From ngoto at gen-info.osaka-u.ac.jp  Tue Apr  1 06:59:24 2008
From: ngoto at gen-info.osaka-u.ac.jp (Naohisa GOTO)
Date: Tue, 1 Apr 2008 19:59:24 +0900
Subject: [BioRuby] Bio::PDB parsing problem (1B2M)
In-Reply-To: <47F19A16.1000004@gmail.com>
References: <47ED7EEB.2080607@gmail.com>
	<AD709955-C1CA-4BAB-858B-24F942880EB9@ruggedtextile.com>
	<47F19A16.1000004@gmail.com>
Message-ID: <20080401105925.188FA1CBC593@idnmail.gen-info.osaka-u.ac.jp>

Hi Semin,

Thank you for reporting bugs and patches.

The patch chain.diff seems good. 
I changed only to capture ArgumentError and committed into CVS.
In addition, Bio::PDB#seqres is also changed because the
Bio::AminoAcid.three2one is also used in the method.

The patch pdb.diff would work in most cases, but might break things
in some rare cases. I inserted "cResidue = nil" and "cLigand = nil"
in the place after the cChain have been changed, and committed into CVS.

Please see changes in below CVS commit mail.
http://lists.open-bio.org/pipermail/bioruby-cvs/2008-April/001606.html

Cheers,

Naohisa Goto
ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org


On Tue, 01 Apr 2008 03:12:38 +0100
Semin Lee <seminlee at gmail.com> wrote:

> Hi AlexG,
> 
> Please find attached two patch files. I don't think those patches are 
> ideal solution, but it seems working fine. As for the 'aaseq' method of 
> Chain class, I think it would be nice to have more abstracted method 
> like 'seq', so it works for any kinds of polymers in PDB.
> 
> Cheers,
> Semin
> 
> 
> Alex Gutteridge wrote:
> > Hi Semin,
> >
> > Definately a parser error - the combined HETATM/ATOM chains are 
> > confusing it, but they shouldn't. If you have the time and the 
> > inclination then patches are very welcome. If not, I can try and take 
> > a look next week.
> >
> > AlexG
> >
> > On 28 Mar 2008, at 23:27, Semin Lee wrote:
> >> Hi guys,
> >>
> >> I've got some problems when parsing 1B2M PDB file using Bio::PDB. It 
> >> doesn't seem to parse chain C to E properly. I'm currently using 
> >> BioRuby gem ver. 1.2.1 and Ruby 1.8.6 on Mac OS X Leopard.
> >>
> >> >> require "bio"
> >> => true
> >> >> require "open-uri"
> >> => true
> >> >> pdb = 
> >> Bio::PDB.new(open("http://www.rcsb.org/pdb/files/1b2m.pdb").read)
> >> => #<Bio::PDB entry_id="1B2M">
> >> >> p pdb.models.first.chains
> >> ArgumentError: ArgumentError
> >>       from 
> >> /opt/local/lib/ruby/gems/1.8/gems/bio-1.2.1/lib/bio/data/aa.rb:184:in 
> >> `three2one'
> >>       from 
> >> /opt/local/lib/ruby/gems/1.8/gems/bio-1.2.1/lib/bio/db/pdb/chain.rb:192:in 
> >> `aaseq'
> >>       from 
> >> /opt/local/lib/ruby/gems/1.8/gems/bio-1.2.1/lib/bio/db/pdb/chain.rb:186:in 
> >> `each'
> >>       from 
> >> /opt/local/lib/ruby/gems/1.8/gems/bio-1.2.1/lib/bio/db/pdb/chain.rb:186:in 
> >> `aaseq'
> >>       from 
> >> /opt/local/lib/ruby/gems/1.8/gems/bio-1.2.1/lib/bio/db/pdb/chain.rb:178:in 
> >> `inspect'
> >>       from (irb):4:in `p'
> >>       from (irb):4
> >> >>
> >>
> >> a strange error occurred, but I just overrided(?) 'aaseq' method to 
> >> see what happens,
> >>
> >> >> module Bio
> >> >>   class PDB
> >> >>     class Chain
> >> >>       def aaseq
> >> >>         ""
> >> >>         end
> >> >>       end
> >> >>     end
> >> >>   end
> >> => nil
> >> >> pp pdb.models.first.chains
> >> [#<Bio::PDB::Chain id="A" model.serial=nil residues.size=104 
> >> heterogens.size=0 aaseq="">,
> >> #<Bio::PDB::Chain id="B" model.serial=nil residues.size=104 
> >> heterogens.size=0 aaseq="">,
> >> #<Bio::PDB::Chain id="C" model.serial=nil residues.size=1 
> >> heterogens.size=1 aaseq="">,
> >> #<Bio::PDB::Chain id="D" model.serial=nil residues.size=0 
> >> heterogens.size=0 aaseq="">,
> >> #<Bio::PDB::Chain id="E" model.serial=nil residues.size=0 
> >> heterogens.size=0 aaseq="">,
> >> #<Bio::PDB::Chain id=" " model.serial=nil residues.size=0 
> >> heterogens.size=92 aaseq="">]
> >> => nil
> >> >>
> >>
> >> Now it doesn't complain, but Bio::PDB::Chain for chain D and E have 
> >> wrong number of residues and heterogens. In the 1B2M PDB file, each 
> >> chain D and E also has a RNA residue and a heterogen, U34, just like 
> >> chain C. However, Bio::PDB::Chain for chain D and E have no residues 
> >> and heterogens. Does anyone have any ideas? Or, am I missing something?
> >>
> >> Cheers,
> >> Semin
> >>
> >> _______________________________________________
> >> BioRuby mailing list
> >> BioRuby at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioruby
> >>
> >
> 
> 

From pathoquest at gmail.com  Sun Apr  6 13:54:49 2008
From: pathoquest at gmail.com (bio scientist)
Date: Sun, 6 Apr 2008 10:54:49 -0700
Subject: [BioRuby] getting started with BioRuby
Message-ID: <8d4642290804061054t1b45d37ay54a556abedf75936@mail.gmail.com>

Dear All,

This is my first mail to the group. YARN (yet another ruby nuby). :-)

Ever since Ruby has taken over the programming world, an increasing number
of biologists have also adapted Ruby as a language of their choice. Among
these is a generation of biologists whose first programming language is
Ruby: the so-called 'people-who-don't-know
-the-pain-of-programming-in-Java/Perl'. I belong to this category and am
trying to learn Ruby, BioRuby and Rails for my work. I wish to learn more by
interacting with the BioRuby Gurus and give back to the community what I
have learnt. That prologue was to make the point that my questions are of
the basic kind, while most posts here seem to be coming from and for coders.
So, please bear with me and have the patience to clear my doubts.

Thanks a ton to Katayama, Goto and Prins for the tutorials.

