From hlapp at drycafe.net Mon Aug 1 18:36:27 2011 From: hlapp at drycafe.net (Hilmar Lapp) Date: Mon, 1 Aug 2011 18:36:27 -0400 Subject: [BioRuby] Job opportunity: User Interface Design and Web Application Developer Message-ID: <7F0AE58E-6052-469B-ACD0-207FAD060472@drycafe.net> (Apologies if you have received this already or if this is considered spam - we're trying to reach out as broad as possible and I know that quite a few in the Bio* communities would be well qualified. Please feel free to pass on to anyone who might be interested, or might know someone who is.) User Interface Design and Web Application Developer The National Evolutionary Synthesis Center (NESCent) seeks a creative and enthusiastic individual to design user interfaces and web applications for scientific applications that manage, analyze, visualize and share data in support of evolutionary research. The incumbent will work as part of a small informatics team in close collaboration with domain scientists. NESCent (http://nescent.org) is an NSF-funded center dedicated to cross-disciplinary research in evolutionary science. Our informatics team works closely with visiting and resident scientists to support their custom software and database development needs (http://informatics.nescent.org ), and collaborates broadly with other biodiversity informatics projects. All NESCent software products are open-source, and the Center has a number of initiatives to actively promote collaborative development of community software resources. Above all, we are enthusiastic about our work, about the mission of the Center, and about the contribution of informatics to that mission. Job description: The incumbent will design and develop user interfaces and web applications for databases and other software tools for sponsored scientists and staff. The job responsibilities include all stages of the software development process, including requirements gathering, design, implementation, release packaging and documentation, as part of a small team (typically 2-3 individuals). We expect the incumbent to present their work at conferences and contribute to publications with scientific collaborators; interact regularly with visiting and resident scientists, other members of the informatics team and Center staff; and generally serve as an expert resource for Center personnel. The position provides opportunities for professional development and encourages research into new technologies. Most informatics staff work at our Durham NC offices, located adjacent to Duke University, but we support a wide range of technologies for virtual communication with off-site staff and collaborators. Salary range: $70,000 - $80,000, depending on education and experience Required Qualifications: * Demonstrated success collaborating with clients on custom software solutions * Experience with various stages of the software development cycle * Expertise in development and testing of user interface designs * Excellent communication skills, both virtual and face-to-face Preferred Qualifications: * M.S. or Ph.D. in Computer Science, Bioinformatics or related field * Demonstrated interest in science, particularly biology * Expertise in dynamic and interactive web technologies (JavaScript, CGI) * Expertise in rapid application development and respective programming technologies and languages (e.g., modern scripting languages and web-application frameworks such as Python/Django, Ruby/ Ruby-on-Rails, and Perl/Catalyst). * Expertise in graphic design * Expertise in data visualization and/or scientific data integration * Expertise in software usability design and assessment * Expertise in web service (SOAP, REST, XML, JSON) and semantic web technologies * Fluency in Java programming * Prior experience in relational database programming (PostgreSQL or MySQL) * Experience with open-source, and collaborative, software development How to apply: Please send cover letter, resume and contact information for three references to Dr. Karen Cranston, Training Coordinator and Bioinformatics Project Manager (karen.cranston at nescent.org); Please also complete the online application at the University of North Carolina HR website: http://bit.ly/r9HQ8r. Informal inquires or requests for additional information may be directed to Dr. Cranston by email or phone (+1-919-613-2275). Closing date is August 15, 2011. -- =========================================================== : Hilmar Lapp -:- Durham, NC -:- hlapp at drycafe dot net : =========================================================== From pjotr.public14 at thebird.nl Tue Aug 2 07:25:16 2011 From: pjotr.public14 at thebird.nl (Pjotr Prins) Date: Tue, 2 Aug 2011 13:25:16 +0200 Subject: [BioRuby] biogems.info In-Reply-To: <20110731181443.565a6fe0@mail.ingm.it> References: <20110730135448.GA17613@thebird.nl> <20110731181443.565a6fe0@mail.ingm.it> Message-ID: <20110802112516.GA1819@thebird.nl> http://biogems.info/ now has trends (based on 90d download ranking), DOI, and a marker for stable/testing. Pj. On Sun, Jul 31, 2011 at 08:14:43PM +0200, Raoul Bonnal wrote: > I like it :-) > > well done. > > -------------------------------------------------------------------------- > > From: Pjotr Prins [mailto:pjotr.public14 at thebird.nl] > To: bioruby [mailto:bioruby at lists.open-bio.org] > Sent: Sat, 30 Jul 2011 15:54:48 +0200 > Subject: [BioRuby] New site: http://biogems.info > > >From the Biogem project we have created Biogems.info > > [1]http://biogems.info/ > > which lists all available biogems. We have an amazing 21 new biogems, > since the introduction of the biogem tool and BioRuby plugins, > reflecting a 10x increase in new Ruby code for Bioinformatics in the > last 8 months, compared to the same period a year before. > > Keep them coming! > > PS The website can be improved. The code is at > [2]https://github.com/pjotrp/biogems.info. Feel free! > > PS If you want a different description / URLs for your gem, update > your project Rakefile and run 'rake gemspec ; rake release'. > > PS If your gem is not listed - host it on rubygems and pass the info > to me. The script automatically harvests gems that start with bio- > (bio and dash). > _______________________________________________ > BioRuby Project - [3]http://www.bioruby.org/ > BioRuby mailing list > [4]BioRuby at lists.open-bio.org > [5]http://lists.open-bio.org/mailman/listinfo/bioruby > > References > > Visible links > 1. http://biogems.info/ > 2. https://github.com/pjotrp/biogems.info > 3. http://www.bioruby.org/ > 4. mailto:BioRuby at lists.open-bio.org > 5. http://lists.open-bio.org/mailman/listinfo/bioruby From pjotr.public14 at thebird.nl Tue Aug 2 07:33:56 2011 From: pjotr.public14 at thebird.nl (Pjotr Prins) Date: Tue, 2 Aug 2011 13:33:56 +0200 Subject: [BioRuby] BioRuby gem hits 10K downloads today Message-ID: <20110802113356.GA2213@thebird.nl> Hats off! http://rubygems.org/gems/bio From bonnal at ingm.org Tue Aug 2 08:45:25 2011 From: bonnal at ingm.org (Raoul Bonnal) Date: Tue, 02 Aug 2011 14:45:25 +0200 Subject: [BioRuby] BioRuby gem hits 10K downloads today In-Reply-To: <20110802113356.GA2213@thebird.nl> Message-ID: Historic ?! :-) On 02/08/11 13.33, "Pjotr Prins" wrote: > Hats off! > > http://rubygems.org/gems/bio > _______________________________________________ > BioRuby Project - http://www.bioruby.org/ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby From bonnal at ingm.org Tue Aug 2 08:44:04 2011 From: bonnal at ingm.org (Raoul Bonnal) Date: Tue, 02 Aug 2011 14:44:04 +0200 Subject: [BioRuby] BioRuby gem hits 10K downloads today In-Reply-To: <20110802113356.GA2213@thebird.nl> Message-ID: Historical day. By tomorrow meta packages will be ready. On 02/08/11 13.33, "Pjotr Prins" wrote: > Hats off! > > http://rubygems.org/gems/bio > _______________________________________________ > BioRuby Project - http://www.bioruby.org/ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby From pjotr.public14 at thebird.nl Tue Aug 2 16:29:38 2011 From: pjotr.public14 at thebird.nl (Pjotr Prins) Date: Tue, 2 Aug 2011 22:29:38 +0200 Subject: [BioRuby] New site: http://biogems.info In-Reply-To: References: <20110730135448.GA17613@thebird.nl> Message-ID: <20110802202938.GA5550@thebird.nl> Hi Ben, Your SignalP gem has been marked as NEW. Gems less than one month old will be marked automatically. See http://biogems.info and http://gems.bioruby.org Pj. On Sun, Jul 31, 2011 at 10:54:37AM +1000, Ben Woodcroft wrote: > Nice idea Pjotr. Would it be easy and useful to make an RSS feed or > similar available? > ben > > On 31 July 2011 00:10, Francesco Strozzi <[1]francesco.strozzi at gmail.com> > wrote: > > Nice and well done!! > > Cheers > Francesco > > On Sat, Jul 30, 2011 at 15:54, Pjotr Prins > <[2]pjotr.public14 at thebird.nl>wrote: > > >From the Biogem project we have