports.  Peter, know the progress on open-bio's buildbot?

chris

On Mar 3, 2011, at 1:12 PM, Pjotr Prins wrote:

> Thanks Peter and Chris. I am glad we can learn from your experience.
> 
> Toshiaki had a very cool idea today (on IRC). The implications
> carry beyond BioRuby gems. 
> 
> My wish is to see whether BioRuby and plugins are running well on
> different Ruby implementations, and operating systems.
> 
> The reality is that developers won't test every possibility.
> 
> On the other hand, users do ;)
> 
> Also, for every plugin and BioRuby we create tests.
> 
> Users can run those tests. 
> 
> So, what we need is a tool to report test results to some central DB
> 
> If any user can simply run a test - say bioruby/test/test_any1.rb - we
> could ask them (or they can choose to do it themselves) and
> automatically update the DB centrally through a web service.
> 
>  biogem --report-test test/test_any1.rb
> 
> Resulting in:
> 
>  BioRuby, test_any1.rb runs on ruby 1.9.2p136 (2010-12-25 revision 30365) [i686-linux]
> 
> or, worse scenario, fail with trace ;)
> 
> We could pass in more info (dependencies etc). 
> 
> Not too hard to implement, and a great resource for docs and feedback
> to users.
> 
> This would be interesting to rubygems in general. Debian uses
> something similar for packages. What do you think? I don't think
> BioPerl or BioPython has that, correct?
> 
> Pj.
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby




From cjfields at illinois.edu  Thu Mar  3 19:25:27 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 13:25:27 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <54C7986C-DA6B-4A30-A163-62A36471CBFE@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
	<54C7986C-DA6B-4A30-A163-62A36471CBFE@hgc.jp>
Message-ID: <3D146203-1188-444B-8EF7-1CE001AD340B@illinois.edu>

On Mar 3, 2011, at 12:10 PM, Toshiaki Katayama wrote:

> Hi Chris,
> 
> I forgot to mention but, okeefm started some work to sort out the current situation, thankfully.
> http://bioruby.open-bio.org/wiki/DocumentationTeam

Good!

> Sadly, Wiki have it's own weakness that we still have attacked everyday. This is really annoying.
> I have no reaction from OBF support team yet about the idea of introducing authorization to create new wiki account.

That may be due to our current tendency to migrate services off open-bio servers to something that removes the maintenance burden from OBF, namely our current move of CVS off dev.open-bio.org to github or elsewhere, and our in-progress move of bugzilla to redmine (yes, we are switching at some point).

That being said, the plugins for authorization via mediawiki are present I believe, as well as several systems to help prevent spam.  

> P.S.
> What is the b/c?

Short for 'because'.

-c


From ktym at hgc.jp  Thu Mar  3 19:27:34 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Fri, 4 Mar 2011 04:27:34 +0900
Subject: [BioRuby] tutorial
In-Reply-To: <20110303180908.GA10762@thebird.nl>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
	<20110303180908.GA10762@thebird.nl>
Message-ID: <312EEAEC-F6EF-4E6D-A5AC-94C41A515E03@hgc.jp>

Pj,

On 2011/03/04, at 3:09, Pjotr Prins wrote:

> Not much to add to Chris. The main problem we have now is docs in
> multiple places, and out of sync. Be good to get a coherent whole.
> 
> Wiki's tend to be more inviting, with a vibrant user community. But,
> for BioRuby the Tutorial has been a wiki for years, with no edits,
> that appears to not to work. Also I find Wiki's in general are rarely
> maintained.

This is not limited to the Wiki. Unfortunately, it is also true that
we could not maintain the text version enough, too.

https://github.com/bioruby/bioruby/commits/master/doc/Tutorial.rd

I agree that we need to avoid having multiple places for documents
as long as possible.


> I agree with Chris docs should really be versioned against the
> versioned classes, methods etc. Ideally we should also show
> dependencies and whether they work for Ruby1.8/1.9, JRuby, Rubinius.

This kind of check sheet should be automatically generated (e.g.
using RVM). The results can be included in the RDoc markup of each
method in the source code during the release management procedure.
Then, it will be available via the API reference (http://bioruby.org/rdoc/)
with versioning (because it is embedded in the code).
If we do that, I can agree that it will be useful resource to have.
However, I don't think RDoc is good for beginners to start with
(actually, web interface of rdoc is not friendly even for expert).

We are not talking about these method specifications or validations,
but thinking about the way to encourage writers of the introductory
documents.

Therefore, as for the new attempt, I proposed an idea to organize
a doc team responsible to

* write new documents
* update the existing docs in sync
* maintain a list of available documents coherently

independent from coders. Finally, the team will choose most convenient
technology to use -- GitHub, Wiki or whatever. But, most important
thing is to start writing the contents (than discussing on those choices).

I'm not sure how it works for now, but let's try. Because of the
weekly IRC meeting, I have a feeling that our community is evolving
very quickly toward a right direction and developing good social
interactions as well.

Toshiaki


> For several reasons I personally prefer generated docs. Maybe we
> should think of generating the docs from Doctest files + RDoc +
> Examples - and (cross)-index them nicely. Generation would help for
> plugins too.
> 
> I know it is more work, and not very grateful, but if someone would
> volunteer it would really pay off in the longer term. Note that
> rubygems.org supports rdoc too - so we can host versioned docs there.
> 
> Pj.



From mail at michaelbarton.me.uk  Thu Mar  3 19:29:29 2011
From: mail at michaelbarton.me.uk (Michael Barton)
Date: Thu, 3 Mar 2011 14:29:29 -0500
Subject: [BioRuby] tutorial
In-Reply-To: <20110303191246.GB11821@thebird.nl>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>
	<20110303191246.GB11821@thebird.nl>
Message-ID: <AANLkTimSX-NGC-Sur0UB9QiSNQ_1rkAt+uj-bv0=YOPk@mail.gmail.com>

This has been recently created for rubygems -
http://www.engineyard.com/blog/2011/introducing-gem-testers/

On 3 March 2011 14:12, Pjotr Prins <pjotr.public14 at thebird.nl> wrote:
> Thanks Peter and Chris. I am glad we can learn from your experience.
>
> Toshiaki had a very cool idea today (on IRC). The implications
> carry beyond BioRuby gems.
>
> My wish is to see whether BioRuby and plugins are running well on
> different Ruby implementations, and operating systems.
>
> The reality is that developers won't test every possibility.
>
> On the other hand, users do ;)
>
> Also, for every plugin and BioRuby we create tests.
>
> Users can run those tests.
>
> So, what we need is a tool to report test results to some central DB
>
> If any user can simply run a test - say bioruby/test/test_any1.rb - we
> could ask them (or they can choose to do it themselves) and
> automatically update the DB centrally through a web service.
>
> ?biogem --report-test test/test_any1.rb
>
> Resulting in:
>
> ?BioRuby, test_any1.rb runs on ruby 1.9.2p136 (2010-12-25 revision 30365) [i686-linux]
>
> or, worse scenario, fail with trace ;)
>
> We could pass in more info (dependencies etc).
>
> Not too hard to implement, and a great resource for docs and feedback
> to users.
>
> This would be interesting to rubygems in general. Debian uses
> something similar for packages. What do you think? I don't think
> BioPerl or BioPython has that, correct?
>
> Pj.
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>



From cjfields at illinois.edu  Thu Mar  3 19:30:33 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 13:30:33 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
Message-ID: <97A621B2-C49D-42F1-8363-AF66A35D43C8@illinois.edu>

On Mar 3, 2011, at 11:41 AM, Toshiaki Katayama wrote:

> Hi Chris,
> 
> Interesting. Thank you for your valuable inputs. :-)
> 
> So far, the main problem with us is not technical ones but lack of documentation itself (and man power). I personally believe that if we expose more documents on the web, it will raise chances to attract more people.
> 
> 1) 99.9% of the cases, people try google first. Installed docs are usually hard to find for users and it is very rare that we can't access to the web.

Right, I agree having a nice browsable version present on the wiki or elsewhere is a good idea.  However, does that version need to be the single official one?  Could it be generated, or have a public HTML page linked to?  The RSpec example Michael pointed out could be a very nice alternative.

> 2) Perhaps I don't perfectly understand what you mean, but having the latest version is probably enough in most cases... and we can also include the dump of entire wiki site at that time in the release package, if it makes sense.

Let's say a user has an older version of bioruby installed.  The official documentation is included with that version.  If that documentation is removed from any future versions, the only thing to point to is what is on the wiki (which may or may not work, but always points to the latest version).  

The tendency then is to suggest upgrading to the latest version that matches the documentation, but that pushes the burden back on the user to upgrade (not always a bad thing, truthfully).  However, if the user is locked in to a bioruby version somehow, they may be suddenly stuck w/o documentation.  

Ex: they are stuck using an old version of ruby due to draconian sysadmins, or they are reliant on a specific piece of code that requires an old bioruby version, and thus can't use the latest shiny bioruby.  Both of these scenarios have been reported by bioperl users in the past.

Regarding including the wiki with the distribution, we had thought about this as well (maybe even including nice PDFs) but it became too much of a maintenance hassle when the PDF generation could be done directly from the wiki itself.

> 3) If you have inline testing framework, it is not that hard. In our case, if I remember correctly, Pjotr have already implemented an inline testing tool for the BioRuby Tutorial (doctest?), so all we need is to run it against the output of the following script, for example.
> 
> ------------------------------------------------------------
> #!/usr/bin/env ruby
> 
> require 'rubygems'
> require 'nokogiri'
> require 'uri'
> require 'open-uri'
> 
> wiki = "http://bioruby.open-bio.org/w/index.php?title=Tutorial&action=edit"
> html = open(URI.encode(wiki)).read
> text = Nokogiri(html).search("textarea").inner_text
> 
> puts text
> ------------------------------------------------------------

Pjotr's mentioned his thoughts on this.

> 4) If HOWTOs are maintained as independent files, it still seems to have the same problem -- developers might forget to update the howto files when they made changes in the codes (and, this is the current situation we have now in BioRuby ;-).

That is a very common community problem, though; bioperl suffers it as well.  The only way around it is to have some sort of workflow that includes tests (including in-line tests) and doc checks prior to commits or releases.  Have a way to implement smoke tests, etc so the community can help on their end.

> Anyway, thanks again for your comments!
> 
> Toshiaki

No problem, glad to give my 2c.

chris

> On 2011/03/04, at 1:17, Chris Fields wrote:
> 
>> All,
>> 
>> We are currently having a discussion related to this re: BioPerl docs and the wiki, in relation to our upcoming bioperl release and future directions.  I think our current conclusions are relevant here.
>> 
>> We moved the tutorial and HOWTOs over to the wiki a few years back, and I have been thinking fairly seriously about moving them back to github after the next release, then having a locked wiki page auto-generated from those (with an editable discussion page for suggestions/edits by the community).  This decision is based on several problems we found over the last few years by moving the docs over to the wiki.  
>> 
>> Note these apply mainly to my experiences via bioperl and are primarily my opinions (though some devs have agreed with me), so this may not apply to the bioruby community or even other bioperl devs:
>> 
>> 1) Simple documentation access: what recourse do users have if they can't access the wiki for some reason (server goes down, local network problems, etc)?  Installed docs are always available.
>> 
>> 2) By placing documentation on the wiki (tutorials, HOWTOs, etc), one effectively 'forks' the documentation from the actual distribution.  It has it's own wikified history separate from the code.  That may be okay initially, but then the tendency is that the wiki documentation becomes the 'official' one and only relates to the in-development version or last release of your project.  A way around that is to create possibly API-specific tutorials for specific releases, but they are still effectively separate from the actual versioned code.  
>> 
>> 3) B/c changes in code occur independently from changes in the documentation and they are stored in completely different media (github VCS vc wiki CMS), implementing some nice defensive coding measures becomes harder, if not impossible.  For instance, we're thinking about implementing inline testing for the tutorials and the HOWTOs.  This is intractable if documentation is on the wiki alone and if maintenance of that documentation occurs independently of the code it is documenting.  Not impossible, just harder to maintain long-term.
>> 
>> 4) Finally, we found the initial idea of wiki-fying the docs is in theory well-intentioned (allows dynamic editing of the docs by everyone), but in reality we have found that documentation placed on the wiki tends to lag behind or drift from changes in the code, simply b/c devs tend to forget about the wiki while developing code on github.  Yes, maybe it's a hassle to maintain docs in the repo, but github has mechanisms to allow anyone to make changes (fork/pull request), and if you can set up a system that converts github docs to wiki or another suitable markup, even better (believe me, POD is pretty minimal, so we have our work cut out for us on the perl end).
>> 
>> Again, this may be completely different in the bioruby ecosystem.  Just wanted to share my similar experience with bioperl.
>> 
>> chris
>> 
>> On Mar 3, 2011, at 8:47 AM, Toshiaki Katayama wrote:
>> 
>>> Pj,
>>> 
>>> We just discussed about this on the IRC meeting and people agreed to
>>> maintain the tutorial on the Wiki rather than in the source code
>>> because people usually search for docs on the web and we can potentially
>>> involve more people to improve/update the document. Let's see how it works!
>>> 
>>> Toshiaki
>>> 
>>> On 2011/02/23, at 19:51, Pjotr Prins wrote:
>>> 
>>>> On Wed, Feb 23, 2011 at 06:45:36PM +0900, Toshiaki Katayama wrote:
>>>>> however, I don't know there is a best way to synchronize it with
>>>>> 
>>>>> 	http://bioruby.open-bio.org/wiki/Tutorial
>>>>> 
>>>>> because Mediawiki format is also a different one from RD and rdoc... Any ideas?
>>>> 
>>>> we should drop the Mediawiki version - despite the nice colours.
>>>> 
>>>> Pj.
>>> 
>>> 
>>> _______________________________________________
>>> BioRuby Project - http://www.bioruby.org/
>>> BioRuby mailing list
>>> BioRuby at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioruby
>> 
> 




From cjfields at illinois.edu  Thu Mar  3 19:39:56 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 13:39:56 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <312EEAEC-F6EF-4E6D-A5AC-94C41A515E03@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
	<20110303180908.GA10762@thebird.nl>
	<312EEAEC-F6EF-4E6D-A5AC-94C41A515E03@hgc.jp>
Message-ID: <2E582A20-9A8C-4CE5-9845-05F619B7B69C@illinois.edu>

On Mar 3, 2011, at 1:27 PM, Toshiaki Katayama wrote:

> Pj,
> 
> On 2011/03/04, at 3:09, Pjotr Prins wrote:
> 
>> Not much to add to Chris. The main problem we have now is docs in
>> multiple places, and out of sync. Be good to get a coherent whole.
>> 
>> Wiki's tend to be more inviting, with a vibrant user community. But,
>> for BioRuby the Tutorial has been a wiki for years, with no edits,
>> that appears to not to work. Also I find Wiki's in general are rarely
>> maintained.
> 
> This is not limited to the Wiki. Unfortunately, it is also true that
> we could not maintain the text version enough, too.
> 
> https://github.com/bioruby/bioruby/commits/master/doc/Tutorial.rd
> 
> I agree that we need to avoid having multiple places for documents
> as long as possible.
> 
> 
>> I agree with Chris docs should really be versioned against the
>> versioned classes, methods etc. Ideally we should also show
>> dependencies and whether they work for Ruby1.8/1.9, JRuby, Rubinius.
> 
> This kind of check sheet should be automatically generated (e.g.
> using RVM). The results can be included in the RDoc markup of each
> method in the source code during the release management procedure.
> Then, it will be available via the API reference (http://bioruby.org/rdoc/)
> with versioning (because it is embedded in the code).
> If we do that, I can agree that it will be useful resource to have.
> However, I don't think RDoc is good for beginners to start with
> (actually, web interface of rdoc is not friendly even for expert).
> 
> We are not talking about these method specifications or validations,
> but thinking about the way to encourage writers of the introductory
> documents.
> 
> Therefore, as for the new attempt, I proposed an idea to organize
> a doc team responsible to
> 
> * write new documents
> * update the existing docs in sync
> * maintain a list of available documents coherently
> 
> independent from coders. Finally, the team will choose most convenient
> technology to use -- GitHub, Wiki or whatever. But, most important
> thing is to start writing the contents (than discussing on those choices).
> 
> I'm not sure how it works for now, but let's try. Because of the
> weekly IRC meeting, I have a feeling that our community is evolving
> very quickly toward a right direction and developing good social
> interactions as well.
> 
> Toshiaki

I think this makes sense, as long as there is a migration path to getting important documentation back into the code repository (convert to rdoc, add tests, etc) to make it somewhat officially canonized.  I say that anything used to generate any useful documentation for users is a great thing (specifically if they lower the barrier to participation), but there is a definite need to imbed it properly within the project otherwise it may be lost or wither on the vine.

chris




From cjfields at illinois.edu  Thu Mar  3 19:42:28 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 13:42:28 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <AANLkTimSX-NGC-Sur0UB9QiSNQ_1rkAt+uj-bv0=YOPk@mail.gmail.com>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>
	<20110303191246.GB11821@thebird.nl>
	<AANLkTimSX-NGC-Sur0UB9QiSNQ_1rkAt+uj-bv0=YOPk@mail.gmail.com>
Message-ID: <4491C72E-22D9-4F2A-8209-170E132B24F6@illinois.edu>

Heh, similar to this: http://wiki.cpantesters.org/

It's good to see this for ruby!

chris

On Mar 3, 2011, at 1:29 PM, Michael Barton wrote:

