From urban at bettong.net Fri Dec 2 08:00:01 2005 From: urban at bettong.net (Urban Hafner) Date: Fri Dec 2 08:16:42 2005 Subject: [BioRuby] Parsing a file in Swissprot format Message-ID: <1133528401.3277.15.camel@mws16.gsf.de> Hej everybody, I'm new to BioRuby and I think I'm doing something wrong while parsing a file in Swissprot format. What I'm trying to do is to get the sequence out of it. I do it like this: sequence = Bio::SPTR.new(File.new(f).read) p sequence.sq But that doesn't work it gives me this error message: /home/users/hafner/lib/site_ruby/1.8/bio/db/embl/sptr.rb:706:in `sq': Invalid SQ Line: (RuntimeError) 'AAGCTTAATGTATATAATCTTTTAGAGGTAAAATCTACAGCCAGCAAAAGTCATGGTAAA TATTCTTTGACTGAACTCTCACTAAACTCCTCTAAATTATATGTCATATTAACTGGTTAA ATTAATATAAATTTGTGACATGACCTTAACTGGTTAGGTAGGATATTTTTCTTCATGCAA AAATATGACTAATAATAATTTAGCACAAAAATATTTCCCAATACTTTAATTCTGTGATAG AAAAATGTTTAACTCAGCTACTATAATCCCATAATTTTGAAAACTATTTATTAGCTTTTG TGTTTGACCCTTCCCTAGCCAAAGGCAACTATTTAAGGACCCTTTAAAACTCTTGAAACT ACTTTAGAGTC' from diplomarbeit/tools/smartdb-entries-without- sequence.rb:10 I"m not sure if this is BioRuby's (I'm using the version from CVS) fault or if the input file is faulty. Does anybody have a clue what I'm doing wrong here? Cheers, Urban Here's my input file: AC SM0000001 XX DT 1.1.1999 00:00:00 (created); ili DT 8.12.2004 12:49:00 (updated); ili2 XX NA MOUSE$kappa-MAR XX OS mouse, Mus spec. OC eukaryota; animalia; metazoa; chordata; vertebrata; OC tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae; OC murinae XX HO human, rabbit [2] XX SZ 371 bp XX DE G000538; immunoglobulin kappa light chain DP Direction: 3'; Pos 1: ATG DN Internal: y; DC between joining and constant regions [1]; ~200 bp DC upstream of the kappa enhancer [1] XX SQ AAGCTTAATGTATATAATCTTTTAGAGGTAAAATCTACAGCCAGCAAAAGTCATGGTAAA SQ TATTCTTTGACTGAACTCTCACTAAACTCCTCTAAATTATATGTCATATTAACTGGTTAA SQ ATTAATATAAATTTGTGACATGACCTTAACTGGTTAGGTAGGATATTTTTCTTCATGCAA SQ AAATATGACTAATAATAATTTAGCACAAAAATATTTCCCAATACTTTAATTCTGTGATAG SQ AAAAATGTTTAACTCAGCTACTATAATCCCATAATTTTGAAAACTATTTATTAGCTTTTG SQ TGTTTGACCCTTCCCTAGCCAAAGGCAACTATTTAAGGACCCTTTAAAACTCTTGAAACT SQ ACTTTAGAGTC SC [7] XX FT 2 - 11: cleavage by topoisomerase II [3] FT 2 - 15: deleted in plasmacytoma PC 7183 [3] FT 5 - 14: cleavage by topoisomerase II [3] FT 5 - 14: 5'-recombination junction [3] FT 8 - 17: cleavage by topoisomerase II [3] FT 10 - 19: cleavage by topoisomerase II [3] FT 32 - 41: cleavage by topoisomerase II [3] FT 53 - 62: cleavage by Drosophila topoisomerase II only FT [3] FT 68 - 77: cleavage by topoisomerase II [3] FT 69 - 78: cleavage by topoisomerase II [3] FT 73 - 82: cleavage by topoisomerase II [3] FT 98 - 107: cleavage by Drosophila topoisomerase II only FT [3] FT 147 - 156: cleavage by topoisomerase II [3] FT 163 - 284: confers MAR-like features upon any DNA when FT contiguously reiterated in the same molecule FT [7] FT 164 - 170: similar motif found in human PARP MAR FT SM0000116 [8] FT 182 - 191: cleavage by topoisomerase II [3] FT 189 - 198: cleavage by topoisomerase II [3] FT 219 - 228: cleavage by topoisomerase II [3] FT 242 - 251: cleavage by topoisomerase II [3] FT 248 - 257: cleavage by topoisomerase II [3] FT 253 - 253: G in [3] FT 256 - 265: cleavage by topoisomerase II [3] XX SF topoisomerase II sites [1]; AT-rich sites [1]; SF contains a breakpoint for chromosomal translocation [3]; SF several short stretches of homopolymeric adenine or SF thymine [7] XX BP 75% [J. Bode, direct submission]; 20% [7] TP constitutive [1] XX FF prototype of a S/MAR; contributes to maximal expression of FF the kappa gene [2]; contributes to hypermutation [9]; FF contributes to kappa expression as shown by flow cytometic FF assay, but has little effect on accumulation of the FF respective mRNA [9] XX CP liver, kidney, spleen, thymus, MPC-11, P-815, L-cell [1] XX EV in vitro selection of S/MAR EC [J. Bode, direct submission] XX BF SB000002; lamin A [6] MM nitrocellulose filter binding; SO rl; rat QA 6 BF SB000003; lamin B1 [6] MM nitrocellulose filter binding; SO rl; rat QA 6 BF SB000004; lamin C [6] MM nitrocellulose filter binding; SO rl; rat QA 6 BF SB000018; SP120 [4] MM nitrocellulose filter binding; SO brain; rat QA 6 BF SB000018; SP120 [4] MM southwestern blotting; SO brain; rat QA 6 BF SB000022; topoisomerase II [3] MM gel retardation; SO Drosophila; Drosophila melanogaster QA 6 BF SB000022; topoisomerase II [3] MM topoisomerase II cleavage assay; SO Drosophila; Drosophila melanogaster QA 6 BF SB000043; topoisomerase II [3] MM topoisomerase II cleavage assay; SO calf; calf QA 6 BF SB000045; SMI1 [5] MM functional analysis; PR 254 bp fragment SO yeast, extract; baker's yeast, Saccharomyces cerevisiae QA 6 BF SB000052; topoisomerase II [3] MM topoisomerase II cleavage assay; SO mouse; mouse QA 6 BF SB000053; topoisomerase II [3] MM nitrocellulose filter binding; SO HeLa; human QA 6 BF