[BioRuby] Bioruby HTML output

Toshiaki Katayama ktym at hgc.jp
Tue Jan 19 07:41:31 EST 2010


Dear Pj and all,

I'm sorry that I could not spare enough time to follow this thread
but I'd like to add some comments.

Firstly, I don't like to use the method name 'to_html' as we already
deprecated to use 'to_fasta' because 'to_' is reserved for conversion
of the class in Ruby's convention (above two methods just convert
String to String).

We (Nakao-san and me) are now working to improve our TogoWS service
(http://togows.dbcls.jp) by supporting RDF output. I hope to propose
a generalized way to achieve this (hopefully, before the BioHackathon
2010 http://hackathon3.dbcls.jp/).

Our current attempt is to have an 'output' method in the Bio::DB class
and each sub-class implements actual 'output_*' methods relevant
to appropriate formats.

# This kind of requirements may also be true for classes other than
# the Bio::DB (for example, Bio::Sequence, Alignment, Newick classes),
# so we may put this interface in the top level class (Bio::Root?),
# which does not exist for now, though.

In TogoWS, we internally use the BioRuby library, and the URI

http://togows.dbcls.jp/entry/exampledb/1/definition

is sent to the 'definition' method defined in the Bio::ExampleDB class.
Similarly, we can map '.' notation in the following URLs to call output
method using their suffix as a format specifier.

http://togows.dbcls.jp/entry/exampledb/1.rdf
http://togows.dbcls.jp/entry/exampledb/1.fasta

Therefore, these can be mapped to output(:rdf) and output(:fasta) method
calls to the Bio::ExampleDB class, respectively.

All we need to do is to add these methods in every database class
comprehensively.

I think this is simple enough and beautiful.
I'll attach a primitive pseudo code in below.
Comments are welcome.

Regards,
Toshiaki Katayama


module Bio
  class DB
    def output(format)
      send("output_#{format.to_s.downcase}")
    end
  end
end

module Bio
  class ExampleDB < DB
    # output sequence of the entry in FASTA format
    def output_fasta
      ">#{@entry_id} #{@definition}\n#{@sequence}\n"
    end

    # output contents of the entry in RDF (N3) format
    def output_rdf
      prefix_subject   = "http://togows.dbcls.jp/entry/exampledb"
      prefix_predicate = "http://togows.dbcls.jp/ontology/exampledb"
      "<#{prefix_subject}/#{@entry_id}>\t<#{prefix_predicate}#definition>\t#{@definition} .\n" +
      "<#{prefix_subject}/#{@entry_id}>\t<#{prefix_predicate}#sequence>\t#{@sequence} .\n"
    end

    # output contents of the entry in HTML format
    def output_html
      "<h1>#{@entry_id}</h1> ... blah, blah, blah ..."
    end
  end
end

entry = Bio::ExampleDB.new(str)

entry.output(:fasta)
# =>
# >ENTRY_ID
# atgcatgcatgcatgcatgc

entry.output(:rdf)
# =>
# <http://togows.dbcls.jp/entry/exampledb/ENTRY_ID>	<http://togows.dbcls.jp/ontology/exampledb#definition>	"DEFINITION" .
# <http://togows.dbcls.jp/entry/exampledb/ENTRY_ID>	<http://togows.dbcls.jp/ontology/exampledb#seqence>	"atgcatgcatgcatgc" .



On 2010/01/19, at 19:50, Pjotr Prins wrote:

> Based on Tomoaki's comments I propose the following:
> 
> The requirements are:
> 
>  A- input objects that know about HTML should generate that
>  B- other input files get escapeHTML(object.to_s)
> 
> For a container/displayer to recognize object A, object A should have
> a method to_html:
> 
>  class ObjectA 
>    def to_html
>    end
>  end
> 
> If to_html does not exist to_s is called - and escaped. The principle
> will go into a mixin for the container class.
> 
> Everyone OK with this? 
> 
> Pj.
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby




More information about the BioRuby mailing list