created Biogems.info > > > > [3]http://biogems.info/ > > > > which lists all available biogems. We have an amazing 21 new biogems, > > since the introduction of the biogem tool and BioRuby plugins, > > reflecting a 10x increase in new Ruby code for Bioinformatics in the > > last 8 months, compared to the same period a year before. > > > > Keep them coming! > > > > PS The website can be improved. The code is at > > [4]https://github.com/pjotrp/biogems.info. Feel free! > > > > PS If you want a different description / URLs for your gem, update > > your project Rakefile and run 'rake gemspec ; rake release'. > > > > PS If your gem is not listed - host it on rubygems and pass the info > > to me. The script automatically harvests gems that start with bio- > > (bio and dash). > > _______________________________________________ > > BioRuby Project - [5]http://www.bioruby.org/ > > BioRuby mailing list > > [6]BioRuby at lists.open-bio.org > > [7]http://lists.open-bio.org/mailman/listinfo/bioruby > > > > -- > Francesco > _______________________________________________ > BioRuby Project - [8]http://www.bioruby.org/ > BioRuby mailing list > [9]BioRuby at lists.open-bio.org > [10]http://lists.open-bio.org/mailman/listinfo/bioruby > > -- > Ben J Woodcroft, BE (Hons) > > PhD Candidate > Ralph Laboratory > The University of Melbourne > Melbourne, Australia > > tel: (+613) 8344 2319 > [11]b.woodcroft at pgrad.unimelb.edu.au > > References > > Visible links > 1. mailto:francesco.strozzi at gmail.com > 2. mailto:pjotr.public14 at thebird.nl > 3. http://biogems.info/ > 4. https://github.com/pjotrp/biogems.info > 5. http://www.bioruby.org/ > 6. mailto:BioRuby at lists.open-bio.org > 7. http://lists.open-bio.org/mailman/listinfo/bioruby > 8. http://www.bioruby.org/ > 9. mailto:BioRuby at lists.open-bio.org > 10. http://lists.open-bio.org/mailman/listinfo/bioruby > 11. mailto:b.woodcroft at pgrad.unimelb.edu.au From ktym at hgc.jp Tue Aug 2 17:47:19 2011 From: ktym at hgc.jp (Toshiaki Katayama) Date: Wed, 3 Aug 2011 06:47:19 +0900 Subject: [BioRuby] Fwd: [InterMine Dev] Ruby Client Library Released References: <20110802133111.GD18142@squirrel> Message-ID: <18C5D0FC-A2E9-47FE-A7C6-DCC77E1BD167@hgc.jp> FYI Begin forwarded message: > ???: Alex Kalderimis > ??: 2011?8?2? 22:31:12JST > ??: dev at intermine.org > ??: [InterMine Dev] Ruby Client Library Released > > Have a look at it here and let me know if anything is terribly > ske-wiff: > > The rubygems listing: > http://rubygems.org/search?query=intermine > > The hosted docs: (bio ones haven't been processed yet) > http://rubydoc.info/gems/intermine/0.98.05/file/README.rdoc > > Our own hosted docs > http://www.intermine.org/docs/ruby-docs/ > http://www.intermine.org/docs/ruby-bio-docs/ > > Wiki page coming shortly. > > Alex > > _______________________________________________ > dev mailing list > dev at intermine.org > http://mail.intermine.org/cgi-bin/mailman/listinfo/dev From ktym at hgc.jp Tue Aug 2 18:23:02 2011 From: ktym at hgc.jp (Toshiaki Katayama) Date: Wed, 3 Aug 2011 07:23:02 +0900 Subject: [BioRuby] BioRuby gem hits 10K downloads today In-Reply-To: References: Message-ID: <592B0F44-2767-4898-A23C-85B7E63155BB@hgc.jp> Wow, great news! >From the number of DLs in 2005 https://skitch.com/toshiakikatayama/fpgge/ I had almost correctly estimated the day of 10k DLs in 2006 https://skitch.com/toshiakikatayama/fpggq/ this means we will hit million DLs in coming five years. ;-p Toshiaki On 2011/08/02, at 21:44, Raoul Bonnal wrote: > Historical day. > By tomorrow meta packages will be ready. > > On 02/08/11 13.33, "Pjotr Prins" wrote: > >> Hats off! >> >> http://rubygems.org/gems/bio >> _______________________________________________ >> BioRuby Project - http://www.bioruby.org/ >> BioRuby mailing list >> BioRuby at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioruby > > > _______________________________________________ > BioRuby Project - http://www.bioruby.org/ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby From donttrustben at gmail.com Tue Aug 2 20:29:24 2011 From: donttrustben at gmail.com (Ben Woodcroft) Date: Wed, 3 Aug 2011 10:29:24 +1000 Subject: [BioRuby] New site: http://biogems.info In-Reply-To: <20110802202938.GA5550@thebird.nl> References: <20110730135448.GA17613@thebird.nl> <20110802202938.GA5550@thebird.nl> Message-ID: OK, Thanks. On 3 August 2011 06:29, Pjotr Prins wrote: > Hi Ben, > > Your SignalP gem has been marked as NEW. Gems less than one month old > will be marked automatically. > > See http://biogems.info and http://gems.bioruby.org > > Pj. > > On Sun, Jul 31, 2011 at 10:54:37AM +1000, Ben Woodcroft wrote: > > Nice idea Pjotr. Would it be easy and useful to make an RSS feed or > > similar available? > > ben > > > > On 31 July 2011 00:10, Francesco Strozzi <[1] > francesco.strozzi at gmail.com> > > wrote: > > > > Nice and well done!! > > > > Cheers > > Francesco > > > > On Sat, Jul 30, 2011 at 15:54, Pjotr Prins > > <[2]pjotr.public14 at thebird.nl>wrote: > > > >From the Biogem project we have created Biogems.info > > > > > > [3]http://biogems.info/ > > > > > > which lists all available biogems. We have an amazing 21 new > biogems, > > > since the introduction of the biogem tool and BioRuby plugins, > > > reflecting a 10x increase in new Ruby code for Bioinformatics in > the > > > last 8 months, compared to the same period a year before. > > > > > > Keep them coming! > > > > > > PS The website can be improved. The code is at > > > [4]https://github.com/pjotrp/biogems.info. Feel free! > > > > > > PS If you want a different description / URLs for your gem, update > > > your project Rakefile and run 'rake gemspec ; rake release'. > > > > > > PS If your gem is not listed - host it on rubygems and pass the > info > > > to me. The script automatically harvests gems that start with bio- > > > (bio and dash). > > > _______________________________________________ > > > BioRuby Project - [5]http://www.bioruby.org/ > > > BioRuby mailing list > > > [6]BioRuby at lists.open-bio.org > > > [7]http://lists.open-bio.org/mailman/listinfo/bioruby > > > > > > > -- > > Francesco > > _______________________________________________ > > BioRuby Project - [8]http://www.bioruby.org/ > > BioRuby mailing list > > [9]BioRuby at lists.open-bio.org > > [10]http://lists.open-bio.org/mailman/listinfo/bioruby > > > > -- > > Ben J Woodcroft, BE (Hons) > > > > PhD Candidate > > Ralph Laboratory > > The University of Melbourne > > Melbourne, Australia > > > > tel: (+613) 8344 2319 > > [11]b.woodcroft at pgrad.unimelb.edu.au > > > > References > > > > Visible links > > 1. mailto:francesco.strozzi at gmail.com > > 2. mailto:pjotr.public14 at thebird.nl > > 3. http://biogems.info/ > > 4. https://github.com/pjotrp/biogems.info > > 5. http://www.bioruby.org/ > > 6. mailto:BioRuby at lists.open-bio.org > > 7. http://lists.open-bio.org/mailman/listinfo/bioruby > > 8. http://www.bioruby.org/ > > 9. mailto:BioRuby at lists.open-bio.org > > 10. http://lists.open-bio.org/mailman/listinfo/bioruby > > 11. mailto:b.woodcroft at pgrad.unimelb.edu.au > -- Ben J Woodcroft, BE (Hons) PhD Candidate Ralph Laboratory The University of Melbourne Melbourne, Australia tel: (+613) 8344 2319 b.woodcroft at pgrad.unimelb.edu.au From pjotr.public14 at thebird.nl Wed Aug 3 04:35:12 2011 From: pjotr.public14 at thebird.nl (Pjotr Prins) Date: Wed, 3 Aug 2011 10:35:12 +0200 Subject: [BioRuby] New site: http://biogems.info In-Reply-To: References: <20110730135448.GA17613@thebird.nl> Message-ID: <20110803083512.GA8369@thebird.nl> On Sun, Jul 31, 2011 at 10:54:37AM +1000, Ben Woodcroft wrote: > Nice idea Pjotr. Would it be easy and useful to make an RSS feed or > similar available? RSS done: http://www.biogems.info/rss.xml Pj. From donttrustben at gmail.com Wed Aug 3 04:57:51 2011 From: donttrustben at gmail.com (Ben Woodcroft) Date: Wed, 3 Aug 2011 18:57:51 +1000 Subject: [BioRuby] New site: http://biogems.info In-Reply-To: <20110803083512.GA8369@thebird.nl> References: <20110730135448.GA17613@thebird.nl> <20110803083512.GA8369@thebird.nl> Message-ID: Score. Of course, now releasing the actual gem is more daunting and less low key for the authors.. On 3 August 2011 18:35, Pjotr Prins wrote: > On Sun, Jul 31, 2011 at 10:54:37AM +1000, Ben Woodcroft wrote: > > Nice idea Pjotr. Would it be easy and useful to make an RSS feed or > > similar available? > > RSS done: > > http://www.biogems.info/rss.xml > > Pj. > -- Ben J Woodcroft, BE (Hons) PhD Candidate Ralph Laboratory The University of Melbourne Melbourne, Australia tel: (+613) 8344 2319 b.woodcroft at pgrad.unimelb.edu.au From bonnal at ingm.org Wed Aug 3 06:37:52 2011 From: bonnal at ingm.org (Raoul Bonnal) Date: Wed, 03 Aug 2011 12:37:52 +0200 Subject: [BioRuby] IRC meeting Message-ID: Hi folks, I?d like to have an irc meeting tomorrow. server: irc.freenode.net channel: #bioruby time: 14:00 GMT Topics: * biogems.info: comments, ideas * plugins: update, guide lines for creating new plugins ( common namespace ?, plugin name), collaboration with other projects. * bioruby: general discussion about the project and future plans * gsoc: update Feel free to modify the topics and please give me a feedback here http://poll.pollcode.com/jZ8 -- Ra From tomoakin at kenroku.kanazawa-u.ac.jp Sat Aug 13 06:05:09 2011 From: tomoakin at kenroku.kanazawa-u.ac.jp (Tomoaki NISHIYAMA) Date: Sat, 13 Aug 2011 19:05:09 +0900 Subject: [BioRuby] Fastq.to_s Message-ID: <8F89F463-8DA4-421A-AC5E-1A7B20C02F6E@kenroku.kanazawa-u.ac.jp> Hi, For flatfiles I think its nice if we can output the original text entries as split. For example #!