SB000067; SMAR1 [10] MM gel shift competition; SO rec(mouse-E.coli); mouse QA 6 BF SB000077; SAF-A [12] MM supershift (antibody binding); SO liver; mouse QA 6 BF SB000077; SAF-A [12] MM southwestern blotting; SO liver; mouse QA 6 XX RN [1] RX MEDLINE; 86106203 PubMed; 3002631 RA Cockerill, P. N., Garrard, W. T. RT Chromosomal loop anchorage of the kappa immunoglobin gene RT occurs next to the enhancer in a region containing RT topoisomerase II sites RL Cell 44:273-282 (1986) RN [2] RX MEDLINE; 90078219 PubMed; 2512290 RA Blasquez, V. C., Xu, M., Moses, S. C., Garrard, W. T. RT Immunoglobulin kappa gene expression after stable RT integration. I. Role of the intronic MAR and enhancer in RT plasmacytoma cells RL J. Biol. Chem. 264:21183-21189 (1989) RN [3] RX MEDLINE; 89315824 PubMed; 2546156 RA Sperry, A. O., Blasquez, V. C., Garrard, W. T. RT Dysfunction of chromosomal llop attachment sites: RT Illegitimate recombination linked to matrix association RT regions and topoisomerase II RL Proc. Natl. Acad. Sci. USA 86:5497-5501 (1989) RN [4] RX MEDLINE; 93286136 PubMed; 8509422 RA Tsutsui, K., Tsutsui, K., Okada, S., Watarai, S., Seki, S., RA Yasuda, T., Shohmori, T. RT Identification and characterization of a nuclear scaffold RT protein that binds the matrix attachment region DNA RL J. Biol. Chem. 268:12886-12894 (1993) RN [5] RX MEDLINE; 93296190 PubMed; 8516310 RA Fishel, B. R., Sperry, A. O., Garrard, W. T. RT Yeast calmodulin and a conserved nuclear protein RT participate in the in vivo binding of a matrix associated RT region RL Proc. Natl. Acad. Sci. USA 90:5623-5627 (1993) RN [6] RX MEDLINE; 94344140 PubMed; 8065361 RA Luderus, M. E. E., den Blaauwen, J. L., de Smit, O. J. B., RA Compton, D. A., van Driel, R. RT Binding of matrix attachment regions to lamin polymers RT involves single-stranded regions and the minor groove RL Mol. Cell. Biol. 14:6297-6305 (1994) RN [7] RX MEDLINE; 96222527 PubMed; 8670229 RA Okada, S., Tsutsui, K., Tsutsui, K., Seki, S., Shohmori, T. RT Subdomain structure of the matrix attachment region located RT within the mouse immunoglobulin kappa gene intron RL Biochem. Biophys. Res. Commun. 222:472-477 (1996) RN [8] RA Boulikas, T., Kong, C. F., Brooks, D., Hsie, L. RT The 3' untranslated region of the human RT poly(ADP-ribose)polymerase gene is a nuclear matrix RT anchoring site RL Int. J. Oncol. 9:1287-1294 (1996) RN [9] RX MEDLINE; 97377037 PubMed; 9233808 RA Goyenechea, B., Klix, N., Williams, G. T., Riddell, A., RA Neuberger, M. S., Milstein, C. RT Cells strongly expressing Ig kappa transgenes show clonal RT recruitment of hypermutation: a role for both MAR and the RT enhancers RL EMBO J. 16:3987-3994 (1997) RN [10] RX MEDLINE; 20408892 PubMed; 10950932 RA Chattopadhyay, S., Kaul, R., Charest, A., Housman, D., RA Chen, J. RT SMAR1, a novel, alternatively spliced gene product, binds RT the scaffold/matrix-associated region at the T cell RT receptor beta locus RL Genomics 68:93-96 (2000) RN [11] RX MEDLINE; 20496822 PubMed; 11041885 RA Morisawa, G., Han-yama, A., Moda, I., Tamai, A., Iwabuchi, RA M., Meshi, T. RT AHM1, a novel type of nuclear matrix-localized, MAR binding RT protein with a single AT hook and a J RT domain-homologous region RL Plant Cell 12:1903-1916 (2000) RN [12] RX MEDLINE; 21456956 PubMed; 11573239 RA Lobov, I. B., Tsutsui, K., Mitchell, A. R., Podgornaya, O. RA I. RT Specificity of SAF-A and lamin B binding in vitro RT correlates with the satellite DNA bending state RL J. Cell. Biochem. 83:218-229 (2001) // From n at bioruby.org Fri Dec 2 11:16:22 2005 From: n at bioruby.org (n@bioruby.org) Date: Fri Dec 2 11:49:08 2005 Subject: [BioRuby] Parsing a file in Swissprot format In-Reply-To: <1133528401.3277.15.camel@mws16.gsf.de> References: <1133528401.3277.15.camel@mws16.gsf.de> Message-ID: <20051203.011622.217694867.cortel@machina.localizome.net> Hi Urban, Thank you for your error report, but, it seems that your input data is no swissprot format text. (1) You can find the SwissProt SQ line format at , and the sequence data line format at . (2) You can make a parser class for your swissprot like format like here, require 'bio/db' require 'bio/db/embl/common' module Bio class SwissProtLike < EMBLDB include Bio::EMBLDB::Common def sq Bio::Sequence::AA.new( fetch('SQ').gsub(/ |\d+/, '') ) end end end You can save the above code piece as "swissprotlike.rb" and you can use it to parse your files like here, require 'swissprotlike' entry = Bio::SwissProtLike.new( File.read("entry.file") ) entry.accession #=> "SM0000001" entry.sq #=> "AAGCTTAATGTATATAATCTTTTAGAGGTAAAATCTACAGCCAGCAAAAGTCATGGTAAATATTCTTTGACTGAACTCTCACTAAACTCCTCTAAATTATATGTCATATTAACTGGTTAAATTAATATAAATTTGTGACATGACCTTAACTGGTTAGGTAGGATATTTTTCTTCATGCAAAAATATGACTAATAATAATTTAGCACAAAAATATTTCCCAATACTTTAATTCTGTGATAGAAAAATGTTTAACTCAGCTACTATAATCCCATAATTTTGAAAACTATTTATTAGCTTTTGTGTTTGACCCTTCCCTAGCCAAAGGCAACTATTTAAGGACCCTTTAAAACTCTTGAAACTACTTTAGAGTC" Best, Mitsuteru - Mitsuteru Nakao Sequence Analysis Team Compuational Biology Research Center (CBRC) National Institute of Advanced Industrial Science and Technology (AIST) BioRuby Project b-Src From: Urban Hafner Subject: [BioRuby] Parsing a file in Swissprot format Date: Fri, 02 Dec 2005 14:00:01 +0100 > Hej everybody, > I'm new to BioRuby and I think I'm doing something wrong while parsing a > file in Swissprot format. What I'm trying to do is to get the sequence > out of it. I do it like this: > > sequence = Bio::SPTR.new(File.new(f).read) > p sequence.sq > > But that doesn't work it gives me this error message: > > /home/users/hafner/lib/site_ruby/1.8/bio/db/embl/sptr.rb:706:in `sq': > Invalid SQ Line: (RuntimeError) > 'AAGCTTAATGTATATAATCTTTTAGAGGTAAAATCTACAGCCAGCAAAAGTCATGGTAAA > TATTCTTTGACTGAACTCTCACTAAACTCCTCTAAATTATATGTCATATTAACTGGTTAA > ATTAATATAAATTTGTGACATGACCTTAACTGGTTAGGTAGGATATTTTTCTTCATGCAA > AAATATGACTAATAATAATTTAGCACAAAAATATTTCCCAATACTTTAATTCTGTGATAG > AAAAATGTTTAACTCAGCTACTATAATCCCATAATTTTGAAAACTATTTATTAGCTTTTG > TGTTTGACCCTTCCCTAGCCAAAGGCAACTATTTAAGGACCCTTTAAAACTCTTGAAACT > ACTTTAGAGTC' from diplomarbeit/tools/smartdb-entries-without- > sequence.rb:10 > > I"m not sure if this is BioRuby's (I'm using the version from CVS) fault > or if the input file is faulty. > > Does anybody have a clue what I'm doing wrong here? > > Cheers, Urban > > Here's my input file: > > AC SM0000001 > XX > DT 1.1.1999 00:00:00 (created); ili > DT 8.12.2004 12:49:00 (updated); ili2 > XX > NA MOUSE$kappa-MAR > XX > OS mouse, Mus spec. > OC eukaryota; animalia; metazoa; chordata; vertebrata; > OC tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae; > OC murinae > XX > HO human, rabbit [2] > XX > SZ 371 bp > XX > DE G000538; immunoglobulin kappa light chain > DP Direction: 3'; Pos 1: ATG > DN Internal: y; > DC between joining and constant regions [1]; ~200 bp > DC upstream of the kappa enhancer [1] > XX > SQ AAGCTTAATGTATATAATCTTTTAGAGGTAAAATCTACAGCCAGCAAAAGTCATGGTAAA > SQ TATTCTTTGACTGAACTCTCACTAAACTCCTCTAAATTATATGTCATATTAACTGGTTAA > SQ ATTAATATAAATTTGTGACATGACCTTAACTGGTTAGGTAGGATATTTTTCTTCATGCAA > SQ AAATATGACTAATAATAATTTAGCACAAAAATATTTCCCAATACTTTAATTCTGTGATAG > SQ AAAAATGTTTAACTCAGCTACTATAATCCCATAATTTTGAAAACTATTTATTAGCTTTTG > SQ TGTTTGACCCTTCCCTAGCCAAAGGCAACTATTTAAGGACCCTTTAAAACTCTTGAAACT > SQ ACTTTAGAGTC > SC [7] > XX > FT 2 - 11: cleavage by topoisomerase II [3] > FT 2 - 15: deleted in plasmacytoma PC 7183 [3] > FT 5 - 14: cleavage by topoisomerase II [3] > FT 5 - 14: 5'-recombination junction [3] > FT 8 - 17: cleavage by topoisomerase II [3] > FT 10 - 19: cleavage by topoisomerase II [3] > FT 32 - 41: cleavage by topoisomerase II [3] > FT 53 - 62: cleavage by Drosophila topoisomerase II only > FT [3] > FT 68 - 77: cleavage by topoisomerase II [3] > FT 69 - 78: cleavage by topoisomerase II [3] > FT 73 - 82: cleavage by topoisomerase II [3] > FT 98 - 107: cleavage by Drosophila topoisomerase II only > FT [3] > FT 147 - 156: cleavage by topoisomerase II [3] > FT 163 - 284: confers MAR-like features upon any DNA when > FT contiguously reiterated in the same molecule > FT [7] > FT 164 - 170: similar motif found in human PARP MAR > FT SM0000116 [8] > FT 182 - 191: cleavage by topoisomerase II [3] > FT 189 - 198: cleavage by topoisomerase II [3] > FT 219 - 228: cleavage by topoisomerase II [3] > FT 242 - 251: cleavage by topoisomerase II [3] > FT 248 - 257: cleavage by topoisomerase II [3] > FT 253 - 253: G in [3] > FT 256 - 265: cleavage by topoisomerase II [3] > XX > SF topoisomerase II sites [1]; AT-rich sites [1]; > SF contains a breakpoint for chromosomal translocation [3]; > SF several short stretches of homopolymeric adenine or > SF thymine [7] > XX > BP 75% [J. Bode, direct submission]; 20% [7] > TP constitutive [1] > XX > FF prototype of a S/MAR; contributes to maximal expression of > FF the kappa gene [2]; contributes to hypermutation [9]; > FF contributes to kappa expression as shown by flow cytometic > FF assay, but has little effect on accumulation of the > FF respective mRNA [9] > XX > CP liver, kidney, spleen, thymus, MPC-11, P-815, L-cell [1] > XX > EV in vitro selection of S/MAR > EC [J. Bode, direct submission] > XX > BF SB000002; lamin A [6] > MM nitrocellulose filter binding; > SO rl; rat > QA 6 > BF SB000003; lamin B1 [6] > MM nitrocellulose filter binding; > SO rl; rat > QA 6 > BF SB000004; lamin C [6] > MM nitrocellulose filter binding; > SO rl; rat > QA 6 > BF SB000018; SP120 [4] > MM nitrocellulose filter binding; > SO brain; rat > QA 6 > BF SB000018; SP120 [4] > MM southwestern blotting; > SO brain; rat > QA 6 > BF SB000022; topoisomerase II [3] > MM gel retardation; > SO Drosophila; Drosophila melanogaster > QA 6 > BF SB000022; topoisomerase II [3] > MM topoisomerase II cleavage assay; > SO Drosophila; Drosophila melanogaster > QA 6 > BF SB000043; topoisomerase