---------------------------------------------------------------------------------------------------------------
I have installed Ruby 1.8.6 and followed the instructions to install 'bio'
and 'bioruby' via gems. Now, I can see the '*bioruby>*' prompt and am able
to do the simple examples like translation, complement, GC% etc. However, I
am unable to work with a saved program as in the example copy -pasted below
from http://dev.bioruby.org/wiki/en/?Tutorial.rd:


In most cases, sequences are read from files or retrieved from databases.
For example:

require 'bio'

input_seq = ARGF.read       # reads all files in arguments

my_naseq = Bio::Sequence::NA.new(input_seq)
my_aaseq = my_naseq.translate

puts my_aaseq

Save the program as na2aa.rb. Prepare a nucleic acid sequence described
below and saves it as my_naseq.txt:

gtggcgatctttccgaaagcgatgactggagcgaagaaccaaagcagtgacatttgtctg
atgccgcacgtaggcctgataagacgcggacagcgtcgcatcaggcatcttgtgcaaatg
tcggatgcggcgtga

na2aa.rb translates a nucleic acid sequence to a protein sequence. For
example, translates my_naseq.txt:

% ruby na2aa.rb my_naseq.txt

---------------------------------------------------------------------------------------------------------
I saved the files as per the example, but when I try to open the file using
bioruby>na2aa.rb, it gives me an error message saying '* undefined local
variable or method'na2aa'* for main:Object.

Can you please tell me what I should do?
--------------------------------------------------------------------------------------------------------

Also, could you please throw some more light on saving .seq sequences from
NCBI's ftp site? This is in reference to the Parsing example in the tutorial
:
Parsing GenBank data (Bio::GenBank class)

We assume that you already have some GenBank data files. (If you don't,
download some .seq files from ftp://ftp.ncbi.nih.gov/genbank/).As an example
we fetch the ID, definition and sequence of each entry from the GenBank
format and convert it to FASTA. This is also an example script in the
BioRuby distribution.

A first attempt could be to use the Bio::GenBank class for reading in the
data:

#!/usr/bin/env ruby

require 'bio'

# Read all lines from STDIN split by the GenBank delimiter
while entry = gets(Bio::GenBank::DELIMITER)
  gb = Bio::GenBank.new(entry)      # creates GenBank object

  print ">#{gb.accession} "         # Accession
  puts gb.definition                # Definition
  puts gb.naseq                     # Nucleic acid sequence
                                    # (Bio::Sequence::NA object)
end
----------------------------------------------------------------------------------------------------------
Thanks in advance,
KK

From pjotr2008 at thebird.nl  Sun Apr  6 17:21:19 2008
From: pjotr2008 at thebird.nl (Pjotr Prins)
Date: Sun, 6 Apr 2008 23:21:19 +0200
Subject: [BioRuby] getting started with BioRuby
In-Reply-To: <8d4642290804061054t1b45d37ay54a556abedf75936@mail.gmail.com>
References: <8d4642290804061054t1b45d37ay54a556abedf75936@mail.gmail.com>
Message-ID: <20080406212119.GA13586@thebird.nl>

On Sun, Apr 06, 2008 at 10:54:49AM -0700, bio scientist wrote:
> the basic kind, while most posts here seem to be coming from and for coders.
> So, please bear with me and have the patience to clear my doubts.

What doubts ;-). There should be no doubts - there is only one true
gospel.

> Thanks a ton to Katayama, Goto and Prins for the tutorials.

Well, we do what we can... and perhaps, we could do a little more!

> ---------------------------------------------------------------------------------------------------------------
> I have installed Ruby 1.8.6 and followed the instructions to install 'bio'
> and 'bioruby' via gems. Now, I can see the '*bioruby>*' prompt and am able
> to do the simple examples like translation, complement, GC% etc. However, I
> am unable to work with a saved program as in the example copy -pasted below
> from http://dev.bioruby.org/wiki/en/?Tutorial.rd:
> 
> 
> In most cases, sequences are read from files or retrieved from databases.
> For example:
> 
> require 'bio'
> 
> input_seq = ARGF.read       # reads all files in arguments
> 
> my_naseq = Bio::Sequence::NA.new(input_seq)
> my_aaseq = my_naseq.translate
> 
> puts my_aaseq
> 
> Save the program as na2aa.rb. Prepare a nucleic acid sequence described
> below and saves it as my_naseq.txt:
> 
> gtggcgatctttccgaaagcgatgactggagcgaagaaccaaagcagtgacatttgtctg
> atgccgcacgtaggcctgataagacgcggacagcgtcgcatcaggcatcttgtgcaaatg
> tcggatgcggcgtga
> 
> na2aa.rb translates a nucleic acid sequence to a protein sequence. For
> example, translates my_naseq.txt:
> 
> % ruby na2aa.rb my_naseq.txt
> 
> ---------------------------------------------------------------------------------------------------------
> I saved the files as per the example, but when I try to open the file using
> bioruby>na2aa.rb, it gives me an error message saying '* undefined local
> variable or method'na2aa'* for main:Object.

The bioruby shell is correct. You are trying something that is not
ruby, or Ruby shell, but rather a shell command. That may sound
weird, and I guess we should make the Tutorial more accurate.

You can run Ruby from the command line - and feed it na2aa.rb as a
command. So not from within the Ruby shell, but from the Unix (or
cygwin) command prompt.

> Can you please tell me what I should do?
> --------------------------------------------------------------------------------------------------------
> 
> Also, could you please throw some more light on saving .seq sequences from
> NCBI's ftp site? This is in reference to the Parsing example in the tutorial
> :
> Parsing GenBank data (Bio::GenBank class)
> 
> We assume that you already have some GenBank data files. (If you don't,
> download some .seq files from ftp://ftp.ncbi.nih.gov/genbank/).As an example
> we fetch the ID, definition and sequence of each entry from the GenBank
> format and convert it to FASTA. This is also an example script in the
> BioRuby distribution.
> 
> A first attempt could be to use the Bio::GenBank class for reading in the
> data:
> 
> #!/usr/bin/env ruby
> 
> require 'bio'
> 
> # Read all lines from STDIN split by the GenBank delimiter
> while entry = gets(Bio::GenBank::DELIMITER)
>   gb = Bio::GenBank.new(entry)      # creates GenBank object
> 
>   print ">#{gb.accession} "         # Accession
>   puts gb.definition                # Definition
>   puts gb.naseq                     # Nucleic acid sequence
>                                     # (Bio::Sequence::NA object)
> end
> ----------------------------------------------------------------------------------------------------------
> Thanks in advance,
> KK

again, this is a shell thing. When you have .seq files on your file
system you can parse them with these commands. Download .seq files
from NCBI - maybe someone has a link - and run the Ruby program from
the command line.

The command line is king - there is a tutorial here:

  http://www.linuxcommand.org/learning_the_shell.php

you can run Ruby from the command line - that is the missing link.

