From alexg at kuicr.kyoto-u.ac.jp Tue Oct 9 22:31:34 2007 From: alexg at kuicr.kyoto-u.ac.jp (Alex Gutteridge) Date: Wed, 10 Oct 2007 11:31:34 +0900 Subject: [BioRuby] SBML Message-ID: <55B1B5D8-48E6-4FD8-B574-3691D220BA53@kuicr.kyoto-u.ac.jp> Hi, Has anyone done any work on a parser for SBML or bindings for libsbml? I am just about to start playing with a SWIG generated binding for libsbml, but I don't want to re-invent the wheel if I can avoid it. Alex Gutteridge Bioinformatics Center Kyoto University From francesco.strozzi at gmail.com Wed Oct 10 07:04:10 2007 From: francesco.strozzi at gmail.com (Francesco Strozzi) Date: Wed, 10 Oct 2007 13:04:10 +0200 Subject: [BioRuby] bioruby docs Message-ID: Hi All, few months ago I started to use Ruby and Rails to develop bioinformatics web sites and applications, so I was wondering if there is any documentation for the BioRuby library. I have found only the API documentation that seemed poor in examples. I'm currently using BioPerl package so I am quite familiar with these type of libraries for the bioinformatics. I'm just looking for a good point to start learning BioRuby and move to Ruby language also for my bioinformatics scripts and programs. Thank you Cheers Francesco From shameer at ncbs.res.in Wed Oct 10 07:12:08 2007 From: shameer at ncbs.res.in (Shameer Khadar) Date: Wed, 10 Oct 2007 16:42:08 +0530 (IST) Subject: [BioRuby] bioruby docs In-Reply-To: References: Message-ID: <42287.192.168.1.1.1192014728.squirrel@mail.ncbs.res.in> Dear Francesco, Your point is right. I joined the BioRuby list after seeing an impressive Bioinformatics Server based on Ruby-On-Rails : http://toolkit.tuebingen.mpg.de/ MPI- Bioinformatics Toolkit. Even after learning the basics of Ruby from the tutorials and RubyDocs am still not in a position to start the actual ROR implementation. I strongly agree with your point that Bioruby docs should have a version of more readable/easy-to-use format for beginners apart from the API stuff. I am looking forward for the BioRuby-Core-Developers inputs in this regard, Cheers, > Hi All, > > few months ago I started to use Ruby and Rails to develop bioinformatics > web > sites and applications, so I was wondering if there is any documentation > for > the BioRuby library. I have found only the API documentation that seemed > poor in examples. I'm currently using BioPerl package so I am quite > familiar > with these type of libraries for the bioinformatics. I'm just looking for > a > good point to start learning BioRuby and move to Ruby language also for my > bioinformatics scripts and programs. > -- Shameer From shameer at ncbs.res.in Thu Oct 11 05:18:32 2007 From: shameer at ncbs.res.in (Shameer Khadar) Date: Thu, 11 Oct 2007 14:48:32 +0530 (IST) Subject: [BioRuby] bioruby docs In-Reply-To: <42287.192.168.1.1.1192014728.squirrel@mail.ncbs.res.in> References: <42287.192.168.1.1.1192014728.squirrel@mail.ncbs.res.in> Message-ID: <47620.192.168.1.1.1192094312.squirrel@mail.ncbs.res.in> Here is an excellent article about the status of BioRuby http://saaientist.blogspot.com/ (NB: Not official but an excellent personal perspective) Jan, This is a good initiative - Excellent article. Eventhough, I am experimenting with Ruby/BioRuby as of now.I am looking forward to contribute to the project by writing HOW-TO and by providing some wrappers to the database/servers I am developing. Just now I noticed that I am not able to create a login-id in the BioRuby Doc page. Is this open only for core developers ? http://bioruby-doc.org/index.php?title=Main_Page All bioprogrammers, Unite, Lets push Ruby/BioRuby/ROR to the forefront of bioinformatics. Cheers Shameer -- Shameer Khadar Prof. R. Sowdhamini's Lab (# 25) The Computational Biology Group National Centre for Biological Sciences (TIFR) GKVK Campus, Bellary Road, Bangalore - 65, Karnataka - India T - 91-080-23666001 EXT - 6251 W - http://www.ncbs.res.in From francesco.strozzi at gmail.com Thu Oct 11 06:21:47 2007 From: francesco.strozzi at gmail.com (Francesco Strozzi) Date: Thu, 11 Oct 2007 12:21:47 +0200 Subject: [BioRuby] bioruby docs In-Reply-To: <47620.192.168.1.1.1192094312.squirrel@mail.ncbs.res.in> References: <42287.192.168.1.1.1192014728.squirrel@mail.ncbs.res.in> <47620.192.168.1.1.1192094312.squirrel@mail.ncbs.res.in> Message-ID: I've seen me too that blog. Right now I am dealing with his BioGraphics library and as soon as possible I will start to use this, instead of BioPerl graphics module, for my Rails Bioinformatics sites. I will report here my experiences using BioRuby and I will try to do my part inside this community. Cheers Francesco 2007/10/11, Shameer Khadar : > > Here is an excellent article about the status of BioRuby > http://saaientist.blogspot.com/ > (NB: Not official but an excellent personal perspective) > > Jan, This is a good initiative - Excellent article. Eventhough, I am > experimenting with Ruby/BioRuby as of now.I am looking forward to > contribute to the project by writing HOW-TO and by providing some wrappers > to the database/servers I am developing. > > Just now I noticed that I am not able to create a login-id in the BioRuby > Doc page. Is this open only for core developers ? > > http://bioruby-doc.org/index.php?title=Main_Page > > All bioprogrammers, Unite, Lets push Ruby/BioRuby/ROR to the forefront of > bioinformatics. > > Cheers > Shameer > > -- > Shameer Khadar > Prof. R. Sowdhamini's Lab (# 25) The Computational Biology Group > National Centre for Biological Sciences (TIFR) > GKVK Campus, Bellary Road, Bangalore - 65, Karnataka - India > T - 91-080-23666001 EXT - 6251 > W - http://www.ncbs.res.in > > _______________________________________________ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby > From shameer at ncbs.res.in Thu Oct 11 13:52:36 2007 From: shameer at ncbs.res.in (Shameer Khadar) Date: Thu, 11 Oct 2007 23:22:36 +0530 (IST) Subject: [BioRuby] bioruby docs In-Reply-To: References: <42287.192.168.1.1.1192014728.squirrel@mail.ncbs.res.in> <47620.192.168.1.1.1192094312.squirrel@mail.ncbs.res.in> Message-ID: <43626.192.168.1.1.1192125156.squirrel@mail.ncbs.res.in> Hi, All the best. Looking forward to hear about your experience with BioRuby. It will be great if you can write a Beginners guide to BioRuby & ROR for Bioinformatics. > I've seen me too that blog. Right now I am dealing with his BioGraphics > library and as soon as possible I will start to use this, instead of > BioPerl > graphics module, for my Rails Bioinformatics sites. I will report > here my experiences using BioRuby and I will try to do my part inside this > community. > Cheers, -- Shameer Khadar Prof. R. Sowdhamini's Lab (# 25) The Computational Biology Group National Centre for Biological Sciences (TIFR) GKVK Campus, Bellary Road, Bangalore - 65, Karnataka - India T - 91-080-23666001 EXT - 6251 W - http://www.ncbs.res.in From shameer at ncbs.res.in Thu Oct 11 14:20:53 2007 From: shameer at ncbs.res.in (Shameer Khadar) Date: Thu, 11 Oct 2007 23:50:53 +0530 (IST) Subject: [BioRuby] bioruby docs In-Reply-To: <43626.192.168.1.1.1192125156.squirrel@mail.ncbs.res.in> References: <42287.192.168.1.1.1192014728.squirrel@mail.ncbs.res.in> <47620.192.168.1.1.1192094312.squirrel@mail.ncbs.res.in> <43626.192.168.1.1.1192125156.squirrel@mail.ncbs.res.in> Message-ID: <53092.192.168.1.1.1192126853.squirrel@mail.ncbs.res.in> Please read the second line as... It will be great if you can write a Beginners guide to BioRuby / ROR for Bioinformatics based on your experience. -- Shameer > Hi, > > All the best. Looking forward to hear about your experience with BioRuby. > It will be great if you can write a Beginners guide to BioRuby & ROR for > Bioinformatics. > >> I've seen me too that blog. Right now I am dealing with his BioGraphics >> library and as soon as possible I will start to use this, instead of >> BioPerl > graphics module, for my Rails Bioinformatics sites. I will > report > here my experiences using BioRuby and I will try to do my part > inside this >> community. >> > From francesco.strozzi at gmail.com Fri Oct 12 07:00:48 2007 From: francesco.strozzi at gmail.com (Francesco Strozzi) Date: Fri, 12 Oct 2007 13:00:48 +0200 Subject: [BioRuby] bioruby docs In-Reply-To: <53092.192.168.1.1.1192126853.squirrel@mail.ncbs.res.in> References: <42287.192.168.1.1.1192014728.squirrel@mail.ncbs.res.in> <47620.192.168.1.1.1192094312.squirrel@mail.ncbs.res.in> <43626.192.168.1.1.1192125156.squirrel@mail.ncbs.res.in> <53092.192.168.1.1.1192126853.squirrel@mail.ncbs.res.in> Message-ID: I don't know if I am the right person to do a beginners guide for BioRuby, as I think there will be more qualified people in the community and I'm also a beginner too! But I've started a blog http://bioinforuby.blogspot.com (following Jan example) where I'm planning to put my experiences as you are asking (hoping that this will be helpful). But principally I will write here, in the mailing list, all the problems, bugs and difficulties that I will experience using BioRuby. Jan, I've seen that you have written the Ruby API for Ensembl core database. As soon as possible I would like to start use this and finally write a complete Ruby application and not a patchwork of different languages (as I'm doing right now)! Cheers Francesco 2007/10/11, Shameer Khadar : > > Please read the second line as... It will be great if you can write a > Beginners guide to BioRuby / ROR for Bioinformatics based on your > experience. > -- > Shameer > > > Hi, > > > > All the best. Looking forward to hear about your experience with > BioRuby. > > It will be great if you can write a Beginners guide to BioRuby & ROR for > > Bioinformatics. > > > >> I've seen me too that blog. Right now I am dealing with his BioGraphics > >> library and as soon as possible I will start to use this, instead of > >> BioPerl > graphics module, for my Rails Bioinformatics sites. I will > > report > here my experiences using BioRuby and I will try to do my part > > inside this > >> community. > >> > > > > _______________________________________________ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby > From pjotr2007 at thebird.nl Fri Oct 12 07:20:21 2007 From: pjotr2007 at thebird.nl (Pjotr Prins) Date: Fri, 12 Oct 2007 13:20:21 +0200 Subject: [BioRuby] bioruby docs In-Reply-To: <47620.192.168.1.1.1192094312.squirrel@mail.ncbs.res.in> References: <42287.192.168.1.1.1192014728.squirrel@mail.ncbs.res.in> <47620.192.168.1.1.1192094312.squirrel@mail.ncbs.res.in> Message-ID: <20071012112021.GA14794@thebird.nl> On Thu, Oct 11, 2007 at 02:48:32PM +0530, Shameer Khadar wrote: > Here is an excellent article about the status of BioRuby > http://saaientist.blogspot.com/ > (NB: Not official but an excellent personal