II [3] > MM topoisomerase II cleavage assay; > SO calf; calf > QA 6 > BF SB000045; SMI1 [5] > MM functional analysis; > PR 254 bp fragment > SO yeast, extract; baker's yeast, Saccharomyces cerevisiae > QA 6 > BF SB000052; topoisomerase II [3] > MM topoisomerase II cleavage assay; > SO mouse; mouse > QA 6 > BF SB000053; topoisomerase II [3] > MM nitrocellulose filter binding; > SO HeLa; human > QA 6 > BF SB000067; SMAR1 [10] > MM gel shift competition; > SO rec(mouse-E.coli); mouse > QA 6 > BF SB000077; SAF-A [12] > MM supershift (antibody binding); > SO liver; mouse > QA 6 > BF SB000077; SAF-A [12] > MM southwestern blotting; > SO liver; mouse > QA 6 > XX > RN [1] > RX MEDLINE; 86106203 PubMed; 3002631 > RA Cockerill, P. N., Garrard, W. T. > RT Chromosomal loop anchorage of the kappa immunoglobin gene > RT occurs next to the enhancer in a region containing > RT topoisomerase II sites > RL Cell 44:273-282 (1986) > RN [2] > RX MEDLINE; 90078219 PubMed; 2512290 > RA Blasquez, V. C., Xu, M., Moses, S. C., Garrard, W. T. > RT Immunoglobulin kappa gene expression after stable > RT integration. I. Role of the intronic MAR and enhancer in > RT plasmacytoma cells > RL J. Biol. Chem. 264:21183-21189 (1989) > RN [3] > RX MEDLINE; 89315824 PubMed; 2546156 > RA Sperry, A. O., Blasquez, V. C., Garrard, W. T. > RT Dysfunction of chromosomal llop attachment sites: > RT Illegitimate recombination linked to matrix association > RT regions and topoisomerase II > RL Proc. Natl. Acad. Sci. USA 86:5497-5501 (1989) > RN [4] > RX MEDLINE; 93286136 PubMed; 8509422 > RA Tsutsui, K., Tsutsui, K., Okada, S., Watarai, S., Seki, S., > RA Yasuda, T., Shohmori, T. > RT Identification and characterization of a nuclear scaffold > RT protein that binds the matrix attachment region DNA > RL J. Biol. Chem. 268:12886-12894 (1993) > RN [5] > RX MEDLINE; 93296190 PubMed; 8516310 > RA Fishel, B. R., Sperry, A. O., Garrard, W. T. > RT Yeast calmodulin and a conserved nuclear protein > RT participate in the in vivo binding of a matrix associated > RT region > RL Proc. Natl. Acad. Sci. USA 90:5623-5627 (1993) > RN [6] > RX MEDLINE; 94344140 PubMed; 8065361 > RA Luderus, M. E. E., den Blaauwen, J. L., de Smit, O. J. B., > RA Compton, D. A., van Driel, R. > RT Binding of matrix attachment regions to lamin polymers > RT involves single-stranded regions and the minor groove > RL Mol. Cell. Biol. 14:6297-6305 (1994) > RN [7] > RX MEDLINE; 96222527 PubMed; 8670229 > RA Okada, S., Tsutsui, K., Tsutsui, K., Seki, S., Shohmori, T. > RT Subdomain structure of the matrix attachment region located > RT within the mouse immunoglobulin kappa gene intron > RL Biochem. Biophys. Res. Commun. 222:472-477 (1996) > RN [8] > RA Boulikas, T., Kong, C. F., Brooks, D., Hsie, L. > RT The 3' untranslated region of the human > RT poly(ADP-ribose)polymerase gene is a nuclear matrix > RT anchoring site > RL Int. J. Oncol. 9:1287-1294 (1996) > RN [9] > RX MEDLINE; 97377037 PubMed; 9233808 > RA Goyenechea, B., Klix, N., Williams, G. T., Riddell, A., > RA Neuberger, M. S., Milstein, C. > RT Cells strongly expressing Ig kappa transgenes show clonal > RT recruitment of hypermutation: a role for both MAR and the > RT enhancers > RL EMBO J. 16:3987-3994 (1997) > RN [10] > RX MEDLINE; 20408892 PubMed; 10950932 > RA Chattopadhyay, S., Kaul, R., Charest, A., Housman, D., > RA Chen, J. > RT SMAR1, a novel, alternatively spliced gene product, binds > RT the scaffold/matrix-associated region at the T cell > RT receptor beta locus > RL Genomics 68:93-96 (2000) > RN [11] > RX MEDLINE; 20496822 PubMed; 11041885 > RA Morisawa, G., Han-yama, A., Moda, I., Tamai, A., Iwabuchi, > RA M., Meshi, T. > RT AHM1, a novel type of nuclear matrix-localized, MAR binding > RT protein with a single AT hook and a J > RT domain-homologous region > RL Plant Cell 12:1903-1916 (2000) > RN [12] > RX MEDLINE; 21456956 PubMed; 11573239 > RA Lobov, I. B., Tsutsui, K., Mitchell, A. R., Podgornaya, O. > RA I. > RT Specificity of SAF-A and lamin B binding in vitro > RT correlates with the satellite DNA bending state > RL J. Cell. Biochem. 83:218-229 (2001) > // > > _______________________________________________ > BioRuby mailing list > BioRuby@open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioruby From n at bioruby.org Fri Dec 2 22:41:04 2005 From: n at bioruby.org (n@bioruby.org) Date: Fri Dec 2 22:39:16 2005 Subject: [BioRuby] Parsing a file in Swissprot format In-Reply-To: <1133528401.3277.15.camel@mws16.gsf.de> References: <1133528401.3277.15.camel@mws16.gsf.de> Message-ID: <20051203.124104.200048149.cortel@machina.localizome.net> Hi Uarban, Your input file is a entry (SM0000001) in S/MARt DB. * S/MARt DB http://smartdb.bioinf.med.uni-goettingen.de/SMARtDB/browse/index.html * SM0000001 http://smartdb.bioinf.med.uni-goettingen.de/cgi-bin/SMARtDB/getSMAR.cgi?SM0000001 > > Here's my input file: > > AC SM0000001 > XX > DT 1.1.1999 00:00:00 (created); ili > DT 8.12.2004 12:49:00 (updated); ili2 > XX > NA MOUSE$kappa-MAR > XX > OS mouse, Mus spec. > OC eukaryota; animalia; metazoa; chordata; vertebrata; > OC tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae; > OC murinae > XX > HO human, rabbit [2] > XX > SZ 371 bp > XX > DE G000538; immunoglobulin kappa light chain > DP Direction: 3'; Pos 1: ATG > DN Internal: y; > DC between joining and constant regions [1]; ~200 bp > DC upstream of the kappa enhancer [1] > XX > SQ AAGCTTAATGTATATAATCTTTTAGAGGTAAAATCTACAGCCAGCAAAAGTCATGGTAAA > SQ TATTCTTTGACTGAACTCTCACTAAACTCCTCTAAATTATATGTCATATTAACTGGTTAA > SQ ATTAATATAAATTTGTGACATGACCTTAACTGGTTAGGTAGGATATTTTTCTTCATGCAA > SQ AAATATGACTAATAATAATTTAGCACAAAAATATTTCCCAATACTTTAATTCTGTGATAG > SQ AAAAATGTTTAACTCAGCTACTATAATCCCATAATTTTGAAAACTATTTATTAGCTTTTG > SQ TGTTTGACCCTTCCCTAGCCAAAGGCAACTATTTAAGGACCCTTTAAAACTCTTGAAACT > SQ ACTTTAGAGTC > SC [7] > XX > FT 2 - 11: cleavage by topoisomerase II [3] > FT 2 - 15: deleted in plasmacytoma PC 7183 [3] > FT 5 - 14: cleavage by topoisomerase II [3] > FT 5 - 14: 5'-recombination junction [3] > FT 8 - 17: cleavage by topoisomerase II [3] > FT 10 - 19: cleavage by topoisomerase II [3] > FT 32 - 41: cleavage by topoisomerase II [3] > FT 53 - 62: cleavage by Drosophila topoisomerase II only > FT [3] > FT 68 - 77: cleavage by topoisomerase II [3] > FT 69 - 78: cleavage by topoisomerase II [3] > FT 73 - 82: cleavage by topoisomerase II [3] > FT 98 - 107: cleavage by Drosophila topoisomerase II only > FT [3] > FT 147 - 156: cleavage by topoisomerase II [3] > FT 163 - 284: confers MAR-like features upon any DNA when > FT contiguously reiterated in the same molecule > FT [7] > FT 164 - 170: similar motif found in human PARP MAR > FT SM0000116 [8] > FT 182 - 191: cleavage by topoisomerase II [3] > FT 189 - 198: cleavage by topoisomerase II [3] > FT 219 - 228: cleavage by topoisomerase II [3] > FT 242 - 251: cleavage by topoisomerase II [3] > FT 248 - 257: cleavage by topoisomerase II [3] > FT 253 - 253: G in [3] > FT 256 - 265: cleavage by topoisomerase II [3] > XX > SF topoisomerase II sites [1]; AT-rich sites [1]; > SF contains a breakpoint for chromosomal translocation [3]; > SF several short stretches of homopolymeric adenine or > SF thymine [7] > XX > BP 75% [J. Bode, direct submission]; 20% [7] > TP constitutive [1] > XX > FF prototype of a S/MAR; contributes to maximal expression of > FF the kappa gene [2]; contributes to hypermutation [9]; > FF contributes to kappa expression as shown by flow cytometic > FF assay, but has little effect on accumulation of the > FF respective mRNA [9] > XX > CP liver, kidney, spleen, thymus, MPC-11, P-815, L-cell [1] > XX > EV in vitro selection of S/MAR > EC [J. Bode, direct submission] > XX > BF SB000002; lamin A [6] > MM nitrocellulose filter binding; > SO rl; rat > QA 6 > BF SB000003; lamin B1 [6] > MM nitrocellulose filter binding; > SO rl; rat > QA 6 > BF SB000004; lamin C [6] > MM nitrocellulose filter binding; > SO rl; rat > QA 6 > BF SB000018; SP120 [4] > MM nitrocellulose filter binding; > SO brain; rat > QA 6 > BF SB000018; SP120 [4] > MM southwestern blotting; > SO brain; rat > QA 6 > BF SB000022; topoisomerase II [3] > MM gel retardation; > SO Drosophila; Drosophila melanogaster > QA 6 > BF SB000022; topoisomerase II [3] > MM topoisomerase II cleavage assay; > SO Drosophila; Drosophila melanogaster > QA 6 > BF SB000043; topoisomerase II [3] > MM topoisomerase II cleavage assay; > SO calf; calf > QA 6 > BF SB000045; SMI1 [5] > MM functional analysis; > PR 254 bp fragment > SO yeast, extract; baker's yeast, Saccharomyces cerevisiae > QA 6 > BF SB000052; topoisomerase II [3] > MM topoisomerase II cleavage assay; > SO mouse; mouse > QA 6 > BF SB000053; topoisomerase II [3] > MM nitrocellulose filter binding; > SO HeLa; human > QA 6 > BF SB000067; SMAR1 [10] > MM gel shift competition; > SO rec(mouse-E.coli); mouse > QA 6 > BF SB000077; SAF-A [12] > MM supershift (antibody binding); > SO liver; mouse > QA 6 > BF SB000077; SAF-A [12] > MM southwestern blotting; > SO liver; mouse > QA 6 > XX > RN [1] > RX MEDLINE; 86106203 PubMed; 3002631 > RA Cockerill, P. N., Garrard, W. T. > RT Chromosomal loop anchorage of the kappa immunoglobin gene > RT occurs next to the enhancer in a region containing > RT topoisomerase II sites > RL Cell 44:273-282 (1986) > RN [2] > RX MEDLINE; 90078219 PubMed; 2512290 > RA Blasquez, V. C., Xu, M., Moses, S. C., Garrard, W. T. > RT Immunoglobulin kappa gene expression after stable > RT integration. I. Role of the intronic MAR and enhancer in > RT plasmacytoma cells > RL J. Biol. Chem. 264:21183-21189 (1989) > RN [3] > RX MEDLINE; 89315824 PubMed; 2546156 > RA Sperry, A. O., Blasquez, V. C., Garrard, W. T. > RT Dysfunction of chromosomal llop attachment sites: > RT Illegitimate recombination linked to matrix association > RT regions and