> This has been recently created for rubygems -
> http://www.engineyard.com/blog/2011/introducing-gem-testers/
> 
> On 3 March 2011 14:12, Pjotr Prins <pjotr.public14 at thebird.nl> wrote:
>> Thanks Peter and Chris. I am glad we can learn from your experience.
>> 
>> Toshiaki had a very cool idea today (on IRC). The implications
>> carry beyond BioRuby gems.
>> 
>> My wish is to see whether BioRuby and plugins are running well on
>> different Ruby implementations, and operating systems.
>> 
>> The reality is that developers won't test every possibility.
>> 
>> On the other hand, users do ;)
>> 
>> Also, for every plugin and BioRuby we create tests.
>> 
>> Users can run those tests.
>> 
>> So, what we need is a tool to report test results to some central DB
>> 
>> If any user can simply run a test - say bioruby/test/test_any1.rb - we
>> could ask them (or they can choose to do it themselves) and
>> automatically update the DB centrally through a web service.
>> 
>>  biogem --report-test test/test_any1.rb
>> 
>> Resulting in:
>> 
>>  BioRuby, test_any1.rb runs on ruby 1.9.2p136 (2010-12-25 revision 30365) [i686-linux]
>> 
>> or, worse scenario, fail with trace ;)
>> 
>> We could pass in more info (dependencies etc).
>> 
>> Not too hard to implement, and a great resource for docs and feedback
>> to users.
>> 
>> This would be interesting to rubygems in general. Debian uses
>> something similar for packages. What do you think? I don't think
>> BioPerl or BioPython has that, correct?
>> 
>> Pj.
>> _______________________________________________
>> BioRuby Project - http://www.bioruby.org/
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
>> 
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby




From p.j.a.cock at googlemail.com  Thu Mar  3 19:51:09 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 3 Mar 2011 19:51:09 +0000
Subject: [BioRuby] tutorial
In-Reply-To: <20110303191246.GB11821@thebird.nl>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<AANLkTim+uk67uJdszGVsnQH+dvBoXxfbkKe5gwCwu4GA@mail.gmail.com>
	<20110303191246.GB11821@thebird.nl>
Message-ID: <AANLkTikewrc9sG8n8uwbsP7Pz+MSq9JvYxOA0SawW01M@mail.gmail.com>

On Thu, Mar 3, 2011 at 7:12 PM, Pjotr Prins <pjotr.public14 at thebird.nl> wrote:
> Thanks Peter and Chris. I am glad we can learn from your experience.
>
> Toshiaki had a very cool idea today (on IRC). The implications
> carry beyond BioRuby gems.
>
> My wish is to see whether BioRuby and plugins are running well on
> different Ruby implementations, and operating systems.
>
> The reality is that developers won't test every possibility.
>
> On the other hand, users do ;)
>
> Also, for every plugin and BioRuby we create tests.
>
> Users can run those tests.
>
> So, what we need is a tool to report test results to some central DB
> ...
> This would be interesting to rubygems in general. Debian uses
> something similar for packages. What do you think? I don't think
> BioPerl or BioPython has that, correct?
>
> Pj.
>

No, but Biopython is now using Buildbot on http://testing.open-bio.org
with a small number of buildslaves belonging to Biopython developers
running nightly unit tests on our latest code in github.

This is a very recent setup (having been prototyped on another OBF
machine late last year), and in theory other build systems could be
used too. I think BioPerl is interested in using smoke server.

Having end users submit tests would be useful too...

Peter


From ktym at hgc.jp  Thu Mar  3 20:16:52 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Fri, 4 Mar 2011 05:16:52 +0900
Subject: [BioRuby] tutorial
In-Reply-To: <3D146203-1188-444B-8EF7-1CE001AD340B@illinois.edu>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
	<54C7986C-DA6B-4A30-A163-62A36471CBFE@hgc.jp>
	<3D146203-1188-444B-8EF7-1CE001AD340B@illinois.edu>
Message-ID: <7E15D6C2-A0C4-4384-A6A0-ADAC9AA2396B@hgc.jp>

On 2011/03/04, at 4:25, Chris Fields wrote:
> On Mar 3, 2011, at 12:10 PM, Toshiaki Katayama wrote:
>> Sadly, Wiki have it's own weakness that we still have attacked everyday. This is really annoying.
>> I have no reaction from OBF support team yet about the idea of introducing authorization to create new wiki account.
> 
> That may be due to our current tendency to migrate services off open-bio servers to something that removes the maintenance burden from OBF, namely our current move of CVS off dev.open-bio.org to github or elsewhere, and our in-progress move of bugzilla to redmine (yes, we are switching at some point).
> 
> That being said, the plugins for authorization via mediawiki are present I believe, as well as several systems to help prevent spam.  

I understand they are very busy and working as volunteers, but I just requested to the OBF helpdesk again. :)
If OBF will discontinue the mediawiki service or they are so busy to support, we'll consider to setup our own.

>> P.S.
>> What is the b/c?
> 
> Short for 'because'.

Added to my dic, thanks!

I also thank for your subsequent posts on this thread, but I'd like to close the discussion (from my side) for now.
I'd like to see what happens with the doc team and I need to sleep (it's 5AM).

Toshiaki


From bonnalraoul at ingm.it  Thu Mar  3 20:29:15 2011
From: bonnalraoul at ingm.it (Raoul Bonnal)
Date: Thu, 03 Mar 2011 21:29:15 +0100
Subject: [BioRuby] tutorial
In-Reply-To: <AANLkTikewrc9sG8n8uwbsP7Pz+MSq9JvYxOA0SawW01M@mail.gmail.com>
Message-ID: <20110303202915.1d4d385c@mail.ingm.it>

Dear All,
a) this discussion is a good starting point for a workgroup during Codefest 2011 and/or BOSC (can't post to bopen-bio list cause I don't have the addr here, sorry)
a.idea) why not create a common "machine" on the cloud for testing our projects ?! It would be fun to see all the bio* with stats about testing etc...
b) testing is very important and new contributes should be accepted only with tests, which implies a problem how to check fake tests? :-)
c) usually ruby's community relies a lot on doc==tests that's completely wrong, because the newbies can't read fluently the code, also because there are different tools and sometimes a lot of mocking.
c.a) recently i had an idea, but I have no time to do that: establish a relationship between a mock and a real object and validate the mock or enable it only if the real object has been tested before. That would make mocking more sens to me, but i think this is another story.
d) I agree with Toshiaki, after this very useful brain storming start working (Impressed to see all this traffic :-) )

Cheers.
  _____  

From: Peter Cock [mailto:p.j.a.cock at googlemail.com]
To: Pjotr Prins [mailto:pjotr.public14 at thebird.nl]
Cc: BioRuby [mailto:bioruby at lists.open-bio.org]
Sent: Thu, 03 Mar 2011 20:51:09 +0100
Subject: Re: [BioRuby] tutorial

On Thu, Mar 3, 2011 at 7:12 PM, Pjotr Prins <pjotr.public14 at thebird.nl> wrote:
  > Thanks Peter and Chris. I am glad we can learn from your experience.
  >
  > Toshiaki had a very cool idea today (on IRC). The implications
  > carry beyond BioRuby gems.
  >
  > My wish is to see whether BioRuby and plugins are running well on
  > different Ruby implementations, and operating systems.
  >
  > The reality is that developers won't test every possibility.
  >
  > On the other hand, users do ;)
  >
  > Also, for every plugin and BioRuby we create tests.
  >
  > Users can run those tests.
  >
  > So, what we need is a tool to report test results to some central DB
  > ...
  > This would be interesting to rubygems in general. Debian uses
  > something similar for packages. What do you think? I don't think
  > BioPerl or BioPython has that, correct?
  >
  > Pj.
  >
  
  No, but Biopython is now using Buildbot on http://testing.open-bio.org
  with a small number of buildslaves belonging to Biopython developers
  running nightly unit tests on our latest code in github.
  
  This is a very recent setup (having been prototyped on another OBF
  machine late last year), and in theory other build systems could be
  used too. I think BioPerl is interested in using smoke server.
  
  Having end users submit tests would be useful too...
  
  Peter
  _______________________________________________
  BioRuby Project - http://www.bioruby.org/
  BioRuby mailing list
  BioRuby at lists.open-bio.org
  http://lists.open-bio.org/mailman/listinfo/bioruby
    


From cjfields at illinois.edu  Thu Mar  3 20:50:00 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 14:50:00 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <7E15D6C2-A0C4-4384-A6A0-ADAC9AA2396B@hgc.jp>
References: <031681A4-3307-4F8D-AEF2-7B74668046E3@unil.ch>
	<C4A4D381-99C6-4844-8D04-A5624BD3CD78@hgc.jp>
	<20110223105132.GA24543@thebird.nl>
	<956251BD-D8E4-451D-9BB6-428A52094A40@hgc.jp>
	<7EA281AB-9E16-4BCE-9E4D-D1B3AAB2BBD7@illinois.edu>
	<A3C1A146-1D7E-40ED-94B9-C2A2CC6D4210@hgc.jp>
	<54C7986C-DA6B-4A30-A163-62A36471CBFE@hgc.jp>
	<3D146203-1188-444B-8EF7-1CE001AD340B@illinois.edu>
	<7E15D6C2-A0C4-4384-A6A0-ADAC9AA2396B@hgc.jp>
Message-ID: <144459DC-E36C-4483-AF84-7F9021987FD2@illinois.edu>

On Mar 3, 2011, at 2:16 PM, Toshiaki Katayama wrote:

> On 2011/03/04, at 4:25, Chris Fields wrote:
>> On Mar 3, 2011, at 12:10 PM, Toshiaki Katayama wrote:
>>> Sadly, Wiki have it's own weakness that we still have attacked everyday. This is really annoying.
>>> I have no reaction from OBF support team yet about the idea of introducing authorization to create new wiki account.
>> 
>> That may be due to our current tendency to migrate services off open-bio servers to something that removes the maintenance burden from OBF, namely our current move of CVS off dev.open-bio.org to github or elsewhere, and our in-progress move of bugzilla to redmine (yes, we are switching at some point).
>> 
>> That being said, the plugins for authorization via mediawiki are present I believe, as well as several systems to help prevent spam.  
> 
> I understand they are very busy and working as volunteers, but I just requested to the OBF helpdesk again. :)
> If OBF will discontinue the mediawiki service or they are so busy to support, we'll consider to setup our own.

Not sure of the status.  We (bioperl) have talked about it, mainly b/c of the hassle of wiki sysadmin maintenance.

>>> P.S.
>>> What is the b/c?
>> 
>> Short for 'because'.
> 
> Added to my dic, thanks!
> 
> I also thank for your subsequent posts on this thread, but I'd like to close the discussion (from my side) for now.
> I'd like to see what happens with the doc team and I need to sleep (it's 5AM).
> 
> Toshiaki

np (No problem).  Get some sleep.

chris


From cjfields at illinois.edu  Thu Mar  3 20:52:50 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 3 Mar 2011 14:52:50 -0600
Subject: [BioRuby] tutorial
In-Reply-To: <20110303202915.1d4d385c@mail.ingm.it>
References: <20110303202915.1d4d385c@mail.ingm.it>
Message-ID: <3DE2622D-406F-43EC-9554-BF7A8D7A38E6@illinois.edu>

On Mar 3, 2011, at 2:29 PM, Raoul Bonnal wrote:

> Dear All,
> a) this discussion is a good starting point for a workgroup during Codefest 2011 and/or BOSC (can't post to bopen-bio list cause I don't have the addr here, sorry)
> a.idea) why not create a common "machine" on the cloud for testing our projects ?! It would be fun to see all the bio* with stats about testing etc...

I think the buildbot instance covers some of that, but they are mainly automated builds:

http://testing.open-bio.org/

biopython is the only one set up currently. 

> b) testing is very important and new contributes should be accepted only with tests, which implies a problem how to check fake tests? :-)

Code review and checking the test results.  Otherwise, you have to trust your developers.

> c) usually ruby's community relies a lot on doc==tests that's completely wrong, because the newbies can't read fluently the code, also because there are different tools and sometimes a lot of mocking.
> c.a) recently i had an idea, but I have no time to do that: establish a relationship between a mock and a real object and validate the mock or enable it only if the real object has been tested before. That would make mocking more sens to me, but i think this is another story.

Yes, I've thought about that as well re: Moose-based work, haven't wrapped my head around it either.

> d) I agree with Toshiaki, after this very useful brain storming start working (Impressed to see all this traffic :-) )
> 
> Cheers.

+1.  Will be interesting to see how things progress.

chris


From bonnalraoul at ingm.it  Fri Mar  4 09:31:10 2011
From: bonnalraoul at ingm.it (Raoul Bonnal)
Date: Fri, 4 Mar 2011 10:31:10 +0100
Subject: [BioRuby] Programmatic interfaces to online-only bioinformatic
	tools
In-Reply-To: <AANLkTi=zSwQK=V5pWx70eds0kB=84uYco45tyWyos_Qj@mail.gmail.com>
References: <AANLkTi=zSwQK=V5pWx70eds0kB=84uYco45tyWyos_Qj@mail.gmail.com>
Message-ID: <18AE3D74-5120-46C9-A042-08551F90A936@ingm.it>

Dear Ben,
I'm very happy that you like the plugin system, thanks!

Yesterday we created the doc team which is charge to supervise every doc content for BioRuby.
@DocTeam: please make a public announce.

Our role is to make their life easier, so write tests, documentation in code and useful comments so,  I invite you to add your case study to the README for a better comprehension of the tool, or where the docteam will decide.

Also a reminder for all developers:
try to respect/reflect the bioruby directory tree, in this particular case:

lib/bio-cnls_screenscraper.rb
  require 'bio/cnls_screenscraper'

mkdir lib/bio 
touch lib/bio/cnls_screenscraper.rb and add your code here.

Don't forget, git add .

This would help in the future for an easier incorporation into bioruby, if we decide that a particular plugin can be assimilated (BORG)

PS: probably I need to make this concept more clear on biogem, sorry it's my fault.

On 03/mar/2011, at 01.47, Ben Woodcroft wrote:

> Hi there,
> 
> I'm after an opinion on best practice for accessing those bioinformatic
> tools that are only accessible via web-interfaces, without any way of
> downloading the program itself. As I often want to throw an organisms's
> whole proteome at the tool (in my case ~5500 proteins), doing it one at a
> time is obviously not feasible. Do people think that writing a wrapper that
> hammers the website in question is a nice thing to do, provided I wait 1
> second in between each upload (1 protein/upload)? From what I can
> understand, processing each protein is not computationally demanding and
> results are returned almost instantaneously when querying the server
> manually, unlike a blast server.
> 
> Some background:
> I'm really like this bioruby plugin thing - thanks to those involved in its
> creation. I've written a bioruby plugin
> https://github.com/wwood/bioruby-cnls_screenscraper which queries
> http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi that does what
> I've described above. Not quite as well documented as it might be, but it
> appears to work and isn't too complicated.
> 
> Thanks,
> ben
> 
> -- 
> Ben J Woodcroft, BE (Hons)
> 
> PhD Candidate
> Ralph Laboratory
> The University of Melbourne
> Melbourne, Australia
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby

--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios









From p.j.a.cock at googlemail.com  Fri Mar  4 11:45:11 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 4 Mar 2011 11:45:11 +0000
Subject: [BioRuby] Automated testing server; was  tutorial
Message-ID: <AANLkTik4LqbcQeV8qujtUTGNw0AeunRfYEtuSQR_tYHP@mail.gmail.com>

Hi all,

I've retitled this thread to reflect the current topic, and CC'd the open-bio-l
mailing list as Raoul suggested. Can we continue the discussion there?
http://lists.open-bio.org/mailman/listinfo/open-bio-l

On Thu, Mar 3, 2011 at 8:52 PM, Chris Fields <cjfields at illinois.edu> wrote:
> On Mar 3, 2011, at 2:29 PM, Raoul Bonnal wrote:
>
>> Dear All,
>> a) this discussion is a good starting point for a workgroup during Codefest
>> 2011 and/or BOSC (can't post to bopen-bio list cause I don't have the addr
>> here, sorry) a.idea) why not create a common "machine" on the cloud for
>> testing our projects ?! It would be fun to see all the bio* with stats about
>> testing etc...
>
> I think the buildbot instance covers some of that, but they are mainly
> automated builds:
>
> http://testing.open-bio.org/
>
> biopython is the only one set up currently.

Note that this is a small Amazon cloud machine, and doesn't actually run
the tests itself (that would require a more expensive machine due to the
higher load). Instead we need client machines (covering a range of OS,
Python version etc) whose run-time is donated (currently by Biopython
developers or their employers).

When setting up http://testing.open-bio.org/ the intention was to have
it host other Bio* projects too - and they don't have to be using the
buildbot software (but they could if they wanted to).

>> b) testing is very important and new contributes should be accepted
>> only with tests, which implies a problem how to check fake tests? :-)
>
> Code review and checking the test results. ?Otherwise, you have to trust
> your developers.

This is something we're pushing much more with Biopython in recent
years (a depressing amount of legacy code had no tests when I first
got involved, things are a lot better now). For any new code contributions
we do ask for tests and minimal documentation (and try and work
with the contributor to help this happen).

>> c) usually ruby's community relies a lot on doc==tests that's
>> completely wrong, because the newbies can't read fluently the
>> code, also because there are different tools and sometimes a lot
>> of mocking.

With Biopython we're starting to make more use of testable docs
(Python's doctest system) which is really good I think. But you are
right, you need proper unit tests AS WELL. With our doctests,
the primary aim is to be useful documentation (which can double
as a basic functional test).

>> c.a) recently i had an idea, but I have no time to do that: establish
>> a relationship between a mock and a real object and validate the
>> mock or enable it only if the real object has been tested before.
>> That would make mocking more sens to me, but i think this is
>> another story.
>
> Yes, I've thought about that as well re: Moose-based work, haven't
> wrapped my head around it either.