/bin/env ruby require 'bio' ff1 = Bio::FlatFile.open(nil, ARGV[0]) ff2 = Bio::FlatFile.open(nil, ARGV[1]) ff1.each_entry do |fe1| fe2 = ff2.next_entry puts fe1 puts fe2 end should be able to merge read1 and read2 in different file to a single file. This does work with fasta format but not with fastq format right now, because Bio::Fastq does not have to_s method. As Fastq does not hold really original data, reconstructing as the following patch is perhaps a good way (don't use twice memory just for the to_s function). Or, do we need to fold the sequence to some (original or fixed) length? diff --git a/lib/bio/db/fastq.rb b/lib/bio/db/fastq.rb index f913e6d..5ff1a15 100644 --- a/lib/bio/db/fastq.rb +++ b/lib/bio/db/fastq.rb @@ -407,6 +407,10 @@ class Fastq # raw sequence data as a String object attr_reader :sequence_string + def to_s + "@#{@definition}\n#{@sequence_string}\n+#{@definition2}\n#{@quality_string}\n" + end + # returns Bio::Sequence::NA def naseq unless defined? @naseq then Best regards, -- Tomoaki NISHIYAMA Advanced Science Research Center, Kanazawa University, 13-1 Takara-machi, Kanazawa, 920-0934, Japan From ngoto at gen-info.osaka-u.ac.jp Mon Aug 22 02:09:49 2011 From: ngoto at gen-info.osaka-u.ac.jp (Naohisa Goto) Date: Mon, 22 Aug 2011 15:09:49 +0900 Subject: [BioRuby] Fastq.to_s In-Reply-To: <8F89F463-8DA4-421A-AC5E-1A7B20C02F6E@kenroku.kanazawa-u.ac.jp> References: <8F89F463-8DA4-421A-AC5E-1A7B20C02F6E@kenroku.kanazawa-u.ac.jp> Message-ID: <20110822150948.256E.EEF6E030@gen-info.osaka-u.ac.jp> Hi, In this case, Bio::FlatFile#entry_raw, which returns the last entry's string in the flat-file object, is recommended, from the viewpoint of performance (not to create additional objects). modified example: require 'bio' ff1 = Bio::FlatFile.open(nil, ARGV[0]) ff2 = Bio::FlatFile.open(nil, ARGV[1]) ff1.each_entry do |fe1| fe1_raw = ff1.entry_raw fe2 = ff2.next_entry fe2_raw = ff2.entry_raw print fe1_raw print fe2 end Note that the example will not correctly work when the two files contain different number of sequences. I also agree Fastq#to_s as a convenience method regardless of performance. -- Naohisa Goto ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org > Hi, > > For flatfiles I think its nice if we can output the original text entries as split. > For example > > #!/bin/env ruby > > require 'bio' > > ff1 = Bio::FlatFile.open(nil, ARGV[0]) > ff2 = Bio::FlatFile.open(nil, ARGV[1]) > > ff1.each_entry do |fe1| > fe2 = ff2.next_entry > puts fe1 > puts fe2 > end > > should be able to merge read1 and read2 in different file to a single file. > This does work with fasta format but not with fastq format right now, because > Bio::Fastq does not have to_s method. As Fastq does not hold really original > data, reconstructing as the following patch is perhaps a good way (don't use > twice memory just for the to_s function). Or, do we need to fold the sequence > to some (original or fixed) length? > > diff --git a/lib/bio/db/fastq.rb b/lib/bio/db/fastq.rb > index f913e6d..5ff1a15 100644 > --- a/lib/bio/db/fastq.rb > +++ b/lib/bio/db/fastq.rb > @@ -407,6 +407,10 @@ class Fastq > # raw sequence data as a String object > attr_reader :sequence_string > > + def to_s > + "@#{@definition}\n#{@sequence_string}\n+#{@definition2}\n#{@quality_string}\n" > + end > + > # returns Bio::Sequence::NA > def naseq > unless defined? @naseq then > > Best regards, > -- > Tomoaki NISHIYAMA > > Advanced Science Research Center, > Kanazawa University, > 13-1 Takara-machi, > Kanazawa, 920-0934, Japan > From yannick.wurm at unil.ch Mon Aug 22 03:16:22 2011 From: yannick.wurm at unil.ch (Yannick Wurm) Date: Mon, 22 Aug 2011 15:16:22 +0800 Subject: [BioRuby] bio-relevant ruby-one-liners Message-ID: Hi List, More and more, I find myself using ruby one-liners to replace grep, sed, etc. Here's one I use to subset sequences from 454 based on length information in the header line: ruby -ne 'BEGIN{$/="\n>"}; length = $_.match(/length=(\d+)/)[1].to_i; print $_ if (300..320).include?(length) ' < my.fasta > subset.fasta I'm sure there's more elgant ways of generalizing & fool-proofing this. Whats your favorite bio-relevant ruby oneliner? Cheers, yannick FYI, the 454 read input FASTA file looks like this: >F07XJJT02F00DS length=421 xy=2354_2974 region=2 run=R_2009_08_22_19_24_45_ TCTCTCAGTGGTCAGGACTCTGTTAACTTACTGCCTGACTCGATTGATTTGGAGATCAGG [...] G >F07XJJT02F00E3 length=357 xy=2354_3021 region=2 run=R_2009_08_22_19_24_45_ TTTTTATTTTTTTTTTTTACTTTGTACAGCTTTATTAAGATCTAATAAAAATAGATTACA [...] CC >F07XJJT02F00EH length=490 xy=2354_2999 region=2 run=R_2009_08_22_19_24_45_ TCTAAATGTGTTATTAATTATTTTCAACTATTTATAACTATGTATAGTATTTACAATATT [...] TACTCAATTT >F07XJJT02F00ET length=93 xy=2354_3011 region=2 run=R_2009_08_22_19_24_45_ GATAGGCAGGGTTGTGCCATATATTTTAAGATTACGTCTATACCAGTTTTTACGTAAACA ATACGTGATGTTTANATGTAATGTAACGAATGT >F07XJJT02F00EV length=445 xy=2354_3013 region=2 run=R_2009_08_22_19_24_45_ TATTTTAATTGATATTATAATTTGTGTTGTATATATTTTTGCTTGTATCTTATAAATTAA [...] AATATAAAACAATTCAAAATAAATAAGCAAATTATTTACTTAAAA ----------------------------- Ant Genomes & Evolution http://yannick.poulet.org skype://yannickwurm ----------------------------- BLAST @ http://antgenomes.org From daniel.lundin at scilifelab.se Mon Aug 22 04:18:34 2011 From: daniel.lundin at scilifelab.se (Daniel Lundin) Date: Mon, 22 Aug 2011 10:18:34 +0200 Subject: [BioRuby] ActiveRecord classes for BioSQL? Message-ID: <4E5210DA.4060507@scilifelab.se> Hi everyone, I'm working on a couple of Rails applications that will one way or another be dependent on taxonomy and sequence data stored in a BioSQL schema database. For this I need to develop some (rather simple) ActiveRecord classes. I would of course like to be able to have the BioSQL schema loaded in some other database than the main application database, possibly using a different db engine on another computer. I'm a little concerned about the best way of packing up the classes (a Rails plugin seems best) and how to best deal with the fact that these classes will use another db connection than the main app. Is anyone doing something similar and can share experiences? Something like this would be nice to have in BioRuby, I think. /Daniel -- Daniel Lundin, Postdoc SciLifeLab, School of biotechnology, KTH Royal institute of technology, Stockholm, Sweden Postal address: Box 1031 171 21 Solna Sweden Visiting address: Tomtebodav?gen 23 A Mobile: +46 (0)708 123 922 Email: daniel.lundin at scilifelab.se From bonnal at ingm.org Mon Aug 22 05:28:49 2011 From: bonnal at ingm.org (Raoul Bonnal) Date: Mon, 22 Aug 2011 18:28:49 +0900 Subject: [BioRuby] ActiveRecord classes for BioSQL? In-Reply-To: <4E5210DA.4060507@scilifelab.se> Message-ID: Hi Daniel, actually BioSQL is support in Ruby using ActiveRecord https://github.com/bioruby/bioruby/blob/master/lib/bio/io/sql.rb and https://github.com/bioruby/bioruby/tree/master/lib/bio/io/biosql Please, check the reference schema because I'm not synched with the latest one, sorry too busy. If you want to update the library I'm more than happy. Then a feature which is still in experimental stage is the chance to create a bioruby-plugin which is a Rails Engine, so you can add there your own classes or code so that can be reused in multiple Rails applications. Here, https://github.com/helios/bioruby-gem/tree/rails_engine, you can find the git branch don't know if it is buggy, I must check. Let me know I'll try to provide as much support I can. -- Ra On 22/08/11 17.18, "Daniel Lundin" wrote: > Hi everyone, > > I'm working on a couple of Rails applications that will one way or > another be dependent on taxonomy and sequence data stored in a BioSQL > schema database. For this I need to develop some (rather simple) > ActiveRecord classes. I would of course like to be able to have the > BioSQL schema loaded in some other database than the main application > database, possibly using a different db engine on another computer. > > I'm a little concerned about the best way of packing up the classes (a > Rails plugin