perspective) Criticism is good and Jan is a respected contributor to BioRuby. Nevertheless with open source projects we have to take great care at giving people their due respect and it is easier to criticise the management side of this type of project than actually fixing stuff. I have seen to many opensource projects where people don't actually commit themselves fully after lengthy discussions on 'how to do things'. So, until a number of individuals steps up and says "WE WANT TO RUN WITH THIS PROJECT AND MAKE IT A GREAT SUCCESS", I will favour the idea of running with the people who have made it a success, so far. Otherwise, it is unfair on the guys who have put in a lot of their free time and energy to get where we are. Almost all open source project hinge on a few individuals - and BIORUBY could do better (I agree), but who has the real time and energy and has the proven coding track record? Both Jan and Trevor belong in the last category - but I know they don't have time. Pj. From jan.aerts at bbsrc.ac.uk Fri Oct 12 08:40:19 2007 From: jan.aerts at bbsrc.ac.uk (jan aerts (RI)) Date: Fri, 12 Oct 2007 13:40:19 +0100 Subject: [BioRuby] bioruby docs References: <42287.192.168.1.1.1192014728.squirrel@mail.ncbs.res.in><47620.192.168.1.1.1192094312.squirrel@mail.ncbs.res.in> <20071012112021.GA14794@thebird.nl> Message-ID: <1F16910BB8546C4DA5526FABB0C98D09120C07@ebre2ksrv1.ebrc.bbsrc.ac.uk> Hey Pjotr. You're absolutely right. The last thing I wanted to do was to criticize the management (I hope you don't read the blog post in that way). They've done a great job and it's not easy to put a lot of effort in an open source project (as I've experienced myself as well). Believe me: I have the greatest respect. As I mentioned in that post, what I proposed was actually to have part of the load lifted from upper echelon's shoulders. That way, they probably would feel less pressure as well about being in charge of bioruby. Where I mentioned "getting organized", I didn't mean that _they_ should get organized (as a way of pointing a finger), but that we should find a way to distribute the responsibilities more. It's *us*, the community, that has to get organized as well. As you say, until there is a group of people that can say "We'll put a lot of time in this and make it a great success", we all favour running with the people who gave birth to bioruby. At the same time, we could help them more if some simple things would be organized in a slightly different way (e.g. making it easy to give people the opportunity to add to the wiki). What I wanted to call for in addition, is to have bioruby put a bit more in the spotlights. We all know that bioruby is relatively unknown compared to other projects like bioperl (obviously), biojava and biopython. Of course that has a lot to do with the fact that ruby is less known than the other languages, but I think that 'getting the word out' is not a bad thing. Hence my call for a blog or something where we (the developers) could organize our thoughts on what we would like to add to or change in bioruby as well as explain the rationale behind some decisions. The more bioruby is mentioned everywhere, the more we can create a buzz, the more people will get interested, the more developers we'll get, the better bioruby will become. So in the end, you're right if you say "who has the time or energy". What we could try to do is find a way to distribute the efforts, so less time and energy is needed from single individuals. I'll try to rephrase some things on the blog to make sure it's clear that it's meant as some suggestions rather than criticism. (The title now seems like a bad choice as well...) jan. -----Original Message----- From: bioruby-bounces at lists.open-bio.org on behalf of Pjotr Prins Sent: Fri 12/10/2007 12:20 To: Shameer Khadar Cc: bioruby at lists.open-bio.org Subject: Re: [BioRuby] bioruby docs On Thu, Oct 11, 2007 at 02:48:32PM +0530, Shameer Khadar wrote: > Here is an excellent article about the status of BioRuby > http://saaientist.blogspot.com/ > (NB: Not official but an excellent personal perspective) Criticism is good and Jan is a respected contributor to BioRuby. Nevertheless with open source projects we have to take great care at giving people their due respect and it is easier to criticise the management side of this type of project than actually fixing stuff. I have seen to many opensource projects where people don't actually commit themselves fully after lengthy discussions on 'how to do things'. So, until a number of individuals steps up and says "WE WANT TO RUN WITH THIS PROJECT AND MAKE IT A GREAT SUCCESS", I will favour the idea of running with the people who have made it a success, so far. Otherwise, it is unfair on the guys who have put in a lot of their free time and energy to get where we are. Almost all open source project hinge on a few individuals - and BIORUBY could do better (I agree), but who has the real time and energy and has the proven coding track record? Both Jan and Trevor belong in the last category - but I know they don't have time. Pj. _______________________________________________ BioRuby mailing list BioRuby at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/bioruby From shameer at ncbs.res.in Fri Oct 12 14:43:50 2007 From: shameer at ncbs.res.in (Shameer Khadar) Date: Sat, 13 Oct 2007 00:13:50 +0530 (IST) Subject: [BioRuby] bioruby docs In-Reply-To: <20071012112021.GA14794@thebird.nl> References: <42287.192.168.1.1.1192014728.squirrel@mail.ncbs.res.in> <47620.192.168.1.1.1192094312.squirrel@mail.ncbs.res.in> <20071012112021.GA14794@thebird.nl> Message-ID: <38560.192.168.1.1.1192214630.squirrel@mail.ncbs.res.in> I missed the list id last time. Here's my reply to Pjotr Prins mail. Hi, Criticism is good and Jan is a respected contributor to BioRuby. Nevertheless with open source projects we have to take great care at giving people their due respect and it is easier to criticise the management side of this type of project than actually fixing stuff. I have seen to many opensource projects where people don't actually commit themselves fully after lengthy discussions on 'how to do things'. Before reading Jan's Blog, I didnt search much about his contributions to the project (sorry for that :( ), its only after reading the blog in detail I came to know about his contributions to the project (especially graphics and ensembl API). I just joined this list couple of months back and started to learn Ruby from the links that provided by Naohisa GOTO. Now I reached in a position to read up and understand the flow of code. I want to explore new areas in BioRuby like ROR. Its only yesterday I came to know about dedicated server softwares are there for ROR (light_httpd & MONGREL etc),. For a person like me with programming experience in LAMP, it may take some time to understand these kind of basic technical stuffs. So, until a number of individuals steps up and says "WE WANT TO RUN WITH THIS PROJECT AND MAKE IT A GREAT SUCCESS", I will favour the idea of running with the people who have made it a success, so far. Otherwise, it is unfair on the guys who have put in a lot of their free time and energy to get where we are. This is true. I strongly agree with you. I can see the dates as old as 2003 in BioRuby homepage, Project is atleast 5 years old. There should be strong inputs from the core-developers to push the project to greater heights. Almost all open source project hinge on a few individuals - and BIORUBY could do better (I agree), but who has the real time and energy and has the proven coding track record? Both Jan and Trevor belong in the last category - but I know they don't have time. BIORUBY could do better - thats the point !!! In my day today work I am dealing with sequenc and structure data/database and I am developing web based applications and databases using the LAMP. If I can do my job in simple and effects way using a new language/technology (Ruby/ROR). I am happy to learn that. There will be many like me who are ready to learn and use this in Bioinformatics application development. Several People are using Ruby/BioRuby/ROR extensively (But not all bioinformaticians... ), if they could share the links/blogs or some of them can update the HOW-TO's and doc in BioRuby doc Wiki. BioRuby will get much better visibility and appreciation that it deserves. PS. My mail was not intend to be a criticising one. I am extremly sorry if it sounds like that to anyone. It was an excitement of a Bioinformtics programmer wondering about the exciting thing that he is going to do using BioRuby/ROR. -- Shameer From jan.aerts at bbsrc.ac.uk Fri Oct 12 15:40:37 2007 From: jan.aerts at bbsrc.ac.uk (jan aerts (RI)) Date: Fri, 12 Oct 2007 20:40:37 +0100 Subject: [BioRuby] bioruby docs References: <42287.192.168.1.1.1192014728.squirrel@mail.ncbs.res.in><47620.192.168.1.1.1192094312.squirrel@mail.ncbs.res.in><20071012112021.GA14794@thebird.nl> <1F16910BB8546C4DA5526FABB0C98D09120C07@ebre2ksrv1.ebrc.bbsrc.ac.uk> Message-ID: <1F16910BB8546C4DA5526FABB0C98D09120C0F@ebre2ksrv1.ebrc.bbsrc.ac.uk> Just a little suggestion: what if we would start with trying to get an idea of who blogs about ruby and bioinformatics? We could then put that list on the bioruby website for example. There is Propeller Twist (http://fjossinet.u-strasbg.fr/), the new bioinforuby by Francesco (http://bioinforuby.blogspot.com/), my own SaaienTist (http://saaientist.blogspot.com), and if possible the Japanese ones as well. I suspect that Mitsuteru has one: http://bioruby.g.hatena.ne.jp/nakao_mitsuteru/. What do you think? jan. -----Original Message----- From: bioruby-bounces at lists.open-bio.org on behalf of jan aerts (RI) Sent: Fri 12/10/2007 13:40 To: Pjotr Prins; Shameer Khadar Cc: bioruby at lists.open-bio.org Subject: Re: [BioRuby] bioruby docs Hey Pjotr. You're absolutely right. The last thing I wanted to do was to criticize the management (I hope you don't read the blog post in that way). They've done a great job and it's not easy to put a lot of effort in an open source project (as I've experienced myself as well). Believe me: I have the greatest respect. As I mentioned in that post, what I proposed was actually to have part of the load lifted from upper echelon's shoulders. That way, they probably would feel less pressure as well about being in charge of bioruby. Where I mentioned "getting organized", I didn't mean that _they_ should get organized (as a way of pointing a finger), but that we should find a way to distribute the responsibilities more. It's *us*, the community, that has to get organized as well. As you say, until there is a group of people that can say "We'll put a lot of time in this and make it a great success", we