Pj (aka prins)

> _______________________________________________
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby

From pathoquest at gmail.com  Wed Apr  9 15:50:25 2008
From: pathoquest at gmail.com (bio scientist)
Date: Wed, 9 Apr 2008 12:50:25 -0700
Subject: [BioRuby] getting started with BioRuby
Message-ID: <8d4642290804091250g68780427w77c2c9d4bf15fda6@mail.gmail.com>

Thanks a lot for the encouragement and responses! And for helping me to get
started. So, I was making the mistake of running the examples from within
the shell. Once I changed that to doing it from command line, it works fine.

Also, thanks Jan. I was able to get to GenBank and get the .seq files, so I
was able to do those examples as well.

Wow, it feels so good to actually see things working and the ATGC's
scrolling past!

With the permission of the authors of the tutorial, I would like to
incorporate and show those examples in my blog. As I learn each new thing, I
would want to try and put them online for other programming newbies to
understand.

(Just an observation: I tried the examples on Windows. Where Ruby is
installed independently, things work fine, but no so with Instant Rails.
Maybe I am missing something, but  wanted to share anyway)

KK

From pjotr2008 at thebird.nl  Thu Apr 10 02:42:04 2008
From: pjotr2008 at thebird.nl (Pjotr Prins)
Date: Thu, 10 Apr 2008 08:42:04 +0200
Subject: [BioRuby] getting started with BioRuby
In-Reply-To: <8d4642290804091250g68780427w77c2c9d4bf15fda6@mail.gmail.com>
References: <8d4642290804091250g68780427w77c2c9d4bf15fda6@mail.gmail.com>
Message-ID: <20080410064204.GA22995@thebird.nl>

Sure, you can post to your blog! In fact, if you think there are
things that can be improved in the tutorial just mail them to me -
I'll try and update.

Pj.

On Wed, Apr 09, 2008 at 12:50:25PM -0700, bio scientist wrote:
> Thanks a lot for the encouragement and responses! And for helping me to get
> started. So, I was making the mistake of running the examples from within
> the shell. Once I changed that to doing it from command line, it works fine.
> 
> Also, thanks Jan. I was able to get to GenBank and get the .seq files, so I
> was able to do those examples as well.
> 
> Wow, it feels so good to actually see things working and the ATGC's
> scrolling past!
> 
> With the permission of the authors of the tutorial, I would like to
> incorporate and show those examples in my blog. As I learn each new thing, I
> would want to try and put them online for other programming newbies to
> understand.
> 
> (Just an observation: I tried the examples on Windows. Where Ruby is
> installed independently, things work fine, but no so with Instant Rails.
> Maybe I am missing something, but  wanted to share anyway)
> 
> KK
> _______________________________________________
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby

From shameer at ncbs.res.in  Thu Apr 10 02:32:04 2008
From: shameer at ncbs.res.in (K. Shameer)
Date: Thu, 10 Apr 2008 12:02:04 +0530 (IST)
Subject: [BioRuby] How to renumber a PDB file using BioRuby ?
Message-ID: <38921.192.168.1.1.1207809124.squirrel@mail.ncbs.res.in>

Dear All,

I have  a pdb file ( in perfect pdb format, no hetatm, no solvent, single
chain file). I need to renumber the whole pdb file, for example if my
input file is 1CRN.pdb and it starts with residue number 1, I need to
renumber them so that first resiude number will be 12, next 13, 14... like
that. I want to know if I can specifically access the residue number and
increment it from first residue using my new number (here it will be
residue_number  +  12)and regenerate the file.

Anybody had tried this before,

Thanks in advance for any help,
K. Shameer


From yjchen at reciprocallattice.com  Thu Apr 10 04:14:57 2008
From: yjchen at reciprocallattice.com (Yen-Ju Chen)
Date: Thu, 10 Apr 2008 16:14:57 +0800
Subject: [BioRuby] How to renumber a PDB file using BioRuby ?
In-Reply-To: <38921.192.168.1.1.1207809124.squirrel@mail.ncbs.res.in>
References: <38921.192.168.1.1.1207809124.squirrel@mail.ncbs.res.in>
Message-ID: <bd370ace0804100114q21f02f2dr1f12b57b8b49877b@mail.gmail.com>

This is how I do it for atom number. You probably can find a way for residues.

require 'bio'

file = File.new('a.pdb').gets(nil)
structure = Bio::PDB.new(file)

structure.each do |model|
 model.each do |chain|
 chain.each do |residue|
 residue.each do |atom|
 atom.resSeq += 400
 end
 end
 end
end

File.open('x.pdb', 'w') do |file|
 file << structure.to_s
end

Yen-Ju

On Thu, Apr 10, 2008 at 2:32 PM, K. Shameer <shameer at ncbs.res.in> wrote:
> Dear All,
>
> I have  a pdb file ( in perfect pdb format, no hetatm, no solvent, single
> chain file). I need to renumber the whole pdb file, for example if my
> input file is 1CRN.pdb and it starts with residue number 1, I need to
> renumber them so that first resiude number will be 12, next 13, 14... like
> that. I want to know if I can specifically access the residue number and
> increment it from first residue using my new number (here it will be
> residue_number  +  12)and regenerate the file.
>
> Anybody had tried this before,
>
> Thanks in advance for any help,
> K. Shameer
>
> _______________________________________________
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>

From alexg at ruggedtextile.com  Thu Apr 10 04:29:07 2008
From: alexg at ruggedtextile.com (Alex Gutteridge)
Date: Thu, 10 Apr 2008 09:29:07 +0100
Subject: [BioRuby] How to renumber a PDB file using BioRuby ?
In-Reply-To: <38921.192.168.1.1.1207809124.squirrel@mail.ncbs.res.in>
References: <38921.192.168.1.1.1207809124.squirrel@mail.ncbs.res.in>
Message-ID: <5737E29D-6ABE-4474-BCD2-A75AE8AB3AEE@ruggedtextile.com>

On 10 Apr 2008, at 07:32, K. Shameer wrote:
> Dear All,
>
> I have  a pdb file ( in perfect pdb format, no hetatm, no solvent,  
> single
> chain file). I need to renumber the whole pdb file, for example if my
> input file is 1CRN.pdb and it starts with residue number 1, I need to
> renumber them so that first resiude number will be 12, next 13,  
> 14... like
> that. I want to know if I can specifically access the residue number  
> and
> increment it from first residue using my new number (here it will be
> residue_number  +  12)and regenerate the file.
>
> Anybody had tried this before,
>
> Thanks in advance for any help,
> K. Shameer
>
> _______________________________________________
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>


hi,

You have to alter the number by atom rather than by residue. Altering  
the residue object directly used to work, but has been broken  
recently. Anyway, this seems to work for your purpose:

require 'bio'

pdb = Bio::PDB.new(File.read(ARGV[0]))

pdb.each_atom do |atom|
  atom.resSeq += 12
end

puts pdb

It would be good (IMHO) to have:

require 'bio'

pdb = Bio::PDB.new(File.read(ARGV[0]))

pdb.each_residue do |residue|
  residue.resSeq += 10
end

puts pdb

Do the same thing, but currently changes to residue objects don't  
propagate back down to the atoms they contain so the above code  
doesn't do anything useful.