seems best) and how to best deal with the fact that these > classes will use another db connection than the main app. > > Is anyone doing something similar and can share experiences? > > Something like this would be nice to have in BioRuby, I think. > > /Daniel From p.j.a.cock at googlemail.com Fri Aug 26 10:56:15 2011 From: p.j.a.cock at googlemail.com (Peter Cock) Date: Fri, 26 Aug 2011 15:56:15 +0100 Subject: [BioRuby] BioRuby 1.4.2 released Message-ID: Hi all, For those who don't subscribe to the RSS feed or missed it on twitter, BioRuby 1.4.2 was released earlier today: http://news.open-bio.org/news/2011/08/bioruby-1-4-2-released/ When Goto-san announced at the end of the BioHackathon today in Kyoto that the release would be "soon", I didn't expect it to be this soon - I only just installed BioRuby a few days ago, and now it is out of date ;-) Omedetou! Peter From ngoto at gen-info.osaka-u.ac.jp Fri Aug 26 13:49:32 2011 From: ngoto at gen-info.osaka-u.ac.jp (Naohisa Goto) Date: Sat, 27 Aug 2011 02:49:32 +0900 Subject: [BioRuby] BioRuby 1.4.2 released Message-ID: <20110827024931.6C42.EEF6E030@gen-info.osaka-u.ac.jp> Hi, all, We are pleased to announce the release of BioRuby 1.4.2. This new release fixes bugs existed in 1.4.1 and adds new features and improvement of performance. Tar.gz file: http://bioruby.org/archive/bioruby-1.4.2.tar.gz Gem file: http://bioruby.org/archive/gems/bio-1.4.2.gem We also put RubyGems pacakge at RubyForge and RubyGems.org. You can easily install by using RubyGems. First, check the version number by using search command: % gem search --remote bio and find ?bio (1.4.2)? in the list. Then, % sudo gem install bio Here is a brief summary of changes. Speed-up of Bio::RestrictionEnzyme::Analysis.cut: The new code is 50 to 80 fold faster than the previous code when cutting 1Mbp sequence running on Ruby 1.9.2p180. The code is written by Tomoaki NISHIYAMA and Naohisa Goto. New classes Bio::DDBJ::REST, REST interface for DDBJ Web API for Biology (WABI) web service in additon to SOAP. Currently, only selected APIs are implemented. Bio::Blast with remote DDBJ server uses REST instead of SOAP because Soap4r (SOAP library for Ruby) does not work well with Ruby 1.9. We can now use remote DDBJ BLAST server with Ruby 1.9. The Tutorial.rd is updated by Pjotr Prins and Michael O?Keefe. Many unit tests are added for Bio::GenBank, Bio::GenPept, Bio::NBRF, Bio::PDB and so on. Most of them are developed by Kazuhiro Hayashi during the Google Summer of Code 2010. New methods: Bio::Fastq#to_s, Bio::NCBI::REST::EFetch.nucleotide, Bio::NCBI::REST::EFetch.protein. Bug fixes: * Bio::Blast: Failure of remote BLAST execution is fixed, due to the changes in GenomeNet and DDBJ. * Bio::Blast: When executing remote BLAST with ?genomenet? server, options ?-b? and ?-v? are now correctly used to limit the number of hits to be reported. * Bio::SPTR (Bio::UniProt): Due to the UniProtKB format changes, ID, DE, and WEB RESOURCE of CC lines were not correctly parsed. * Bio::Reference#pubmed_url: Updated to follow recent NCBI changes. * Bio::Newick#reparse failure. * Bio::MEDLINE#reference: doi field should be filled. * Bio::Reference#endnote fails when url is not set. * Bio::FastaFormat#query passes nil to the given factory object. * BioRuby Shell: efetch(), getent(), and demo() fail. In addition, many changes have been made, including incompatible changes. For more information, see RELEASE_NOTES.rdoc and ChangeLog. Acknowledgments: Thanks to all persons reporting issues and/or submitting patches. In addition, thanks to NDBC / DBCLS BioHackathon2011 participants and organizers who try BioRuby during the BioHackathon2011. Hope you enjoy. -- Naohisa Goto ng at bioruby.org / ngoto at gen-info.osaka-u.ac.jp From ngoto at gen-info.osaka-u.ac.jp Fri Aug 26 13:52:25 2011 From: ngoto at gen-info.osaka-u.ac.jp (Naohisa Goto) Date: Sat, 27 Aug 2011 02:52:25 +0900 Subject: [BioRuby] BioRuby 1.4.2 released In-Reply-To: References: Message-ID: <20110827025225.6C45.EEF6E030@gen-info.osaka-u.ac.jp> Hi Peter, Thanks!!! I forgot to post an announce to the mailing list. Naohisa Goto ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org > Hi all, > > For those who don't subscribe to the RSS feed or missed it on twitter, > BioRuby 1.4.2 was released earlier today: > > http://news.open-bio.org/news/2011/08/bioruby-1-4-2-released/ > > When Goto-san announced at the end of the BioHackathon today in Kyoto that > the release would be "soon", I didn't expect it to be this soon - I only > just installed BioRuby a few days ago, and now it is out of date ;-) > > Omedetou! > > Peter From tomoakin at kenroku.kanazawa-u.ac.jp Sun Aug 28 21:04:54 2011 From: tomoakin at kenroku.kanazawa-u.ac.jp (Tomoaki NISHIYAMA) Date: Mon, 29 Aug 2011 10:04:54 +0900 Subject: [BioRuby] Fastq.to_s In-Reply-To: <20110822150948.256E.EEF6E030@gen-info.osaka-u.ac.jp> References: <8F89F463-8DA4-421A-AC5E-1A7B20C02F6E@kenroku.kanazawa-u.ac.jp> <20110822150948.256E.EEF6E030@gen-info.osaka-u.ac.jp> Message-ID: <6D1AEB91-9C44-462A-9D8A-D4A381C012AE@kenroku.kanazawa-u.ac.jp> Hi Goto-san, Thank you, incorporating the fastq.to_s and releasing 1.4.2! With 1.4.2, the following two programs run about the same time; 56m38s vs 56m24s user time for a pair of 22-GB fastq files (single measurement). So, we perhaps can simply choose one easier to read, write, or explain;-) flatmerge #!/bin/env ruby require 'bio' ff1 = Bio::FlatFile.open(nil, ARGV[0]) ff2 = Bio::FlatFile.open(nil, ARGV[1]) ff1.each_entry do |fe1| fe2 = ff2.next_entry puts fe1.to_s puts fe2.to_s end flatmerge2 #!/bin/env ruby require 'bio' ff1 = Bio::FlatFile.open(nil, ARGV[0]) ff2 = Bio::FlatFile.open(nil, ARGV[1]) ff1.each_entry do |fe1| print ff1.entry_raw fe2 = ff2.next_entry print ff2.entry_raw end -- Tomoaki NISHIYAMA Advanced Science Research Center, Kanazawa University, 13-1 Takara-machi, Kanazawa, 920-0934, Japan On 2011/08/22, at 15:09, Naohisa Goto wrote: > Hi, > > In this case, Bio::FlatFile#entry_raw, which returns the last > entry's string in the flat-file object, is recommended, from > the viewpoint of performance (not to create additional objects). > > modified example: > require 'bio' > > ff1 = Bio::FlatFile.open(nil, ARGV[0]) > ff2 = Bio::FlatFile.open(nil, ARGV[1]) > > ff1.each_entry do |fe1| > fe1_raw = ff1.entry_raw > fe2 = ff2.next_entry > fe2_raw = ff2.entry_raw > print fe1_raw > print fe2 > end > > Note that the example will not correctly work when the > two files contain different number of sequences. > > I also agree Fastq#to_s as a convenience method > regardless of performance. > > -- > Naohisa Goto > ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org > >> Hi, >> >> For flatfiles I think its nice if we can output the original text entries as split. >> For example >> >> #!/bin/env ruby >> >> require 'bio' >> >> ff1 = Bio::FlatFile.open(nil, ARGV[0]) >> ff2 = Bio::FlatFile.open(nil, ARGV[1]) >> >> ff1.each_entry do |fe1| >> fe2 = ff2.next_entry >> puts fe1 >> puts fe2 >> end >> >> should be able to merge read1 and read2 in different file to a single file. >> This does work with fasta format but not with fastq format right now, because >> Bio::Fastq does not have to_s method. As Fastq does not hold really original >> data, reconstructing as the following patch is perhaps a good way (don't use >> twice memory just for the to_s function). Or, do we need to fold the sequence >> to some (original or fixed) length? >> >> diff --git a/lib/bio/db/fastq.rb b/lib/bio/db/fastq.rb >> index f913e6d..5ff1a15 100644 >> --- a/lib/bio/db/fastq.rb >> +++ b/lib/bio/db/fastq.rb >> @@ -407,6 +407,10 @@ class Fastq >> # raw sequence data as a String object >> attr_reader :sequence_string >> >> + def to_s >> + "@#{@definition}\n#{@sequence_string}\n+#{@definition2}\n#{@quality_string}\n" >> + end >> + >> # returns Bio::Sequence::NA >> def naseq >> unless defined? @naseq then >> >> Best regards, >> -- >> Tomoaki NISHIYAMA >> >> Advanced Science Research Center, >> Kanazawa University, >> 13-1 Takara-machi, >> Kanazawa, 920-0934, Japan >> > > > From michalkoziarski at gmail.com Mon Aug 29 12:16:57 2011 From: michalkoziarski at gmail.com (=?ISO-8859-2?Q?Micha=B3_Koziarski?