all favour running with the people who gave birth to bioruby. At the same time, we could hel! p them more if some simple things would be organized in a slightly different way (e.g. making it easy to give people the opportunity to add to the wiki). What I wanted to call for in addition, is to have bioruby put a bit more in the spotlights. We all know that bioruby is relatively unknown compared to other projects like bioperl (obviously), biojava and biopython. Of course that has a lot to do with the fact that ruby is less known than the other languages, but I think that 'getting the word out' is not a bad thing. Hence my call for a blog or something where we (the developers) could organize our thoughts on what we would like to add to or change in bioruby as well as explain the rationale behind some decisions. The more bioruby is mentioned everywhere, the more we can create a buzz, the more people will get interested, the more developers we'll get, the better bioruby will become. So in the end, you're right if you say "who has the time or energy". What we could try to do is find a way to distribute the efforts, so less time and energy is needed from single individuals. I'll try to rephrase some things on the blog to make sure it's clear that it's meant as some suggestions rather than criticism. (The title now seems like a bad choice as well...) jan. -----Original Message----- From: bioruby-bounces at lists.open-bio.org on behalf of Pjotr Prins Sent: Fri 12/10/2007 12:20 To: Shameer Khadar Cc: bioruby at lists.open-bio.org Subject: Re: [BioRuby] bioruby docs On Thu, Oct 11, 2007 at 02:48:32PM +0530, Shameer Khadar wrote: > Here is an excellent article about the status of BioRuby > http://saaientist.blogspot.com/ > (NB: Not official but an excellent personal perspective) Criticism is good and Jan is a respected contributor to BioRuby. Nevertheless with open source projects we have to take great care at giving people their due respect and it is easier to criticise the management side of this type of project than actually fixing stuff. I have seen to many opensource projects where people don't actually commit themselves fully after lengthy discussions on 'how to do things'. So, until a number of individuals steps up and says "WE WANT TO RUN WITH THIS PROJECT AND MAKE IT A GREAT SUCCESS", I will favour the idea of running with the people who have made it a success, so far. Otherwise, it is unfair on the guys who have put in a lot of their free time and energy to get where we are. Almost all open source project hinge on a few individuals - and BIORUBY could do better (I agree), but who has the real time and energy and has the proven coding track record? Both Jan and Trevor belong in the last category - but I know they don't have time. Pj. _______________________________________________ BioRuby mailing list BioRuby at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/bioruby _______________________________________________ BioRuby mailing list BioRuby at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/bioruby From trevor at corevx.com Sat Oct 13 14:59:22 2007 From: trevor at corevx.com (Trevor Wennblom) Date: Sat, 13 Oct 2007 18:59:22 +0000 Subject: [BioRuby] BioRuby/Core, BioRuby/CoolProject7, BioRuby/ThisThingInC, BioRuby/FrumpyExtensionForMyThesis Message-ID: Re: "bioruby docs" thread - Everyone has made important, and very valid, points. Here's how I'm seeing the sum of the matters at hand: 1) The documentation could be better Whenever I need to use an aspect of the library I'm unfamiliar with the only documentation I turn to is pulling apart the code and examining the tests. This isn't how I want to do it of course, but there's several barriers to anything better. The RDoc could use some attention. I made this point a little while back but didn't get around to doing much about it. (RDoc as a documentation format is a little rough around the edges.) Here's an overview of several ways to screw up a project's documentation with a syntactically-poorly documented module: http://ninecoldwinters.com/ferro/rdoc-comment-block-examples/ The library's interface is inconsistent from module to module. I'm okay with this since each problem a module attempts to solve would likely feel awkward trying to share the same interface with another module. Divergence is okay since each module has a different problem domain. Even Ruby's biggest poster-child project, Rails, has very vocal - and accurate - complaints regarding it's lack of documentation. When I need to really know what's going on I have to look at it's code too, either because the RDoc is lacking, or I'm missing a piece of the big picture. And they have books. The let's-make-a-wiki approach doesn't work, it's a poor substitute for good documentation. 2) Direction I struggle to really nail down the overall goal for BioRuby. Currently (and feel free to add and correct) it seems to be: * Sequence Manipulator - Strings of text become sequence data objects with common convenience methods. * File Parser - Take data files and turn them into objects to manage the contained information. * Reference - Factual information provided as a convenience (molecular weight information for instance). * Web Service API - There are several web-services available to use as a data source or a data manipulator, this essentially provides methods of convenience to interact with those. * Analyzer - Tools that tell you information about your data. * Shell - Interactive interface So what are BioRuby's strengths and what are it's weaknesses for these? Perhaps in several areas we can say that nothing needs any more development - the goal has been achieved. Other objectives perhaps are secondary and don't need to be developed further. What needs to be added? I very much like the idea of BioRuby being a sort of "core" library that has one goal and does it very well (and something that we could document exhaustively). There are many BioRuby related tools that could be built on top of that and offered as separate modules. I would see the Sequence Manipulator, File Parser, and Reference roles to be all that I'm concerned about seeing in BioRuby/Core. Everything else could be provided as extensions that have their own project maintainers with separate gem release cycles. It should be easy for someone to add and extend to BioRuby simply by 'require'-ing it and by adhering to using the basic BioRuby module/class structure. There could be dozens of RubyForge projects that utilize and add to 'bio', advertised on bioruby.org's front page, where someone could install each of them if they wished, or just BioRuby/Core for the basics. At present BioRuby/Core seems destined for feature bloat. BioRuby/Annex was an excellent idea of course, I'd just like that strategy to become how BioRuby is consistently extended in the future. In theory for BioRuby 1.2 I could rip out several of my modules and provide them as separate gems, but if that was the case I'd recommend the same for several other modules that currently compose BioRuby. 3) Documentation, again Once we know exactly what we all care about in common, then it's easy to have some common inertia. It's "easy" to provide an extremely good, lengthy, tutorial on, say, parsing Fasta files. But providing exhaustive documentation / tuturials on the lesser used projects, and therefore all of BioRuby at present, is understandably uninteresting. The world is changing too fast for BioRuby to grow with it under the same way we've been doing business. Science changes, Web Services get replaced with REST, file format slop becomes RDF with real ontologies, files become SPARQL endpoints, etc. So I suppose the question I have is what do we want BioRuby to be? What do we want it to excel at? From revalia at gmail.com Mon Oct 15 02:29:56 2007 From: revalia at gmail.com (Kristen) Date: Sun, 14 Oct 2007 23:29:56 -0700 Subject: [BioRuby] How to get organism name from a fasta file? Message-ID: Hello, I have many entries that look familiar to this in one big fasta file: >Gene:IGI00206306|PYRAB16740 Proteome:37|P_abyssi_Orsay ProteinIDs:CAB50578 Product:Q9UY34|N-terminal acetyltransferase atggaagacatcctcgaaaacaaaggcgaagtcaagaagaaaattccgatttccttgata actataaggagtgcaaaactgtttgatattccctatattatgaggatagagcaggcatcg I would like to retrieve the part that says "Proteome:37|P_abyssi_Orsay", but not sure how to do this. The tutorial shows how to loop through all the entries in the fasta file, but this doesnt help me. Is there an easy way to retrieve this information from a fasta object? Or is there a way to output the definition info of the first fasta entry? Maybe something like: ff = Bio::FlatFile.new(Bio::FastaFormat, ARGF) puts ff[1].definiton Thanks in advance, Kristen From francesco.strozzi at gmail.com Mon Oct 15 08:30:21 2007 From: francesco.strozzi at gmail.com (Francesco Strozzi) Date: Mon, 15 Oct 2007 14:30:21 +0200 Subject: [BioRuby] How to get organism name from a fasta file? In-Reply-To: References: Message-ID: Hi, I'm new here, but I think that this can be done using regular expressions, applied to the output of the "definition()" method. This should work with your example: re = /\S+\s(\S+)\s.