Alex Gutteridge

Department of Biochemistry
University of Cambridge





From alexg at ruggedtextile.com  Thu Apr 10 04:13:59 2008
From: alexg at ruggedtextile.com (Alex Gutteridge)
Date: Thu, 10 Apr 2008 09:13:59 +0100
Subject: [BioRuby] How to renumber a PDB file using BioRuby ?
In-Reply-To: <38921.192.168.1.1.1207809124.squirrel@mail.ncbs.res.in>
References: <38921.192.168.1.1.1207809124.squirrel@mail.ncbs.res.in>
Message-ID: <1D75B4AC-0AEB-4F11-BDCF-0235D075C810@ruggedtextile.com>

On 10 Apr 2008, at 07:32, K. Shameer wrote:
> Dear All,
>
> I have  a pdb file ( in perfect pdb format, no hetatm, no solvent,  
> single
> chain file). I need to renumber the whole pdb file, for example if my
> input file is 1CRN.pdb and it starts with residue number 1, I need to
> renumber them so that first resiude number will be 12, next 13,  
> 14... like
> that. I want to know if I can specifically access the residue number  
> and
> increment it from first residue using my new number (here it will be
> residue_number  +  12)and regenerate the file.
>
> Anybody had tried this before,
>
> Thanks in advance for any help,
> K. Shameer


hi,

You have to alter the number by atom rather than by residue. Altering  
the residue object directly used to work, but has been broken. Anyway,  
this seems to work for your purpose:

require 'bio'

pdb = Bio::PDB.new(File.read(ARGV[0]))

pdb.each_atom do |atom|
   atom.resSeq += 12
end

puts pdb

It would be good (IMHO) to have:

require 'bio'

pdb = Bio::PDB.new(File.read(ARGV[0]))

pdb.each_residue do |residue|
   residue.resSeq += 10
end

puts pdb

Do the same thing, but currently changes to residue objects don't  
propagate back down to the atoms so the above code doesn't do anything  
useful.

Alex Gutteridge

Department of Biochemistry
University of Cambridge





From shameer at ncbs.res.in  Thu Apr 10 04:17:49 2008
From: shameer at ncbs.res.in (K. Shameer)
Date: Thu, 10 Apr 2008 13:47:49 +0530 (IST)
Subject: [BioRuby] How to renumber a PDB file using BioRuby ?
In-Reply-To: <1D75B4AC-0AEB-4F11-BDCF-0235D075C810@ruggedtextile.com>
References: <38921.192.168.1.1.1207809124.squirrel@mail.ncbs.res.in>
	<1D75B4AC-0AEB-4F11-BDCF-0235D075C810@ruggedtextile.com>
Message-ID: <42113.192.168.1.1.1207815469.squirrel@mail.ncbs.res.in>

Dear Alex,

Thanks for your help

> You have to alter the number by atom rather than by residue. Altering
> the residue object directly used to work, but has been broken. Anyway,
> this seems to work for your purpose:
>
> require 'bio'
>
> pdb = Bio::PDB.new(File.read(ARGV[0]))
>
> pdb.each_atom do |atom|
>    atom.resSeq += 12
> end
> puts pdb

Sorry, this is exactly I want to do, I want to apply it in a whole atom
level, not residue level - this works well for me !

Once again Thank you Alex and Chen for quick and great help,
K. Shameer

>
> It would be good (IMHO) to have:
>
> require 'bio'
>
> pdb = Bio::PDB.new(File.read(ARGV[0]))
>
> pdb.each_residue do |residue|
>    residue.resSeq += 10
> end
>
> puts pdb
>
> Do the same thing, but currently changes to residue objects don't
> propagate back down to the atoms so the above code doesn't do anything
> useful.
>
> Alex Gutteridge
>
> Department of Biochemistry
> University of Cambridge



From shameer at ncbs.res.in  Thu Apr 10 04:49:11 2008
From: shameer at ncbs.res.in (K. Shameer)
Date: Thu, 10 Apr 2008 14:19:11 +0530 (IST)
Subject: [BioRuby] How to renumber a PDB file using BioRuby ?
In-Reply-To: <1D75B4AC-0AEB-4F11-BDCF-0235D075C810@ruggedtextile.com>
References: <38921.192.168.1.1.1207809124.squirrel@mail.ncbs.res.in>
	<1D75B4AC-0AEB-4F11-BDCF-0235D075C810@ruggedtextile.com>
Message-ID: <57721.192.168.1.1.1207817351.squirrel@mail.ncbs.res.in>

Hi,

I automated Alex's (thanks a lot, alex) script and finished my renumbering
job :)

> ruby renumber.rb xxxx.pdb step_size

__START__

require 'bio'
pdb = Bio::PDB.new(File.read(ARGV[0]))
step_size = ARGV[1]
pdb.each_atom do |atom|
  atom.resSeq += step_size.to_i
end
puts pdb

__END__

K. Shameer


From sgujja at broad.mit.edu  Thu Apr 10 14:20:26 2008
From: sgujja at broad.mit.edu (Sharvari Gujja)
Date: Thu, 10 Apr 2008 14:20:26 -0400
Subject: [BioRuby] CDART  BioRuby
Message-ID: <47FE5A6A.7020202@broad.mit.edu>

Hi,

I am trying to use NCBI CDART( Conserved Domain Architecture Retreival 
Tool ) to analyze multiple protein sequences in fasta format.

CDART assigns domains based on RPS Blast so this is what I intend to do 
in bioruby:

1. Take the input protein sequences file in fasta format .

2. Do RPS Blast for each sequence using Bio::Blast class
          - I still have to look into it.

3. From the output get the pssm/cd id to efetch the cdd page from ncbi.
          -This is where I need help.Is there a class in Bioruby which I 
can use to retrieve the cdd page?

You can try an example : cd00066 to see how the output looks like ( 
search under Conserved Domain Database)

Appreciate any help.

Thanks
S



From sgujja at broad.mit.edu  Thu Apr 10 15:34:29 2008
From: sgujja at broad.mit.edu (Sharvari Gujja)
Date: Thu, 10 Apr 2008 15:34:29 -0400
Subject: [BioRuby] RPS Blast using Bioruby...
Message-ID: <47FE6BC5.3010207@broad.mit.edu>

Hi all,

This is in reference to my earlier email on how to fetch CDD output from 
NCBI.

Like I said I am also trying to do RPS Blast on CDD database using 
Bio::Blast.