I'm not quite following - it may be a terminology difference.

>> d) I agree with Toshiaki, after this very useful brain storming
>> start working (Impressed to see all this traffic :-) )
>>
>> Cheers.
>
> +1. ?Will be interesting to see how things progress.
>
> chris

Same here :)

Peter



From hlapp at drycafe.net  Fri Mar  4 23:26:25 2011
From: hlapp at drycafe.net (Hilmar Lapp)
Date: Fri, 4 Mar 2011 18:26:25 -0500
Subject: [BioRuby] Informatics job opportunity at NESCent
Message-ID: <1878F27F-000D-4C80-B9EA-A83F7887828F@drycafe.net>

(Apologies if you receive multiple copies, and also if you are not  
interested in job opportunities.  In my defense, quite a few people on  
Bio* lists might qualify for (let alone enjoy) the position. And if  
you know someone who might be interested please forward.)

===================================================
User Interface Design and Web Application Developer
===================================================

The National Evolutionary Synthesis Center (NESCent) seeks a creative  
and enthusiastic individual to design user interfaces and web  
applications for scientific applications. The incumbent will work as  
part of a small informatics team in close collaboration with domain  
scientists.

NESCent is an NSF-funded center dedicated to cross-disciplinary  
research in evolutionary science. Our informatics team works closely  
with visiting and resident scientists to support their custom software  
and database development needs. All NESCent software products are open- 
source, and the Center has a number of initiatives to actively promote  
collaborative development of community software resources  
(informatics.nescent.org). Above all, we are enthusiastic about our  
work, about the mission of the Center, and about the contribution of  
informatics to that mission.

Job description: The incumbent will design and develop user interfaces  
and web applications for databases and other software tools for  
sponsored scientists and staff. The job responsibilities include all  
stages of the software development process, including requirements  
gathering, design, implementation, release packaging and  
documentation, as part of a small team (typically 2-3 individuals)  
following project management best practices. We expect the incumbent  
to present their work at conferences and contribute to publications  
with scientific collaborators; interact regularly with visiting and  
resident scientists, other members of the informatics team and Center  
staff; and generally serve as an expert resource for Center personnel.  
The position provides opportunities for professional development. Most  
informatics staff work at our Durham NC offices, located adjacent to  
Duke University, but we do support a wide range of technologies for  
virtual communication with off-site staff and collaborators.

Required Qualifications:
* Demonstrated success collaborating with clients on custom software  
solutions
* Experience with various stages of the software development cycle
* Expertise in development and testing of user interface designs
* Excellent communication skills, both virtual and face-to-face
* A four-year college degree in Computer Science, Bioinformatics or a  
related field

Preferred Qualifications:
* M.S. or Ph.D. in Computer Science, Bioinformatics or related field  
along with demonstrated interest in science, particularly biology
* Expertise in rapid application development and respective  
programming technologies and languages (e.g., modern scripting  
languages and web-application frameworks such as Python/Django, Ruby/ 
Ruby-on-Rails, and Perl/Catalyst), fluency in Java programming, and  
prior experience in relational database programming (PostgreSQL or  
MySQL)
* Expertise in dynamic and interactive web technologies (JavaScript,  
CGI), web service (SOAP, REST, XML, JSON) and semantic web technologies
* Experience with open-source, and collaborative, software  
development, software usability design and assessment
* Expertise in graphic design, data visualization and/or scientific  
data integration

How to apply: Please send cover letter, resume and contact information  
for three references to Dr. Karen Cranston, Training Coordinator and  
Bioinformatics Project Manager (karen.cranston at nescent.org). Review of  
applications will begin March 21, 2011. Informal inquires or requests  
for additional information may be directed to Dr. Cranston by email or  
phone (+1-919-613-2275).

-- 
===========================================================
: Hilmar Lapp -:- Durham, NC -:- hlapp at drycafe dot net :
===========================================================






From donttrustben at gmail.com  Sat Mar  5 00:09:16 2011
From: donttrustben at gmail.com (Ben Woodcroft)
Date: Sat, 5 Mar 2011 11:09:16 +1100
Subject: [BioRuby] Programmatic interfaces to online-only bioinformatic
	tools
In-Reply-To: <18AE3D74-5120-46C9-A042-08551F90A936@ingm.it>
References: <AANLkTi=zSwQK=V5pWx70eds0kB=84uYco45tyWyos_Qj@mail.gmail.com>
	<18AE3D74-5120-46C9-A042-08551F90A936@ingm.it>
Message-ID: <AANLkTi=saAb-OYMzoA_-BHqJRo9x9tR9vPaNm1p+3RT6@mail.gmail.com>

Hi Raul,

Thanks for the tips - I've added a README and moved things around in the
tree as per your suggestion, and uploaded to github.

I originally put the code in lib/bio-cnls_screenscraper.rb was because that
is the file that was created as part of the biogem process. Would changing
the default to lib/bio/cnls_screenscraper.rb be sensible? Isn't the same
true of the tests? I moved test/bio-cnls_screenscraper.rb to
test/bio/cnls_screenscraper.rb as well.

I think it unlikely that my code will make it into the bioruby main tree,
because of the dependence on the webserver (as well as the usual reasons for
not including my code!). The reason I used biogem was that it created an
environment where I could write a distinct chunk of bioruby-associated code
rapidly. The results will hopefully be published soon (how to cite biogem?)
and I wanted to make the code available. Slotting it into the bioruby main
tree isn't something I much care about.

I'm a bit confused by what you mean by "add your case study to the README".
Perhaps when the DocTeam make the public announcement that will become
clearer.

Thanks,
ben

On 4 March 2011 20:31, Raoul Bonnal <bonnalraoul at ingm.it> wrote:

> Dear Ben,
> I'm very happy that you like the plugin system, thanks!
>
> Yesterday we created the doc team which is charge to supervise every doc
> content for BioRuby.
> @DocTeam: please make a public announce.
>
> Our role is to make their life easier, so write tests, documentation in
> code and useful comments so,  I invite you to add your case study to the
> README for a better comprehension of the tool, or where the docteam will
> decide.
>
> Also a reminder for all developers:
> try to respect/reflect the bioruby directory tree, in this particular case:
>
> lib/bio-cnls_screenscraper.rb
>   require 'bio/cnls_screenscraper'
>
> mkdir lib/bio
> touch lib/bio/cnls_screenscraper.rb and add your code here.
>
> Don't forget, git add .
>
> This would help in the future for an easier incorporation into bioruby, if
> we decide that a particular plugin can be assimilated (BORG)
>
> PS: probably I need to make this concept more clear on biogem, sorry it's
> my fault.
>
> On 03/mar/2011, at 01.47, Ben Woodcroft wrote:
>
> Hi there,
>
> I'm after an opinion on best practice for accessing those bioinformatic
> tools that are only accessible via web-interfaces, without any way of
> downloading the program itself. As I often want to throw an organisms's
> whole proteome at the tool (in my case ~5500 proteins), doing it one at a
> time is obviously not feasible. Do people think that writing a wrapper that
> hammers the website in question is a nice thing to do, provided I wait 1
> second in between each upload (1 protein/upload)? From what I can
> understand, processing each protein is not computationally demanding and
> results are returned almost instantaneously when querying the server
> manually, unlike a blast server.
>
> Some background:
> I'm really like this bioruby plugin thing - thanks to those involved in its
> creation. I've written a bioruby plugin
> https://github.com/wwood/bioruby-cnls_screenscraper which queries
> http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi that does
> what
> I've described above. Not quite as well documented as it might be, but it
> appears to work and isn't too complicated.
>
> Thanks,
> ben
>
> --
> Ben J Woodcroft, BE (Hons)
>
> PhD Candidate
> Ralph Laboratory
> The University of Melbourne
> Melbourne, Australia
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>
>
> --
> Ra
>
> linkedin: http://it.linkedin.com/in/raoulbonnal
> twitter: http://twitter.com/ilpuccio
> skype: ilpuccio
> irc.freenode.net: Helius
> github: https://github.com/helios
>
>
>
>
>
>
>


-- 
Ben J Woodcroft, BE (Hons)

PhD Candidate
Ralph Laboratory
The University of Melbourne
Melbourne, Australia

tel: (+613) 8344 2319
b.woodcroft at pgrad.unimelb.edu.au


From donttrustben at gmail.com  Sat Mar  5 07:05:57 2011
From: donttrustben at gmail.com (Ben Woodcroft)
Date: Sat, 5 Mar 2011 18:05:57 +1100
Subject: [BioRuby] Programmatic interfaces to online-only bioinformatic
	tools
In-Reply-To: <AANLkTi=saAb-OYMzoA_-BHqJRo9x9tR9vPaNm1p+3RT6@mail.gmail.com>
References: <AANLkTi=zSwQK=V5pWx70eds0kB=84uYco45tyWyos_Qj@mail.gmail.com>
	<18AE3D74-5120-46C9-A042-08551F90A936@ingm.it>
	<AANLkTi=saAb-OYMzoA_-BHqJRo9x9tR9vPaNm1p+3RT6@mail.gmail.com>
Message-ID: <AANLkTikPDN2vrCoqN4_tmVDZuKWMFnOLija+wk89f26T@mail.gmail.com>

Hi again,

I now believe I'd misunderstood you, sorry. Not enough coffee, my guess is.
I take back my suggestion about changing the default to
lib/bio/cnls_screenscraper.rb. Would it be a good idea to make
lib/bio-cnls_screenscraper.rb by default have some comment about what to do
here, instead of being empty, something like below?

# Please require your code below, respecting the bioruby directory tree. For
instance,
# require 'lib/bio/sequence/awesome_sequence_thingy'
#
# It is bad practice to write other code directly into this file, because
doing so causes confusion if this biogem was ever to get merged into the
main bioruby tree.

Thanks,
ben

On 5 March 2011 11:09, Ben Woodcroft <donttrustben at gmail.com> wrote:

> Hi Raul,
>
> Thanks for the tips - I've added a README and moved things around in the
> tree as per your suggestion, and uploaded to github.
>
> I originally put the code in lib/bio-cnls_screenscraper.rb was because that
> is the file that was created as part of the biogem process. Would changing
> the default to lib/bio/cnls_screenscraper.rb be sensible? Isn't the same
> true of the tests? I moved test/bio-cnls_screenscraper.rb to
> test/bio/cnls_screenscraper.rb as well.
>
> I think it unlikely that my code will make it into the bioruby main tree,
> because of the dependence on the webserver (as well as the usual reasons for
> not including my code!). The reason I used biogem was that it created an
> environment where I could write a distinct chunk of bioruby-associated code
> rapidly. The results will hopefully be published soon (how to cite biogem?)
> and I wanted to make the code available. Slotting it into the bioruby main
> tree isn't something I much care about.
>
> I'm a bit confused by what you mean by "add your case study to the README".
> Perhaps when the DocTeam make the public announcement that will become
> clearer.
>
> Thanks,
> ben
>
>
> On 4 March 2011 20:31, Raoul Bonnal <bonnalraoul at ingm.it> wrote:
>
>> Dear Ben,
>> I'm very happy that you like the plugin system, thanks!
>>
>> Yesterday we created the doc team which is charge to supervise every doc
>> content for BioRuby.
>> @DocTeam: please make a public announce.
>>
>> Our role is to make their life easier, so write tests, documentation in
>> code and useful comments so,  I invite you to add your case study to the
>> README for a better comprehension of the tool, or where the docteam will
>> decide.
>>
>> Also a reminder for all developers:
>> try to respect/reflect the bioruby directory tree, in this particular
>> case:
>>
>> lib/bio-cnls_screenscraper.rb
>>   require 'bio/cnls_screenscraper'
>>
>> mkdir lib/bio
>> touch lib/bio/cnls_screenscraper.rb and add your code here.
>>
>> Don't forget, git add .
>>
>> This would help in the future for an easier incorporation into bioruby, if
>> we decide that a particular plugin can be assimilated (BORG)
>>
>> PS: probably I need to make this concept more clear on biogem, sorry it's
>> my fault.
>>
>> On 03/mar/2011, at 01.47, Ben Woodcroft wrote:
>>
>> Hi there,
>>
>> I'm after an opinion on best practice for accessing those bioinformatic
>> tools that are only accessible via web-interfaces, without any way of
>> downloading the program itself. As I often want to throw an organisms's
>> whole proteome at the tool (in my case ~5500 proteins), doing it one at a
>> time is obviously not feasible. Do people think that writing a wrapper
>> that
>> hammers the website in question is a nice thing to do, provided I wait 1
>> second in between each upload (1 protein/upload)? From what I can
>> understand, processing each protein is not computationally demanding and
>> results are returned almost instantaneously when querying the server
>> manually, unlike a blast server.
>>
>> Some background:
>> I'm really like this bioruby plugin thing - thanks to those involved in
>> its
>> creation. I've written a bioruby plugin
>> https://github.com/wwood/bioruby-cnls_screenscraper which queries
>> http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi that does
>> what
>> I've described above. Not quite as well documented as it might be, but it
>> appears to work and isn't too complicated.
>>
>> Thanks,
>> ben
>>
>> --
>> Ben J Woodcroft, BE (Hons)
>>
>> PhD Candidate
>> Ralph Laboratory
>> The University of Melbourne
>> Melbourne, Australia
>> _______________________________________________
>> BioRuby Project - http://www.bioruby.org/
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
>>
>>
>>   --
>> Ra
>>
>> linkedin: http://it.linkedin.com/in/raoulbonnal
>> twitter: http://twitter.com/ilpuccio
>> skype: ilpuccio
>> irc.freenode.net: Helius
>> github: https://github.com/helios
>>
>>
>>
>>
>>
>>
>>
>
>


From pjotr.public14 at thebird.nl  Thu Mar 10 08:24:33 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Thu, 10 Mar 2011 09:24:33 +0100
Subject: [BioRuby] BioRuby GSoC 2011 ideas?
In-Reply-To: <116E7FA5-1886-4DA0-93B1-AAB83EE34DB0@ingm.it>
References: <28297803-062D-4C40-A6F6-999A71A2D176@nescent.org>
	<9C15E792-54F7-44F7-986B-9CD413E03BE1@hgc.jp>
	<116E7FA5-1886-4DA0-93B1-AAB83EE34DB0@ingm.it>
Message-ID: <20110310082433.GA18827@thebird.nl>

What is the status of GSoC proposals for BioRuby. We should have at
least one proposal go in with OBF. It would also be good to have a
Nescent proposal.

IRC today?

Pj.

On Wed, Feb 23, 2011 at 01:10:30PM +0100, Raoul Bonnal wrote:
> Dear All,
> I remind you about the irc meeting for live discussion, I think the main topic can be GSoC 2011
> 
> I'd like to have some update about Semantic Web its reliability and if we (bioruby) are going to use it. Where?
> 
> I'm available for mentoring on OBF GSoC projects.
> 
> On 23/feb/2011, at 08.43, Toshiaki Katayama wrote:
> 
> > Hi all,
> > 
> > I just discussed with Rutger about Google Summer of Code (GSoC) 2011.
> > If you are interested in to mentor/participate GSoC this year, please put your ideas on this list.
> > 
> > Attached is an announcement from NESCent, which is focused on phloinformatics.
> > I heard that Open Bio Foundation (OBF) is also considering to organize GSoC again (not confirmed, though).
> > 
> > http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2011
> > http://www.open-bio.org/wiki/Google_Summer_of_Code
> > 
> > Some ideas from our side are:
> > 
> > for NESCent GSoC,
> > - compile phyloinfo plugins for BioRuby (based on NEXML https://github.com/rvosa/bio-nexml, forester http://code.google.com/p/forester/ etc.) to make analysis pipeline available (relevant to Bio::Phylo in Perl) - with a nice tutorial, hopefully ;)
> > 
> > for OBF GSoC,
> > - develop NGS-related plugins
> > - develop a generic framework for workflow management and parallel execution of tasks
> > - develop plugins for Semantic Web (RDF utilities, SPARQL query interface, handling ontologies etc.)
> > 
> > Regards,
> > Toshiaki Katayama
> > 
> > Begin forwarded message:
> > 
> >> From: Hilmar Lapp <hlapp at nescent.org>
> >> Date: 2011???2???22??? 03:55:52JST
> >> To: PhyloSoC Announcements <phylosoc-announce at googlegroups.com>
> >> Subject: Phyloinformatics Summer of Code 2011: Call for Mentors
> >> Reply-To: phylosoc-announce at googlegroups.com
> >> 
> >> Over the next 3 weeks we will be pulling together NESCent's application to the 2011 Google Summer of Code as a mentoring organization. This is a call for all prospective mentors, primary and secondary, to step forward.
> >> 
> >> Participating as an organization is competitive. Over the last years the acceptance rate for organizations has been around 30-35%. The most important component of organization applications is the Ideas page, and specifically the quality and suitability of the project ideas. These project ideas are contributed by you, our mentors. In the past we have had a strong, diverse and well-documented portfolio of ideas with different degrees of difficulty, from different participating open-source projects, using different programming languages.
> >> 
> >> If you can fancy yourself serving as a mentor, or helping someone else mentoring a student as a secondary mentor, or would like to help out in other capacities, please contact us as soon as you can at phylosoc-admin at nescent.org. If you have not been a mentor with us in previous years, we'll send you guidance on what doing so involves, and how you can contribute to our participation. We will also add everyone who is interested in serving to our (private) mentors mailing list (at least those who aren't already).
> >> 
> >> If you are new to Summer of Code and wonder what it takes or what it is like to be a mentor for us, don't hesitate to ask questions or to contact previous mentors (see URLs below for projects that got selected). Being a mentor does require time (see http://bit.ly/soc2011-mentortime), but our past mentors have pretty much unanimously found it a fun and rewarding experience. That's aside from the code a student could contribute to your project, and, possibly most important of all in the long run, the chance to gain a new developer.
> >> 
> >> The initial skeleton of our 2011 Ideas page is now up here and ready for adding project ideas and mentors(*).
> >> 
> >> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2011
> >> 
> >> We will send further guidance on drafting project ideas, but for now you can see examples of the format and scope of project ideas on the Ideas pages from previous years (click on "Ideas"):
> >> 
> >> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2010
> >> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2009
> >> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2008
> >> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2007
> >> 
> >> Dates:
> >> ======
> >> 
> >> Submission of organization applications starts Feb 28 and closes on March 11. For project ideas to contribute to the strength of our application they must be in reasonable shape by the morning of March 11. *If* we are accepted, ideas can be refined (or added) between March 18-27.
> >> 
> >> Students apply March 28-April 8, and selected students are announced April 25. The coding period runs from May 23 to August 22. See
> >> http://bit.ly/soc2011-timeline for a full timeline of the whole program.
> >> 
> >> Cheers, and we look forward to hearing from you!
> >> 
> >>       Karen Cranston
> >>       Hilmar Lapp
> >> 
> >> (*) Editing content on the NESCent Informatics wiki (f.k.a. Hackathon wiki) requires you to login. We had to disable local account creation due to spam getting out of control. The wiki is still open, though - just login with your OpenID. If you don't have an OpenID, the "Login with OpenID" page has information on you can easily get one, and if you have a Google account, you're all set to go.
> >> 
> >> -- 
> >> You received this message because you are subscribed to the Google
> >> Groups "Phyloinfomatics Summer of Code Announcements" group.
> >> To unsubscribe from this group, send email to
> >> phylosoc-announce+unsubscribe at googlegroups.com
> >> For more options, visit this group at
> >> http://groups.google.com/group/phylosoc-announce?hl=en
> > 
> > 
> > _______________________________________________
> > BioRuby Project - http://www.bioruby.org/
> > BioRuby mailing list
> > BioRuby at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioruby
> 
> --
> Ra
> 
> 
> 
> 
> 
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby


From john.woods at marcottelab.org  Thu Mar 10 22:24:50 2011
From: john.woods at marcottelab.org (John Woods)
Date: Thu, 10 Mar 2011 16:24:50 -0600
Subject: [BioRuby] Google Summer of Code
Message-ID: <AANLkTin-w-JZBoEJdgAv_hQ5TXSqR9XYSzVkZr1O9u4R@mail.gmail.com>

Hey everyone,

I'm working on the application for SciRuby (not BioRuby) for GSoC. We're a
pretty new project. Any chance you all would be willing to vouch for us?

This email also serves as a reminder that we're out here. Come and join us.
=)

http://github.com/SciRuby/sciruby/wiki/The-SciRuby-Manifesto

Here's our application (not finished):
http://github.com/SciRuby/sciruby/wiki/Google-Summer-of-Code

Many thanks,
John Woods

Director, SciRuby Project
National Science Foundation Fellow | The Marcotte Lab
The University of Texas at Austin


From john.woods at marcottelab.org  Thu Mar 10 22:48:38 2011
From: john.woods at marcottelab.org (John Woods)
Date: Thu, 10 Mar 2011 16:48:38 -0600
Subject: [BioRuby] Google Summer of Code
In-Reply-To: <AANLkTin-w-JZBoEJdgAv_hQ5TXSqR9XYSzVkZr1O9u4R@mail.gmail.com>
References: <AANLkTin-w-JZBoEJdgAv_hQ5TXSqR9XYSzVkZr1O9u4R@mail.gmail.com>
Message-ID: <AANLkTi=CLEw1Jmf17iZd4JJO0tQrFDL9NrbH2cgjppYg@mail.gmail.com>

Just to clarify, to vouch for us you have to be either (1) a Googler or (2)
a past GSoC mentoring organization, such as BioRuby.

John


On Thu, Mar 10, 2011 at 4:24 PM, John Woods <john.woods at marcottelab.org>wrote:

> Hey everyone,
>
> I'm working on the application for SciRuby (not BioRuby) for GSoC. We're a
> pretty new project. Any chance you all would be willing to vouch for us?
>
> This email also serves as a reminder that we're out here. Come and join us.
> =)
>
> http://github.com/SciRuby/sciruby/wiki/The-SciRuby-Manifesto
>
> Here's our application (not finished):
> http://github.com/SciRuby/sciruby/wiki/Google-Summer-of-Code
>
> Many thanks,
> John Woods
>
> Director, SciRuby Project
> National Science Foundation Fellow | The Marcotte Lab
> The University of Texas at Austin
>


From bonnalraoul at ingm.it  Fri Mar 11 00:13:53 2011
From: bonnalraoul at ingm.it (Raoul Bonnal)
Date: Fri, 11 Mar 2011 01:13:53 +0100
Subject: [BioRuby] Google Summer of Code
In-Reply-To: <AANLkTi=CLEw1Jmf17iZd4JJO0tQrFDL9NrbH2cgjppYg@mail.gmail.com>
Message-ID: <20110311001353.c4309e55@mail.ingm.it>

We are under OBF, I don't know if you can join that organization too, but I'm not the right one to ask for.
Who can answer to vouch?
It's a pity that we can't work together because some ideas, I think, could be shared between two groups.

http://www.open-bio.org/wiki/Gsoc
  _____  

From: John Woods [mailto:john.woods at marcottelab.org]
To: bioruby at lists.open-bio.org
Sent: Thu, 10 Mar 2011 23:48:38 +0100
Subject: Re: [BioRuby] Google Summer of Code

Just to clarify, to vouch for us you have to be either (1) a Googler or (2)
  a past GSoC mentoring organization, such as BioRuby.
  
  John
  
  
  On Thu, Mar 10, 2011 at 4:24 PM, John Woods <john.woods at marcottelab.org>wrote:
  
  > Hey everyone,
  >
  > I'm working on the application for SciRuby (not BioRuby) for GSoC. We're a
  > pretty new project. Any chance you all would be willing to vouch for us?
  >
  > This email also serves as a reminder that we're out here. Come and join us.
  > =)
  >
  > http://github.com/SciRuby/sciruby/wiki/The-SciRuby-Manifesto
  >
  > Here's our application (not finished):
  > http://github.com/SciRuby/sciruby/wiki/Google-Summer-of-Code
  >
  > Many thanks,
  > John Woods
  >
  > Director, SciRuby Project
  > National Science Foundation Fellow | The Marcotte Lab
  > The University of Texas at Austin
  >
  _______________________________________________
  BioRuby Project - http://www.bioruby.org/
  BioRuby mailing list
  BioRuby at lists.open-bio.org
  http://lists.open-bio.org/mailman/listinfo/bioruby
    


From bonnalraoul at ingm.it  Fri Mar 11 02:41:02 2011
From: bonnalraoul at ingm.it (Raoul Bonnal)
Date: Fri, 11 Mar 2011 03:41:02 +0100
Subject: [BioRuby] =?iso-8859-1?q?BioRuby_GSoC_2011_ideas=3F?=
In-Reply-To: <20110310082433.GA18827@thebird.nl>
Message-ID: <20110311024102.27cd865e@mail.ingm.it>

Dear All,
I've  added proposals to our wiki page 
  http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Proposal_2011
with these titles:


* 3.1 Proposal 2011  

* 3.1.1 Support Next Generation Sequencing (NGS) in BioRuby
* 3.1.2 BioRuby Wrapper for Command line application
* 3.1.3 Represent bio-objects and related information with images
* 3.1.4 Modular annotation knowledge base for BioRuby
  
I've also update the OBF wiki page linking these proposal, 
http://www.open-bio.org/wiki/Google_Summer_of_Code#Mentors_and_Project_Ideas

As usual we have to refine many things but I hope it helped.

See you in few hours ^_^

Any modification/contribute is very appreciated.


Notes:
1) I forgot to mention the semantic web SPARQL...., please add it if you are going to support it.
2) I reduced the lims part because was too complicated probably and for NGS I did subproposal but I don't know if that is the right formant.
3) For those not cited as mentor, don't hesitate to add yourself to the list, I'm just tired.
4) I think old projects could be resubmitted, please Goto-san evaluate this possibility too.

--
Ra


From francesco.strozzi at gmail.com  Fri Mar 11 07:10:43 2011
From: francesco.strozzi at gmail.com (Francesco Strozzi)
Date: Fri, 11 Mar 2011 08:10:43 +0100
Subject: [BioRuby] BioRuby GSoC 2011 ideas?
In-Reply-To: <20110311024102.27cd865e@mail.ingm.it>
References: <20110310082433.GA18827@thebird.nl>
	<20110311024102.27cd865e@mail.ingm.it>
Message-ID: <AANLkTin8r-RFieZoHgHMJd-mOFPP3hoohG4vp3zY_Qa6@mail.gmail.com>

First of all I hope everybody in Japan are fine. Just saw right now the
breaking news about the big earthquake that hit Tokyo...

Raoul,
many thanks for the work you have done (this night), I'm reading the
proposals and making small changes....

Francesco

On Fri, Mar 11, 2011 at 03:41, Raoul Bonnal <bonnalraoul at ingm.it> wrote:

> Dear All,
> I've  added proposals to our wiki page
>  http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Proposal_2011
> with these titles:
>
>
> * 3.1 Proposal 2011
>
> * 3.1.1 Support Next Generation Sequencing (NGS) in BioRuby
> * 3.1.2 BioRuby Wrapper for Command line application
> * 3.1.3 Represent bio-objects and related information with images
> * 3.1.4 Modular annotation knowledge base for BioRuby
>
> I've also update the OBF wiki page linking these proposal,
>
> http://www.open-bio.org/wiki/Google_Summer_of_Code#Mentors_and_Project_Ideas
>
> As usual we have to refine many things but I hope it helped.
>
> See you in few hours ^_^
>
> Any modification/contribute is very appreciated.
>
>
> Notes:
> 1) I forgot to mention the semantic web SPARQL...., please add it if you
> are going to support it.
> 2) I reduced the lims part because was too complicated probably and for NGS
> I did subproposal but I don't know if that is the right formant.
> 3) For those not cited as mentor, don't hesitate to add yourself to the
> list, I'm just tired.
> 4) I think old projects could be resubmitted, please Goto-san evaluate this
> possibility too.
>
> --
> Ra
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>



-- 

Francesco


From cmzmasek at yahoo.com  Fri Mar 11 07:19:47 2011
From: cmzmasek at yahoo.com (Christian Zmasek)
Date: Thu, 10 Mar 2011 23:19:47 -0800 (PST)
Subject: [BioRuby] tsunami
Message-ID: <392600.43663.qm@web38401.mail.mud.yahoo.com>

Hi, all:

I am just seeing on TV that there was a large earthquake and the resulting 
tsuunami affecting the northern parts of Japan.
It seems that there are some damages in Odaiba, though.
I hope everybody is OK.

Christian


From ktym at hgc.jp  Fri Mar 11 07:26:28 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Fri, 11 Mar 2011 16:26:28 +0900
Subject: [BioRuby] tsunami
In-Reply-To: <392600.43663.qm@web38401.mail.mud.yahoo.com>
References: <392600.43663.qm@web38401.mail.mud.yahoo.com>
Message-ID: <BA3EA6BB-DE87-4B51-ADD6-D9DB8F0CFBC2@hgc.jp>

Hi Chris,

Thank you for your kind mail.
Fortunately, BioRuby developers (Mitsuteru, Naohisa and me) are fine.
I heard that our colleagues in DBCLS are safe (including Goran-san).
I'm also watching on TV. It looks really severe...

Thanks,
Toshiaki

On 2011/03/11, at 16:19, Christian Zmasek wrote:

> Hi, all:
> 
> I am just seeing on TV that there was a large earthquake and the resulting 
> tsuunami affecting the northern parts of Japan.
> It seems that there are some damages in Odaiba, though.
> I hope everybody is OK.
> 
> Christian
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby



From rutgeraldo at gmail.com  Fri Mar 11 09:33:01 2011
From: rutgeraldo at gmail.com (Rutger Vos)
Date: Fri, 11 Mar 2011 09:33:01 +0000
Subject: [BioRuby] tsunami
In-Reply-To: <BA3EA6BB-DE87-4B51-ADD6-D9DB8F0CFBC2@hgc.jp>
References: <392600.43663.qm@web38401.mail.mud.yahoo.com>
	<BA3EA6BB-DE87-4B51-ADD6-D9DB8F0CFBC2@hgc.jp>
Message-ID: <AANLkTimWtPjtwb3oMFmCUfC+JXD5m=TOuthRfi7qPa+t@mail.gmail.com>

All the best - my thoughts are with you all.

On Fri, Mar 11, 2011 at 7:26 AM, Toshiaki Katayama <ktym at hgc.jp> wrote:
> Hi Chris,
>
> Thank you for your kind mail.
> Fortunately, BioRuby developers (Mitsuteru, Naohisa and me) are fine.
> I heard that our colleagues in DBCLS are safe (including Goran-san).
> I'm also watching on TV. It looks really severe...
>
> Thanks,
> Toshiaki
>
> On 2011/03/11, at 16:19, Christian Zmasek wrote:
>
>> Hi, all:
>>
>> I am just seeing on TV that there was a large earthquake and the resulting
>> tsuunami affecting the northern parts of Japan.
>> It seems that there are some damages in Odaiba, though.
>> I hope everybody is OK.
>>
>> Christian
>> _______________________________________________
>> BioRuby Project - http://www.bioruby.org/
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
>
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>



-- 
Dr. Rutger A. Vos
School of Biological Sciences
Philip Lyle Building, Level 4
University of Reading
Reading
RG6 6BX
United Kingdom
Tel: +44 (0) 118 378 7535
http://www.nexml.org
http://rutgervos.blogspot.com


From francesco.strozzi at gmail.com  Fri Mar 11 09:44:37 2011
From: francesco.strozzi at gmail.com (Francesco Strozzi)
Date: Fri, 11 Mar 2011 10:44:37 +0100
Subject: [BioRuby] BioRuby GSoC 2011 ideas?
In-Reply-To: <AANLkTin8r-RFieZoHgHMJd-mOFPP3hoohG4vp3zY_Qa6@mail.gmail.com>
References: <20110310082433.GA18827@thebird.nl>
	<20110311024102.27cd865e@mail.ingm.it>
	<AANLkTin8r-RFieZoHgHMJd-mOFPP3hoohG4vp3zY_Qa6@mail.gmail.com>
Message-ID: <AANLkTinyjYfj4eby27eskUuQ0ShEB1+Gos47+BvnuOF3@mail.gmail.com>

Ok, made some changes with Raoul to the BioRuby proposals. We think this is
fine for us for now, if you have comments or want to change something let us
know...time is quite short.

Cheers
Francesco

On Fri, Mar 11, 2011 at 08:10, Francesco Strozzi <
francesco.strozzi at gmail.com> wrote:

> First of all I hope everybody in Japan are fine. Just saw right now the
> breaking news about the big earthquake that hit Tokyo...
>
> Raoul,
> many thanks for the work you have done (this night), I'm reading the
> proposals and making small changes....
>
> Francesco
>
>
> On Fri, Mar 11, 2011 at 03:41, Raoul Bonnal <bonnalraoul at ingm.it> wrote:
>
>> Dear All,
>> I've  added proposals to our wiki page
>>  http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Proposal_2011
>> with these titles:
>>
>>
>> * 3.1 Proposal 2011
>>
>> * 3.1.1 Support Next Generation Sequencing (NGS) in BioRuby
>> * 3.1.2 BioRuby Wrapper for Command line application
>> * 3.1.3 Represent bio-objects and related information with images
>> * 3.1.4 Modular annotation knowledge base for BioRuby
>>
>> I've also update the OBF wiki page linking these proposal,
>>
>> http://www.open-bio.org/wiki/Google_Summer_of_Code#Mentors_and_Project_Ideas
>>
>> As usual we have to refine many things but I hope it helped.
>>
>> See you in few hours ^_^
>>
>> Any modification/contribute is very appreciated.
>>
>>
>> Notes:
>> 1) I forgot to mention the semantic web SPARQL...., please add it if you
>> are going to support it.
>> 2) I reduced the lims part because was too complicated probably and for
>> NGS I did subproposal but I don't know if that is the right formant.
>> 3) For those not cited as mentor, don't hesitate to add yourself to the
>> list, I'm just tired.
>> 4) I think old projects could be resubmitted, please Goto-san evaluate
>> this possibility too.
>>
>> --
>> Ra
>> _______________________________________________
>> BioRuby Project - http://www.bioruby.org/
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
>>
>
>
>
> --
>
> Francesco
>
>


-- 

Francesco


From cmzmasek at yahoo.com  Fri Mar 11 11:52:15 2011
From: cmzmasek at yahoo.com (Christian Zmasek)
Date: Fri, 11 Mar 2011 03:52:15 -0800 (PST)
Subject: [BioRuby] BioRuby forester GSoC project
Message-ID: <640657.71672.qm@web38406.mail.mud.yahoo.com>

Hi,

To those interested, please have a look at:
http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2011#BioRuby_forester


Comments? Suggestions? Corrections?

Also, this project needs at least two co-mentors from BioRuby community.

Anybody interested?