*/ Bio::FlatFile.open(Bio::FastaFormat,ARGF) do |file| file.each do |f| m = re.match(f.definition) puts m[1] end end This will display only the part you are interested in from the comment of your FASTA sequences. I take a look at the RDOC of BioRuby and I didn't find any method to grab this information directly. I've seen the method "identifiers()", used to grab informations from NCBI like IDs, but I think this is not your case. Basically, here you have to parse the definition of the FASTA sequence and extract all the informations between the first and the second space characters. If there is a more simple and elegant way, please let me know! Cheers Francesco 2007/10/15, Kristen : > > Hello, > > I have many entries that look familiar to this in one big fasta file: > > >Gene:IGI00206306|PYRAB16740 Proteome:37|P_abyssi_Orsay > ProteinIDs:CAB50578 > Product:Q9UY34|N-terminal acetyltransferase > atggaagacatcctcgaaaacaaaggcgaagtcaagaagaaaattccgatttccttgata > actataaggagtgcaaaactgtttgatattccctatattatgaggatagagcaggcatcg > > > I would like to retrieve the part that says "Proteome:37|P_abyssi_Orsay", > but not sure how to do this. The tutorial shows how to loop through all > the entries in the fasta file, but this doesnt help me. > Is there an easy way to retrieve this information from a fasta object? > Or is there a way to output the definition info of the first fasta entry? > Maybe something like: > ff = Bio::FlatFile.new(Bio::FastaFormat, ARGF) > puts ff[1].definiton > > Thanks in advance, > Kristen > _______________________________________________ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby > From georgkam at gmail.com Mon Oct 22 18:08:17 2007 From: georgkam at gmail.com (George) Date: Mon, 22 Oct 2007 23:08:17 +0100 Subject: [BioRuby] bioruby as a rails plugin. Message-ID: <471D1F51.3070203@gmail.com> Hi all, I have a rails project in which i need to access the bioruby library. Currently, i have just done a require 'bio' in the environment.rb However i had a rumor that bioruby is possible as a rails plugin. and on checking from http://rubyforge.org/pm/task.php?func=detailtask&project_task_id=820&group_id=769&group_project_id=194 I found that the implementation is a 100% complete. Please where is this plugin located and please any documentation? What is the best way of calling the bio plugin? Thank you in advance. George From ktym at hgc.jp Mon Oct 22 23:27:20 2007 From: ktym at hgc.jp (Toshiaki Katayama) Date: Tue, 23 Oct 2007 12:27:20 +0900 Subject: [BioRuby] bioruby as a rails plugin. In-Reply-To: <471D1F51.3070203@gmail.com> References: <471D1F51.3070203@gmail.com> Message-ID: <632A790F-90AC-4E89-944D-17695FDD9179@hgc.jp> Hi George, On 2007/10/23, at 7:08, George wrote: > Hi all, > I have a rails project in which i need to access the bioruby library. > Currently, i have just done a require 'bio' in the environment.rb I think this is the right way. > However i had a rumor that bioruby is possible as a rails plugin. and on > checking from > http://rubyforge.org/pm/task.php?func=detailtask&project_task_id=820&group_id=769&group_project_id=194 > I found that the implementation is a 100% complete. I have implemented a Rails generator for BioRuby shell and it is bundled in the BioRuby v1.1.0 release. It is called "BioRuby shell", and the "bioruby" command can be used as a better replacement for the "script/console", and if you use "--rails" option, it will generate a web interface and acts as a replacement for the "script/server". The strength of the bioruby command is that it can store your command line history and objects across the sessions. This functionality is generally applicable for any rails application, and not necessary to be prefixed with bio-, but as a historical reason, and I can't spare enough time for refactoring, it remains as it was born. You can invoke it as % bioruby --rails foo or on top of the existing rails app as % rails bar % bioruby --rails bar This will create 'data' and 'shell' directories in addition to the rails defaults, and installs bioruby_controller, related views, stylesheets and icons for the following functionality. Then you can access to http://localhost:3000/bioruby/ where you can type in any Ruby code including BioRuby shell commands to execute. For example, cdc28 = getent("uniprot:CDC28_YEAST") genes = keggapi.get_genes_by_pathway("path:hsa00010") You can use all Bio::* classes in BioRuby as well. seq = Bio::Sequence::NA.new("atgc" * 10).randomize seq.translate You can also use your Rails models as in script/console. user = User.find(:first) user.name The goal of this interface is to make it as a front end of the workflow of the bioinformatics analysis. For example, 1) find a specific gene, select orthologs, alignment, build trees, visualize it with ape in R thorough RSruby. 2) load expression profiles, map to KEGG, generate sub graphs, rendering it in Cytoscape. 3) ... More work should be done: * prettier rendering of various kind of objects including images * auto complementation of the variables, methods and services * integrating more web services, applications Here is a snippet from a changelog of 2007-06-08 http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/bioruby/ChangeLog?rev=1.68&cvsroot=bioruby&content-type=text/vnd.viewcvs-markup If --rails (-r) option is applied, 'bioruby' command will run in the Rails server mode, and the server will start in the :savedir. (A) IRB mode 1. run in the current directory and the session will be saved in the ~/.bioruby directory % bioruby 2. run in the current directory and the session will be saved in the foo/bar directory % bioruby foo/bar 3. run in the current directory and the session will be saved in the /tmp/foo/bar directory % bioruby /tmp/foo/bar (B) Rails mode 4. run in the ~/.bioruby directory and the session will also be saved in the ~/.bioruby directory % bioruby -r 5. run in the foo/bar directory and the session will also be saved in the foo/bar directory % bioruby -r foo/bar 6. run in the /tmp/foo/bar directory and the session will also be saved in the /tmp/foo/bar directory % bioruby -r /tmp/foo/bar (C) Script mode 7. run in the current directory using the session saved in the ~/.bioruby directory % bioruby ~/.bioruby/shell/script.rb 8. run in the current directory using the session saved in the foo/bar directory % bioruby foo/bar/shell/script.rb 9. run in the current directory using the session saved in the /tmp/foo/bar directory % bioruby /tmp/foo/bar/shell/script.rb From ktym at hgc.jp Tue Oct 23 00:08:44 2007 From: ktym at hgc.jp (Toshiaki Katayama) Date: Tue, 23 Oct 2007 13:08:44 +0900 Subject: [BioRuby] bioruby docs In-Reply-To: <1F16910BB8546C4DA5526FABB0C98D09120C0F@ebre2ksrv1.ebrc.bbsrc.ac.uk> References: <42287.192.168.1.1.1192014728.squirrel@mail.ncbs.res.in><47620.192.168.1.1.1192094312.squirrel@mail.ncbs.res.in><20071012112021.GA14794@thebird.nl> <1F16910BB8546C4DA5526FABB0C98D09120C07@ebre2ksrv1.ebrc.bbsrc.ac.uk> <1F16910BB8546C4DA5526FABB0C98D09120C0F@ebre2ksrv1.ebrc.bbsrc.ac.uk> Message-ID: Hi, I've just read through this thread and the saaientist blog (too long for me... :-) and added links to the following blogs at http://bioruby.org/ As for the site integration, * Top page needs refactoring. Pretty cool icons were contributed from Okamoto-san, and I made a draft version of the new site but never finished. Hisotically, the site is hosted at my office (University of Tokyo) but now might be the time to migrate to open-bio.org. http://bioruby.org/ http://bioruby.org/tmp/site_design.png * Wiki sites needs to be transfered. I can't keep control over the wiki site anymore, so the contents in the current wiki pages should be transfered to the other site and updated by the user community. I thought that to use the Media Wiki at open-bio.org is the best solution, but using rubyforge's Wiki page is the another option as Jan was suggested. Any way, I'll forward wiki.bioruby.org to the new site when the migration is done. http://wiki.bioruby.org/ - obsoleted by spam http://dev.bioruby.org/wiki/ja/ http://dev.bioruby.org/wiki/en/ * How about API documentations? Trevor has been kindly provided bioruby-doc.org for the API documentation site. 1. just link to the site from the new bioruby.org 2. put the contents under the new bioruby.org site (http://bioruby.org/rdoc/) 3. radically integrate it with Trac and SVN system at open-bio.org?! For any of the above, I need volunteers. Thanks, Toshiaki Katayama On 2007/10/13, at 4:40, jan aerts (RI) wrote: > Just a little suggestion: what if we would start with trying to get an idea of who blogs about ruby and bioinformatics? We could then put that list on the bioruby website for example. There is Propeller Twist (http://fjossinet.u-strasbg.fr/), the new bioinforuby by Francesco (http://bioinforuby.blogspot.com/), my own SaaienTist (http://saaientist.blogspot.com), and if possible the Japanese ones as well. I suspect that Mitsuteru has one: http://bioruby.g.hatena.ne.jp/nakao_mitsuteru/. > > What do you think? > > jan. > > > -----Original Message----- > From: bioruby-bounces at lists.open-bio.org on behalf of jan aerts (RI) > Sent: Fri 12/10/2007 13:40 > To: Pjotr Prins; Shameer Khadar > Cc: bioruby at lists.open-bio.org > Subject: Re: [BioRuby] bioruby docs > > Hey Pjotr. > > You're absolutely right. The last thing I wanted to do was to criticize the management (I hope you don't read the blog post in that way). They've done a great job and it's not easy to put a lot of effort in an open source project (as I've experienced myself as well). Believe me: I have the greatest respect. As I mentioned in that post, what I proposed was actually to have part of the load lifted from upper echelon's shoulders. That way, they probably would feel less pressure as well about being in charge of bioruby. Where I mentioned "getting organized", I didn't mean that _they_ should get organized (as a way of pointing a finger), but that we should find a way to distribute the responsibilities more. It's *us*, the community, that has to get organized as well. As you say, until there is a group of people that can say "We'll put a lot of time in this and make it a great success", we all favour running with the people who gave birth to bioruby. At the same time, we could he l! > p them more if some simple things would be organized in a slightly different way (e.g. making it easy to give people the opportunity to add to the wiki). > > What I wanted to call for in addition, is to have bioruby put a bit more in the spotlights. We all know that bioruby is relatively unknown compared to other projects like bioperl (obviously), biojava and biopython. Of course that has a lot to do with the fact that ruby is less known than the other languages, but I think that 'getting the word out' is not a bad thing. Hence my call for a blog or something where we (the developers) could organize our thoughts on what we would like to add to or change in bioruby as well as explain the rationale behind some decisions. The more bioruby is mentioned everywhere, the more we can create a buzz, the more people will get interested, the more developers we'll get, the better bioruby will become. > > So in the end, you're right if you say "who has the time or energy". What we could try to do is find a way to distribute the efforts, so less time and energy is needed from single individuals. > > I'll try to rephrase some things on the blog to make sure it's clear that it's meant as some suggestions rather than criticism. (The title now seems like a bad choice as well...) > > jan. > > > -----Original Message----- > From: bioruby-bounces at lists.open-bio.org on behalf of Pjotr Prins > Sent: Fri 12/10/2007 12:20 > To: Shameer Khadar > Cc: bioruby at lists.open-bio.org > Subject: Re: [BioRuby] bioruby docs > > On Thu, Oct 11, 2007 at 02:48:32PM +0530, Shameer Khadar wrote: >> Here is an excellent article about the status of BioRuby >> http://saaientist.blogspot.com/ >> (NB: Not official but an excellent personal perspective) > > Criticism is good and Jan is a respected contributor to BioRuby. > Nevertheless with open source projects we have to take great care at > giving people their due respect and it is easier to criticise the > management side of this type of project than actually