topoisomerase II > RL Proc. Natl. Acad. Sci. USA 86:5497-5501 (1989) > RN [4] > RX MEDLINE; 93286136 PubMed; 8509422 > RA Tsutsui, K., Tsutsui, K., Okada, S., Watarai, S., Seki, S., > RA Yasuda, T., Shohmori, T. > RT Identification and characterization of a nuclear scaffold > RT protein that binds the matrix attachment region DNA > RL J. Biol. Chem. 268:12886-12894 (1993) > RN [5] > RX MEDLINE; 93296190 PubMed; 8516310 > RA Fishel, B. R., Sperry, A. O., Garrard, W. T. > RT Yeast calmodulin and a conserved nuclear protein > RT participate in the in vivo binding of a matrix associated > RT region > RL Proc. Natl. Acad. Sci. USA 90:5623-5627 (1993) > RN [6] > RX MEDLINE; 94344140 PubMed; 8065361 > RA Luderus, M. E. E., den Blaauwen, J. L., de Smit, O. J. B., > RA Compton, D. A., van Driel, R. > RT Binding of matrix attachment regions to lamin polymers > RT involves single-stranded regions and the minor groove > RL Mol. Cell. Biol. 14:6297-6305 (1994) > RN [7] > RX MEDLINE; 96222527 PubMed; 8670229 > RA Okada, S., Tsutsui, K., Tsutsui, K., Seki, S., Shohmori, T. > RT Subdomain structure of the matrix attachment region located > RT within the mouse immunoglobulin kappa gene intron > RL Biochem. Biophys. Res. Commun. 222:472-477 (1996) > RN [8] > RA Boulikas, T., Kong, C. F., Brooks, D., Hsie, L. > RT The 3' untranslated region of the human > RT poly(ADP-ribose)polymerase gene is a nuclear matrix > RT anchoring site > RL Int. J. Oncol. 9:1287-1294 (1996) > RN [9] > RX MEDLINE; 97377037 PubMed; 9233808 > RA Goyenechea, B., Klix, N., Williams, G. T., Riddell, A., > RA Neuberger, M. S., Milstein, C. > RT Cells strongly expressing Ig kappa transgenes show clonal > RT recruitment of hypermutation: a role for both MAR and the > RT enhancers > RL EMBO J. 16:3987-3994 (1997) > RN [10] > RX MEDLINE; 20408892 PubMed; 10950932 > RA Chattopadhyay, S., Kaul, R., Charest, A., Housman, D., > RA Chen, J. > RT SMAR1, a novel, alternatively spliced gene product, binds > RT the scaffold/matrix-associated region at the T cell > RT receptor beta locus > RL Genomics 68:93-96 (2000) > RN [11] > RX MEDLINE; 20496822 PubMed; 11041885 > RA Morisawa, G., Han-yama, A., Moda, I., Tamai, A., Iwabuchi, > RA M., Meshi, T. > RT AHM1, a novel type of nuclear matrix-localized, MAR binding > RT protein with a single AT hook and a J > RT domain-homologous region > RL Plant Cell 12:1903-1916 (2000) > RN [12] > RX MEDLINE; 21456956 PubMed; 11573239 > RA Lobov, I. B., Tsutsui, K., Mitchell, A. R., Podgornaya, O. > RA I. > RT Specificity of SAF-A and lamin B binding in vitro > RT correlates with the satellite DNA bending state > RL J. Cell. Biochem. 83:218-229 (2001) > // Best, Mitsuteru - Mitsuteru Nakao Sequence Analysis Team Compuational Biology Research Center (CBRC) National Institute of Advanced Industrial Science and Technology (AIST) BioRuby Project b-Src From urban at bettong.net Sat Dec 3 03:21:45 2005 From: urban at bettong.net (Urban Hafner) Date: Sat Dec 3 03:19:55 2005 Subject: [BioRuby] Parsing a file in Swissprot format In-Reply-To: <20051203.124104.200048149.cortel@machina.localizome.net> References: <1133528401.3277.15.camel@mws16.gsf.de> <20051203.124104.200048149.cortel@machina.localizome.net> Message-ID: <108BF1E6-87F7-4DC1-A544-1C04A68A02B3@bettong.net> -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 On 3 Dec 2005, at 04:41, n@bioruby.org wrote: > Your input file is a entry (SM0000001) in S/MARt DB. > > * S/MARt DB > http://smartdb.bioinf.med.uni-goettingen.de/SMARtDB/browse/ > index.html > > * SM0000001 > http://smartdb.bioinf.med.uni-goettingen.de/cgi-bin/SMARtDB/ > getSMAR.cgi?SM0000001 Yes, I know. Thanks again Mitsuteru. Just out of curiosity. Is there a format like what they are using or did they, in good bioinformatics tradition, invent yet another format? Cheers, Urban -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.4.0 (Darwin) iD8DBQFDkVWiggNuVCIrEyURAsw0AJsET2iE7E1hwSPw2wCXMgwU0edeqACfTb0S 66K414KhY/xnOdPxesXVwj8= =2WIP -----END PGP SIGNATURE----- From trevor at corevx.com Sat Dec 3 12:24:04 2005 From: trevor at corevx.com (Trevor Wennblom) Date: Sat Dec 3 12:42:06 2005 Subject: [BioRuby] Parsing a file in Swissprot format In-Reply-To: <108BF1E6-87F7-4DC1-A544-1C04A68A02B3@bettong.net> References: <1133528401.3277.15.camel@mws16.gsf.de> <20051203.124104.200048149.cortel@machina.localizome.net> <108BF1E6-87F7-4DC1-A544-1C04A68A02B3@bettong.net> Message-ID: <4391D4B4.9040902@corevx.com> Urban Hafner wrote: > > Yes, I know. Thanks again Mitsuteru. Just out of curiosity. Is there > a format like what they are using or did they, in good bioinformatics > tradition, invent yet another format? > > Cheers, Urban Is it critical that you need to parse these S/MARt DB files soon? The format seems pretty straightforward. If there's sufficient interest I can come up with something after I get a few other projects finished