This is what I am trying to do:

#!/usr/bin/env ruby
require 'bio'
program = 'blastp'
db = 'nr-aa'
fasta = File.open("input1" , "r+")
blast = Bio::Blast.remote(program,db,'-e 1e-10')
report = blast.query(fasta.read)
report.each do |hit|
puts hit.target_id
end

How can I do rps blast on cdd?

Thanks
S


From email2ants at gmail.com  Fri Apr 11 07:25:08 2008
From: email2ants at gmail.com (Anthony Underwood)
Date: Fri, 11 Apr 2008 12:25:08 +0100
Subject: [BioRuby] Sequence format conversion
Message-ID: <3576D7DD-F878-45F4-84D8-BF344D0E113C@gmail.com>

Hi Noahisa, Hi all

I have recently run into the lack of functionality in reading in a
sequence in one format and converting to another. The ouput(:format)
method does not seem to be available to a Bio::Sequence::NA object
made from reading in a Genbank flat-file and calling the seq method.
Is there any way I can contribute to this since IMHO it is one of the
basics of bioinformatics.

Jan informed me that a CVS branch was made at the biohakathon and  
suggested that I drop a line to you Noahisa and to the list. Perhaps I  
can help with new branch?


All the best

Anthony

From sgujja at broad.mit.edu  Fri Apr 11 15:20:17 2008
From: sgujja at broad.mit.edu (Sharvari Gujja)
Date: Fri, 11 Apr 2008 15:20:17 -0400
Subject: [BioRuby]  RPS Blast using Bioruby...
In-Reply-To: <47FE6BC5.3010207@broad.mit.edu>
References: <47FE6BC5.3010207@broad.mit.edu>
Message-ID: <47FFB9F1.4090901@broad.mit.edu>

Sharvari Gujja wrote:
> Hi all,
>
> This is in reference to my earlier email on how to fetch CDD output 
> from NCBI.
>
> Like I said I am also trying to do RPS Blast on CDD database using 
> Bio::Blast.
>
> This is what I am trying to do:
>
> #!/usr/bin/env ruby
> require 'bio'
> program = 'blastp'
> db = 'nr-aa'
> fasta = File.open("input1" , "r+")
> blast = Bio::Blast.remote(program,db,'-e 1e-10')
> report = blast.query(fasta.read)
> report.each do |hit|
> puts hit.target_id
> end
>
> How can I do rps blast on cdd?
>
> Thanks
> S
>
> _______________________________________________
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby


Hi,

I have tried a bunch of things to run RPS Blast using Bioruby.Alas, no 
success yet!

I know that this can be done in Bioperl ( from a friend of mine) and 
this is the first time I could not do something in BioRuby.Can someone 
please tell me if this can be done in Bioruby.

Please help.

Thanks
Sharvari


From jdudley at stanford.edu  Fri Apr 11 18:18:41 2008
From: jdudley at stanford.edu (Joel Dudley)
Date: Fri, 11 Apr 2008 15:18:41 -0700
Subject: [BioRuby] Looking for projects to highlight
Message-ID: <22C84AC4-A1D2-4E7A-98A0-2E88F6B843FB@stanford.edu>

Hello BioRuby list. I'm going to be speaking at the upcoming Third  
Annual Silicon Valley Ruby Conference in San Jose, CA on April 19th  
and I am looking for some biology and medicine related projects to  
highlight.

http://www.sdforum.org/Ruby

The title of my talk is: "Gems and Genomics: Ruby at the Edge of  
Biology and Medicine in the Genomic Era" and I'm looking to highlight  
some projects other than my own that are using Ruby to do some  
interesting and/or big-scale biological research.

If you are doing anything interesting with Ruby in this area please  
drop me a note so I can highlight it in my talk. The conference will  
be well-attended so it could be a great opportunity to get your  
project's name out. I'm going to be speaking along side a bunch of IT  
people so I really want to use this opportunity to raise awareness  
about Ruby in Science.

Cheers,

Joel Dudley

From ngoto at gen-info.osaka-u.ac.jp  Mon Apr 14 08:51:42 2008
From: ngoto at gen-info.osaka-u.ac.jp (Naohisa GOTO)
Date: Mon, 14 Apr 2008 21:51:42 +0900
Subject: [BioRuby] RPS Blast using Bioruby...
In-Reply-To: <47FE6BC5.3010207@broad.mit.edu>
References: <47FE6BC5.3010207@broad.mit.edu>
Message-ID: <20080414125143.601A11CBC4A1@idnmail.gen-info.osaka-u.ac.jp>

Hi, 

Currently, RPS-Blast is not suppoted in BioRuby.

In addition, currently, Bio::Blast in BioRuby does not support
remote BLAST on NCBI. It supports GenomeNet or stand-alone BLAST.

Thanks,

Naohisa Goto
ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org

On Thu, 10 Apr 2008 15:34:29 -0400
Sharvari Gujja <sgujja at broad.mit.edu> wrote:

> Hi all,
> 
> This is in reference to my earlier email on how to fetch CDD output from 
> NCBI.
> 
> Like I said I am also trying to do RPS Blast on CDD database using 
> Bio::Blast.
> 
> This is what I am trying to do:
> 
> #!/usr/bin/env ruby
> require 'bio'
> program = 'blastp'
> db = 'nr-aa'
> fasta = File.open("input1" , "r+")
> blast = Bio::Blast.remote(program,db,'-e 1e-10')
> report = blast.query(fasta.read)
> report.each do |hit|
> puts hit.target_id
> end
> 
> How can I do rps blast on cdd?
> 
> Thanks
> S
> 

From ngoto at gen-info.osaka-u.ac.jp  Tue Apr 15 09:59:06 2008
From: ngoto at gen-info.osaka-u.ac.jp (Naohisa GOTO)
Date: Tue, 15 Apr 2008 22:59:06 +0900
Subject: [BioRuby] RPS Blast using Bioruby...
In-Reply-To: <20080414125143.601A11CBC4A1@idnmail.gen-info.osaka-u.ac.jp>
References: <47FE6BC5.3010207@broad.mit.edu>
	<20080414125143.601A11CBC4A1@idnmail.gen-info.osaka-u.ac.jp>
Message-ID: <20080415135908.107871CBC575@idnmail.gen-info.osaka-u.ac.jp>

Hi,

RPS Blast output parser is now added into CVS HEAD.

0. Database preparation

You can download formatted databases from NCBI.
Be careful that formatted databases are architecture-dependent.
For little-endian machines, you can download from
ftp://ftp.ncbi.nih.gov/pub/mmdb/cdd/little_endian
For big-endian machines, 
ftp://ftp.ncbi.nih.gov/pub/mmdb/cdd/big_endian

If you want to create database from scratch, please see
the document "Using RPS-BLAST with Biopython"
http://www2.warwick.ac.uk/fac/sci/moac/currentstudents/peter_cock/python/rpsblast/
This is useful not only for Biopython users but also
for RPS-BLAST newbies.