fixing stuff. I > have seen to many opensource projects where people don't actually > commit themselves fully after lengthy discussions on 'how to do > things'. > > So, until a number of individuals steps up and says "WE WANT TO RUN > WITH THIS PROJECT AND MAKE IT A GREAT SUCCESS", I will favour the > idea of running with the people who have made it a success, so far. > > Otherwise, it is unfair on the guys who have put in a lot of their > free time and energy to get where we are. > > Almost all open source project hinge on a few individuals - and > BIORUBY could do better (I agree), but who has the real time and > energy and has the proven coding track record? Both Jan and Trevor > belong in the last category - but I know they don't have time. > > Pj. > > > _______________________________________________ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby > > > _______________________________________________ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby > > > > > _______________________________________________ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby From trevor at corevx.com Tue Oct 23 00:31:35 2007 From: trevor at corevx.com (Trevor Wennblom) Date: Tue, 23 Oct 2007 04:31:35 +0000 Subject: [BioRuby] bioruby docs In-Reply-To: Message-ID: Hi all, On Oct 22, 2007, at 11:08 PM, Toshiaki Katayama wrote: > Trevor has been kindly provided bioruby-doc.org for the API documentation site. I'm not sure if this is really needed anymore. It's currently "on hold" from my end. I believe anything kept on it could be at bioruby.org. Basically, a public wiki was a poor substitute for proper documentation. I'm open to suggestions as to how it could be best used. I'm still voting for splitting BioRuby into a core module with a clearly debated, agreed, and defined purpose and pulling out everything that doesn't meet that purpose into extensions. > 3. radically integrate it with Trac and SVN system at open-bio.org?! I wonder how much Trac is really needed at this point. With BioRuby's relatively slow release cycle it may be more trouble than it's worth, and the mailing list seems sufficient for resolving bugs. While I'm still by far in favor of Subversion over CVS, I strongly believe Mercurial would ultimately be better. It would seem a distributed revision control system (RCS) would better meet the needs of the project since many people seem to want to take the project in different directions. A distributed RCS would make the entire issue of project forks non-existent, hopefully driving more aggressive development activity from individuals outside the core development group. From ktym at hgc.jp Tue Oct 23 01:00:01 2007 From: ktym at hgc.jp (Toshiaki Katayama) Date: Tue, 23 Oct 2007 14:00:01 +0900 Subject: [BioRuby] Web Service BioHackathon In-Reply-To: References: Message-ID: <5688B780-ACF6-4BD2-8894-5F1AD66EA093@hgc.jp> Hi, This would be the 1st announcement of the Web Service BioHackahton which I'm planning to hold in next January or February in Japan. Trevor, thank you for your excellent summary. I'd like to start from responding to your sentences. > Web Services get replaced with REST Partially correct, but biological complex object can't be passed to each other with REST, and the format of the returned value of REST service varies and needs to be parsed. On the other hand, to develop bioinformatics workflow with the distributed databases and services, we need standardized objects which can be used as inputs and outputs for each service. To solve this situation, I hope to organize a community to make a standard set of the biological objects based on the web service. > So I suppose the question I have is what do we want BioRuby to be? Currently, even the Bio::Sequence object is not compatible among BioPerl, BioJava, BioPython, and BioRuby. The sequence object obtained from BioRuby based web service, can't easily be utilized in the workflow written in BioPython, I suppose. So, we need refactoring of the all Bio* libraries. Based on the standardized set of SOAP-based objects, every Bio* projects implement them in their library in a unified way. The classes are not just a container of the biological objects, but they also shares a compatible set of methods (to reduce the number of web service calls, standardize the workflow among languages etc.). Bio::WebService::Sequence ? Bio::WebService::Reference ? Bio::WebService::Pathway ? Bio::WebService::Alignment ? : ??? Now I'm engaged in the Integrated Life Science Database project in Japan and hope to organize a Web Service BioHackathon. I hope to invide developers from the web services providers, Bio* libraries, BioMOBY, Taverna and myGrid projects etc. As the budget is limited, I can invite only a limited number of participants, but if you are interested in the above project, please let me know. Regards, Toshiaki Katayama On 2007/10/14, at 3:59, Trevor Wennblom wrote: > Re: "bioruby docs" thread - Everyone has made important, and very > valid, points. Here's how I'm seeing the sum of the matters at hand: > > 1) The documentation could be better > > Whenever I need to use an aspect of the library I'm unfamiliar with the > only documentation I turn to is pulling apart the code and examining the > tests. This isn't how I want to do it of course, but there's several > barriers to anything better. > > The RDoc could use some attention. I made this point a little while back > but didn't get around to doing much about it. (RDoc as a documentation > format is a little rough around the edges.) Here's an overview of > several ways to screw up a project's documentation with a > syntactically-poorly documented module: > http://ninecoldwinters.com/ferro/rdoc-comment-block-examples/ > > The library's interface is inconsistent from module to module. I'm okay > with this since each problem a module attempts to solve would likely > feel awkward trying to share the same interface with another module. > Divergence is okay since each module has a different problem domain. > > Even Ruby's biggest poster-child project, Rails, has very vocal - and > accurate - complaints regarding it's lack of documentation. When I need > to really know what's going on I have to look at it's code too, either > because the RDoc is lacking, or I'm missing a piece of the big picture. > And they have books. > > The let's-make-a-wiki approach doesn't work, it's a poor substitute > for good documentation. > > > 2) Direction > > I struggle to really nail down the overall goal for BioRuby. Currently > (and feel free to add and correct) it seems to be: > > * Sequence Manipulator - Strings of text become sequence data objects > with common convenience methods. > > * File Parser - Take data files and turn them into objects to manage > the contained information. > > * Reference - Factual information provided as a convenience (molecular > weight information for instance). > > * Web Service API - There are several web-services available to use as > a data source or a data manipulator, this essentially provides methods > of convenience to interact with those. > > * Analyzer - Tools that tell you information about your data. > > * Shell - Interactive interface > > So what are BioRuby's strengths and what are it's weaknesses for these? > Perhaps in several areas we can say that nothing needs any more > development - the goal has been achieved. Other objectives perhaps are > secondary and don't need to be developed further. What needs to be > added? > > I very much like the idea of BioRuby being a sort of "core" library > that has one goal and does it very well (and something that we could > document exhaustively). There are many BioRuby related tools that could > be built on top of that and offered as separate modules. > > I would see the Sequence Manipulator, File Parser, and Reference roles to > be all that I'm concerned about seeing in BioRuby/Core. Everything else > could be provided as extensions that have their own project maintainers > with separate gem release cycles. It should be easy for someone to add > and extend to BioRuby simply by 'require'-ing it and by adhering to > using the basic BioRuby module/class structure. > > There could be dozens of RubyForge projects that utilize and add to > 'bio', advertised on bioruby.org's front page, where someone could > install each of them if they wished, or just BioRuby/Core for the > basics. At present BioRuby/Core seems destined for feature bloat. > BioRuby/Annex was an excellent idea of course, I'd just like that > strategy to become how BioRuby is consistently extended in the future. > In theory for BioRuby 1.2 I could rip out several of my modules and > provide them as separate gems, but if that was the case I'd recommend > the same for several other modules that currently compose BioRuby. > > > 3) Documentation, again > > Once we know exactly what we all care about in common, then it's easy to > have some common inertia. It's "easy" to provide an extremely good, > lengthy, tutorial on, say, parsing Fasta files. But providing exhaustive > documentation / tuturials on the lesser used projects, and therefore all > of BioRuby at present, is understandably uninteresting. > > > The world is changing too fast for BioRuby to grow with it under the same > way we've been doing business. Science changes, Web Services get > replaced with REST, file format slop becomes RDF with real ontologies, > files become SPARQL endpoints, etc. > > So I suppose the question I have is what do we want BioRuby to be? What > do we want it to excel at? > > _______________________________________________ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby From jan.aerts at bbsrc.ac.uk Tue Oct 23 12:03:38 2007 From: jan.aerts at bbsrc.ac.uk (jan aerts (RI)) Date: Tue, 23 Oct 2007 17:03:38 +0100 Subject: [BioRuby] bioruby docs References: Message-ID: <1F16910BB8546C4DA5526FABB0C98D09120C61@ebre2ksrv1.ebrc.bbsrc.ac.uk> I agree with Trevor that modularization of the bioruby code would be a good thing, as he also explained in one of the mails last week. As for the wiki: go for the one at open-bio. They've got the thing running, and that would remove the hassle for Toshiaki. We shouldn't see the wiki as something that is writable by _everyone_, but rather a website that can be added to by a limited number of people. I could e.g. put the Bio::Graphics tutorial there :-) As for bug fixing: you're right that the mailing list is at the moment sufficient for tracking that. But still I think it's a good idea that we'd use a little bit more formal system. That's what I do for Bio::Graphics: instead of having to remember that someone send a bug report or a feature request, I just put it on rubyforge and don't have to worry that I