up. Thanks, Trevor From urban at bettong.net Sat Dec 3 14:19:16 2005 From: urban at bettong.net (Urban Hafner) Date: Sat Dec 3 14:17:14 2005 Subject: [BioRuby] Parsing a file in Swissprot format In-Reply-To: <4391D4B4.9040902@corevx.com> References: <1133528401.3277.15.camel@mws16.gsf.de> <20051203.124104.200048149.cortel@machina.localizome.net> <108BF1E6-87F7-4DC1-A544-1C04A68A02B3@bettong.net> <4391D4B4.9040902@corevx.com> Message-ID: <62C67754-E207-4049-B2D5-5897E24FC9A0@bettong.net> -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 On 3 Dec 2005, at 18:24, Trevor Wennblom wrote: > Is it critical that you need to parse these S/MARt DB files soon? > The format seems pretty straightforward. If there's sufficient > interest I can come up with something after I get a few other > projects finished up. No, no, I was only a bit upset they invented their own format. But if you want to write the parser I can donate some code that converts the S/MARt DB entries, which are HTML files, into plain-text files. Urban -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.4.0 (Darwin) iD8DBQFDke+9ggNuVCIrEyURApj8AKC6ErV/kXF4S/YnhvuemH/f8XKzgwCcDRWq JuC5MapAe5rV7fhsjimaipU= =ZuvM -----END PGP SIGNATURE----- From urban at bettong.net Tue Dec 6 07:21:48 2005 From: urban at bettong.net (Urban Hafner) Date: Tue Dec 6 07:50:28 2005 Subject: [BioRuby] Error reading GenBank file Message-ID: Hej, I'm trying to read a GenBank file like this: ff = Bio::FlatFile.auto(filename) ff.each_entry |gb| p gb.naseq end What I get is not the sequence object but this error: /home/users/hafner/lib/site_ruby/1.8/bio/db.rb:223:in `tag_cut': undefined method `[]=' for nil:NilClass (NoMethodError) from /home/users/hafner/lib/site_ruby/1.8/bio/db/genbank/common.rb:239:in `origin' from /home/users/hafner/lib/site_ruby/1.8/bio/db/genbank/genbank.rb:72:in `naseq' from ../additional_mouse_smars.rb:76 from /home/users/hafner/lib/site_ruby/1.8/bio/io/flatfile.rb:196:in `each_entry' from ../additional_mouse_smars.rb:75 from ../additional_mouse_smars.rb:72 As an example file take AJ271885: http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=11342587 Urban From k at bioruby.org Tue Dec 6 22:37:42 2005 From: k at bioruby.org (Toshiaki Katayama) Date: Tue Dec 6 23:04:01 2005 Subject: [BioRuby] Error reading GenBank file In-Reply-To: References: Message-ID: <0A5D38B3-510B-4CD9-8EB0-25F3B5A8F9EB@bioruby.org> On 2005/12/06, at 21:21, Urban Hafner wrote: > Hej, > I'm trying to read a GenBank file like this: > > ff = Bio::FlatFile.auto(filename) > ff.each_entry |gb| ff.each_entry do |gb| > p gb.naseq > end > > What I get is not the sequence object but this error: > > /home/users/hafner/lib/site_ruby/1.8/bio/db.rb:223:in `tag_cut': > undefined method `[]=' for nil:NilClass (NoMethodError) (snip) > As an example file take AJ271885: > http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=11342587 I could not reproduce this error with this entry. I suspect that your input file is not in GenBank format but, for example, saved in HTML or something? Regards, Toshiaki Katayama From urban at bettong.net Wed Dec 7 03:39:30 2005 From: urban at bettong.net (Urban Hafner) Date: Wed Dec 7 03:37:38 2005 Subject: [BioRuby] Error reading GenBank file In-Reply-To: <0A5D38B3-510B-4CD9-8EB0-25F3B5A8F9EB@bioruby.org> Message-ID: On 7 Dec 2005, at 04:37, Toshiaki Katayama wrote: I could not reproduce this error with this entry. Strange. I suspect that your input file is not in GenBank format but, for example, saved in HTML or something? OK. Here's the code again: require 'bio' fn = 'AJ271885.gb' ff = Bio::FlatFile.auto(fn) ff.each_entry do |gb| p gb.naseq.class end And that's what I get: Bio::Sequence::NA NoMethodError: undefined method `[]=' for nil:NilClass from /opt/local/lib/ruby/site_ruby/1.8/bio/db.rb:223:in `tag_cut' from /opt/local/lib/ruby/site_ruby/1.8/bio/db/genbank/common.rb:239:in `origin' from /opt/local/lib/ruby/site_ruby/1.8/bio/db/genbank/genbank.rb:72:in `naseq' from (irb):10 from (irb):9:in `each_entry' from (irb):9 To download the file I used the 'Save to file' drop down on the site. (http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=11342587). Just to make sure, here's the file I used: http://bettong.net/mail/AJ271885.gb.gz Thanks again for the help. I very much appreciate it. Urban From ktym at hgc.jp Wed Dec 7 04:13:41 2005 From: ktym at hgc.jp (Toshiaki Katayama) Date: Wed Dec 7 04:37:16 2005 Subject: [BioRuby] Error reading GenBank file In-Reply-To: References: Message-ID: <73E0878D-6BB8-48B6-A924-3F83B510367F@hgc.jp> Hi, Your file contains extra "\n" after the GenBank delimiter //. If you strip the last empty line from the input file, this bug won't occur. And the following code also works. require 'bio' gb = Bio::GenBank.new(ARGF.read) p gb.naseq.class So, it is a problem with Bio::FlatFile module. I'll talk with Goto-san, the maintainer, on