1. Runs rpsblast command

 % rpsblast -i test.fst -d Pfam -o test.rpsblast

2. Parses the result

The usage of Bio::Blast::RPSBlast::Report is almost the same
as Bio::Blast::Default::Report, except for multi-query output
supports and some methods (see RDoc in the class).

Below is a sample script.

    require 'bio'
    filename = 'test.rpsblast'
    Bio::FlatFile.open(Bio::Blast::RPSBlast::Report, filename) do |ff|
      ff.each do |e|
        i = 0
        e.each_iteration do |result|
          i += 1
          print "Query\##{i} = ", result.query_def, "\n"
          j = 0
          result.each do |hit|
            j += 1
            print "Query\##{i}/Hit\##{j} = ", hit.target_def, "\n"
            k = 0
            hit.each do |hsp|
              k += 1
              print "Query\##{i}/Hit\##{j}/Hsp\##{k} = ",
                "evalue=#{hsp.evalue}, ",
                "Positions #{hsp.query_from}..#{hsp.query_to}:",
                "#{hsp.hit_from}..#{hsp.hit_to}\n"
              print "Query : #{hsp.qseq}\n"
              print "        #{hsp.midline}\n"
              print "Hit   : #{hsp.hseq}\n"
            end
          end             
        end
      end
    end

3. References

Using RPS-BLAST with Biopython
http://www2.warwick.ac.uk/fac/sci/moac/currentstudents/peter_cock/python/rpsblast/



Regards,

Naohisa Goto
ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org

On Mon, 14 Apr 2008 21:51:42 +0900
Naohisa GOTO <ngoto at gen-info.osaka-u.ac.jp> wrote:

> Hi, 
> 
> Currently, RPS-Blast is not suppoted in BioRuby.
> 
> In addition, currently, Bio::Blast in BioRuby does not support
> remote BLAST on NCBI. It supports GenomeNet or stand-alone BLAST.
> 
> Thanks,
> 
> Naohisa Goto
> ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org
> 
> On Thu, 10 Apr 2008 15:34:29 -0400
> Sharvari Gujja <sgujja at broad.mit.edu> wrote:
> 
> > Hi all,
> > 
> > This is in reference to my earlier email on how to fetch CDD output from 
> > NCBI.
> > 
> > Like I said I am also trying to do RPS Blast on CDD database using 
> > Bio::Blast.
> > 
> > This is what I am trying to do:
> > 
> > #!/usr/bin/env ruby
> > require 'bio'
> > program = 'blastp'
> > db = 'nr-aa'
> > fasta = File.open("input1" , "r+")
> > blast = Bio::Blast.remote(program,db,'-e 1e-10')
> > report = blast.query(fasta.read)
> > report.each do |hit|
> > puts hit.target_id
> > end
> > 
> > How can I do rps blast on cdd?
> > 
> > Thanks
> > S
> > 
> _______________________________________________
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby

From mail at michaelbarton.me.uk  Thu Apr 17 11:21:18 2008
From: mail at michaelbarton.me.uk (Michael Barton)
Date: Thu, 17 Apr 2008 16:21:18 +0100
Subject: [BioRuby] BioRuby on github + lighthouse
Message-ID: <0A349FF7-51BD-4546-8744-B342C4EA8950@michaelbarton.me.uk>

Hi,

I wondered if the BioRuby developers had considered moving from SVN  
hosting to git hosting, specifically on github. I think using git and  
github could lower the barrier to people contributing code. Github  
offers free hosting for open source projects. Similarly Lighthouse  
offers free issue tracking to open source projects and integrates well  
with github.

https://github.com
http://www.lighthouseapp.com

I've written a bit more about why this could be useful on my blog
http://tinyurl.com/4yxm7u

Thanks

Mike


From adamnkraut at gmail.com  Thu Apr 17 12:50:24 2008
From: adamnkraut at gmail.com (Adam Kraut)
Date: Thu, 17 Apr 2008 12:50:24 -0400
Subject: [BioRuby] BioRuby on github + lighthouse
In-Reply-To: <0A349FF7-51BD-4546-8744-B342C4EA8950@michaelbarton.me.uk>
References: <0A349FF7-51BD-4546-8744-B342C4EA8950@michaelbarton.me.uk>
Message-ID: <134ede0b0804170950w7624e8b9u97ae8c285717d891@mail.gmail.com>

git+=1

I have switched over several of our internal comp bio/chem projects to Git
and so far it is working out wonderfully.  I don't think I understand
everything Git is capable of yet but I am already seeing some huge benefits
in how I approach development.  Having broken my teeth for so long on CVS I
would welcome the change for something like BioRuby.  BioPerl is *just* now
moving to subversion, I vote for BioRuby to leapfrog them and test the
waters with Git.  I've never contributed back to BioRuby and I feel that Git
could indeed lower that barrier for myself and others.  Github itself is a
Ruby (Rails?/Merb?) application and it seems like the greater Ruby community
is switching rapidly.  Is there anything stopping someone from putting
BioRuby up on Github right now just to play around with?

Regards,

Adam

On Thu, Apr 17, 2008 at 11:21 AM, Michael Barton <mail at michaelbarton.me.uk>
wrote:

> Hi,
>
> I wondered if the BioRuby developers had considered moving from SVN
> hosting to git hosting, specifically on github. I think using git and github
> could lower the barrier to people contributing code. Github offers free
> hosting for open source projects. Similarly Lighthouse offers free issue
> tracking to open source projects and integrates well with github.
>
> https://github.com
> http://www.lighthouseapp.com
>
> I've written a bit more about why this could be useful on my blog
> http://tinyurl.com/4yxm7u
>
> Thanks
>
> Mike
>
> _______________________________________________
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby<https://lists.open-bio.org/mailman/listinfo/bioruby>
>

From mail at michaelbarton.me.uk  Thu Apr 17 13:41:57 2008
From: mail at michaelbarton.me.uk (Michael Barton)
Date: Thu, 17 Apr 2008 18:41:57 +0100
Subject: [BioRuby] BioRuby on github + lighthouse
In-Reply-To: <134ede0b0804170950w7624e8b9u97ae8c285717d891@mail.gmail.com>
References: <0A349FF7-51BD-4546-8744-B342C4EA8950@michaelbarton.me.uk>
	<134ede0b0804170950w7624e8b9u97ae8c285717d891@mail.gmail.com>
Message-ID: <9454D2A5-EB57-44AA-BE27-16371150535A@michaelbarton.me.uk>

I definitely agree with your statement about leap frogging SVN  
straight to git, and it is also true that many ruby applications are  
switching to github too.

However forking BioRuby on github whilst still actively maintaining  
the CVS/SVN version could generate confusion based on two differing  
versions. My suggestion would be to freeze CVS development of BioRuby  
at the next release, then move development over to github.