=) Date: Mon, 29 Aug 2011 18:16:57 +0200 Subject: [BioRuby] [GSoC] bio-vis Message-ID: Hi everyone, as GSoC is over, I would like to share my work with you and, hopefully, get some feedback on it. General info and some samples are available at http://bioruby.open-bio.org/wiki/GSoC:Bio-images Code itself is stored at github: - visualization package at https://github.com/e-mka/bioruby-vis - image browser at https://github.com/e-mka/bioruby-vis-browser Big thanks for my mentors, Raoul Bonnal and Francesco Strozzi. They helped me a lot with the project, I wouldn't be able to complete it without them. Thank you! Micha? From hlapp at drycafe.net Mon Aug 1 22:36:27 2011 From: hlapp at drycafe.net (Hilmar Lapp) Date: Mon, 1 Aug 2011 18:36:27 -0400 Subject: [BioRuby] Job opportunity: User Interface Design and Web Application Developer Message-ID: <7F0AE58E-6052-469B-ACD0-207FAD060472@drycafe.net> (Apologies if you have received this already or if this is considered spam - we're trying to reach out as broad as possible and I know that quite a few in the Bio* communities would be well qualified. Please feel free to pass on to anyone who might be interested, or might know someone who is.) User Interface Design and Web Application Developer The National Evolutionary Synthesis Center (NESCent) seeks a creative and enthusiastic individual to design user interfaces and web applications for scientific applications that manage, analyze, visualize and share data in support of evolutionary research. The incumbent will work as part of a small informatics team in close collaboration with domain scientists. NESCent (http://nescent.org) is an NSF-funded center dedicated to cross-disciplinary research in evolutionary science. Our informatics team works closely with visiting and resident scientists to support their custom software and database development needs (http://informatics.nescent.org ), and collaborates broadly with other biodiversity informatics projects. All NESCent software products are open-source, and the Center has a number of initiatives to actively promote collaborative development of community software resources. Above all, we are enthusiastic about our work, about the mission of the Center, and about the contribution of informatics to that mission. Job description: The incumbent will design and develop user interfaces and web applications for databases and other software tools for sponsored scientists and staff. The job responsibilities include all stages of the software development process, including requirements gathering, design, implementation, release packaging and documentation, as part of a small team (typically 2-3 individuals). We expect the incumbent to present their work at conferences and contribute to publications with scientific collaborators; interact regularly with visiting and resident scientists, other members of the informatics team and Center staff; and generally serve as an expert resource for Center personnel. The position provides opportunities for professional development and encourages research into new technologies. Most informatics staff work at our Durham NC offices, located adjacent to Duke University, but we support a wide range of technologies for virtual communication with off-site staff and collaborators. Salary range: $70,000 - $80,000, depending on education and experience Required Qualifications: * Demonstrated success collaborating with clients on custom software solutions * Experience with various stages of the software development cycle * Expertise in development and testing of user interface designs * Excellent communication skills, both virtual and face-to-face Preferred Qualifications: * M.S. or Ph.D. in Computer Science, Bioinformatics or related field * Demonstrated interest in science, particularly biology * Expertise in dynamic and interactive web technologies (JavaScript, CGI) * Expertise in rapid application development and respective programming technologies and languages (e.g., modern scripting languages and web-application frameworks such as Python/Django, Ruby/ Ruby-on-Rails, and Perl/Catalyst). * Expertise in graphic design * Expertise in data visualization and/or scientific data integration * Expertise in software usability design and assessment * Expertise in web service (SOAP, REST, XML, JSON) and semantic web technologies * Fluency in Java programming * Prior experience in relational database programming (PostgreSQL or MySQL) * Experience with open-source, and collaborative, software development How to apply: Please send cover letter, resume and contact information for three references to Dr. Karen Cranston, Training Coordinator and Bioinformatics Project Manager (karen.cranston at nescent.org); Please also complete the online application at the University of North Carolina HR website: http://bit.ly/r9HQ8r. Informal inquires or requests for additional information may be directed to Dr. Cranston by email or phone (+1-919-613-2275). Closing date is August 15, 2011. -- =========================================================== : Hilmar Lapp -:- Durham, NC -:- hlapp at drycafe dot net : =========================================================== From pjotr.public14 at thebird.nl Tue Aug 2 11:25:16 2011 From: pjotr.public14 at thebird.nl (Pjotr Prins) Date: Tue, 2 Aug 2011 13:25:16 +0200 Subject: [BioRuby] biogems.info In-Reply-To: <20110731181443.565a6fe0@mail.ingm.it> References: <20110730135448.GA17613@thebird.nl> <20110731181443.565a6fe0@mail.ingm.it> Message-ID: <20110802112516.GA1819@thebird.nl> http://biogems.info/ now has trends (based on 90d download ranking), DOI, and a marker for stable/testing. Pj. On Sun, Jul 31, 2011 at 08:14:43PM +0200, Raoul Bonnal wrote: > I like it :-) > > well done. > > -------------------------------------------------------------------------- > > From: Pjotr Prins [mailto:pjotr.public14 at thebird.nl] > To: bioruby [mailto:bioruby at lists.open-bio.org] > Sent: Sat, 30 Jul 2011 15:54:48 +0200 > Subject: [BioRuby] New site: http://biogems.info > > >From the Biogem project we have created Biogems.info > > [1]http://biogems.info/ > > which lists all available biogems. We have an amazing 21 new biogems, > since the introduction of the biogem tool and BioRuby plugins, > reflecting a 10x increase in new Ruby code for Bioinformatics in the > last 8 months, compared to the same period a year before. > > Keep them coming! > > PS The website can be improved. The code is at > [2]https://github.com/pjotrp/biogems.info. Feel free! > > PS If you want a different description / URLs for your gem, update > your project Rakefile and run 'rake gemspec ; rake release'. > > PS If your gem is not listed - host it on rubygems and pass the info > to me. The script automatically harvests gems that start with bio- > (bio and dash). > _______________________________________________ > BioRuby Project - [3]http://www.bioruby.org/ > BioRuby mailing list > [4]BioRuby at lists.open-bio.org > [5]http://lists.open-bio.org/mailman/listinfo/bioruby > > References > > Visible links > 1. http://biogems.info/ > 2. https://github.com/pjotrp/biogems.info > 3. http://www.bioruby.org/ > 4. mailto:BioRuby at lists.open-bio.org > 5. http://lists.open-bio.org/mailman/listinfo/bioruby From pjotr.public14 at thebird.nl Tue Aug 2 11:33:56 2011 From: pjotr.public14 at thebird.nl (Pjotr Prins) Date: Tue, 2 Aug 2011 13:33:56 +0200 Subject: [BioRuby] BioRuby gem hits 10K downloads today Message-ID: <20110802113356.GA2213@thebird.nl> Hats off! http://rubygems.org/gems/bio From bonnal at ingm.org Tue Aug 2 12:45:25 2011 From: bonnal at ingm.org (Raoul Bonnal) Date: Tue, 02 Aug 2011 14:45:25 +0200 Subject: [BioRuby] BioRuby gem hits 10K downloads today In-Reply-To: <20110802113356.GA2213@thebird.nl> Message-ID: Historic ?! :-) On 02/08/11 13.33, "Pjotr Prins" wrote: > Hats off! > > http://rubygems.org/gems/bio > _______________________________________________ > BioRuby Project - http://www.bioruby.org/ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby From bonnal at ingm.org Tue Aug 2 12:44:04 2011 From: bonnal at ingm.org (Raoul Bonnal) Date: Tue, 02 Aug 2011 14:44:04 +0200 Subject: [BioRuby] BioRuby gem hits 10K downloads today In-Reply-To: <20110802113356.GA2213@thebird.nl> Message-ID: Historical day. By tomorrow meta packages will be ready. On 02/08/11 13.33, "Pjotr Prins" wrote: > Hats off! > > http://rubygems.org/gems/bio > _______________________________________________ > BioRuby Project - http://www.bioruby.org/ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby From pjotr.public14 at thebird.nl Tue Aug 2 20:29:38 2011 From: pjotr.public14 at thebird.nl (Pjotr Prins) Date: Tue, 2 Aug 2011 22:29:38 +0200 Subject: [BioRuby] New site: http://biogems.info In-Reply-To: References: <20110730135448.GA17613@thebird.nl> Message-ID: <20110802202938.GA5550@thebird.nl> Hi Ben, Your SignalP gem has been marked as NEW. Gems less than one month old will be marked automatically. See http://biogems.info and http://gems.bioruby.org Pj. On Sun, Jul 31, 2011 at 10:54:37AM +1000, Ben Woodcroft wrote: > Nice idea Pjotr. Would it be easy and useful to make an RSS feed or > similar available? > ben > > On 31 July 2011 00:10, Francesco Strozzi <[1]francesco.strozzi at gmail.com> > wrote: > > Nice and well done!! > > Cheers > Francesco > > On Sat, Jul 30, 2011 at 15:54, Pjotr Prins > <[2]pjotr.public14 at thebird.nl>wrote: > > >From the Biogem project we have