Chris


From rutgeraldo at gmail.com  Fri Mar 11 11:58:45 2011
From: rutgeraldo at gmail.com (Rutger Vos)
Date: Fri, 11 Mar 2011 11:58:45 +0000
Subject: [BioRuby] BioRuby forester GSoC project
In-Reply-To: <640657.71672.qm@web38406.mail.mud.yahoo.com>
References: <640657.71672.qm@web38406.mail.mud.yahoo.com>
Message-ID: <AANLkTimt=NEf7n=ZfH9Ga+SARWcYd0kt7yn=BQ9q1RO+@mail.gmail.com>

Hi Chris,

I think this looks like a great project (I was just looking at it
apparently before you hit submit, because it looks more polished now).
The only thing I don't understand - but that's just me being a newbie
- is whether or not there might be problems depending on where objects
that are passed into forrester come from. I.e. could any subclass of
Bio::Tree be passed into that? Is it simply a matter of following the
advertised "interfaces" (sorry, that's java-esque) or are there other
things to take into account. Other than that, this would be a very
cool advance if this became possible.

Cheers,

Rutger

On Fri, Mar 11, 2011 at 11:52 AM, Christian Zmasek <cmzmasek at yahoo.com> wrote:
> Hi,
>
> To those interested, please have a look at:
> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2011#BioRuby_forester
>
>
> Comments? Suggestions? Corrections?
>
> Also, this project needs at least two co-mentors from BioRuby community.
>
> Anybody interested?
>
> Chris
>



-- 
Dr. Rutger A. Vos
School of Biological Sciences
Philip Lyle Building, Level 4
University of Reading
Reading
RG6 6BX
United Kingdom
Tel: +44 (0) 118 378 7535
http://www.nexml.org
http://rutgervos.blogspot.com


From pjotr.public14 at thebird.nl  Fri Mar 11 13:27:02 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Fri, 11 Mar 2011 14:27:02 +0100
Subject: [BioRuby] BioRuby forester GSoC project
In-Reply-To: <640657.71672.qm@web38406.mail.mud.yahoo.com>
References: <640657.71672.qm@web38406.mail.mud.yahoo.com>
Message-ID: <20110311132702.GB25440@thebird.nl>

Looks good Chris

On Fri, Mar 11, 2011 at 03:52:15AM -0800, Christian Zmasek wrote:
> Hi,
> 
> To those interested, please have a look at:
> http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2011#BioRuby_forester
> 
> 
> Comments? Suggestions? Corrections?
> 
> Also, this project needs at least two co-mentors from BioRuby community.
> 
> Anybody interested?
> 
> Chris
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
> 


From cmzmasek at yahoo.com  Fri Mar 11 21:35:14 2011
From: cmzmasek at yahoo.com (Christian Zmasek)
Date: Fri, 11 Mar 2011 13:35:14 -0800 (PST)
Subject: [BioRuby] BioRuby GSoC 2011 ideas?
In-Reply-To: <AANLkTinyjYfj4eby27eskUuQ0ShEB1+Gos47+BvnuOF3@mail.gmail.com>
References: <20110310082433.GA18827@thebird.nl>
	<20110311024102.27cd865e@mail.ingm.it>
	<AANLkTin8r-RFieZoHgHMJd-mOFPP3hoohG4vp3zY_Qa6@mail.gmail.com>
	<AANLkTinyjYfj4eby27eskUuQ0ShEB1+Gos47+BvnuOF3@mail.gmail.com>
Message-ID: <214609.20340.qm@web38404.mail.mud.yahoo.com>

Hi, Francesco and Raoul:

I looked at your proposals and made some minor changes in hope to make them more 
clear.

In the NGS proposal, what do you mean with "and due the high number of unknown 
data generated"?

Also, you now have four projects, all of which have Raoul as the (apparent) 
primary mentor.
I wonder if this could a problem.

Chris





----- Original Message ----
> From: Francesco Strozzi <francesco.strozzi at gmail.com>
> To: Raoul Bonnal <bonnalraoul at ingm.it>
> Cc: BioRuby ML <bioruby at lists.open-bio.org>
> Sent: Fri, March 11, 2011 1:44:37 AM
> Subject: Re: [BioRuby] BioRuby GSoC 2011 ideas?
> 
> Ok, made some changes with Raoul to the BioRuby proposals. We think this  is
> fine for us for now, if you have comments or want to change something let  us
> know...time is quite short.
> 
> Cheers
> Francesco
> 
> On Fri, Mar  11, 2011 at 08:10, Francesco Strozzi <
> francesco.strozzi at gmail.com>  wrote:
> 
> > First of all I hope everybody in Japan are fine. Just saw  right now the
> > breaking news about the big earthquake that hit  Tokyo...
> >
> > Raoul,
> > many thanks for the work you have done  (this night), I'm reading the
> > proposals and making small  changes....
> >
> > Francesco
> >
> >
> > On Fri, Mar 11,  2011 at 03:41, Raoul Bonnal <bonnalraoul at ingm.it>  wrote:
> >
> >> Dear All,
> >> I've  added proposals to  our wiki page
> >>   http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Proposal_2011
> >>  with these titles:
> >>
> >>
> >> * 3.1 Proposal  2011
> >>
> >> * 3.1.1 Support Next Generation Sequencing (NGS) in  BioRuby
> >> * 3.1.2 BioRuby Wrapper for Command line  application
> >> * 3.1.3 Represent bio-objects and related information  with images
> >> * 3.1.4 Modular annotation knowledge base for  BioRuby
> >>
> >> I've also update the OBF wiki page linking these  proposal,
> >>
> >>  
>http://www.open-bio.org/wiki/Google_Summer_of_Code#Mentors_and_Project_Ideas
> >>
> >>  As usual we have to refine many things but I hope it  helped.
> >>
> >> See you in few hours ^_^
> >>
> >>  Any modification/contribute is very  appreciated.
> >>
> >>
> >> Notes:
> >> 1) I forgot  to mention the semantic web SPARQL...., please add it if you
> >> are  going to support it.
> >> 2) I reduced the lims part because was too  complicated probably and for
> >> NGS I did subproposal but I don't know  if that is the right formant.
> >> 3) For those not cited as mentor,  don't hesitate to add yourself to the
> >> list, I'm just  tired.
> >> 4) I think old projects could be resubmitted, please Goto-san  evaluate
> >> this possibility too.
> >>
> >>  --
> >> Ra
> >>  _______________________________________________
> >> BioRuby Project -  http://www.bioruby.org/
> >> BioRuby mailing list
> >> BioRuby at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioruby
> >>
> >
> >
> >
> > ; --
> >
> > Francesco
> >
> >
> 
> 
> -- 
> 
> Francesco
> _______________________________________________
> BioRuby  Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
> 


From bonnalraoul at ingm.it  Sat Mar 12 00:54:48 2011
From: bonnalraoul at ingm.it (Raoul Bonnal)
Date: Sat, 12 Mar 2011 01:54:48 +0100
Subject: [BioRuby] =?iso-8859-1?q?BioRuby_GSoC_2011_ideas=3F?=
In-Reply-To: <214609.20340.qm@web38404.mail.mud.yahoo.com>
Message-ID: <20110312005448.2fa997a1@mail.ingm.it>

Dear Chris,
sorry I was away, and now is quite late in the night.
  _____  

From: Christian Zmasek [mailto:cmzmasek at yahoo.com]
To: Francesco Strozzi [mailto:francesco.strozzi at gmail.com], Raoul Bonnal [mailto:bonnalraoul at ingm.it]
Cc: bioruby at lists.open-bio.org
Sent: Fri, 11 Mar 2011 22:35:14 +0100
Subject: Re: BioRuby GSoC 2011 ideas?

Hi, Francesco and Raoul:
  
  I looked at your proposals and made some minor changes in hope to make them more 
  clear.Thanks
  
  In the NGS proposal, what do you mean with "and due the high number of unknown 
  data generated"?
  
  Also, you now have four projects, all of which have Raoul as the (apparent) 
  primary mentor.
  I wonder if this could a problem.Hope no...Last night I put me as first mentor just because I was writing and because were my ideas, It looked weird also to me.
If we can mix ourself for better chances is fine, no problem at all. But I supposed the time is over. Sorry guys, yesterday have been a long day for me too.

  
  Chris
  
  
  
  
  
  ----- Original Message ----
  > From: Francesco Strozzi <francesco.strozzi at gmail.com>
  > To: Raoul Bonnal <bonnalraoul at ingm.it>
  > Cc: BioRuby ML <bioruby at lists.open-bio.org>
  > Sent: Fri, March 11, 2011 1:44:37 AM
  > Subject: Re: [BioRuby] BioRuby GSoC 2011 ideas?
  > 
  > Ok, made some changes with Raoul to the BioRuby proposals. We think this  is
  > fine for us for now, if you have comments or want to change something let  us
  > know...time is quite short.
  > 
  > Cheers
  > Francesco
  > 
  > On Fri, Mar  11, 2011 at 08:10, Francesco Strozzi <
  > francesco.strozzi at gmail.com>  wrote:
  > 
  > > First of all I hope everybody in Japan are fine. Just saw  right now the
  > > breaking news about the big earthquake that hit  Tokyo...
  > >
  > > Raoul,
  > > many thanks for the work you have done  (this night), I'm reading the
  > > proposals and making small  changes....
  > >
  > > Francesco
  > >
  > >
  > > On Fri, Mar 11,  2011 at 03:41, Raoul Bonnal <bonnalraoul at ingm.it>  wrote:
  > >
  > >> Dear All,
  > >> I've  added proposals to  our wiki page
  > >>   http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Proposal_2011
  > >>  with these titles:
  > >>
  > >>
  > >> * 3.1 Proposal  2011
  > >>
  > >> * 3.1.1 Support Next Generation Sequencing (NGS) in  BioRuby
  > >> * 3.1.2 BioRuby Wrapper for Command line  application
  > >> * 3.1.3 Represent bio-objects and related information  with images
  > >> * 3.1.4 Modular annotation knowledge base for  BioRuby
  > >>
  > >> I've also update the OBF wiki page linking these  proposal,
  > >>
  > >>  
  >http://www.open-bio.org/wiki/Google_Summer_of_Code#Mentors_and_Project_Ideas
  > >>
  > >>  As usual we have to refine many things but I hope it  helped.
  > >>
  > >> See you in few hours ^_^
  > >>
  > >>  Any modification/contribute is very  appreciated.
  > >>
  > >>
  > >> Notes:
  > >> 1) I forgot  to mention the semantic web SPARQL...., please add it if you
  > >> are  going to support it.
  > >> 2) I reduced the lims part because was too  complicated probably and for
  > >> NGS I did subproposal but I don't know  if that is the right formant.
  > >> 3) For those not cited as mentor,  don't hesitate to add yourself to the
  > >> list, I'm just  tired.
  > >> 4) I think old projects could be resubmitted, please Goto-san  evaluate
  > >> this possibility too.
  > >>
  > >>  --
  > >> Ra
  > >>  _______________________________________________
  > >> BioRuby Project -  http://www.bioruby.org/
  > >> BioRuby mailing list
  > >> BioRuby at lists.open-bio.org
  > >> http://lists.open-bio.org/mailman/listinfo/bioruby
  > >>
  > >
  > >
  > >
  > > ; --
  > >
  > > Francesco
  > >
  > >
  > 
  > 
  > -- 
  > 
  > Francesco
  > _______________________________________________
  > BioRuby  Project - http://www.bioruby.org/
  > BioRuby mailing list
  > BioRuby at lists.open-bio.org
  > http://lists.open-bio.org/mailman/listinfo/bioruby
  > 
    


From rutgeraldo at gmail.com  Mon Mar 14 13:47:01 2011
From: rutgeraldo at gmail.com (Rutger Vos)
Date: Mon, 14 Mar 2011 13:47:01 +0000
Subject: [BioRuby] Fwd: Reminder: deadline ievobio @ Fri Mar 18,
	2011 (Rutger Vos)
In-Reply-To: <0015174763185c34ab049e4c15f5@google.com>
References: <0015174763185c34ab049e4c15f5@google.com>
Message-ID: <AANLkTi=i8q-AHxeYYtRB3e5S_2zeog_AdCZLnH_6bLUc@mail.gmail.com>

---------- Forwarded message ----------
From: Google Calendar <calendar-notification at google.com>
Date: Sat, Mar 12, 2011 at 5:05 PM
Subject: Reminder: deadline ievobio @ Fri Mar 18, 2011 (Rutger Vos)
To: Rutger Vos <rutgeraldo at gmail.com>


more details ?<https://www.google.com/calendar/event?action=VIEW&eid=N2hhbzJlczNjY2cyNDJuMHVxZzM5dG9rN2cgcnV0Z2VyYWxkb0Bt&tok=MjAjcnV0Z2VyYWxkb0BnbWFpbC5jb21mMDFlMTZhMWRiYWM0YmI1MmM0MWZmODY4OTJiNDdmMzEzYzZmYmE3&ctz=Europe%2FLondon&hl=en>
deadline ievobio
The Call for Abstracts for full talks is now open for the 2011
conference on Informatics for Phylogenetics, Evolution, and
Biodiversity (iEvoBio), at
http://ievobio.org/ocs/index.php/ievobio/2011<http://www.google.com/url?q=http%3A%2F%2Fievobio.org%2Focs%2Findex.php%2Fievobio%2F2011&usd=2&usg=AFQjCNFZGQoslfCZQYgSiwMP06MbXWh-SQ>.
See below for
instructions.

Accepted talks will be about 15-20 minutes in length and will be
presented during the full talk sessions in the morning of each of the
two conference days, following the day's keynote presentation.

Submitted talks should be in the area of informatics aimed at
advancing research in phylogenetics, evolution, and biodiversity,
including new tools, cyberinfrastructure development, large-scale data
analysis, and visualization.

Submissions consist of a title and an abstract at most 1 page long.
The abstract should provide an overview of the talk's subject. As the
number of program slots for full talks is limited, the abstract should
give enough detail so reviewers can decide whether the submission
merits a full talk or whether it should be moved to one of the
Lightning Talk sessions. If the subject of the talk is a specific
software component for use by the research community, the abstract
must state the license and give the URL where the source code is
available so reviewers can verify that the open-source requirement(*)
is met.

The deadline for submission is March 18, 2011. We intend to notify
authors of accepted talks before early registration for iEvoBio (and
Evolution) ends. Further instructions for submission are at the
following URL:

http://ievobio.org/ocs/index.php/ievobio/2011/schedConf/cfp<http://www.google.com/url?q=http%3A%2F%2Fievobio.org%2Focs%2Findex.php%2Fievobio%2F2011%2FschedConf%2Fcfp&usd=2&usg=AFQjCNG7VXo3RDOBRllz0TiKqiQMvcY4lw>

Full talks are 1 of 5 kinds of contributed content that iEvoBio will
feature. The other 4 are: 1) Lightning talks (5 mins long), 2)
Challenge entries, 3) Software bazaar demonstrations, and 4) Birds-of-
a-Feather gatherings. The Call for Challenge entries is already open
(see http://ievobio.org/challenge.html<http://www.google.com/url?q=http%3A%2F%2Fievobio.org%2Fchallenge.html&usd=2&usg=AFQjCNGQqx6QuPTXhi4JmKWe3v7IzP8ngw>).
The calls for contribution to
the other 3 sessions will open later, and will remain open until
shortly before the conference or until the respective track fills up.

More details about the program and guidelines for contributing content
are available at
http://ievobio.org<http://www.google.com/url?q=http%3A%2F%2Fievobio.org&usd=2&usg=AFQjCNGuGGRgD7Y66tr9YUHcOVpxhmsgKw>.
You can also find continuous
updates on the conference's Twitter feed at
http://twitter.com/<http://www.google.com/url?q=http%3A%2F%2Ftwitter.com%2F&usd=2&usg=AFQjCNFrw0bIBFXMJOynirJL5Eyikc0YuA>
iEvoBio , or subscribe to the low-traffic iEvoBio announcements
mailing list at http://groups.google.com/group/ievobio-announce

iEvoBio is sponsored by the US National Evolutionary Synthesis Center
(NESCent) in partnership with the Society for the Study of Ecolution
(SSE) and the Society of Systematic Biologists (SSB). Additional
support has been provided by the Encyclopedia of Life (EOL).


The iEvoBio 2011 Organizing Committee:
Rob Guralnick (University of Colorado at Boulder) (Co-chair)
Cynthia Parr (Encyclopedia of Life) (Co-chair)
Dawn Field (UK National Environmental Research Center)
Mark Holder (University of Kansas)
Hilmar Lapp (NESCent)
Rod Page (University of Glasgow)

(*) iEvoBio and its sponsors are dedicated to promoting the practice
and philosophy of Open Source software development (see
http://www.opensource.org/docs/definition.php<http://www.google.com/url?q=http%3A%2F%2Fwww.opensource.org%2Fdocs%2Fdefinition.php&usd=2&usg=AFQjCNEQcWgwBoO0kepsI4YHIpT7ADgy9Q>
)
and reuse within the research community. For this reason, if a
submitted talk concerns a specific software system for use by the
research community, that software must be licensed with a recognized
Open Source License (see
http://www.opensource.org/licenses/<http://www.google.com/url?q=http%3A%2F%2Fwww.opensource.org%2Flicenses%2F&usd=2&usg=AFQjCNFvM-2dvS0ruUQBpdGyvnFxG0MA5g>),
and be
available for download, including source code, by a tar/zip file
accessed through ftp/http or through a widely used version control
system like cvs, Subversion, git, Bazaar, or Mercurial. Authors of
full talks who cannot meet this requirement at the time of submission
should state their intentions, and are advised that the requirement
must be met by June 19, 2011, at the latest.

*When*
Fri Mar 18, 2011
*Calendar*
Rutger Vos
*Who*
?
Rutger Vos - organizer

Invitation from Google Calendar <https://www.google.com/calendar/>

You are receiving this email at the account rutgeraldo at gmail.com because you
set a reminder for this event on the calendar Rutger Vos.

