[BioRuby] spidey parser
jan aerts (RI)
jan.aerts at bbsrc.ac.uk
Wed Nov 8 10:15:26 EST 2006
Thanks! Does exactly what I wanted.
jan.
> -----Original Message-----
> From: GOTO Naohisa [mailto:ngoto at gen-info.osaka-u.ac.jp]
> Sent: 08 November 2006 15:04
> To: jan aerts (RI)
> Cc: bioruby at open-bio.org
> Subject: Re: spidey parser
>
> Hi,
>
> To get Bio::Spidey::Report::SegmentPair objects, you can use
> Bio::Spidey::Report::Hit#each (iterates over each exon
> segment pair), Bio::Spidey::Report::Hit#hsps (gets an array
> of exon segment pairs), Bio::Spidey::Report::Hit#exons (same
> as hsps), or Bio::Spidey::Report::Hit#segmentpairs (gets an
> array of all segment pairs including introns) methods.
>
> small sample code:
> --------------------------------------------------
> require 'bio'
>
> Bio::FlatFile.open('file.spidey') do |ff|
> ff.each do |entry|
> entry.each do |hit|
> p hit.query_def # query=mRNA definition
> p hit.target_def # target=genomic sequence definition
> hit.each do |hsp|
> p hsp.qseq # query=mRNA sequence (with gaps)
> p hsp.midline # middle line
> p hsp.hseq # hit=genomic sequence (with gaps)
> p hsp.aaseqline # amino acid sequence line
> end
> end
> end
> end
> --------------------------------------------------
>
> Thanks,
>
> Naohisa Goto
> ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org Department of
> Genome Informatics, Genome Information Research Center,
> Research Institute for Microbial Diseases, Osaka University, Japan
>
>
> On Wed, 8 Nov 2006 14:20:08 -0000
> "jan aerts \(RI\)" <jan.aerts at bbsrc.ac.uk> wrote:
>
> > All,
> >
> > I'm trying to use the spidey parser (Bio::Spidey) to find
> mismatches
> > in the sequence between mRNA and genomic sequence. For
> example the C/T
> > mismatch at the end of the last line in the snippet below.
> >
> > <SNIP>
> > Exon 3: 46694102-46690011 (gen) 152-4244 (mRNA)
> >
> > TATTTTGCAGATAAGTCATCATGGTGAAAAGCCACATAGGCAGTTGGATCCTGGTTCTCT
> > ||||||||||||||||||||||||||||||||||||||||||||||||||
> > ATAAGTCATCATGGTGAAAAGCCACATAGGCAGTTGGATCCTGGTTCTCT
> > V I M V K S H I G S W I L V L
> >
> >
> > ACAGGCCAGTGGATCAGTATAGTAACCAGAACAACTTTGTGCATGACTGTGTCAACATCA
> > ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
> > ACAGGCCAGTGGATCAGTATAGTAACCAGAACAACTTTGTGCATGACTGTGTCAATATCA
> > Y R P V D Q Y S N Q N N F V H D C V N I </SNIP>
> >
> > I couldn't find out exactly how to walk through all segments of the
> > alignment and get to the midline. The
> > Bio::Spidey::Report::SegmentPair#initialize method in the
> > bio/appl/spidey/report.rb file mentions that it "is designed to be
> > called from Bio::Spidey::Report::* classes." and that
> "users shall not
> > call it directly."
> >
> > How can I walk over all segment pairs and access the mRNA
> and genomic
> > sequences as well as the midline?
> >
> > Many thanks,
> >
> > Dr Jan Aerts
> > Bioinformatics Group
> > Roslin Institute
> > Roslin, Scotland, UK
> > +44 131 527 4200
> >
> > ---------The obligatory disclaimer-------- The information
> contained
> > in this e-mail (including any attachments) is
> > confidential and is intended for the use of the addressee
> only. The
> > opinions expressed within this e-mail (including any
> attachments) are
> > the opinions of the sender and do not necessarily
> constitute those of
> > Roslin Institute (Edinburgh) ("the Institute") unless specifically
> > stated by a sender who is duly authorised to do so on behalf of the
> > Institute.
> >
>
>
More information about the BioRuby
mailing list