created Biogems.info > > > > [3]http://biogems.info/ > > > > which lists all available biogems. We have an amazing 21 new biogems, > > since the introduction of the biogem tool and BioRuby plugins, > > reflecting a 10x increase in new Ruby code for Bioinformatics in the > > last 8 months, compared to the same period a year before. > > > > Keep them coming! > > > > PS The website can be improved. The code is at > > [4]https://github.com/pjotrp/biogems.info. Feel free! > > > > PS If you want a different description / URLs for your gem, update > > your project Rakefile and run 'rake gemspec ; rake release'. > > > > PS If your gem is not listed - host it on rubygems and pass the info > > to me. The script automatically harvests gems that start with bio- > > (bio and dash). > > _______________________________________________ > > BioRuby Project - [5]http://www.bioruby.org/ > > BioRuby mailing list > > [6]BioRuby at lists.open-bio.org > > [7]http://lists.open-bio.org/mailman/listinfo/bioruby > > > > -- > Francesco > _______________________________________________ > BioRuby Project - [8]http://www.bioruby.org/ > BioRuby mailing list > [9]BioRuby at lists.open-bio.org > [10]http://lists.open-bio.org/mailman/listinfo/bioruby > > -- > Ben J Woodcroft, BE (Hons) > > PhD Candidate > Ralph Laboratory > The University of Melbourne > Melbourne, Australia > > tel: (+613) 8344 2319 > [11]b.woodcroft at pgrad.unimelb.edu.au > > References > > Visible links > 1. mailto:francesco.strozzi at gmail.com > 2. mailto:pjotr.public14 at thebird.nl > 3. http://biogems.info/ > 4. https://github.com/pjotrp/biogems.info > 5. http://www.bioruby.org/ > 6. mailto:BioRuby at lists.open-bio.org > 7. http://lists.open-bio.org/mailman/listinfo/bioruby > 8. http://www.bioruby.org/ > 9. mailto:BioRuby at lists.open-bio.org > 10. http://lists.open-bio.org/mailman/listinfo/bioruby > 11. mailto:b.woodcroft at pgrad.unimelb.edu.au From ktym at hgc.jp Tue Aug 2 21:47:19 2011 From: ktym at hgc.jp (Toshiaki Katayama) Date: Wed, 3 Aug 2011 06:47:19 +0900 Subject: [BioRuby] Fwd: [InterMine Dev] Ruby Client Library Released References: <20110802133111.GD18142@squirrel> Message-ID: <18C5D0FC-A2E9-47FE-A7C6-DCC77E1BD167@hgc.jp> FYI Begin forwarded message: > ???: Alex Kalderimis > ??: 2011?8?2? 22:31:12JST > ??: dev at intermine.org > ??: [InterMine Dev] Ruby Client Library Released > > Have a look at it here and let me know if anything is terribly > ske-wiff: > > The rubygems listing: > http://rubygems.org/search?query=intermine > > The hosted docs: (bio ones haven't been processed yet) > http://rubydoc.info/gems/intermine/0.98.05/file/README.rdoc > > Our own hosted docs > http://www.intermine.org/docs/ruby-docs/ > http://www.intermine.org/docs/ruby-bio-docs/ > > Wiki page coming shortly. > > Alex > > _______________________________________________ > dev mailing list > dev at intermine.org > http://mail.intermine.org/cgi-bin/mailman/listinfo/dev From ktym at hgc.jp Tue Aug 2 22:23:02 2011 From: ktym at hgc.jp (Toshiaki Katayama) Date: Wed, 3 Aug 2011 07:23:02 +0900 Subject: [BioRuby] BioRuby gem hits 10K downloads today In-Reply-To: References: Message-ID: <592B0F44-2767-4898-A23C-85B7E63155BB@hgc.jp> Wow, great news! >From the number of DLs in 2005 https://skitch.com/toshiakikatayama/fpgge/ I had almost correctly estimated the day of 10k DLs in 2006 https://skitch.com/toshiakikatayama/fpggq/ this means we will hit million DLs in coming five years. ;-p Toshiaki On 2011/08/02, at 21:44, Raoul Bonnal wrote: > Historical day. > By tomorrow meta packages will be ready. > > On 02/08/11 13.33, "Pjotr Prins" wrote: > >> Hats off! >> >> http://rubygems.org/gems/bio >> _______________________________________________ >> BioRuby Project - http://www.bioruby.org/ >> BioRuby mailing list >> BioRuby at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioruby > > > _______________________________________________ > BioRuby Project - http://www.bioruby.org/ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby From donttrustben at gmail.com Wed Aug 3 00:29:24 2011 From: donttrustben at gmail.com (Ben Woodcroft) Date: Wed, 3 Aug 2011 10:29:24 +1000 Subject: [BioRuby] New site: http://biogems.info In-Reply-To: <20110802202938.GA5550@thebird.nl> References: <20110730135448.GA17613@thebird.nl> <20110802202938.GA5550@thebird.nl> Message-ID: OK, Thanks. On 3 August 2011 06:29, Pjotr Prins wrote: > Hi Ben, > > Your SignalP gem has been marked as NEW. Gems less than one month old > will be marked automatically. > > See http://biogems.info and http://gems.bioruby.org > > Pj. > > On Sun, Jul 31, 2011 at 10:54:37AM +1000, Ben Woodcroft wrote: > > Nice idea Pjotr. Would it be easy and useful to make an RSS feed or > > similar available? > > ben > > > > On 31 July 2011 00:10, Francesco Strozzi <[1] > francesco.strozzi at gmail.com> > > wrote: > > > > Nice and well done!! > > > > Cheers > > Francesco > > > > On Sat, Jul 30, 2011 at 15:54, Pjotr Prins > > <[2]pjotr.public14 at thebird.nl>wrote: > > > >From the Biogem project we have created Biogems.info > > > > > > [3]http://biogems.info/ > > > > > > which lists all available biogems. We have an amazing 21 new > biogems, > > > since the introduction of the biogem tool and BioRuby plugins, > > > reflecting a 10x increase in new Ruby code for Bioinformatics in > the > > > last 8 months, compared to the same period a year before. > > > > > > Keep them coming! > > > > > > PS The website can be improved. The code is at > > > [4]https://github.com/pjotrp/biogems.info. Feel free! > > > > > > PS If you want a different description / URLs for your gem, update > > > your project Rakefile and run 'rake gemspec ; rake release'. > > > > > > PS If your gem is not listed - host it on rubygems and pass the > info > > > to me. The script automatically harvests gems that start with bio- > > > (bio and dash). > > > _______________________________________________ > > > BioRuby Project - [5]http://www.bioruby.org/ > > > BioRuby mailing list > > > [6]BioRuby at lists.open-bio.org > > > [7]http://lists.open-bio.org/mailman/listinfo/bioruby > > > > > > > -- > > Francesco > > _______________________________________________ > > BioRuby Project - [8]http://www.bioruby.org/ > > BioRuby mailing list > > [9]BioRuby at lists.open-bio.org > > [10]http://lists.open-bio.org/mailman/listinfo/bioruby > > > > -- > > Ben J Woodcroft, BE (Hons) > > > > PhD Candidate > > Ralph Laboratory > > The University of Melbourne > > Melbourne, Australia > > > > tel: (+613) 8344 2319 > > [11]b.woodcroft at pgrad.unimelb.edu.au > > > > References > > > > Visible links > > 1. mailto:francesco.strozzi at gmail.com > > 2. mailto:pjotr.public14 at thebird.nl > > 3. http://biogems.info/ > > 4. https://github.com/pjotrp/biogems.info > > 5. http://www.bioruby.org/ > > 6. mailto:BioRuby at lists.open-bio.org > > 7. http://lists.open-bio.org/mailman/listinfo/bioruby > > 8. http://www.bioruby.org/ > > 9. mailto:BioRuby at lists.open-bio.org > > 10. http://lists.open-bio.org/mailman/listinfo/bioruby > > 11. mailto:b.woodcroft at pgrad.unimelb.edu.au > -- Ben J Woodcroft, BE (Hons) PhD Candidate Ralph Laboratory The University of Melbourne Melbourne, Australia tel: (+613) 8344 2319 b.woodcroft at pgrad.unimelb.edu.au From pjotr.public14 at thebird.nl Wed Aug 3 08:35:12 2011 From: pjotr.public14 at thebird.nl (Pjotr Prins) Date: Wed, 3 Aug 2011 10:35:12 +0200 Subject: [BioRuby] New site: http://biogems.info In-Reply-To: References: <20110730135448.GA17613@thebird.nl> Message-ID: <20110803083512.GA8369@thebird.nl> On Sun, Jul 31, 2011 at 10:54:37AM +1000, Ben Woodcroft wrote: > Nice idea Pjotr. Would it be easy and useful to make an RSS feed or > similar available? RSS done: http://www.biogems.info/rss.xml Pj. From donttrustben at gmail.com Wed Aug 3 08:57:51 2011 From: donttrustben at gmail.com (Ben Woodcroft) Date: Wed, 3 Aug 2011 18:57:51 +1000 Subject: [BioRuby] New site: http://biogems.info In-Reply-To: <20110803083512.GA8369@thebird.nl> References: <20110730135448.GA17613@thebird.nl> <20110803083512.GA8369@thebird.nl> Message-ID: Score. Of course, now releasing the actual gem is more daunting and less low key for the authors.. On 3 August 2011 18:35, Pjotr Prins wrote: > On Sun, Jul 31, 2011 at 10:54:37AM +1000, Ben Woodcroft wrote: > > Nice idea Pjotr. Would it be easy and useful to make an RSS feed or > > similar available? > > RSS done: > > http://www.biogems.info/rss.xml > > Pj. > -- Ben J Woodcroft, BE (Hons) PhD Candidate Ralph Laboratory The University of Melbourne Melbourne, Australia tel: (+613) 8344 2319 b.woodcroft at pgrad.unimelb.edu.au From bonnal at ingm.org Wed Aug 3 10:37:52 2011 From: bonnal at ingm.org (Raoul Bonnal) Date: Wed, 03 Aug 2011 12:37:52 +0200 Subject: [BioRuby] IRC meeting Message-ID: Hi folks, I?d like to have an irc meeting tomorrow. server: irc.freenode.net channel: #bioruby time: 14:00 GMT Topics: * biogems.info: comments, ideas * plugins: update, guide lines for creating new plugins ( common namespace ?, plugin name), collaboration with other projects. * bioruby: general discussion about the project and future plans * gsoc: update Feel free to modify the topics and please give me a feedback here http://poll.pollcode.com/jZ8 -- Ra From tomoakin at kenroku.kanazawa-u.ac.jp Sat Aug 13 10:05:09 2011 From: tomoakin at kenroku.kanazawa-u.ac.jp (Tomoaki NISHIYAMA) Date: Sat, 13 Aug 2011 19:05:09 +0900 Subject: [BioRuby] Fastq.to_s Message-ID: <8F89F463-8DA4-421A-AC5E-1A7B20C02F6E@kenroku.kanazawa-u.ac.jp> Hi, For flatfiles I think its nice if we can output the original text entries as split. For example #!