You can change your reminders for specific events in the event details page
in https://www.google.com/calendar/.



-- 
Dr. Rutger A. Vos
School of Biological Sciences
Philip Lyle Building, Level 4
University of Reading
Reading
RG6 6BX
United Kingdom
Tel: +44 (0) 118 378 7535
http://www.nexml.org
http://rutgervos.blogspot.com



From cjfields at illinois.edu  Wed Mar 16 17:58:23 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 16 Mar 2011 12:58:23 -0500
Subject: [BioRuby] [ANNOUNCEMENT] Bugzilla to Redmine migration
Message-ID: <34C8C0CB-9273-468E-86D7-74B22464F181@illinois.edu>

(apologies if you receive multiple copies of this)

All,

We are currently about 95% done with a transition over to our new Redmine tracking system, to the point where we feel comfortable in going ahead with opening it to developers:

http://redmine.open-bio.org/

All edits to bugzilla reports on our old system (http://bugzilla.open-bio.org/) are now disabled and the system is now read-only.  Any new bugs and comments to old ones should be reported on the new Redmine server.

For current Bugzilla users, we have migrated login IDs to Redmine (this is normally an email address), but we have reset user passwords for security reasons.  There are two ways to access your account:

1) When logging in (http://redmine.open-bio.org/login), click on the 'Lost password' link.  You will be prompted for your email address (this should be the same as your bugzilla login).  An new email will be sent out containing directions for resetting your password and logging in.

2) It is possible the above may be automatically detected as spam.  If the above doesn't work or the reset email isn't received within a day, contact support at helpdesk.open-bio.org to receive your new password.

Also, note that Redmine has a different syntax for those who want to add links to their reports; see http://www.redmine.org/projects/redmine/wiki/RedmineTextFormatting.

Let us know if you have any questions.  

chris

Christopher Fields
IGB Postdoctoral Fellow
Genomics of Neural & Behavioral Plasticity
University of Illinois Urbana-Champaign
Institute for Genomic Biology
1206 W. Gregory Dr. , MC-195
Urbana, IL 61801


From mail at michaelbarton.me.uk  Wed Mar 16 21:12:01 2011
From: mail at michaelbarton.me.uk (Michael Barton)
Date: Wed, 16 Mar 2011 17:12:01 -0400
Subject: [BioRuby] Remote blast not working?
Message-ID: <20110316211201.GA2640@nku069218.hh.nku.edu>

Hi,

I'm struggling to use the remote blast part of bioruby. I get errors using
either the ddbj or genomenet versions. With genomenet I get an error about
a nil response and with genomenet I get an error for 'cannot understand
response'. I've tried different combinations of databases and options but keep
getting the same problems.

Bio::Blast::Remote.ddbj('blastp', 'nr-aa', '-e 0.001')

Can anyone offer any suggestions?

Cheers

Mike

From rutgeraldo at gmail.com  Wed Mar 16 21:40:08 2011
From: rutgeraldo at gmail.com (Rutger Vos)
Date: Wed, 16 Mar 2011 21:40:08 +0000
Subject: [BioRuby] Remote blast not working?
In-Reply-To: <20110316211201.GA2640@nku069218.hh.nku.edu>
References: <20110316211201.GA2640@nku069218.hh.nku.edu>
Message-ID: <AANLkTin2N5YeHoVyOqfUSkqNCMapAWJ12BsT2CjqDDXc@mail.gmail.com>

DDBJ is offline due to the earthquake

On Wednesday, March 16, 2011, Michael Barton <mail at michaelbarton.me.uk> wrote:
> Hi,
>
> I'm struggling to use the remote blast part of bioruby. I get errors using
> either the ddbj or genomenet versions. With genomenet I get an error about
> a nil response and with genomenet I get an error for 'cannot understand
> response'. I've tried different combinations of databases and options but keep
> getting the same problems.
>
> Bio::Blast::Remote.ddbj('blastp', 'nr-aa', '-e 0.001')
>
> Can anyone offer any suggestions?
>
> Cheers
>
> Mike
>

-- 
Dr. Rutger A. Vos
School of Biological Sciences
Philip Lyle Building, Level 4
University of Reading
Reading
RG6 6BX
United Kingdom
Tel: +44 (0) 118 378 7535
http://www.nexml.org
http://rutgervos.blogspot.com


From tomoakin at kenroku.kanazawa-u.ac.jp  Thu Mar 17 00:35:24 2011
From: tomoakin at kenroku.kanazawa-u.ac.jp (Tomoaki NISHIYAMA)
Date: Thu, 17 Mar 2011 09:35:24 +0900
Subject: [BioRuby] DDBJ services suspension schedule
In-Reply-To: <AANLkTin2N5YeHoVyOqfUSkqNCMapAWJ12BsT2CjqDDXc@mail.gmail.com>
References: <20110316211201.GA2640@nku069218.hh.nku.edu>
	<AANLkTin2N5YeHoVyOqfUSkqNCMapAWJ12BsT2CjqDDXc@mail.gmail.com>
Message-ID: <7576BC8A-F079-465B-882F-7A88CA73BADC@kenroku.kanazawa-u.ac.jp>

Hi

> DDBJ is offline due to the earthquake


That's right.

The announcement by DDBJ/NIG can be found at
http://www.ddbj.nig.ac.jp/whatsnew/2011/110314-e.html#today
http://www.evernote.com/pub/ddbj/topics#v=t&n=def64d51-08b0-4f54-a27b- 
f2701b74a77a&b=0

Essentially its due to electricity shortage in Eastern Honshu Island  
caused by the earthquake on March 11.
Many power stations are stopped, not only the Fukushima nuclear power  
plant.
There are many more internet services that are suspended due to the  
same reason
and not by any problem in the computers.

Sincerely
-- 
Tomoaki NISHIYAMA

Advanced Science Research Center,
Kanazawa University,
13-1 Takara-machi,
Kanazawa, 920-0934, Japan



From ktym at hgc.jp  Thu Mar 17 01:28:21 2011
From: ktym at hgc.jp (Toshiaki Katayama)
Date: Thu, 17 Mar 2011 10:28:21 +0900
Subject: [BioRuby] Remote blast not working?
In-Reply-To: <20110316211201.GA2640@nku069218.hh.nku.edu>
References: <20110316211201.GA2640@nku069218.hh.nku.edu>
Message-ID: <540CCF1E-2F3B-441A-9C44-2F36BB7D2035@hgc.jp>

As for the GenomeNet part, it is already fixed but not yet released.

https://github.com/bioruby/bioruby/blob/master/lib/bio/appl/blast/genomenet.rb#L241

You can replace your installation with the above file for quick fix.

Thanks,
Toshiaki

On 2011/03/17, at 6:12, Michael Barton wrote:

> Hi,
> 
> I'm struggling to use the remote blast part of bioruby. I get errors using
> either the ddbj or genomenet versions. With genomenet I get an error about
> a nil response and with genomenet I get an error for 'cannot understand
> response'. I've tried different combinations of databases and options but keep
> getting the same problems.
> 
> Bio::Blast::Remote.ddbj('blastp', 'nr-aa', '-e 0.001')
> 
> Can anyone offer any suggestions?
> 
> Cheers
> 
> Mike
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby




From rutgeraldo at gmail.com  Fri Mar 18 14:16:25 2011
From: rutgeraldo at gmail.com (Rutger Vos)
Date: Fri, 18 Mar 2011 14:16:25 +0000
Subject: [BioRuby] Please forward: collecting support for Japanese scientists
Message-ID: <AANLkTiksWdna1MLpbBWk2nDv0LAyrXdU7xV3Fs5gSHkF@mail.gmail.com>

Dear colleagues,

A web page has been launched to collect support for Japanese
(bio-)scientists: http://biohelpathon.org - please forward this
address widely.

The purpose of the web page is to establish a knowledge base of
available support for our colleagues in Japan. You are invited to
submit any tips, ideas and offers including accommodation, funding
resources, exchange schemes, lab space, server space and open
positions for visiting students and research personnel from Japan.

We will collect your suggestions and offers and will share them with
whoever is best placed to disseminate them. This initiative originates
with the attendees of the BioHackathons (the Japanese website
http://hackathon.dbcls.jp is offline due to the earthquake), but
anyone is very welcome to contribute. To get in touch, join
http://groups.google.com/group/biohelpathon.

This initiative is no alternative to first responders who are helping
out in Japan right now. The rescue operation and food and shelter
support comes first. If you can only do one thing, it should be a
donation to something like the Red Cross. This comes later.

See also:
A different initiative, with which we're in touch:
http://www.nipponsciencesupport.net/
More info on Nature blogs:
http://blogs.nature.com/news/thegreatbeyond/2011/03/helping_hand_for_scientistrefu.html

PLEASE NOTE: WE ARE NOT HANDLING MONEY. This is simply a way to
crowdsource information about available resources.

Thank you.

Rutger Vos


From pjotr.public14 at thebird.nl  Sun Mar 20 08:51:39 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Sun, 20 Mar 2011 09:51:39 +0100
Subject: [BioRuby] More plugins
Message-ID: <20110320085139.GA12111@thebird.nl>

The rbib gem is a bibtex parser by Nick Gasson. I think it could be a
bioruby vetted plugin. See

  https://rubygems.org/gems/rbib

Pj.


From mail at michaelbarton.me.uk  Sun Mar 20 20:56:51 2011
From: mail at michaelbarton.me.uk (Michael Barton)
Date: Sun, 20 Mar 2011 16:56:51 -0400
Subject: [BioRuby] Remote blast not working?
In-Reply-To: <540CCF1E-2F3B-441A-9C44-2F36BB7D2035@hgc.jp>
References: <20110316211201.GA2640@nku069218.hh.nku.edu>
	<540CCF1E-2F3B-441A-9C44-2F36BB7D2035@hgc.jp>
Message-ID: <20110320205651.GE3954@Michael-Bartons-MacBook.local>

Hi Toshiaki,

Thank you for the patch. That worked perfectly. I sometimes get unusual parsing
errors which I think are originating from raxml. Has anyone else experienced
something similar?

Cheers

Mike

On Thu, Mar 17, 2011 at 10:28:21AM +0900, Toshiaki Katayama wrote:
> As for the GenomeNet part, it is already fixed but not yet released.
> 
> https://github.com/bioruby/bioruby/blob/master/lib/bio/appl/blast/genomenet.rb#L241
> 
> You can replace your installation with the above file for quick fix.
> 
> Thanks,
> Toshiaki
> 
> On 2011/03/17, at 6:12, Michael Barton wrote:
> 
> > Hi,
> > 
> > I'm struggling to use the remote blast part of bioruby. I get errors using
> > either the ddbj or genomenet versions. With genomenet I get an error about
> > a nil response and with genomenet I get an error for 'cannot understand
> > response'. I've tried different combinations of databases and options but keep
> > getting the same problems.
> > 
> > Bio::Blast::Remote.ddbj('blastp', 'nr-aa', '-e 0.001')
> > 
> > Can anyone offer any suggestions?
> > 
> > Cheers
> > 
> > Mike
> > _______________________________________________
> > BioRuby Project - http://www.bioruby.org/
> > BioRuby mailing list
> > BioRuby at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioruby
> 

From pjotr.public14 at thebird.nl  Thu Mar 24 09:48:07 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Thu, 24 Mar 2011 10:48:07 +0100
Subject: [BioRuby] Migrating to Ruby 1.9, the good, the bad and the ugly
Message-ID: <20110324094807.GA5697@thebird.nl>

Ruby had a major overhaul with the introduction of the 1.9 series. 
I wrote something tips for migrating from 1.8 to 1.9:

  http://blog.thebird.nl/

Tell me, if you have more.

Pj.


From mail at michaelbarton.me.uk  Thu Mar 24 15:00:38 2011
From: mail at michaelbarton.me.uk (Michael Barton)
Date: Thu, 24 Mar 2011 11:00:38 -0400
Subject: [BioRuby] Migrating to Ruby 1.9, the good, the bad and the ugly
In-Reply-To: <20110324094807.GA5697@thebird.nl>
References: <20110324094807.GA5697@thebird.nl>
Message-ID: <AANLkTikTZcxF334cO8CtVTj6RqCSxuFk1dmtdL7H7UDq@mail.gmail.com>

There's a blog post here which might also be of use -
http://www.igvita.com/2011/02/03/new-ruby-19-features-tips-tricks/

On 24 March 2011 05:48, Pjotr Prins <pjotr.public14 at thebird.nl> wrote:
> Ruby had a major overhaul with the introduction of the 1.9 series.
> I wrote something tips for migrating from 1.8 to 1.9:
>
> ?http://blog.thebird.nl/
>
> Tell me, if you have more.
>
> Pj.
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>



From pjotr.public14 at thebird.nl  Thu Mar 24 17:20:30 2011
From: pjotr.public14 at thebird.nl (Pjotr Prins)
Date: Thu, 24 Mar 2011 18:20:30 +0100
Subject: [BioRuby] Migrating to Ruby 1.9, the good, the bad and the ugly
In-Reply-To: <AANLkTikTZcxF334cO8CtVTj6RqCSxuFk1dmtdL7H7UDq@mail.gmail.com>
References: <20110324094807.GA5697@thebird.nl>
	<AANLkTikTZcxF334cO8CtVTj6RqCSxuFk1dmtdL7H7UDq@mail.gmail.com>
Message-ID: <20110324172030.GA10683@thebird.nl>

On Thu, Mar 24, 2011 at 11:00:38AM -0400, Michael Barton wrote:
> There's a blog post here which might also be of use -
> http://www.igvita.com/2011/02/03/new-ruby-19-features-tips-tricks/

Only problem, it fails to point out what fails silently ;)


From andrew.j.grimm at gmail.com  Thu Mar 24 22:29:33 2011
From: andrew.j.grimm at gmail.com (Andrew Grimm)
Date: Fri, 25 Mar 2011 09:29:33 +1100
Subject: [BioRuby] Migrating to Ruby 1.9, the good, the bad and the ugly
In-Reply-To: <20110324172030.GA10683@thebird.nl>
References: <20110324094807.GA5697@thebird.nl>
	<AANLkTikTZcxF334cO8CtVTj6RqCSxuFk1dmtdL7H7UDq@mail.gmail.com>
	<20110324172030.GA10683@thebird.nl>
Message-ID: <AANLkTikimPkNiZ1GRE-Jso7Sq_G+yPXam_b6_7uJLh8-@mail.gmail.com>

I've heard that One9 lists cases where you call a method that changes
between 1.8 and 1.9. https://github.com/cldwalker/one9

Andrew

On Fri, Mar 25, 2011 at 4:20 AM, Pjotr Prins <pjotr.public14 at thebird.nl> wrote:
> On Thu, Mar 24, 2011 at 11:00:38AM -0400, Michael Barton wrote:
>> There's a blog post here which might also be of use -
>> http://www.igvita.com/2011/02/03/new-ruby-19-features-tips-tricks/
>
> Only problem, it fails to point out what fails silently ;)
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>


From mikeco57 at gmail.com  Thu Mar 24 22:34:12 2011
From: mikeco57 at gmail.com (Michael O'Keefe)
Date: Thu, 24 Mar 2011 18:34:12 -0400
Subject: [BioRuby] BioRuby tutorial
Message-ID: <4D8BC6E4.5090001@gmail.com>

Hello everyone,

I've updated the tutorial located in the Git repository to add in some 
information that was missing and update the grammar. I created a pull 
request on bioruby/bioruby from my repository at 
https://github.com/okeefm/bioruby
The pull request is at: https://github.com/bioruby/bioruby/pull/32
Please feel free to comment on it; it's my first pull request for 
BioRuby, so I would like to know what I've done well/not well.

Thank you,
Michael O'Keefe
mikeco57 at gmail.com


From bonnal at ingm.org  Fri Mar 25 16:19:36 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Fri, 25 Mar 2011 17:19:36 +0100
Subject: [BioRuby] BioRuby & Google Summer of Code 2011
Message-ID: <E9EBB93A-697D-405F-AF3F-DB8F5DE22935@ingm.org>

Dear All,
our project, is looking for students to participate at GSoC 2011, thanks to OBF and NESCENT
Please feel free to forward this message to your university-ml, lab or local ruby group.

Use our ml to discuss ideas and feel free to contact the mentors or any other member for the development team.