forget. jan. -----Original Message----- From: bioruby-bounces at lists.open-bio.org on behalf of Trevor Wennblom Sent: Tue 23/10/2007 05:31 To: bioruby at lists.open-bio.org Subject: Re: [BioRuby] bioruby docs Hi all, On Oct 22, 2007, at 11:08 PM, Toshiaki Katayama wrote: > Trevor has been kindly provided bioruby-doc.org for the API documentation site. I'm not sure if this is really needed anymore. It's currently "on hold" from my end. I believe anything kept on it could be at bioruby.org. Basically, a public wiki was a poor substitute for proper documentation. I'm open to suggestions as to how it could be best used. I'm still voting for splitting BioRuby into a core module with a clearly debated, agreed, and defined purpose and pulling out everything that doesn't meet that purpose into extensions. > 3. radically integrate it with Trac and SVN system at open-bio.org?! I wonder how much Trac is really needed at this point. With BioRuby's relatively slow release cycle it may be more trouble than it's worth, and the mailing list seems sufficient for resolving bugs. While I'm still by far in favor of Subversion over CVS, I strongly believe Mercurial would ultimately be better. It would seem a distributed revision control system (RCS) would better meet the needs of the project since many people seem to want to take the project in different directions. A distributed RCS would make the entire issue of project forks non-existent, hopefully driving more aggressive development activity from individuals outside the core development group. _______________________________________________ BioRuby mailing list BioRuby at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/bioruby From georgkam at gmail.com Wed Oct 24 04:49:38 2007 From: georgkam at gmail.com (George) Date: Wed, 24 Oct 2007 09:49:38 +0100 Subject: [BioRuby] bioruby as a rails plugin. In-Reply-To: <632A790F-90AC-4E89-944D-17695FDD9179@hgc.jp> References: <471D1F51.3070203@gmail.com> <632A790F-90AC-4E89-944D-17695FDD9179@hgc.jp> Message-ID: <471F0722.7030904@gmail.com> Hi Toshiaki Thank you for the comprehensive explanation and for the insight on bioruby rails generator. george Toshiaki Katayama wrote: > Hi George, > > On 2007/10/23, at 7:08, George wrote: > >> Hi all, >> I have a rails project in which i need to access the bioruby library. >> Currently, i have just done a require 'bio' in the environment.rb >> > > I think this is the right way. > > >> However i had a rumor that bioruby is possible as a rails plugin. and on >> checking from >> http://rubyforge.org/pm/task.php?func=detailtask&project_task_id=820&group_id=769&group_project_id=194 >> I found that the implementation is a 100% complete. >> > > I have implemented a Rails generator for BioRuby shell and it is > bundled in the BioRuby v1.1.0 release. > > It is called "BioRuby shell", and the "bioruby" command can be used as > a better replacement for the "script/console", and if you use "--rails" > option, it will generate a web interface and acts as a replacement for > the "script/server". > > The strength of the bioruby command is that it can store your command line > history and objects across the sessions. > > This functionality is generally applicable for any rails application, > and not necessary to be prefixed with bio-, but as a historical reason, > and I can't spare enough time for refactoring, it remains as it was born. > > You can invoke it as > > % bioruby --rails foo > > or on top of the existing rails app as > > % rails bar > % bioruby --rails bar > > This will create 'data' and 'shell' directories in addition to the > rails defaults, and installs bioruby_controller, related views, > stylesheets and icons for the following functionality. > > Then you can access to http://localhost:3000/bioruby/ where > you can type in any Ruby code including BioRuby shell commands to execute. > > For example, > > cdc28 = getent("uniprot:CDC28_YEAST") > genes = keggapi.get_genes_by_pathway("path:hsa00010") > > You can use all Bio::* classes in BioRuby as well. > > seq = Bio::Sequence::NA.new("atgc" * 10).randomize > seq.translate > > You can also use your Rails models as in script/console. > > user = User.find(:first) > user.name > > The goal of this interface is to make it as a front end of > the workflow of the bioinformatics analysis. > > For example, > 1) find a specific gene, select orthologs, alignment, > build trees, visualize it with ape in R thorough RSruby. > 2) load expression profiles, map to KEGG, generate sub graphs, > rendering it in Cytoscape. > 3) ... > > > More work should be done: > * prettier rendering of various kind of objects including images > * auto complementation of the variables, methods and services > * integrating more web services, applications > > > Here is a snippet from a changelog of 2007-06-08 > > http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/bioruby/ChangeLog?rev=1.68&cvsroot=bioruby&content-type=text/vnd.viewcvs-markup > > If --rails (-r) option is applied, 'bioruby' command will run in > the Rails server mode, and the server will start in the :savedir. > > (A) IRB mode > > 1. run in the current directory and the session will be saved > in the ~/.bioruby directory > > % bioruby > > 2. run in the current directory and the session will be saved > in the foo/bar directory > > % bioruby foo/bar > > 3. run in the current directory and the session will be saved > in the /tmp/foo/bar directory > > % bioruby /tmp/foo/bar > > (B) Rails mode > > 4. run in the ~/.bioruby directory and the session will also be saved > in the ~/.bioruby directory > > % bioruby -r > > 5. run in the foo/bar directory and the session will also be saved > in the foo/bar directory > > % bioruby -r foo/bar > > 6. run in the /tmp/foo/bar directory and the session will also be > saved in the /tmp/foo/bar directory > > % bioruby -r /tmp/foo/bar > > (C) Script mode > > 7. run in the current directory using the session saved > in the ~/.bioruby directory > > % bioruby ~/.bioruby/shell/script.rb > > 8. run in the current directory using the session saved > in the foo/bar directory > > % bioruby foo/bar/shell/script.rb > > 9. run in the current directory using the session saved > in the /tmp/foo/bar directory > > % bioruby /tmp/foo/bar/shell/script.rb > > > > From jan.aerts at bbsrc.ac.uk Wed Oct 24 11:50:32 2007 From: jan.aerts at bbsrc.ac.uk (jan aerts (RI)) Date: Wed, 24 Oct 2007 16:50:32 +0100 Subject: [BioRuby] FW: ruby Bio::Graphics on Mac? References: <1F16910BB8546C4DA5526FABB0C98D09120C33@ebre2ksrv1.ebrc.bbsrc.ac.uk> <471BC4BF.2030303@gmail.com> Message-ID: <1F16910BB8546C4DA5526FABB0C98D09120C72@ebre2ksrv1.ebrc.bbsrc.ac.uk> -----Original Message----- From: George [mailto:georgkam at gmail.com] Sent: Sun 21/10/2007 22:29 To: jan aerts (RI) Cc: edallen at stanford.edu; francesco.strozzi at gmail.com; leotta at cshl.edu Subject: Re: ruby Bio::Graphics on Mac? On a different but related note, i tried to run Bio::Graphics on Windows but was not successful. Has anyone tried it? I installed Gtk+ in the hope of bundling cairo along with it.but i don't know exactly how i would call cairo. jan aerts (RI) wrote: > All, > > Is anyone using Bio::Graphics on a Mac? I've never used Mac before, but am trying to get cairo and rcairo running on that OS and have been unable to do so. Any help appreciated. > > Thanks, > jan. > > From jan.aerts at bbsrc.ac.uk Wed Oct 24 13:15:28 2007 From: jan.aerts at bbsrc.ac.uk (jan aerts (RI)) Date: Wed, 24 Oct 2007 18:15:28 +0100 Subject: [BioRuby] FW: ruby Bio::Graphics on Mac? References: <1F16910BB8546C4DA5526FABB0C98D09120C33@ebre2ksrv1.ebrc.bbsrc.ac.uk> <471BC4BF.2030303@gmail.com> <1F16910BB8546C4DA5526FABB0C98D09120C72@ebre2ksrv1.ebrc.bbsrc.ac.uk> Message-ID: <1F16910BB8546C4DA5526FABB0C98D09120C73@ebre2ksrv1.ebrc.bbsrc.ac.uk> I'll need someone else to test it out (and write down the steps so we can add it to the docs). I never in my life touched a Mac before this week, so getting that to work ended up being just a little bit to difficult for me... If someone gets it running on Windows: please let me know and tell me how. jan. -----Original Message----- From: Toshiaki Katayama [mailto:ktym at hgc.jp] Sent: Wed 24/10/2007 18:05 To: jan aerts (RI) Cc: bioruby at lists.open-bio.org Subject: Re: [BioRuby] FW: ruby Bio::Graphics on Mac? Jan, I have not tried Bio::Graphics yet (sorry), but cairo and rcairo can be easily installed with MacPorts and RubyGems. Toshiaki % uname -a Darwin 9064.local 8.10.1 Darwin Kernel Version 8.10.1: Wed May 23 16:33:00 PDT 2007; root:xnu-792.22.5~1/RELEASE_I386 i386 i386 % sudo port install cairo ---> Fetching render ---> Attempting to fetch renderext-0.9.tar.bz2 from http://xlibs.freedesktop.org/release/ ---> Verifying checksum(s) for render ---> Extracting render ---> Configuring render ---> Building render with target all ---> Staging render into destroot ---> Packaging tgz archive for render 0.9_0 ---> Installing render 0.9_0 ---> Activating render 0.9_0 ---> Cleaning render ---> Fetching xrender ---> Attempting to fetch libXrender-0.9.0.tar.bz2 from http://xlibs.freedesktop.org/release/ ---> Verifying checksum(s) for xrender ---> Extracting xrender ---> Configuring xrender ---> Building xrender with target all ---> Staging xrender into destroot ---> Packaging tgz archive for xrender 0.9.0_0+darwin_8 ---> Installing xrender 0.9.0_0+darwin_8 ---> Activating xrender 0.9.0_0+darwin_8 ---> Cleaning xrender ---> Fetching cairo ---> Attempting to fetch cairo-1.4.2.tar.gz from http://cairographics.org/releases/ ---> Verifying checksum(s) for cairo ---> Extracting cairo ---> Configuring cairo ---> Building cairo with target all ---> Staging cairo into destroot ---> Packaging tgz archive for cairo 1.4.2_0 ---> Installing cairo 1.4.2_0 ---> Activating cairo 1.4.2_0 ---> Cleaning cairo % sudo gem install cairo Building native extensions. This could take a while... Successfully installed cairo-1.5.0 On 2007/10/25, at 0:50, jan aerts (RI) wrote: > > > > -----Original Message----- > From: George [mailto:georgkam at gmail.com] > Sent: Sun 21/10/2007 22:29 > To: jan aerts (RI) > Cc: edallen at stanford.edu; francesco.strozzi at gmail.com; leotta at cshl.edu > Subject: Re: ruby Bio::Graphics on Mac? > > On a different but related note, i tried to run Bio::Graphics on Windows > but was not successful. Has anyone tried it? > I installed Gtk+ in the hope of bundling cairo along with it.but i don't > know exactly how i would call cairo. > > > jan aerts (RI) wrote: >> All, >> >> Is anyone using Bio::Graphics on a Mac? I've never used Mac before, but am trying to get cairo and rcairo running on that OS and have been unable to do so. Any help