On 17 Apr 2008, at 17:50, Adam Kraut wrote:
> git+=1
>
> I have switched over several of our internal comp bio/chem projects  
> to Git and so far it is working out wonderfully.  I don't think I  
> understand everything Git is capable of yet but I am already seeing  
> some huge benefits in how I approach development.  Having broken my  
> teeth for so long on CVS I would welcome the change for something  
> like BioRuby.  BioPerl is *just* now moving to subversion, I vote  
> for BioRuby to leapfrog them and test the waters with Git.  I've  
> never contributed back to BioRuby and I feel that Git could indeed  
> lower that barrier for myself and others.  Github itself is a Ruby  
> (Rails?/Merb?) application and it seems like the greater Ruby  
> community is switching rapidly.  Is there anything stopping someone  
> from putting BioRuby up on Github right now just to play around with?
>
> Regards,
>
> Adam
>
> On Thu, Apr 17, 2008 at 11:21 AM, Michael Barton <mail at michaelbarton.me.uk 
> > wrote:
> Hi,
>
> I wondered if the BioRuby developers had considered moving from SVN  
> hosting to git hosting, specifically on github. I think using git  
> and github could lower the barrier to people contributing code.  
> Github offers free hosting for open source projects. Similarly  
> Lighthouse offers free issue tracking to open source projects and  
> integrates well with github.
>
> https://github.com
> http://www.lighthouseapp.com
>
> I've written a bit more about why this could be useful on my blog
> http://tinyurl.com/4yxm7u
>
> Thanks
>
> Mike
>
> _______________________________________________
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby
>


From timmcilveen at talktalk.net  Thu Apr 17 17:41:26 2008
From: timmcilveen at talktalk.net (Tim)
Date: Thu, 17 Apr 2008 22:41:26 +0100
Subject: [BioRuby] bioruby tutorials
Message-ID: <4807C406.9070003@talktalk.net>

Hi,
I'm new to Ruby and Bioruby. Can you tell me if the tutorials at 
http://bioruby.open-bio.org/ are the only ones available, or are there 
other tutorials elsewhere online? I have found lots of biopython 
resources online, such as the excellent Pasteur Biopython course, but 
can't find a lot on ruby at the moment. I would prefer to learn bioruby, 
but I guess this will be depend on what I can find online. Any help 
would be great !

Thanks for any help,

Tim

p.s. sorry if this is the second time you are receiving this email. The 
first one didn't arrive in my inbox, so I assume there was an error 
sending it.


From georgkam at gmail.com  Thu Apr 17 18:41:10 2008
From: georgkam at gmail.com (George Githinji)
Date: Fri, 18 Apr 2008 01:41:10 +0300
Subject: [BioRuby] BioRuby Digest, Vol 32, Issue 3
In-Reply-To: <mailman.2561.1208468596.2995.bioruby@lists.open-bio.org>
References: <mailman.2561.1208468596.2995.bioruby@lists.open-bio.org>
Message-ID: <55915f820804171541x3da21665w671c745b33dfd99f@mail.gmail.com>

Hi Tim,
check tutorials and bioruby related materials on these blogs:

http://www.biorelated.wordpress.com

http://www.bioinformaticszen.com/

http://saaientist.blogspot.com/

http://bioinforuby.blogspot.com/

http://rubyonwindows.blogspot.com/

http://bioruby.g.hatena.ne.jp/nakao_mitsuteru/

From marc.hoeppner at molbio.su.se  Thu Apr 24 08:08:00 2008
From: marc.hoeppner at molbio.su.se (Marc Hoeppner)
Date: Thu, 24 Apr 2008 14:08:00 +0200
Subject: [BioRuby] BLAST hit, which strand
Message-ID: <48107820.6030906@molbio.su.se>

Hi,

I have a question concerning BLAST::RESULT objects in BioRuby.
I followed the tutorial and available documentation to integrate blast 
into my application, but I noticed that pretty much everything is 
returned from BLAST except the strand a particular hit or hsp was 
identified on.
It is available for objects of the class 
Bio::Blast::Default::Report::HSP (according to the API documentation 
anyway) - but what I get back when I run BLAST according to the tutorial 
is an object of the class Bio::Blast::Report::HSP - which does not 
return the 'hit_strand'.

Is it me, am I missing something or is this a problem with BioRuby?

Cheers,
Marc

-- 

Marc P. Hoeppner
PhD student
Department of Molecular Biology and Functional Genomics
Stockholm University, 10691 Stockholm, Sweden

marc.hoeppner at molbio.su.se
Tel: +46 (0)8 - 164195


From georgkam at gmail.com  Thu Apr 24 17:31:00 2008
From: georgkam at gmail.com (George Githinji)
Date: Fri, 25 Apr 2008 00:31:00 +0300
Subject: [BioRuby] predicting epitopes
Message-ID: <55915f820804241431g6f5f725ao19f64d79df8911e5@mail.gmail.com>

Hi,
Please is there some one who has a script for predicting possible epitopes
in a protein sequence using ruby?
or a wrapper library to some epitope prediction server?

Thank you

-- 
---------------
Sincerely
George

Skype: george_g2
Website: http://biorelated.wordpress.com/

From ngoto at gen-info.osaka-u.ac.jp  Fri Apr 25 02:23:23 2008
From: ngoto at gen-info.osaka-u.ac.jp (Naohisa GOTO)
Date: Fri, 25 Apr 2008 15:23:23 +0900
Subject: [BioRuby] BLAST hit, which strand
In-Reply-To: <48107820.6030906@molbio.su.se>
References: <48107820.6030906@molbio.su.se>
Message-ID: <20080425062324.CAE921CBC4ED@idnmail.gen-info.osaka-u.ac.jp>

Hi,

Perhaps your BLAST result is XML (with -m 7 option).
You can use query_frame and hit_frame methods.
In most case, the start and end positions of query and hit
can also be used to distinguish strands.

Unlike default format, NCBI BLAST XML does not clearly show
query-/hit- strand information. That's why we have no
query_strand and hit_strand methods in BLAST XML output parser.

In addition, it is confusable that the alignment shown in
NCBI BLAST XML is often opposite from that of default output.

For example, below are the results with same query and database.
(blastall 2.2.15 in debian etch).