March 18-27: Would-be student participants discuss application ideas with mentoring organizations.
March 28: Student application period opens.
April 8 19:00 UTC Student application deadline.
from: http://www.google-melange.com/document/show/gsoc_program/google/gsoc2011/timel


Our proposals
-links-
http://bioruby.open-bio.org/wiki/Google_Summer_of_Code#Proposal_2011
http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2011#BioRuby_forester

-text-
Proposal 2011

OBF
Support Next Generation Sequencing (NGS) in BioRuby

Rationale 
The processing and analyzing of NGS data is challenging for a variety of reasons, in particular due to the fact that the data-sets are usually very large and contain a vast amount of information and a high number of unknown data. Furthermore there are many different approaches to perform NGS analyses and several software tools need to be integrated to produce reliable results. Since this topic is so important for the BioRuby community we started a sub-project bioruby-ngs for analyzing NGS data. The project is in an early stage of development but notable results have been quickly gained. Many topics need to be still addressed, in particular:
data and results reporting
workflow management
DSL for describing experimental designs
YALIMS (Yet Another LIMS), a simple web based Lims for raw datasets processing, with reporting and monitoring
Approach 
Due to the open nature of the project the student will choose which feature he/she wants to develop and to focus on. The student will learn basic concept of NGS data analysis and will work tightly with a mentor to produce a working library that will be integrated into the BioRuby NGS project.
Difficulty and needed skills 
Medium to Hard depending on the topic selected.
The project requires
Ruby
Bash programming and knowledge of the Linux environment
Ruby on Rails 3.x
Mentors 
Raoul J.P. Bonnal, Francesco Strozzi
Project overview and updates 
[1]
Source code
https://github.com/helios/bioruby-ngs
BioRuby Wrapper for Command line application

Rationale 
The main reason for this project is the need to support different stand-alone applications critical for Next Generation Sequences analyses. Direct binding to existing C/C++ source code or rewriting all the applications is impractical and a waste of resources. A quick solution is to use stand-alone applications directly, integrating them into the BioRuby API. Some work has been already done in the BioRuby NGS project with this wrapper but a better support for demanding I/O processes is required. Following this design pattern will be possible to improve also the support for other bioinformatics suites, like EMBOSS, outdated in BioRuby at the time of this proposal.
Approach 
The student will familiarize with advanced meta-programming concepts in Ruby and will contribute to the definition of a DSL for this wrapping library. He/she will build also a parser to automatically define additional wrappers for the EMBOSS suites starting from the ACD configuration files.
Difficulty and needed skills 
Medium. Good Ruby knowledge and experience with meta-programming are required to achieve the goals.
The project requires
Ruby 1.9
Ruby Metaprogramming
Mentors 
Raoul J.P. Bonnal, Francesco Strozzi
Source code
https://github.com/helios/bioruby-ngs, wrapper branch
Represent bio-objects and related information with images

Rationale 
Most of the time, after a bioinformatics analysis, the resulting data needs to be re-processed into a graphical way since we, as human-beings, are more comfortable accessing results and data visually than browsing a huge table with interconnected information. Very often it is also difficult to extrapolate the real biological meaning from a raw datasets. The main idea of this proposal is to define and attach graphical functions to BioRuby objects and consequently to the results computed from a generic process or pipeline. With this solution, it would be possible to explore them more naturally but also to export and integrate the information into a web environment, for sharing the knowledge and the results. For example, different objects storing alignments results could share the same interface and display their data in a common way. The same is true also for other kind of objects or computational procedures.
Approach 
The student and the mentor will define together a minimum set of features that need to be shared by the BioRuby objects and that could be visualized. Then the student will create a library/module to implement these graphical features within the BioRuby project. He/she will gain experience with Rubyvis as the graphical API and with Ruby on Rails for web visualization.
Difficulty and needed skills 
Medium/Hard. The student will need to define a graphical API and integrate the new code with the existing BioRuby modules. High level coding skills will be required to create a clean API with a clear documentation.
The project requires
Very good knowledge of Ruby (1.9) and pattern design
Basic concepts of graphics/visualization
Ruby on Rails basic knowledge
Mentors 
Raoul J.P. Bonnal, Christian Zmasek, Claudio Bustos (confirm)


Modular annotation knowledge base for BioRuby

Rationale 
Handling data sets coming from platforms for gene expression analysis or real time PCR requires to access the corresponding gene annotations several times during the measurements. This kind of information is normally stored into remote databases that provide the required knowledge and data. Problems arise when the available databases do not support a specific version of the data of interest or when huge queries need to be submitted. A BioRuby knowledge base, designed to be modular and expandable through time, could solve these problems. A good compromise between performances and portability could be achieved using embedded databases and accessing the data through a clean API.
Approach 
The student and the mentor will explore which platforms should be supported by their popularity. Then the student will recover the essential annotation and will design a simple database schema to support all the relevant non-redundant information. The schema will be flexible enough to allow interconnecting the dataset with external databases or resources for subsequent analyses. After this phase of discovery and design, the student will build the database using SQLite and will write a Ruby library to access the data using ORM ActiveRecord
Difficulty and needed skills 
Medium. The student will need to define the core data to be included into the database and how this information will be organized and accessed by the end-user. The Ruby library will be created using the powerful ActiveRecord paradigms, but good coding skills will be required to design an efficient API with a clear documentation.
The project requires
Minimal SQL dialect
Good knowledge of Ruby
Experience in querying biological databases
Experience with annotation data
Mentors 
Raoul J.P. Bonnal, Francesco Strozzi
--------------


NESCENT

 BioRuby forester

Rationale 
Forester is a collection of software libraries, mostly written in Java, for comparative genomics and evolutionary biology research. A prominent example of a tool based on forester is the phylogenetic tree explorer Archaeopteryx. Most of forester's use-cases are associated with the use of evolutionary trees as tools for establishing (functional) relations between genes or proteins (for example protein function prediction with RIO) and comparing genome based features between different species. Therefore, it implements objects representing evolutionary trees overlaid with biological data from other sources (e.g. protein domain architectures), as well as algorithms operating on these, such as the automated inference of ancestral taxonomies on gene trees, which has proven useful in the functional interpretation of large gene trees.
Most of these methods are currently only accessible via the command-line or through the GUI of Archaeopteryx and therefore difficult or impossible to use from other computer programs or toolkits (such as BioRuby). Although forester is mostly written in Java, it also contains components in Ruby ("evoruby"). These implement operations on multiple sequence alignments (MSAs) that are crucial in the development of workflows for automated, large scale, phylogenetic inference, including I/O, and efficient MSA manipulation (such as deletion of all columns with a gap-portion larger than a given threshold, removal of short and/or redundant sequences).
Approach 
The goal would be to develop a framework for accessing forester's central algorithms and applications from within BioRuby. It is expected that this project will be implemented in form of a BioRuby plugin in order to avoid creating additional dependencies for the main BioRuby distribution. Full two-way access between the Java and Ruby languages can be accomplished by using JRuby as the underlaying platform.
Depending on the level of experience and skills of a student, a project proposal could also include either or both of the following additional goals.
BioRuby and the "evoruby" components of forester partially overlap in functionality. You could incorporate MSA management functionality present in "evoruby" but missing in BioRuby into the BioRuby distribution. This would not only make that functionality immediately accessible to all BioRuby users, but would also allow a larger community of developers to participate in maintentence and future development of these components.
Display gene conversions. This would entail developing a parser for GENECONV output and use the newly developed BioRuby-forester link to directly display gene conversions within Archaeopteryx.
Challenges
The student needs to learn two disparate toolkits, BioRuby and forester.
The project involves two programming languages, Ruby and Java.
Need to understand the BioRuby plugin system.
Involved toolkits or projects 
BioRuby
BioRuby plugin system
RubyGems
JRuby
forester
Degree of difficulty and needed skills 
Expected difficulty: Medium. Proficiency in at least one of the two involved programming languages, Ruby and Java, is necessary. Experience/interest in molecular evolution or comparative genomics is required, and experience with BioRuby or forester will help.
Mentors 
Christian Zmasek, Pjotr Prins, Raoul J.P. Bonnal




--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios








From bonnal at ingm.org  Fri Mar 25 17:06:31 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Fri, 25 Mar 2011 18:06:31 +0100
Subject: [BioRuby] FastQ and Quality Scores
Message-ID: <A7169C4B-A433-4666-B6BD-D9F1B2EDF5C0@ingm.org>

Dear All,
probably I don't know very much this part of the bioruby library (not yet). In this days I'm playing a bit with fastq data :-) and bioruby
today I was reading a fastq file coming from Illumina HiScanSQ:
r=Bio::FlatFile.auto("spec/fixture/test.fastq")

x=r.first
 => #<Bio::Fastq:0x00000100849b20 @definition="H125:1:1108:1147:2046#0/1", @sequence_string="CGGGAAATGGCGGAAATGTGCAAGGATGTTATATGAATTGTGTTGGTTGGCCTAAAACACAGAGCCGGCTTGAAGT", @definition2="", @quality_string="[XSZGXPSKPJPP]TWQRFRHXW\\WXXX]PUX[W_^R^[XRNRYV]^Y[]UUNRT]X_BBBBBBBBBBBBBBBBBB"> 

No format specified, but by default the format of the library is sanger:

x.quality_scores
 => [58, 55, 50, 57, 38, 55, 47, 50, 42, 47, 41, 47, 47, 60, 51, 54, 48, 49, 37, 49, 39, 55, 54, 59, 54, 55, 55, 55, 60, 47, 52, 55, 58, 54, 62, 61, 49, 61, 58, 55, 49, 45, 49, 56, 53, 60, 61, 56, 58, 60, 52, 52, 45, 49, 51, 60, 55, 62, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33] 
\">"

x
 => #<Bio::Fastq:0x00000100849b20 @definition="H125:1:1108:1147:2046#0/1", @sequence_string="CGGGAAATGGCGGAAATGTGCAAGGATGTTATATGAATTGTGTTGGTTGGCCTAAAACACAGAGCCGGCTTGAAGT", @definition2="", @quality_string="[XSZGXPSKPJPP]TWQRFRHXW\\WXXX]PUX[W_^R^[XRNRYV]^Y[]UUNRT]X_BBBBBBBBBBBBBBBBBB", @format=#<Bio::Fastq::FormatData::FASTQ_SANGER:0x00000100881ea8 @name="fastq-sanger", @symbol=:fastq_sanger, @offset=33, @score_range=0..93>, @quality_scores=[58, 55, 50, 57, 38, 55, 47, 50, 42, 47, 41, 47, 47, 60, 51, 54, 48, 49, 37, 49, 39, 55, 54, 59, 54, 55, 55, 55, 60, 47, 52, 55, 58, 54, 62, 61, 49, 61, 58, 55, 49, 45, 49, 56, 53, 60, 61, 56, 58, 60, 52, 52, 45, 49, 51, 60, 55, 62, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33, 33]> 

so the sanger is the default.

Is Illumina the right format for the newest technology/datasets ?

x.format = :fastq_illumina
 => :fastq_illumina

x.quality_scores
 => [27, 24, 19, 26, 7, 24, 16, 19, 11, 16, 10, 16, 16, 29, 20, 23, 17, 18, 6, 18, 8, 24, 23, 28, 23, 24, 24, 24, 29, 16, 21, 24, 27, 23, 31, 30, 18, 30, 27, 24, 18, 14, 18, 25, 22, 29, 30, 25, 27, 29, 21, 21, 14, 18, 20, 29, 24, 31, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2]

Note that two formats are using different offsets and ranges.

Obviously also the error_probabilities are different. I think that this behavior is misleading at least for me, using data coming from illumina using their metric and finding the phred right there.

x.error_probabilities #illumina
 => [0.001995262314968879, 0.003981071705534973, 0.012589254117941675, 0.0025118864315095794, 0.19952623149688797, 0.003981071705534973, 0.025118864315095794, 0.012589254117941675, 0.07943282347242814, 0.025118864315095794, 0.1, 0.025118864315095794, 0.025118864315095794, 0.0012589254117941675, 0.01, 0.005011872336272725, 0.0199526231496888, 0.015848931924611134, 0.251188643150958, 0.015848931924611134, 0.15848931924611134, 0.003981071705534973, 0.005011872336272725, 0.001584893192461114, 0.005011872336272725, 0.003981071705534973, 0.003981071705534973, 0.003981071705534973, 0.0012589254117941675, 0.025118864315095794, 0.007943282347242814, 0.003981071705534973, 0.001995262314968879, 0.005011872336272725, 0.0007943282347242813, 0.001, 0.015848931924611134, 0.001, 0.001995262314968879, 0.003981071705534973, 0.015848931924611134, 0.039810717055349734, 0.015848931924611134, 0.0031622776601683794, 0.00630957344480193, 0.0012589254117941675, 0.001, 0.0031622776601683794, 0.001995262314968879, 0.0012589254117941675, 0.007943282347242814, 0.007943282347242814, 0.039810717055349734, 0.015848931924611134, 0.01, 0.0012589254117941675, 0.003981071705534973, 0.0007943282347242813, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932, 0.6309573444801932]

x.error_probabilities #phred
 => [1.584893192461114e-06, 3.162277660168379e-06, 1.0e-05, 1.9952623149688787e-06, 0.00015848931924611142, 3.162277660168379e-06, 1.9952623149688786e-05, 1.0e-05, 6.309573444801929e-05, 1.9952623149688786e-05, 7.943282347242822e-05, 1.9952623149688786e-05, 1.9952623149688786e-05, 1.0e-06, 7.943282347242822e-06, 3.981071705534969e-06, 1.584893192461114e-05, 1.2589254117941661e-05, 0.00019952623149688788, 1.2589254117941661e-05, 0.00012589254117941674, 3.162277660168379e-06, 3.981071705534969e-06, 1.2589254117941661e-06, 3.981071705534969e-06, 3.162277660168379e-06, 3.162277660168379e-06, 3.162277660168379e-06, 1.0e-06, 1.9952623149688786e-05, 6.30957344480193e-06, 3.162277660168379e-06, 1.584893192461114e-06, 3.981071705534969e-06, 6.30957344480193e-07, 7.943282347242822e-07, 1.2589254117941661e-05, 7.943282347242822e-07, 1.584893192461114e-06, 3.162277660168379e-06, 1.2589254117941661e-05, 3.1622776601683795e-05, 1.2589254117941661e-05, 2.5118864315095823e-06, 5.011872336272725e-06, 1.0e-06, 7.943282347242822e-07, 2.5118864315095823e-06, 1.584893192461114e-06, 1.0e-06, 6.30957344480193e-06, 6.30957344480193e-06, 3.1622776601683795e-05, 1.2589254117941661e-05, 7.943282347242822e-06, 1.0e-06, 3.162277660168379e-06, 6.30957344480193e-07, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725, 0.0005011872336272725] 

a) What do you think about specify the format right in the loading phase (initialize) ?
a.1) the problem is that illumina's documentation makes clear reference to 
NOTE
The quality scoring scheme Illumina uses is the Phred scoring scheme, encoded as an ASCII character by adding 64 to the Phred value. A Phred score of a base is:
Qphred =-10 log10(e) where e is the estimated probability of a base being wrong.
b) try to identify the format from the header of the first sequence or use a convention in the extension ?
c) ALWAYS use sanger 

I'm lost O_o


--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios









From p.j.a.cock at googlemail.com  Sat Mar 26 23:17:30 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Sat, 26 Mar 2011 23:17:30 +0000
Subject: [BioRuby] FastQ and Quality Scores
In-Reply-To: <A7169C4B-A433-4666-B6BD-D9F1B2EDF5C0@ingm.org>
References: <A7169C4B-A433-4666-B6BD-D9F1B2EDF5C0@ingm.org>
Message-ID: <AANLkTin248ZxWrf+4u8raaeTfMPkYV7NZMJxedW9Pscv@mail.gmail.com>

On Fri, Mar 25, 2011 at 5:06 PM, Raoul Bonnal <bonnal at ingm.org> wrote:
> Dear All,
> probably I don't know very much this part of the bioruby library (not yet).
> In this days I'm playing a bit with fastq data :-) and bioruby
> ...
>
> Is Illumina the right format for the newest technology/datasets ?

Right now, yes, but with the imminent release of Illumina's
CASAVA 1.8 pipeline, they will start using the standard
Sanger FASTQ encoding.
http://seqanswers.com/forums/showthread.php?t=8895

> ...
> I'm lost O_o

Hopefully this will help:
http://dx.doi.org/10.1093/nar/gkp1137

Peter


From bonnal at ingm.org  Sun Mar 27 17:11:53 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Sun, 27 Mar 2011 19:11:53 +0200
Subject: [BioRuby] FastQ and Quality Scores
In-Reply-To: <AANLkTin248ZxWrf+4u8raaeTfMPkYV7NZMJxedW9Pscv@mail.gmail.com>
References: <A7169C4B-A433-4666-B6BD-D9F1B2EDF5C0@ingm.org>
	<AANLkTin248ZxWrf+4u8raaeTfMPkYV7NZMJxedW9Pscv@mail.gmail.com>
Message-ID: <8D3CD686-7153-452F-9ADD-C962DD172FAF@ingm.org>

Thanks Peter,
seqanswer  very useful.
I still have concerns about loading by default in sanger, at least now ... btw in the near future it will re-became de facto standard. Confusion is generated from companies obviously.
The discussion in the article is still valid if we must live in a mixed world -_-'

On 27/mar/2011, at 00.17, Peter Cock wrote:

> On Fri, Mar 25, 2011 at 5:06 PM, Raoul Bonnal <bonnal at ingm.org> wrote:
>> Dear All,
>> probably I don't know very much this part of the bioruby library (not yet).
>> In this days I'm playing a bit with fastq data :-) and bioruby
>> ...
>> 
>> Is Illumina the right format for the newest technology/datasets ?
> 
> Right now, yes, but with the imminent release of Illumina's
> CASAVA 1.8 pipeline, they will start using the standard
> Sanger FASTQ encoding.
> http://seqanswers.com/forums/showthread.php?t=8895
> 
>> ...
>> I'm lost O_o
> 
> Hopefully this will help:
> http://dx.doi.org/10.1093/nar/gkp1137
> 
> Peter
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby

--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios









From bonnal at ingm.org  Mon Mar 28 15:49:37 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Mon, 28 Mar 2011 17:49:37 +0200
Subject: [BioRuby] Fastq performances
Message-ID: <D619391D-E44A-45D0-BE29-D9E1C6157423@ingm.org>

Always testing :-)

I have a fastq file,  about 95 Mb and X sequences.
I did a trimming procedure scanning all the sequences but I have a performance issue, it took too long.
The code makes a scan to identify some sequence and trim it. Then I send in output all the sequences in input.
I found that the bottleneck is the conversion process when I need to write out the sequences.

Total number of sequences 514299.