appreciated. >> >> Thanks, >> jan. >> >> > > > > _______________________________________________ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby From ktym at hgc.jp Wed Oct 24 13:05:29 2007 From: ktym at hgc.jp (Toshiaki Katayama) Date: Thu, 25 Oct 2007 02:05:29 +0900 Subject: [BioRuby] FW: ruby Bio::Graphics on Mac? In-Reply-To: <1F16910BB8546C4DA5526FABB0C98D09120C72@ebre2ksrv1.ebrc.bbsrc.ac.uk> References: <1F16910BB8546C4DA5526FABB0C98D09120C33@ebre2ksrv1.ebrc.bbsrc.ac.uk> <471BC4BF.2030303@gmail.com> <1F16910BB8546C4DA5526FABB0C98D09120C72@ebre2ksrv1.ebrc.bbsrc.ac.uk> Message-ID: Jan, I have not tried Bio::Graphics yet (sorry), but cairo and rcairo can be easily installed with MacPorts and RubyGems. Toshiaki % uname -a Darwin 9064.local 8.10.1 Darwin Kernel Version 8.10.1: Wed May 23 16:33:00 PDT 2007; root:xnu-792.22.5~1/RELEASE_I386 i386 i386 % sudo port install cairo ---> Fetching render ---> Attempting to fetch renderext-0.9.tar.bz2 from http://xlibs.freedesktop.org/release/ ---> Verifying checksum(s) for render ---> Extracting render ---> Configuring render ---> Building render with target all ---> Staging render into destroot ---> Packaging tgz archive for render 0.9_0 ---> Installing render 0.9_0 ---> Activating render 0.9_0 ---> Cleaning render ---> Fetching xrender ---> Attempting to fetch libXrender-0.9.0.tar.bz2 from http://xlibs.freedesktop.org/release/ ---> Verifying checksum(s) for xrender ---> Extracting xrender ---> Configuring xrender ---> Building xrender with target all ---> Staging xrender into destroot ---> Packaging tgz archive for xrender 0.9.0_0+darwin_8 ---> Installing xrender 0.9.0_0+darwin_8 ---> Activating xrender 0.9.0_0+darwin_8 ---> Cleaning xrender ---> Fetching cairo ---> Attempting to fetch cairo-1.4.2.tar.gz from http://cairographics.org/releases/ ---> Verifying checksum(s) for cairo ---> Extracting cairo ---> Configuring cairo ---> Building cairo with target all ---> Staging cairo into destroot ---> Packaging tgz archive for cairo 1.4.2_0 ---> Installing cairo 1.4.2_0 ---> Activating cairo 1.4.2_0 ---> Cleaning cairo % sudo gem install cairo Building native extensions. This could take a while... Successfully installed cairo-1.5.0 On 2007/10/25, at 0:50, jan aerts (RI) wrote: > > > > -----Original Message----- > From: George [mailto:georgkam at gmail.com] > Sent: Sun 21/10/2007 22:29 > To: jan aerts (RI) > Cc: edallen at stanford.edu; francesco.strozzi at gmail.com; leotta at cshl.edu > Subject: Re: ruby Bio::Graphics on Mac? > > On a different but related note, i tried to run Bio::Graphics on Windows > but was not successful. Has anyone tried it? > I installed Gtk+ in the hope of bundling cairo along with it.but i don't > know exactly how i would call cairo. > > > jan aerts (RI) wrote: >> All, >> >> Is anyone using Bio::Graphics on a Mac? I've never used Mac before, but am trying to get cairo and rcairo running on that OS and have been unable to do so. Any help appreciated. >> >> Thanks, >> jan. >> >> > > > > _______________________________________________ > BioRuby mailing list > BioRuby at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioruby From baj2107 at columbia.edu Fri Oct 26 09:14:38 2007 From: baj2107 at columbia.edu (Bernd Jagla) Date: Fri, 26 Oct 2007 09:14:38 -0400 Subject: [BioRuby] seeking advice on displaying sequence features Message-ID: <00f801c817d2$2a008fb0$791d919c@cgc.cpmc.columbia.edu> Hi, I am new to Ruby and BioRuby. And I want to learn both! For me the best way of doing this is a little project. I would like to get some pointers and suggestions from you on how to do this and where to start. Maybe it has already been done.. Anyways, here is what I want to do: I have a list of nucleotide sequences (genomic) and a list of features (introns, exons, TFBS, ECRs, etc), basically information in the form Property; start; end; ?direction? AND Just the sequence AND Gene/sequence name(s), description, comments Now I want to display those properties in at least two different ways: 1. all sequences in parallel lines (length correlates with sequence length) and features are color coded objects plotted on top of those lines 2. sequence with boxes, underlined or otherwise marked regions I probably need the ability to zoom, mark, and select specific sequence regions I would like to manually align or move the sequences around based on some user defined marker I want to be able to select the properties to show and export those selected properties in a variety of formats. I hope, I described the problem sufficiently to allow anyone to give me some advice on where to start, if someone has already done parts of that, and probably a list of function I should be using etc. I would be happy to contribute the final code to the community, if there is interest.. Thanks for your kind help and interest, Regards, Bernd From jan.aerts at bbsrc.ac.uk Fri Oct 26 12:49:11 2007 From: jan.aerts at bbsrc.ac.uk (jan aerts (RI)) Date: Fri, 26 Oct 2007 17:49:11 +0100 Subject: [BioRuby] seeking advice on displaying sequence features References: <00f801c817d2$2a008fb0$791d919c@cgc.cpmc.columbia.edu> Message-ID: <1F16910BB8546C4DA5526FABB0C98D09120C8F@ebre2ksrv1.ebrc.bbsrc.ac.uk> Hi Bernd. Good to hear that people are flocking around ruby and bioruby. The Bio::Graphics module (that integrates with bioruby) does part of the job that you want to do. Have a look at http://bio-graphics.rubyforge.org That website will give you an idea of the type of picture you can generate. At the moment, it does only that: generate the picture. There is no interactivity available yet apart from making it possible to create clickable glyphs (if you open the picture in a web browser). I think part of the things you want to do would involve a Rails application. I do have a proof-of-concept working (was pretty easy), but there is no release or something of a Rails-based tool that uses Bio::Graphics. I hope this can help you a bit further. If you've got any more questions, just let the mailing list know... jan. -----Original Message----- From: bioruby-bounces at lists.open-bio.org on behalf of Bernd Jagla Sent: Fri 26/10/2007 14:14 To: bioruby at lists.open-bio.org Subject: [BioRuby] seeking advice on displaying sequence features Hi, I am new to Ruby and BioRuby. And I want to learn both! For me the best way of doing this is a little project. I would like to get some pointers and suggestions from you on how to do this and where to start. Maybe it has already been done.. Anyways, here is what I want to do: I have a list of nucleotide sequences (genomic) and a list of features (introns, exons, TFBS, ECRs, etc), basically information in the form Property; start; end; ?direction? AND Just the sequence AND Gene/sequence name(s), description, comments Now I want to display those properties in at least two different ways: 1. all sequences in parallel lines (length correlates with sequence length) and features are color coded objects plotted on top of those lines 2. sequence with boxes, underlined or otherwise marked regions I probably need the ability to zoom, mark, and select specific sequence regions I would like to manually align or move the sequences around based on some user defined marker I want to be able to select the properties to show and export those selected properties in a variety of formats. I hope, I described the problem sufficiently to allow anyone to give me some advice on where to start, if someone has already done parts of that, and probably a list of function I should be using etc. I would be happy to contribute the final code to the community, if there is interest.. Thanks for your kind help and interest, Regards, Bernd _______________________________________________ BioRuby mailing list BioRuby at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/bioruby From baj2107 at columbia.edu Sat Oct 27 18:23:35 2007 From: baj2107 at columbia.edu (Bernd Jagla) Date: Sat, 27 Oct 2007 18:23:35 -0400 Subject: [BioRuby] installing bio::graphics / cairo In-Reply-To: <1F16910BB8546C4DA5526FABB0C98D09120C8F@ebre2ksrv1.ebrc.bbsrc.ac.uk> References: <00f801c817d2$2a008fb0$791d919c@cgc.cpmc.columbia.edu> <1F16910BB8546C4DA5526FABB0C98D09120C8F@ebre2ksrv1.ebrc.bbsrc.ac.uk> Message-ID: <002001c818e8$03fa6540$0500a8c0@berndhome> Hi guys, I guess I am having problems installing rcairo. At least that is my conclusion... I am working on Windows XP. I installed ruby and bioruby etc (see gem list output below) Ruby -v gives: C:\ruby>ruby -v ruby 1.8.6 (2007-03-13 patchlevel 0) [i386-mswin32] I copied the cairo libraries into the bin directory of ruby: Dir bin (see below) Now I created a file called test.rb with one line in it: Execiting the script gives me the following error message: require 'bio-graphics' C:\Documents and Settings\bernd\ruby>ruby test.rb c:/ruby/lib/ruby/site_ruby/1.8/rubygems/custom_require.rb:27:in `gem_original_require': no such file to load -- cairo (LoadError) from c:/ruby/lib/ruby/site_ruby/1.8/rubygems/custom_require.rb:27:in `require' from c:/ruby/lib/ruby/gems/1.8/gems/bio-graphics-1.2/lib/bio-graphics.rb:10 from c:/ruby/lib/ruby/site_ruby/1.8/rubygems/custom_require.rb:32:in `gem_original_require' from c:/ruby/lib/ruby/site_ruby/1.8/rubygems/custom_require.rb:32:in `require' from test.rb:1 Could you please comment and make some suggestions on get this going? Thanks, Bernd ============================================================ C:\ruby>dir bin Volume in drive C has no label. Volume Serial Number is C86C-B674 Directory of C:\ruby\bin 10/27/2007 05:52 PM . 10/27/2007 05:52 PM .. 