/bin/env ruby require 'bio' ff1 = Bio::FlatFile.open(nil, ARGV[0]) ff2 = Bio::FlatFile.open(nil, ARGV[1]) ff1.each_entry do |fe1| fe2 = ff2.next_entry puts fe1 puts fe2 end should be able to merge read1 and read2 in different file to a single file. This does work with fasta format but not with fastq format right now, because Bio::Fastq does not have to_s method. As Fastq does not hold really original data, reconstructing as the following patch is perhaps a good way (don't use twice memory just for the to_s function). Or, do we need to fold the sequence to some (original or fixed) length? diff --git a/lib/bio/db/fastq.rb b/lib/bio/db/fastq.rb index f913e6d..5ff1a15 100644 --- a/lib/bio/db/fastq.rb +++ b/lib/bio/db/fastq.rb @@ -407,6 +407,10 @@ class Fastq # raw sequence data as a String object attr_reader :sequence_string + def to_s + "@#{@definition}\n#{@sequence_string}\n+#{@definition2}\n#{@quality_string}\n" + end + # returns Bio::Sequence::NA def naseq unless defined? @naseq then Best regards, -- Tomoaki NISHIYAMA Advanced Science Research Center, Kanazawa University, 13-1 Takara-machi, Kanazawa, 920-0934, Japan From ngoto at gen-info.osaka-u.ac.jp Mon Aug 22 06:09:49 2011 From: ngoto at gen-info.osaka-u.ac.jp (Naohisa Goto) Date: Mon, 22 Aug 2011 15:09:49 +0900 Subject: [BioRuby] Fastq.to_s In-Reply-To: <8F89F463-8DA4-421A-AC5E-1A7B20C02F6E@kenroku.kanazawa-u.ac.jp> References: <8F89F463-8DA4-421A-AC5E-1A7B20C02F6E@kenroku.kanazawa-u.ac.jp> Message-ID: <20110822150948.256E.EEF6E030@gen-info.osaka-u.ac.jp> Hi, In this case, Bio::FlatFile#entry_raw, which returns the last entry's string in the flat-file object, is recommended, from the viewpoint of performance (not to create additional objects). modified example: require 'bio' ff1 = Bio::FlatFile.open(nil, ARGV[0]) ff2 = Bio::FlatFile.open(nil, ARGV[1]) ff1.each_entry do |fe1| fe1_raw = ff1.entry_raw fe2 = ff2.next_entry fe2_raw = ff2.entry_raw print fe1_raw print fe2 end Note that the example will not correctly work when the two files contain different number of sequences. I also agree Fastq#to_s as a convenience method regardless of performance. -- Naohisa Goto ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org > Hi, > > For flatfiles I think its nice if we can output the original text entries as split. > For example > > #!/bin/env ruby > > require 'bio' > > ff1 = Bio::FlatFile.open(nil, ARGV[0]) > ff2 = Bio::FlatFile.open(nil, ARGV[1]) > > ff1.each_entry do |fe1| > fe2 = ff2.next_entry > puts fe1 > puts fe2 > end > > should be able to merge read1 and read2 in different file to a single file. > This does work with fasta format but not with fastq format right now, because > Bio::Fastq does not have to_s method. As Fastq does not hold really original > data, reconstructing as the following patch is perhaps a good way (don't use > twice memory just for the to_s function). Or, do we need to fold the sequence > to some (original or fixed) length? > > diff --git a/lib/bio/db/fastq.rb b/lib/bio/db/fastq.rb > index f913e6d..5ff1a15 100644 > --- a/lib/bio/db/fastq.rb > +++ b/lib/bio/db/fastq.rb > @@ -407,6 +407,10 @@ class Fastq > # raw sequence data as a String object > attr_reader :sequence_string > > + def to_s > + "@#{@definition}\n#{@sequence_string}\n+#{@definition2}\n#{@quality_string}\n" > + end > + > # returns Bio::Sequence::NA > def naseq > unless defined? @naseq then > > Best regards, > -- > Tomoaki NISHIYAMA > > Advanced Science Research Center, > Kanazawa University, > 13-1 Takara-machi, > Kanazawa, 920-0934, Japan > From yannick.wurm at unil.ch Mon Aug 22 07:16:22 2011 From: yannick.wurm at unil.ch (Yannick Wurm) Date: Mon, 22 Aug 2011 15:16:22 +0800 Subject: [BioRuby] bio-relevant ruby-one-liners Message-ID: Hi List, More and more, I find myself using ruby one-liners to replace grep, sed, etc. Here's one I use to subset sequences from 454 based on length information in the header line: ruby -ne 'BEGIN{$/="\n>"}; length = $_.match(/length=(\d+)/)[1].to_i; print $_ if (300..320).include?(length) ' < my.fasta > subset.fasta I'm sure there's more elgant ways of generalizing & fool-proofing this. Whats your favorite bio-relevant ruby oneliner? Cheers, yannick FYI, the 454 read input FASTA file looks like this: >F07XJJT02F00DS length=421 xy=2354_2974 region=2 run=R_2009_08_22_19_24_45_ TCTCTCAGTGGTCAGGACTCTGTTAACTTACTGCCTGACTCGATTGATTTGGAGATCAGG [...] G >F07XJJT02F00E3 length=357 xy=2354_3021 region=2 run=R_2009_08_22_19_24_45_ TTTTTATTTTTTTTTTTTACTTTGTACAGCTTTATTAAGATCTAATAAAAATAGATTACA [...] CC >F07XJJT02F00EH length=490 xy=2354_2999 region=2 run=R_2009_08_22_19_24_45_ TCTAAATGTGTTATTAATTATTTTCAACTATTTATAACTATGTATAGTATTTACAATATT [...] TACTCAATTT >F07XJJT02F00ET length=93 xy=2354_3011 region=2 run=R_2009_08_22_19_24_45_ GATAGGCAGGGTTGTGCCATATATTTTAAGATTACGTCTATACCAGTTTTTACGTAAACA ATACGTGATGTTTANATGTAATGTAACGAATGT >F07XJJT02F00EV length=445 xy=2354_3013 region=2 run=R_2009_08_22_19_24_45_ TATTTTAATTGATATTATAATTTGTGTTGTATATATTTTTGCTTGTATCTTATAAATTAA [...] AATATAAAACAATTCAAAATAAATAAGCAAATTATTTACTTAAAA ----------------------------- Ant Genomes & Evolution http://yannick.poulet.org skype://yannickwurm ----------------------------- BLAST @ http://antgenomes.org From daniel.lundin at scilifelab.se Mon Aug 22 08:18:34 2011 From: daniel.lundin at scilifelab.se (Daniel Lundin) Date: Mon, 22 Aug 2011 10:18:34 +0200 Subject: [BioRuby] ActiveRecord classes for BioSQL? Message-ID: <4E5210DA.4060507@scilifelab.se> Hi everyone, I'm working on a couple of Rails applications that will one way or another be dependent on taxonomy and sequence data stored in a BioSQL schema database. For this I need to develop some (rather simple) ActiveRecord classes. I would of course like to be able to have the BioSQL schema loaded in some other database than the main application database, possibly using a different db engine on another computer. I'm a little concerned about the best way of packing up the classes (a Rails plugin seems best) and how to best deal with the fact that these classes will use another db connection than the main app. Is anyone doing something similar and can share experiences? Something like this would be nice to have in BioRuby, I think. /Daniel -- Daniel Lundin, Postdoc SciLifeLab, School of biotechnology, KTH Royal institute of technology, Stockholm, Sweden Postal address: Box 1031 171 21 Solna Sweden Visiting address: Tomtebodav?gen 23 A Mobile: +46 (0)708 123 922 Email: daniel.lundin at scilifelab.se From bonnal at ingm.org Mon Aug 22 09:28:49 2011 From: bonnal at ingm.org (Raoul Bonnal) Date: Mon, 22 Aug 2011 18:28:49 +0900 Subject: [BioRuby] ActiveRecord classes for BioSQL? In-Reply-To: <4E5210DA.4060507@scilifelab.se> Message-ID: Hi Daniel, actually BioSQL is support in Ruby using ActiveRecord https://github.com/bioruby/bioruby/blob/master/lib/bio/io/sql.rb and https://github.com/bioruby/bioruby/tree/master/lib/bio/io/biosql Please, check the reference schema because I'm not synched with the latest one, sorry too busy. If you want to update the library I'm more than happy. Then a feature which is still in experimental stage is the chance to create a bioruby-plugin which is a Rails Engine, so you can add there your own classes or code so that can be reused in multiple Rails applications. Here, https://github.com/helios/bioruby-gem/tree/rails_engine, you can find the git branch don't know if it is buggy, I must check. Let me know I'll try to provide as much support I can. -- Ra On 22/08/11 17.18, "Daniel Lundin" wrote: > Hi everyone, > > I'm working on a couple of Rails applications that will one way or > another be dependent on taxonomy and sequence data stored in a BioSQL > schema database. For this I need to develop some (rather simple) > ActiveRecord classes. I would of course like to be able to have the > BioSQL schema loaded in some other database than the main application > database, possibly using a different db engine on another computer. > > I'm a little concerned about the best way of packing up the classes (a > Rails plugin