THIS TASK IS USING FULL CONVERSION
if read.to_trim?
   trim sequence and quality string, create a (new fastq obj).to_biosequence.output(:fastq_illumina) 
else 
  read.to_biosequence.output(:fastq_illumina)
end 

MacBook-Pro-RaoulB:bioruby-ngs bonnalraoul$ time ./bin/biongs convert:illumina:fastq:trim_b /Users/bonnalraoul/Desktop/s_1_1_1108_qseq.fastq
WARNING: no program is associated with BCLQSEQ task, does not make sense to create a thor task.

real	2m1.749s
user	1m58.079s
sys	0m3.038s


THIS TASK IS USING RAW CONVERSION (formatting fastq sequence on the fly)
same above, but I don't create the biosequence object.
MacBook-Pro-RaoulB:bioruby-ngs bonnalraoul$ time ./bin/biongs convert:illumina:fastq:trim_b /Users/bonnalraoul/Desktop/s_1_1_1108_qseq.fastq
WARNING: no program is associated with BCLQSEQ task, does not make sense to create a thor task.

real	0m43.546s
user	0m41.611s
sys	0m1.133s


The difference in term of time is quite huge, if you consider that this is a tiny dataset. I can gain other 10 seconds If I don't wrap the output string to 70 chars (see below)

Note: output from to_biosequence.output(:fastq_illumina) is not equal to the input (still from illumina)
the sequence(na and quality is wrapped to 70 chas) and the header is repeated. Is it my fault is some part of the code ? I'll put the code in github asap.

--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios









From daijiendoh at gmail.com  Mon Mar 28 23:45:55 2011
From: daijiendoh at gmail.com (=?ISO-2022-JP?B?GyRCMXNGI0JnRnMbKEI=?=)
Date: Tue, 29 Mar 2011 08:45:55 +0900
Subject: [BioRuby] mask on Ilumina-format
Message-ID: <AANLkTikj=qPyQ_yCqYESJd3Gef8WGydDpHnDAF9JQOru@mail.gmail.com>

Dear All
I start to use illumina-formated data.

On the start, data was parsed as below.

Data*****
@ILLUMINA-554790:34:6:107:18082:1570#0/1
AATCGTTGTAGATTCATTACTGCTCCTGAGCGGTTTACAGGAGTAAGTGTAGACGTTGAGAAATGATATTTGTGAA
+ILLUMINA-554790:34:6:107:18082:1570#0/1
efgggfffffffffffggaggggggggg[ggg[gggggagfdfafffaff_aadc^dfYaffcffKaca_^aXcBB
@ILLUMINA-554790:34:6:107:18268:1571#0/1
AGCAAGCAATCGCCAGCAGCAGAGTGCCAAGACGCCCCAGCGCAAACCACAGTCTGCCCGCTTTGCTGTTGCTGGT
+ILLUMINA-554790:34:6:107:18268:1571#0/1
cccSc]\LYSaYYbKcc[ccccccacY_c^aRaZSca\\OYaaaaJR`X\]]FHX^aQaHR\PWSaaccaaaILca
@ILLUMINA-554790:34:6:107:18774:1566#0/1
CCAGGCAAAGAGATCGCGCATAGCGGTAAATTTATTCGACAACAGCAGCCAGATAGCAAAATCACGCAGCAGCCAG
+ILLUMINA-554790:34:6:107:18774:1566#0/1
hhhhhhhhhhhghggghfhhhehhhhffhfhhhhhhhdahghchfaggafhcah[ffhefhcehffahhaffdh_a

Parsing script*****

require 'bio'
quality_threshold = 60
Bio::FlatFile.open('text.txt').each do |entry|
       p entry.format
       p entry.entry_id
       p entry.seq
       hq_seq = entry.mask(quality_threshold, mask_char='n')
end

*******************

But,
p entry.format   returns nil
and
entry.mask    returns    undefined method `mask' for
#<Bio::Fastq:0x7f1eb5d9dc28> (NoMethodError)

How I set format to FASTQ_ILLUMINA and use 'mask' method.
'http://bioruby.open-bio.org/rdoc/'  is so difficult for me and need
help to use it.

With best wishes,
Daiji Endoh


From tomoakin at kenroku.kanazawa-u.ac.jp  Tue Mar 29 04:36:05 2011
From: tomoakin at kenroku.kanazawa-u.ac.jp (Tomoaki NISHIYAMA)
Date: Tue, 29 Mar 2011 13:36:05 +0900
Subject: [BioRuby] mask on Ilumina-format
In-Reply-To: <AANLkTikj=qPyQ_yCqYESJd3Gef8WGydDpHnDAF9JQOru@mail.gmail.com>
References: <AANLkTikj=qPyQ_yCqYESJd3Gef8WGydDpHnDAF9JQOru@mail.gmail.com>
Message-ID: <35F444DE-CF2A-4FD1-B727-097CD236B30F@kenroku.kanazawa-u.ac.jp>

Hi Endoh-san,

What version of bioruby library are you using?

> entry.mask    returns    undefined method `mask' for
> #<Bio::Fastq:0x7f1eb5d9dc28> (NoMethodError)


Based on the history at github
https://github.com/bioruby/bioruby/commits/master/lib/bio/db/fastq.rb
the mask method was defined on August 11, 2010.
So, any prior version does not define the method mask, but later  
versions
like 1.4.1 should have the method.

> p entry.format   returns nil


In the rdoc you mentioned, select Bio::Fastq
in the upper middle column and you will find the following explanation:

format()
Format name. One of ?fastq-sanger?, ?fastq-solexa?, ?fastq- 
illumina?, or nil (when not specified).

Returns:(String or nil) format name

So, getting nil for unspecified format seems what is expected.
-- 
Tomoaki NISHIYAMA

Advanced Science Research Center,
Kanazawa University,
13-1 Takara-machi,
Kanazawa, 920-0934, Japan




From bonnal at ingm.org  Tue Mar 29 07:51:26 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Tue, 29 Mar 2011 09:51:26 +0200
Subject: [BioRuby] mask on Ilumina-format
In-Reply-To: <AANLkTikj=qPyQ_yCqYESJd3Gef8WGydDpHnDAF9JQOru@mail.gmail.com>
References: <AANLkTikj=qPyQ_yCqYESJd3Gef8WGydDpHnDAF9JQOru@mail.gmail.com>
Message-ID: <9004D78D-858A-44A2-94B9-646F1EC7CDE7@ingm.org>

>From a Goto-san's mail:
 q = Bio::Fastq.new("@test\natgcgataatgc\n+test\nCCCCDDDDBXXX\n")
 q.format = :fastq_illumina
 puts q.mask(your_quality_threshold, your_masking_char)
keep in mind mask masks the bases < your_quality_threshold

by default the format is :fastq_sanger if you call q.quality_scores ( without specify q.format)
On 29/mar/2011, at 01.45, ???? wrote:

> Dear All
> I start to use illumina-formated data.
> 
> On the start, data was parsed as below.
> 
> Data*****
> @ILLUMINA-554790:34:6:107:18082:1570#0/1
> AATCGTTGTAGATTCATTACTGCTCCTGAGCGGTTTACAGGAGTAAGTGTAGACGTTGAGAAATGATATTTGTGAA
> +ILLUMINA-554790:34:6:107:18082:1570#0/1
> efgggfffffffffffggaggggggggg[ggg[gggggagfdfafffaff_aadc^dfYaffcffKaca_^aXcBB
> @ILLUMINA-554790:34:6:107:18268:1571#0/1
> AGCAAGCAATCGCCAGCAGCAGAGTGCCAAGACGCCCCAGCGCAAACCACAGTCTGCCCGCTTTGCTGTTGCTGGT
> +ILLUMINA-554790:34:6:107:18268:1571#0/1
> cccSc]\LYSaYYbKcc[ccccccacY_c^aRaZSca\\OYaaaaJR`X\]]FHX^aQaHR\PWSaaccaaaILca
> @ILLUMINA-554790:34:6:107:18774:1566#0/1
> CCAGGCAAAGAGATCGCGCATAGCGGTAAATTTATTCGACAACAGCAGCCAGATAGCAAAATCACGCAGCAGCCAG
> +ILLUMINA-554790:34:6:107:18774:1566#0/1
> hhhhhhhhhhhghggghfhhhehhhhffhfhhhhhhhdahghchfaggafhcah[ffhefhcehffahhaffdh_a
> 
> Parsing script*****
> 
> require 'bio'
> quality_threshold = 60
> Bio::FlatFile.open('text.txt').each do |entry|
>       p entry.format
>       p entry.entry_id
>       p entry.seq
>       hq_seq = entry.mask(quality_threshold, mask_char='n')
> end
> 
> *******************
> 
> But,
> p entry.format   returns nil
> and
> entry.mask    returns    undefined method `mask' for
> #<Bio::Fastq:0x7f1eb5d9dc28> (NoMethodError)
> 
> How I set format to FASTQ_ILLUMINA and use 'mask' method.
> 'http://bioruby.open-bio.org/rdoc/'  is so difficult for me and need
> help to use it.
> 
> With best wishes,
> Daiji Endoh
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby

--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios









From daijiendoh at gmail.com  Tue Mar 29 09:51:25 2011
From: daijiendoh at gmail.com (=?ISO-2022-JP?B?GyRCMXNGI0JnRnMbKEI=?=)
Date: Tue, 29 Mar 2011 18:51:25 +0900
Subject: [BioRuby] Fwd:  mask on Ilumina-format
In-Reply-To: <9004D78D-858A-44A2-94B9-646F1EC7CDE7@ingm.org>
References: <AANLkTikj=qPyQ_yCqYESJd3Gef8WGydDpHnDAF9JQOru@mail.gmail.com>
	<9004D78D-858A-44A2-94B9-646F1EC7CDE7@ingm.org>
Message-ID: <AANLkTi=91GwDiGLQcNQF7h8CkfbjbCs7d6A9CkcZBspR@mail.gmail.com>

Thank you Nishiyama-san and Bonnal-san

1 I use bioruby on Ubuntu10.10 with synnaptic-mediated installation.
The version is 1.40-2. So I cannot use mask. And I will install
bioruby manually.
2 To setup fastq_illumina -format I had not been know. The scripts below.

q = Bio::Fastq.new("@test\natgcgataatgc\n+test\nCCCCDDDDBXXX\n")
 q.format = :fastq_illumina

As it is very difficult for me how to make a new object with certain
format. Mr Bonnal's suggestion is very helpful for me.

Thanks again

---------- ??????? ----------
From: Raoul Bonnal <bonnal at ingm.org>
??: 2011?3?29?16:51
??: Re: [BioRuby] mask on Ilumina-format
To: ???? <daijiendoh at gmail.com>
Cc: bioruby at lists.open-bio.org


>From a Goto-san's mail:
 q = Bio::Fastq.new("@test\natgcgataatgc\n+test\nCCCCDDDDBXXX\n")
 q.format = :fastq_illumina
 puts q.mask(your_quality_threshold, your_masking_char)
keep in mind mask masks the bases < your_quality_threshold
by default the format is :fastq_sanger if you call q.quality_scores (
without specify q.format)
On 29/mar/2011, at 01.45, ???? wrote:

Dear All
I start to use illumina-formated data.

On the start, data was parsed as below.

Data*****
@ILLUMINA-554790:34:6:107:18082:1570#0/1
AATCGTTGTAGATTCATTACTGCTCCTGAGCGGTTTACAGGAGTAAGTGTAGACGTTGAGAAATGATATTTGTGAA
+ILLUMINA-554790:34:6:107:18082:1570#0/1
efgggfffffffffffggaggggggggg[ggg[gggggagfdfafffaff_aadc^dfYaffcffKaca_^aXcBB
@ILLUMINA-554790:34:6:107:18268:1571#0/1
AGCAAGCAATCGCCAGCAGCAGAGTGCCAAGACGCCCCAGCGCAAACCACAGTCTGCCCGCTTTGCTGTTGCTGGT
+ILLUMINA-554790:34:6:107:18268:1571#0/1
cccSc]\LYSaYYbKcc[ccccccacY_c^aRaZSca\\OYaaaaJR`X\]]FHX^aQaHR\PWSaaccaaaILca
@ILLUMINA-554790:34:6:107:18774:1566#0/1
CCAGGCAAAGAGATCGCGCATAGCGGTAAATTTATTCGACAACAGCAGCCAGATAGCAAAATCACGCAGCAGCCAG
+ILLUMINA-554790:34:6:107:18774:1566#0/1
hhhhhhhhhhhghggghfhhhehhhhffhfhhhhhhhdahghchfaggafhcah[ffhefhcehffahhaffdh_a

Parsing script*****

require 'bio'
quality_threshold = 60
Bio::FlatFile.open('text.txt').each do |entry|
      p entry.format
      p entry.entry_id
      p entry.seq
      hq_seq = entry.mask(quality_threshold, mask_char='n')
end

*******************

But,
p entry.format   returns nil
and
entry.mask    returns    undefined method `mask' for
#<Bio::Fastq:0x7f1eb5d9dc28> (NoMethodError)

How I set format to FASTQ_ILLUMINA and use 'mask' method.
'http://bioruby.open-bio.org/rdoc/'  is so difficult for me and need
help to use it.

With best wishes,
Daiji Endoh
_______________________________________________
BioRuby Project - http://www.bioruby.org/
BioRuby mailing list
BioRuby at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioruby

--
Ra
linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios


From p.j.a.cock at googlemail.com  Tue Mar 29 09:56:19 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 29 Mar 2011 10:56:19 +0100
Subject: [BioRuby] Fastq performances
In-Reply-To: <D619391D-E44A-45D0-BE29-D9E1C6157423@ingm.org>
References: <D619391D-E44A-45D0-BE29-D9E1C6157423@ingm.org>
Message-ID: <AANLkTinR1zFCVVGAgOqx6ZgMpjJjXbdqT4kkVcCPAm7X@mail.gmail.com>

On Mon, Mar 28, 2011 at 4:49 PM, Raoul Bonnal <bonnal at ingm.org> wrote:
> Note: output from to_biosequence.output(:fastq_illumina) is not equal to the
> input (still from illumina) the sequence(na and quality is wrapped to 70 chas)
> and the header is repeated. Is it my fault is some part of the code ? I'll put
> the code in github asap.

When writing FASTQ, I would expect BioRuby to omit the repeated header
on the plus line, and NOT to line wrap the sequence and quality lines. This
is deliberate, see http://dx.doi.org/10.1093/nar/gkp1137 for details.

So, if your input did have the repeated header and/or wrapping, then yes,
the input would not match the output.

Peter


From bonnal at ingm.org  Tue Mar 29 10:16:11 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Tue, 29 Mar 2011 12:16:11 +0200
Subject: [BioRuby] Fastq performances
In-Reply-To: <AANLkTinR1zFCVVGAgOqx6ZgMpjJjXbdqT4kkVcCPAm7X@mail.gmail.com>
References: <D619391D-E44A-45D0-BE29-D9E1C6157423@ingm.org>
	<AANLkTinR1zFCVVGAgOqx6ZgMpjJjXbdqT4kkVcCPAm7X@mail.gmail.com>
Message-ID: <0DA2D81C-3CCE-4252-910E-F977AD4C8077@ingm.org>


On 29/mar/2011, at 11.56, Peter Cock wrote:

> On Mon, Mar 28, 2011 at 4:49 PM, Raoul Bonnal <bonnal at ingm.org> wrote:
>> Note: output from to_biosequence.output(:fastq_illumina) is not equal to the
>> input (still from illumina) the sequence(na and quality is wrapped to 70 chas)
>> and the header is repeated. Is it my fault is some part of the code ? I'll put
>> the code in github asap.
> 
> When writing FASTQ, I would expect BioRuby to omit the repeated header
> on the plus line, and NOT to line wrap the sequence and quality lines. This
> is deliberate, see http://dx.doi.org/10.1093/nar/gkp1137 for details.
I did a little  mistake in the previous e-mail, when I was talking about repeated header it was the first line @H125:1:1108:1188:2036#0/1 H125:1:1108:1188:2036#0/1

Input:
@H125:1:1108:1188:2036#0/1
CTTGTATGCAGCATCCCCTTCTTGCCTAGGGACTTGAAGGGCCAGGCTTCCTGTCATTGCCTCACTCAAATGTAGC
+
gggggggggggggegggggffggeggegggeagge^ggdbcgggcdgedegfggffff^ffffefdeeZefccceg

Output created with fastq_read.to_biosequence.output(:fastq_illumina), same with sanger format.
@H125:1:1108:1188:2036#0/1 H125:1:1108:1188:2036#0/1
CTTGTATGCAGCATCCCCTTCTTGCCTAGGGACTTGAAGGGCCAGGCTTCCTGTCATTGCCTCACTCAAA
TGTAGC
+
gggggggggggggegggggffggeggegggeagge^ggdbcgggcdgedegfggffff^ffffefdeeZe
fccceg

> 
> So, if your input did have the repeated header and/or wrapping, then yes,
> the input would not match the output.
My input is not wrapped and has no repeated header.

Thanks Peter.
--
Ra










From bonnal at ingm.org  Thu Mar 31 09:17:27 2011
From: bonnal at ingm.org (Raoul Bonnal)
Date: Thu, 31 Mar 2011 11:17:27 +0200
Subject: [BioRuby] Reminder BioRuby Irc Meeting Today at GMT 14:00
Message-ID: <6028112A-EBFF-40D6-9059-50ADCC9BD6E3@ingm.org>

server: irc.freenode.net
channel: #bioruby
time: 14:00 GMT

topics: 
* samtools
* fastq performances ?
* gsoc 
* bioruby-ngs
* docs
* general updates

this is not a priority list, just a bunch of topics.

see you later.

--
Ra

linkedin: http://it.linkedin.com/in/raoulbonnal
twitter: http://twitter.com/ilpuccio
skype: ilpuccio
irc.freenode.net: Helius
github: https://github.com/helios