[BioRuby] spidey parser

jan aerts (RI) jan.aerts at bbsrc.ac.uk
Wed Nov 8 10:15:26 EST 2006


Thanks! Does exactly what I wanted.

jan. 

> -----Original Message-----
> From: GOTO Naohisa [mailto:ngoto at gen-info.osaka-u.ac.jp] 
> Sent: 08 November 2006 15:04
> To: jan aerts (RI)
> Cc: bioruby at open-bio.org
> Subject: Re: spidey parser
> 
> Hi,
> 
> To get Bio::Spidey::Report::SegmentPair objects, you can use 
> Bio::Spidey::Report::Hit#each (iterates over each exon 
> segment pair), Bio::Spidey::Report::Hit#hsps (gets an array 
> of exon segment pairs), Bio::Spidey::Report::Hit#exons (same 
> as hsps), or Bio::Spidey::Report::Hit#segmentpairs (gets an 
> array of all segment pairs including introns) methods.
> 
> small sample code: 
> --------------------------------------------------
>   require 'bio'
> 
>   Bio::FlatFile.open('file.spidey') do |ff|
>     ff.each do |entry|
>       entry.each do |hit|
>         p hit.query_def    # query=mRNA definition
>         p hit.target_def   # target=genomic sequence definition
>         hit.each do |hsp|
>           p hsp.qseq       # query=mRNA sequence (with gaps)
>           p hsp.midline    # middle line
>           p hsp.hseq       # hit=genomic sequence (with gaps)
>           p hsp.aaseqline  # amino acid sequence line
>         end
>       end
>     end
>   end
> --------------------------------------------------
> 
> Thanks,
> 
> Naohisa Goto
> ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org Department of 
> Genome Informatics, Genome Information Research Center, 
> Research Institute for Microbial Diseases, Osaka University, Japan
> 
> 
> On Wed, 8 Nov 2006 14:20:08 -0000
> "jan aerts \(RI\)" <jan.aerts at bbsrc.ac.uk> wrote:
> 
> > All,
> > 
> > I'm trying to use the spidey parser (Bio::Spidey) to find 
> mismatches 
> > in the sequence between mRNA and genomic sequence. For 
> example the C/T 
> > mismatch at the end of the last line in the snippet below.
> > 
> > <SNIP>
> > Exon 3: 46694102-46690011 (gen)  152-4244 (mRNA)
> > 
> > TATTTTGCAGATAAGTCATCATGGTGAAAAGCCACATAGGCAGTTGGATCCTGGTTCTCT
> >           ||||||||||||||||||||||||||||||||||||||||||||||||||
> >           ATAAGTCATCATGGTGAAAAGCCACATAGGCAGTTGGATCCTGGTTCTCT
> >                V  I  M  V  K  S  H  I  G  S  W  I  L  V  L
> > 
> > 
> > ACAGGCCAGTGGATCAGTATAGTAACCAGAACAACTTTGTGCATGACTGTGTCAACATCA
> > ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
> > ACAGGCCAGTGGATCAGTATAGTAACCAGAACAACTTTGTGCATGACTGTGTCAATATCA
> > Y  R  P  V  D  Q  Y  S  N  Q  N  N  F  V  H  D  C  V  N  I </SNIP>
> > 
> > I couldn't find out exactly how to walk through all segments of the 
> > alignment and get to the midline. The 
> > Bio::Spidey::Report::SegmentPair#initialize method in the 
> > bio/appl/spidey/report.rb file mentions that it "is designed to be 
> > called from Bio::Spidey::Report::* classes." and that 
> "users shall not 
> > call it directly."
> > 
> > How can I walk over all segment pairs and access the mRNA 
> and genomic 
> > sequences as well as the midline?
> > 
> > Many thanks,
> > 
> > Dr Jan Aerts
> > Bioinformatics Group
> > Roslin Institute
> > Roslin, Scotland, UK
> > +44 131 527 4200
> > 
> > ---------The obligatory disclaimer-------- The information 
> contained 
> > in this e-mail (including any attachments) is
> > confidential and is intended for the use of the addressee 
> only.   The
> > opinions expressed within this e-mail (including any 
> attachments) are 
> > the opinions of the sender and do not necessarily 
> constitute those of 
> > Roslin Institute (Edinburgh) ("the Institute") unless specifically 
> > stated by a sender who is duly authorised to do so on behalf of the 
> > Institute.
> > 
> 
> 



More information about the BioRuby mailing list