seems best) and how to best deal with the fact that these > classes will use another db connection than the main app. > > Is anyone doing something similar and can share experiences? > > Something like this would be nice to have in BioRuby, I think. > > /Daniel From p.j.a.cock at googlemail.com Fri Aug 26 14:56:15 2011 From: p.j.a.cock at googlemail.com (Peter Cock) Date: Fri, 26 Aug 2011 15:56:15 +0100 Subject: [BioRuby] BioRuby 1.4.2 released Message-ID: Hi all, For those who don't subscribe to the RSS feed or missed it on twitter, BioRuby 1.4.2 was released earlier today: http://news.open-bio.org/news/2011/08/bioruby-1-4-2-released/ When Goto-san announced at the end of the BioHackathon today in Kyoto that the release would be "soon", I didn't expect it to be this soon - I only just installed BioRuby a few days ago, and now it is out of date ;-) Omedetou! Peter From ngoto at gen-info.osaka-u.ac.jp Fri Aug 26 17:49:32 2011 From: ngoto at gen-info.osaka-u.ac.jp (Naohisa Goto) Date: Sat, 27 Aug 2011 02:49:32 +0900 Subject: [BioRuby] BioRuby 1.4.2 released Message-ID: <20110827024931.6C42.EEF6E030@gen-info.osaka-u.ac.jp> Hi, all, We are pleased to announce the release of BioRuby 1.4.2. This new release fixes bugs existed in 1.4.1 and adds new features and improvement of performance. Tar.gz file: http://bioruby.org/archive/bioruby-1.4.2.tar.gz Gem file: http://bioruby.org/archive/gems/bio-1.4.2.gem We also put RubyGems pacakge at RubyForge and RubyGems.org. You can easily install by using RubyGems. First, check the version number by using search command: % gem search --remote bio and find ?bio (1.4.2)? in the list. Then, % sudo gem install bio Here is a brief summary of changes. Speed-up of Bio::RestrictionEnzyme::Analysis.cut: The new code is 50 to 80 fold faster than the previous code when cutting 1Mbp sequence running on Ruby 1.9.2p180. The code is written by Tomoaki NISHIYAMA and Naohisa Goto. New classes Bio::DDBJ::REST, REST interface for DDBJ Web API for Biology (WABI) web service in additon to SOAP. Currently, only selected APIs are implemented. Bio::Blast with remote DDBJ server uses REST instead of SOAP because Soap4r (SOAP library for Ruby) does not work well with Ruby 1.9. We can now use remote DDBJ BLAST server with Ruby 1.9. The Tutorial.rd is updated by Pjotr Prins and Michael O?Keefe. Many unit tests are added for Bio::GenBank, Bio::GenPept, Bio::NBRF, Bio::PDB and so on. Most of them are developed by Kazuhiro Hayashi during the Google Summer of Code 2010. New methods: Bio::Fastq#to_s, Bio::NCBI::REST::EFetch.nucleotide, Bio::NCBI::REST::EFetch.protein. Bug fixes: * Bio::Blast: Failure of remote BLAST execution is fixed, due to the changes in GenomeNet and DDBJ. * Bio::Blast: When executing remote BLAST with ?genomenet? server, options ?-b? and ?-v? are now correctly used to limit the number of hits to be reported. * Bio::SPTR (Bio::UniProt): Due to the UniProtKB format changes, ID, DE, and WEB RESOURCE of CC lines were not correctly parsed. * Bio::Reference#pubmed_url: Updated to follow recent NCBI changes. * Bio::Newick#reparse failure. * Bio::MEDLINE#reference: doi field should be filled. * Bio::Reference#endnote fails when url is not set. * Bio::FastaFormat#query passes nil to the given factory object. * BioRuby Shell: efetch(), getent(), and demo() fail. In addition, many changes have been made, including incompatible changes. For more information, see RELEASE_NOTES.rdoc and ChangeLog. Acknowledgments: Thanks to all persons reporting issues and/or submitting patches. In addition, thanks to NDBC / DBCLS BioHackathon2011 participants and organizers who try BioRuby during the BioHackathon2011. Hope you enjoy. -- Naohisa Goto ng at bioruby.org / ngoto at gen-info.osaka-u.ac.jp From ngoto at gen-info.osaka-u.ac.jp Fri Aug 26 17:52:25 2011 From: ngoto at gen-info.osaka-u.ac.jp (Naohisa Goto) Date: Sat, 27 Aug 2011 02:52:25 +0900 Subject: [BioRuby] BioRuby 1.4.2 released In-Reply-To: References: Message-ID: <20110827025225.6C45.EEF6E030@gen-info.osaka-u.ac.jp> Hi Peter, Thanks!!! I forgot to post an announce to the mailing list. Naohisa Goto ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org > Hi all, > > For those who don't subscribe to the RSS feed or missed it on twitter, > BioRuby 1.4.2 was released earlier today: > > http://news.open-bio.org/news/2011/08/bioruby-1-4-2-released/ > > When Goto-san announced at the end of the BioHackathon today in Kyoto that > the release would be "soon", I didn't expect it to be this soon - I only > just installed BioRuby a few days ago, and now it is out of date ;-) > > Omedetou! > > Peter From tomoakin at kenroku.kanazawa-u.ac.jp Mon Aug 29 01:04:54 2011 From: tomoakin at kenroku.kanazawa-u.ac.jp (Tomoaki NISHIYAMA) Date: Mon, 29 Aug 2011 10:04:54 +0900 Subject: [BioRuby] Fastq.to_s In-Reply-To: <20110822150948.256E.EEF6E030@gen-info.osaka-u.ac.jp> References: <8F89F463-8DA4-421A-AC5E-1A7B20C02F6E@kenroku.kanazawa-u.ac.jp> <20110822150948.256E.EEF6E030@gen-info.osaka-u.ac.jp> Message-ID: <6D1AEB91-9C44-462A-9D8A-D4A381C012AE@kenroku.kanazawa-u.ac.jp> Hi Goto-san, Thank you, incorporating the fastq.to_s and releasing 1.4.2! With 1.4.2, the following two programs run about the same time; 56m38s vs 56m24s user time for a pair of 22-GB fastq files (single measurement). So, we perhaps can simply choose one easier to read, write, or explain;-) flatmerge #!/bin/env ruby require 'bio' ff1 = Bio::FlatFile.open(nil, ARGV[0]) ff2 = Bio::FlatFile.open(nil, ARGV[1]) ff1.each_entry do |fe1| fe2 = ff2.next_entry puts fe1.to_s puts fe2.to_s end flatmerge2 #!/bin/env ruby require 'bio' ff1 = Bio::FlatFile.open(nil, ARGV[0]) ff2 = Bio::FlatFile.open(nil, ARGV[1]) ff1.each_entry do |fe1| print ff1.entry_raw fe2 = ff2.next_entry print ff2.entry_raw end -- Tomoaki NISHIYAMA Advanced Science Research Center, Kanazawa University, 13-1 Takara-machi, Kanazawa, 920-0934, Japan On 2011/08/22, at 15:09, Naohisa Goto wrote: > Hi, > > In this case, Bio::FlatFile#entry_raw, which returns the last > entry's string in the flat-file object, is recommended, from > the viewpoint of performance (not to create additional objects). > > modified example: > require 'bio' > > ff1 = Bio::FlatFile.open(nil, ARGV[0]) > ff2 = Bio::FlatFile.open(nil, ARGV[1]) > > ff1.each_entry do |fe1| > fe1_raw = ff1.entry_raw > fe2 = ff2.next_entry > fe2_raw = ff2.entry_raw > print fe1_raw > print fe2 > end > > Note that the example will not correctly work when the > two files contain different number of sequences. > > I also agree Fastq#to_s as a convenience method > regardless of performance. > > -- > Naohisa Goto > ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org > >> Hi, >> >> For flatfiles I think its nice if we can output the original text entries as split. >> For example >> >> #!/bin/env ruby >> >> require 'bio' >> >> ff1 = Bio::FlatFile.open(nil, ARGV[0]) >> ff2 = Bio::FlatFile.open(nil, ARGV[1]) >> >> ff1.each_entry do |fe1| >> fe2 = ff2.next_entry >> puts fe1 >> puts fe2 >> end >> >> should be able to merge read1 and read2 in different file to a single file. >> This does work with fasta format but not with fastq format right now, because >> Bio::Fastq does not have to_s method. As Fastq does not hold really original >> data, reconstructing as the following patch is perhaps a good way (don't use >> twice memory just for the to_s function). Or, do we need to fold the sequence >> to some (original or fixed) length? >> >> diff --git a/lib/bio/db/fastq.rb b/lib/bio/db/fastq.rb >> index f913e6d..5ff1a15 100644 >> --- a/lib/bio/db/fastq.rb >> +++ b/lib/bio/db/fastq.rb >> @@ -407,6 +407,10 @@ class Fastq >> # raw sequence data as a String object >> attr_reader :sequence_string >> >> + def to_s >> + "@#{@definition}\n#{@sequence_string}\n+#{@definition2}\n#{@quality_string}\n" >> + end >> + >> # returns Bio::Sequence::NA >> def naseq >> unless defined? @naseq then >> >> Best regards, >> -- >> Tomoaki NISHIYAMA >> >> Advanced Science Research Center, >> Kanazawa University, >> 13-1 Takara-machi, >> Kanazawa, 920-0934, Japan >> > > > From michalkoziarski at gmail.com Mon Aug 29 16:16:57 2011 From: michalkoziarski at gmail.com (=?ISO-8859-2?Q?Micha=B3_Koziarski?=) Date: Mon, 29 Aug 2011 18:16:57 +0200 Subject: [BioRuby] [GSoC] bio-vis Message-ID: Hi everyone, as GSoC is over, I would like to share my work with you and, hopefully, get some feedback on it. General info and some samples are available at http://bioruby.open-bio.org/wiki/GSoC:Bio-images Code itself is stored at github: - visualization package at https://github.com/e-mka/bioruby-vis - image browser at https://github.com/e-mka/bioruby-vis-browser Big thanks for my mentors, Raoul Bonnal and Francesco Strozzi. They helped me a lot with the project, I wouldn't be able to complete it without them. Thank you! Micha?