10/27/2007 10:16 AM 351 bioruby 10/27/2007 10:16 AM 32 bioruby.bat 10/27/2007 10:16 AM 32 bioruby.cmd 10/27/2007 10:16 AM 358 br_biofetch.rb 10/27/2007 10:16 AM 39 br_biofetch.rb.cmd 10/27/2007 10:16 AM 357 br_bioflat.rb 10/27/2007 10:16 AM 38 br_bioflat.rb.cmd 10/27/2007 10:16 AM 359 br_biogetseq.rb 10/27/2007 10:16 AM 40 br_biogetseq.rb.cmd 10/27/2007 10:16 AM 357 br_pmfetch.rb 10/27/2007 10:16 AM 38 br_pmfetch.rb.cmd 10/27/2007 10:34 AM data 03/15/2007 06:33 AM 4,216 erb.bat 03/15/2007 11:51 PM 25 fxri.bat 03/15/2007 11:51 PM 245 fxri.rbw 03/15/2007 11:51 PM 21,504 gdbm.dll 03/15/2007 11:32 PM 701 gem 03/15/2007 11:51 PM 650 gem.bat 10/26/2007 07:27 PM 27 gemhelp.bat 03/15/2007 11:32 PM 3,201 gemlock 03/15/2007 11:38 PM 108 gemlock.cmd 03/15/2007 11:32 PM 515 gemri 03/15/2007 11:38 PM 106 gemri.cmd 03/15/2007 11:51 PM 1,354 gemwhich.bat 03/15/2007 11:51 PM 1,777 gem_mirror.bat 03/15/2007 11:51 PM 11,246 gem_server.bat 03/15/2007 11:48 PM 237,568 glut32.dll 03/15/2007 11:48 PM 28,728 glut32.lib 03/15/2007 11:51 PM 872,448 iconv.dll 03/15/2007 11:51 PM 6,144 iconv.exe 03/15/2007 11:32 PM 7,947 index_gem_repository.rb 03/15/2007 11:51 PM 98 inputrc.euro 03/15/2007 11:51 PM 442 irb.bat 08/20/2007 09:06 PM 536,734 libcairo-2.dll 03/15/2007 11:51 PM 1,077,248 libeay32.dll 03/15/2007 11:48 PM 147,456 libexpat.dll 03/15/2007 11:48 PM 151,552 libexpatw.dll 03/15/2007 11:51 PM 401,462 msvcp60.dll 03/15/2007 06:33 AM 864,321 msvcrt-ruby18.dll 03/15/2007 11:51 PM 282,624 openssl.exe 03/15/2007 11:51 PM 72,192 pdcurses.dll 10/27/2007 10:34 AM plugin 03/15/2007 11:49 PM 5,514 proxyserver.rb 10/27/2007 05:52 PM 352 rails 10/27/2007 05:52 PM 30 rails.cmd 03/15/2007 11:39 PM 399 rake 03/15/2007 11:51 PM 471 rake.bat 03/15/2007 11:51 PM 1,598 rdoc 03/15/2007 06:33 AM 1,804 rdoc.bat 03/15/2007 11:51 PM 136,192 readline.dll 03/15/2007 11:51 PM 1,528 ri 03/15/2007 06:33 AM 1,732 ri.bat 03/15/2007 06:33 AM 20,536 ruby.exe 03/15/2007 06:33 AM 20,537 rubyw.exe 10/27/2007 10:34 AM session 03/15/2007 11:49 PM 12,167 sqlsh.rb 03/15/2007 11:51 PM 200,704 ssleay32.dll 03/15/2007 06:33 AM 354 testrb.bat 03/15/2007 11:32 PM 649 update_rubygems 03/15/2007 11:51 PM 599 update_rubygems.bat 03/15/2007 11:38 PM 116 update_rubygems.cmd 03/15/2007 11:37 PM 59,904 zlib1.dll 59 File(s) 5,199,826 bytes 5 Dir(s) 43,921,285,120 bytes free ======================================================== C:\ruby>gem list *** LOCAL GEMS *** actionmailer (1.3.5) Service layer for easy email delivery and testing. actionpack (1.13.5) Web-flow and rendering framework putting the VC in MVC. actionwebservice (1.2.5) Web service support for Action Pack. activerecord (1.15.5) Implements the ActiveRecord pattern for ORM. activesupport (1.4.4) Support and utility classes used by the Rails framework. bio (1.0.0) Bioinformatics library bio-graphics (1.2) Library for visualizing genomic regions fxri (0.3.6) Graphical interface to the RI documentation, with search engine. fxruby (1.6.6) FXRuby is the Ruby binding to the FOX GUI toolkit. hpricot (0.4) a swift, liberal HTML parser with a fantastic library log4r (1.0.5) Log4r is a comprehensive and flexible logging library for Ruby. rails (1.2.5) Web-application framework with template engine, control-flow layer, and ORM. rake (0.7.2) Ruby based make-like utility. sources (0.0.1) This package provides download sources for remote gem installation win32-clipboard (0.4.1) A package for interacting with the Windows clipboard win32-dir (0.3.1) Extra constants and methods for the Dir class on Windows. win32-eventlog (0.4.3) Interface for the MS Windows Event Log. win32-file (0.5.3) Extra or redefined methods for the File class on Windows. win32-file-stat (1.2.3) A File::Stat class tailored to MS Windows win32-process (0.5.1) Adds fork, wait, wait2, waitpid, waitpid2 and a special kill method win32-sapi (0.1.3) An interface to the MS SAPI (Sound API) library. win32-sound (0.4.0) A package for playing with sound on Windows. windows-pr (0.6.2) Windows functions and constants predefined via Win32API From ngoto at gen-info.osaka-u.ac.jp Sun Oct 28 10:07:31 2007 From: ngoto at gen-info.osaka-u.ac.jp (Naohisa Goto) Date: Sun, 28 Oct 2007 23:07:31 +0900 Subject: [BioRuby] installing bio::graphics / cairo In-Reply-To: <002001c818e8$03fa6540$0500a8c0@berndhome> References: <1F16910BB8546C4DA5526FABB0C98D09120C8F@ebre2ksrv1.ebrc.bbsrc.ac.uk> <002001c818e8$03fa6540$0500a8c0@berndhome> Message-ID: <20071028230620.13E8.NGOTO@gen-info.osaka-u.ac.jp> Hi, Ruby-GNOME2 Win32 GUI Installer which contains rcairo-1.2.6 will solve the problem. http://ruby-gnome2.sourceforge.jp/?News_20070212_1 (ruby-gnome2-0.16.0-1-i386-mswin32.exe) During installation, checking "Register enviroment variables" option is recommended. I'm not sure, but it seems better to uninstall the cairo binaries you've previously been installed. > Hi guys, > > I guess I am having problems installing rcairo. At least that is my > conclusion... > > I am working on Windows XP. > I installed ruby and bioruby etc (see gem list output below) > > Ruby -v gives: > C:\ruby>ruby -v > ruby 1.8.6 (2007-03-13 patchlevel 0) [i386-mswin32] > > I copied the cairo libraries into the bin directory of ruby: > Dir bin (see below) -- Naohisa Goto ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org From jan.aerts at bbsrc.ac.uk Sun Oct 28 11:08:30 2007 From: jan.aerts at bbsrc.ac.uk (jan aerts (RI)) Date: Sun, 28 Oct 2007 15:08:30 -0000 Subject: [BioRuby] installing bio::graphics / cairo References: <1F16910BB8546C4DA5526FABB0C98D09120C8F@ebre2ksrv1.ebrc.bbsrc.ac.uk><002001c818e8$03fa6540$0500a8c0@berndhome> <20071028230620.13E8.NGOTO@gen-info.osaka-u.ac.jp> Message-ID: <1F16910BB8546C4DA5526FABB0C98D09120C98@ebre2ksrv1.ebrc.bbsrc.ac.uk> Thanks Naohisa. Bernd: if you get it running, let me know and I'll add that to the documentation. jan. -----Original Message----- From: bioruby-bounces at lists.open-bio.org on behalf of Naohisa Goto Sent: Sun 28/10/2007 14:07 To: Bernd Jagla; bioruby at lists.open-bio.org Subject: Re: [BioRuby] installing bio::graphics / cairo Hi, Ruby-GNOME2 Win32 GUI Installer which contains rcairo-1.2.6 will solve the problem. http://ruby-gnome2.sourceforge.jp/?News_20070212_1 (ruby-gnome2-0.16.0-1-i386-mswin32.exe) During installation, checking "Register enviroment variables" option is recommended. I'm not sure, but it seems better to uninstall the cairo binaries you've previously been installed. > Hi guys, > > I guess I am having problems installing rcairo. At least that is my > conclusion... > > I am working on Windows XP. > I installed ruby and bioruby etc (see gem list output below) > > Ruby -v gives: > C:\ruby>ruby -v > ruby 1.8.6 (2007-03-13 patchlevel 0) [i386-mswin32] > > I copied the cairo libraries into the bin directory of ruby: > Dir bin (see below) -- Naohisa Goto ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org _______________________________________________ BioRuby mailing list BioRuby at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/bioruby From baj2107 at columbia.edu Sun Oct 28 20:16:49 2007 From: baj2107 at columbia.edu (Bernd Jagla) Date: Sun, 28 Oct 2007 19:16:49 -0500 Subject: [BioRuby] installing bio::graphics / cairo In-Reply-To: <20071028230620.13E8.NGOTO@gen-info.osaka-u.ac.jp> References: <1F16910BB8546C4DA5526FABB0C98D09120C8F@ebre2ksrv1.ebrc.bbsrc.ac.uk> <002001c818e8$03fa6540$0500a8c0@berndhome> <20071028230620.13E8.NGOTO@gen-info.osaka-u.ac.jp> Message-ID: <004201c819c1$01969f10$0500a8c0@berndhome> Indeed, this solved the problem. Now I get nice graphics with the script from the tutorial. Noahisa, THANKS A LOT!!! And Jan, THANKS for the library!!! Sone more question though, where does BioExt::Graphics::Panel come from? The ri command doesn't seem to work from within Bioruby. I thought that with this I could get some documentation... How are you guys staying on top of all the functionality? I would appreciate any tips and tricks, but I am already quite happy... ;-) Thanks, Bernd |-----Original Message----- |From: Naohisa Goto [mailto:ngoto at gen-info.osaka-u.ac.jp] |Sent: Sunday, October 28, 2007 9:08 AM |To: Bernd Jagla; bioruby at lists.open-bio.org |Subject: Re: [BioRuby] installing bio::graphics / cairo | |Hi, | |Ruby-GNOME2 Win32 GUI Installer which contains rcairo-1.2.6 |will solve the problem. | |http://ruby-gnome2.sourceforge.jp/?News_20070212_1 |(ruby-gnome2-0.16.0-1-i386-mswin32.exe) | |During installation, checking "Register enviroment variables" |option is recommended. | |I'm not sure, but it seems better to uninstall the cairo binaries |you've previously been installed. | | |> Hi guys, |> |> I guess I am having problems installing rcairo. At least that is my |> conclusion... |> |> I am working on Windows XP. |> I installed ruby and bioruby etc (see gem list output below) |> |> Ruby -v gives: |> C:\ruby>ruby -v |> ruby 1.8.6 (2007-03-13 patchlevel 0) [i386-mswin32] |> |> I copied the cairo libraries into the bin directory of ruby: |> Dir bin (see below) | |-- |Naohisa Goto |ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org From jan.aerts at bbsrc.ac.uk Sun Oct 28 21:03:41 2007 From: jan.aerts at bbsrc.ac.uk (jan aerts (RI)) Date: Mon, 29 Oct 2007 01:03:41 -0000 Subject: [BioRuby] installing bio::graphics / cairo References: <1F16910BB8546C4DA5526FABB0C98D09120C8F@ebre2ksrv1.ebrc.bbsrc.ac.uk><002001c818e8$03fa6540$0500a8c0@berndhome><20071028230620.13E8.NGOTO@gen-info.osaka-u.ac.jp> <004201c819c1$01969f10$0500a8c0@berndhome> Message-ID: <1F16910BB8546C4DA5526FABB0C98D09120C9C@ebre2ksrv1.ebrc.bbsrc.ac.uk> Believe it or not, but I'm actually teaching at a _perl_ course for the moment... :-) The Bio::Graphics::Panel library was written from scratch, but built on the idea's of Lincoln Stein's great Bio::Graphics module in bioperl. Bio::Graphics is _not_ part of bioruby yet, but I think that it might become in the future. At the moment working on the possibility for vertical graphics and better integration with bioruby, so stay tuned. j. -----Original Message----- From: bioruby-bounces at lists.open-bio.org on behalf of Bernd Jagla Sent: Mon 29/10/2007 00:16 To: 'Naohisa Goto'; bioruby at lists.open-bio.org Subject: Re: [BioRuby] installing bio::graphics / cairo Indeed, this solved the problem. Now I get nice graphics with the script from the tutorial. Noahisa, THANKS A LOT!!! And Jan, THANKS for the library!!! Sone more question though, where does BioExt::Graphics::Panel come from? The ri command doesn't seem to work from within Bioruby. I thought that with this I could get some documentation... How are you guys staying on top of all the functionality? I would appreciate any tips and tricks, but I am already quite happy... ;-) Thanks, Bernd |-----Original Message----- |From: Naohisa Goto [mailto:ngoto at gen-info.osaka-u.ac.jp] |Sent: Sunday, October 28, 2007 9:08 AM |To: Bernd Jagla; bioruby at lists.open-bio.org |Subject: Re: [BioRuby] installing bio::graphics / cairo | |Hi, | |Ruby-GNOME2 Win32 GUI Installer which contains rcairo-1.2.6 |will solve the problem. | |http://ruby-gnome2.sourceforge.jp/?News_20070212_1 |(ruby-gnome2-0.16.0-1-i386-mswin32.exe) | |During installation, checking "Register enviroment variables" |option is recommended. | |I'm not sure, but it seems better to uninstall the cairo binaries |you've previously been installed. | | |> Hi guys, |> |> I guess I am having problems installing rcairo. At least that is my |> conclusion... |> |> I am working on Windows XP. |> I installed ruby and bioruby etc (see gem list output below) |> |> Ruby -v gives: |> C:\ruby>ruby -v |> ruby 1.8.6 (2007-03-13 patchlevel 0) [i386-mswin32] |> |> I copied the cairo libraries into the bin directory of ruby: |> Dir bin (see below) | |-- |Naohisa Goto |ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org _______________________________________________ BioRuby mailing list BioRuby at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/bioruby