The query sequence:
>query
cgatcgatcgatagctaggcgactagcatatctaacatcgtacacatactggcat

The hit sequence in database:
>test
nnnnnnnnnnnnnnnnnnnn
atgccagtatgtgtacgatgttagatatgctagtcgcctagctatcgatcgatcg

default output:
---------------------------------------------------------------------
 Score =  109 bits (55), Expect = 4e-30
 Identities = 55/55 (100%)
 Strand = Plus / Minus


Query: 1  cgatcgatcgatagctaggcgactagcatatctaacatcgtacacatactggcat 55
          |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 75 cgatcgatcgatagctaggcgactagcatatctaacatcgtacacatactggcat 21

---------------------------------------------------------------------

XML output:
---------------------------------------------------------------------
<Hsp>
  <Hsp_num>1</Hsp_num>
  <Hsp_bit-score>109.522</Hsp_bit-score>
  <Hsp_score>55</Hsp_score>
  <Hsp_evalue>3.75451e-30</Hsp_evalue>
  <Hsp_query-from>55</Hsp_query-from>
  <Hsp_query-to>1</Hsp_query-to>
  <Hsp_hit-from>21</Hsp_hit-from>
  <Hsp_hit-to>75</Hsp_hit-to>
  <Hsp_query-frame>1</Hsp_query-frame>
  <Hsp_hit-frame>-1</Hsp_hit-frame>
  <Hsp_identity>55</Hsp_identity>
  <Hsp_positive>55</Hsp_positive>
  <Hsp_align-len>55</Hsp_align-len>
  <Hsp_qseq>ATGCCAGTATGTGTACGATGTTAGATATGCTAGTCGCCTAGCTATCGATCGATCG</Hsp_qseq>
  <Hsp_hseq>ATGCCAGTATGTGTACGATGTTAGATATGCTAGTCGCCTAGCTATCGATCGATCG</Hsp_hseq>
  <Hsp_midline>|||||||||||||||||||||||||||||||||||||||||||||||||||||||</Hsp_midline>
</Hsp>
---------------------------------------------------------------------

Both <Hsp_qseq> and <Hsp_hseq> are reverse-complement of
those of default output, and the <Hsp_qseq> is
reverse-compement of the query sequence. 
The XML shows <Hsp_query-frame> = 1 and <Hsp_hit-frame> = -1,
and I think these are opposite from our feeling.
It might be a problem of NCBI BLAST.

Regards,

Naohisa Goto
ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org


On Thu, 24 Apr 2008 14:08:00 +0200
Marc Hoeppner <marc.hoeppner at molbio.su.se> wrote:

> Hi,
> 
> I have a question concerning BLAST::RESULT objects in BioRuby.
> I followed the tutorial and available documentation to integrate blast 
> into my application, but I noticed that pretty much everything is 
> returned from BLAST except the strand a particular hit or hsp was 
> identified on.
> It is available for objects of the class 
> Bio::Blast::Default::Report::HSP (according to the API documentation 
> anyway) - but what I get back when I run BLAST according to the tutorial 
> is an object of the class Bio::Blast::Report::HSP - which does not 
> return the 'hit_strand'.
> 
> Is it me, am I missing something or is this a problem with BioRuby?
> 
> Cheers,
> Marc
> 
> -- 
> 
> Marc P. Hoeppner
> PhD student
> Department of Molecular Biology and Functional Genomics
> Stockholm University, 10691 Stockholm, Sweden
> 
> marc.hoeppner at molbio.su.se
> Tel: +46 (0)8 - 164195
> 

From pathoquest at gmail.com  Sat Apr 26 21:48:02 2008
From: pathoquest at gmail.com (bio scientist)
Date: Sat, 26 Apr 2008 18:48:02 -0700
Subject: [BioRuby] parsing Prosite data
Message-ID: <8d4642290804261848y798736fawde54f0f4d5c0188e@mail.gmail.com>

How can we parse Prosite data using Bioruby? I am looking for a way to
populate a database table with Prosite patterns and their IDs that
correspond to a set
of genes. For example:*

**GeneID    GeneName    PrositeID       PrositePattern      Consensus**
*
1234            xyzA           PSxxxxx           KDEL
[KRHQSA]-[DENQ]-E-L

I have not yet fully grasped how parsing works. So any help and links to
resources will go a long way. Thanks.

From mail at michaelbarton.me.uk  Wed Apr 30 08:49:08 2008
From: mail at michaelbarton.me.uk (Michael Barton)
Date: Wed, 30 Apr 2008 13:49:08 +0100
Subject: [BioRuby] BioRuby on github + lighthouse
In-Reply-To: <9454D2A5-EB57-44AA-BE27-16371150535A@michaelbarton.me.uk>
References: <0A349FF7-51BD-4546-8744-B342C4EA8950@michaelbarton.me.uk>
	<134ede0b0804170950w7624e8b9u97ae8c285717d891@mail.gmail.com>
	<9454D2A5-EB57-44AA-BE27-16371150535A@michaelbarton.me.uk>
Message-ID: <6773F437-607A-48A0-A60C-46B6994E70C6@michaelbarton.me.uk>

Can I just bump this discussion.
I wonder if anyone has had any further thoughts about the practicality  
and usefulness of porting BioRuby over to git and github?

Mike


On 17 Apr 2008, at 18:41, Michael Barton wrote:

> I definitely agree with your statement about leap frogging SVN  
> straight to git, and it is also true that many ruby applications are  
> switching to github too.
>
> However forking BioRuby on github whilst still actively maintaining  
> the CVS/SVN version could generate confusion based on two differing  
> versions. My suggestion would be to freeze CVS development of  
> BioRuby at the next release, then move development over to github.
>
>
> On 17 Apr 2008, at 17:50, Adam Kraut wrote:
>> git+=1
>>
>> I have switched over several of our internal comp bio/chem projects  
>> to Git and so far it is working out wonderfully.  I don't think I  
>> understand everything Git is capable of yet but I am already seeing  
>> some huge benefits in how I approach development.  Having broken my  
>> teeth for so long on CVS I would welcome the change for something  
>> like BioRuby.  BioPerl is *just* now moving to subversion, I vote  
>> for BioRuby to leapfrog them and test the waters with Git.  I've  
>> never contributed back to BioRuby and I feel that Git could indeed  
>> lower that barrier for myself and others.  Github itself is a Ruby  
>> (Rails?/Merb?) application and it seems like the greater Ruby  
>> community is switching rapidly.  Is there anything stopping someone  
>> from putting BioRuby up on Github right now just to play around with?
>>
>> Regards,
>>
>> Adam
>>
>> On Thu, Apr 17, 2008 at 11:21 AM, Michael Barton <mail at michaelbarton.me.uk 
>> > wrote:
>> Hi,
>>
>> I wondered if the BioRuby developers had considered moving from SVN  
>> hosting to git hosting, specifically on github. I think using git  
>> and github could lower the barrier to people contributing code.  
>> Github offers free hosting for open source projects. Similarly  
>> Lighthouse offers free issue tracking to open source projects and  
>> integrates well with github.
>>
>> https://github.com
>> http://www.lighthouseapp.com
>>
>> I've written a bit more about why this could be useful on my blog
>> http://tinyurl.com/4yxm7u
>>
>> Thanks
>>
>> Mike
>>
>> _______________________________________________
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
>>
>