this. Thanks, Toshiaki On 2005/12/07, at 17:39, Urban Hafner wrote: > On 7 Dec 2005, at 04:37, Toshiaki Katayama wrote: > > I could not reproduce this error with this entry. > > Strange. > > I suspect that your input file is not in GenBank format but, for example, > saved in HTML or something? > > OK. Here's the code again: > > require 'bio' > fn = 'AJ271885.gb' > ff = Bio::FlatFile.auto(fn) > ff.each_entry do |gb| > p gb.naseq.class > end > > And that's what I get: > > Bio::Sequence::NA > NoMethodError: undefined method `[]=' for nil:NilClass > from /opt/local/lib/ruby/site_ruby/1.8/bio/db.rb:223:in `tag_cut' > from > /opt/local/lib/ruby/site_ruby/1.8/bio/db/genbank/common.rb:239:in > `origin' > from > /opt/local/lib/ruby/site_ruby/1.8/bio/db/genbank/genbank.rb:72:in > `naseq' > from (irb):10 > from (irb):9:in `each_entry' > from (irb):9 > > To download the file I used the 'Save to file' drop down on the site. > (http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=11342587). > Just to make sure, here's the file I used: > http://bettong.net/mail/AJ271885.gb.gz > > Thanks again for the help. I very much appreciate it. > > Urban > > _______________________________________________ > BioRuby mailing list > BioRuby@open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioruby From ktym at hgc.jp Wed Dec 7 04:55:16 2005 From: ktym at hgc.jp (Toshiaki Katayama) Date: Wed Dec 7 04:52:47 2005 Subject: [BioRuby] Error reading GenBank file In-Reply-To: <73E0878D-6BB8-48B6-A924-3F83B510367F@hgc.jp> References: <73E0878D-6BB8-48B6-A924-3F83B510367F@hgc.jp> Message-ID: <21F01E78-09C8-4851-A07C-1DBCFF5BF49C@hgc.jp> On 2005/12/07, at 18:13, Toshiaki Katayama wrote: > So, it is a problem with Bio::FlatFile module. Sorry, it was a problem with Bio::GenBank module. To say more precisely, your file contained 2 entries in logic. One is a genbank:AJ271885 and the other is empty entry. >> And that's what I get: >> >> Bio::Sequence::NA This is a result from the first entry, >> NoMethodError: undefined method `[]=' for nil:NilClass and this is a error caused by the second entry. What is the best interface for the empty or incomplete entry? raise an exception? or just returns empty string? irb> gb = Bio::GenBank.new('') irb> p gb.naseq NoMethodError: undefined method `[]=' for nil:NilClass Toshiaki From pjotr at pckassa.com Wed Dec 7 05:03:30 2005 From: pjotr at pckassa.com (Pjotr Prins) Date: Wed Dec 7 05:21:50 2005 Subject: [BioRuby] Error reading GenBank file In-Reply-To: <21F01E78-09C8-4851-A07C-1DBCFF5BF49C@hgc.jp> References: <73E0878D-6BB8-48B6-A924-3F83B510367F@hgc.jp> <21F01E78-09C8-4851-A07C-1DBCFF5BF49C@hgc.jp> Message-ID: <20051207100330.GA4898@tm2.nmi-agro.nl> On Wed, Dec 07, 2005 at 06:55:16PM +0900, Toshiaki Katayama wrote: > What is the best interface for the empty or incomplete entry? > raise an exception? or just returns empty string? > > irb> gb = Bio::GenBank.new('') > irb> p gb.naseq > NoMethodError: undefined method `[]=' for nil:NilClass Why not return a nil? Or raise an exception at initialization if illegal tags are not allowed. Pj. From ktym at hgc.jp Wed Dec 7 06:27:34 2005 From: ktym at hgc.jp (Toshiaki Katayama) Date: Wed Dec 7 06:25:04 2005 Subject: [BioRuby] Error reading GenBank file In-Reply-To: <20051207100330.GA4898@tm2.nmi-agro.nl> References: <73E0878D-6BB8-48B6-A924-3F83B510367F@hgc.jp> <21F01E78-09C8-4851-A07C-1DBCFF5BF49C@hgc.jp> <20051207100330.GA4898@tm2.nmi-agro.nl> Message-ID: On 2005/12/07, at 19:03, Pjotr Prins wrote: > On Wed, Dec 07, 2005 at 06:55:16PM +0900, Toshiaki Katayama wrote: >> What is the best interface for the empty or incomplete entry? >> raise an exception? or just returns empty string? >> >> irb> gb = Bio::GenBank.new('') >> irb> p gb.naseq >> NoMethodError: undefined method `[]=' for nil:NilClass > > Why not return a nil? Or raise an exception at initialization if > illegal tags are not allowed. > > Pj. I just commited a patch to make the following code will work without errors even if the input file contains an empty entry (e.g. file attached in Urban's post). Toshiaki Bio::FlatFile.auto(ARGF) do |ff| ff.each_entry do |gb| # genbank/genbank.rb p gb.entry_id p gb.length p gb.strand p gb.natype p gb.circular p gb.division p gb.date p gb.basecount # genbank/common.rb p gb.definition p gb.versions p gb.accessions p gb.acc_version p gb.accession p gb.version p gb.gi p gb.nid p gb.keywords p gb.segment p gb.source p gb.common_name p gb.organism p gb.taxonomy p gb.references p gb.comment p gb.features p gb.origin p gb.naseq end end From trevor at corevx.com Wed Dec 7 23:54:54 2005 From: trevor at corevx.com (Trevor Wennblom) Date: Wed Dec 7 23:52:27 2005 Subject: [BioRuby] Including GPL code? Message-ID: <4397BC9E.6090007@corevx.com> So what is BioRuby's official position on including GPL'd code in the project? I'd like to use the Permuation library which is GPL'd but I'm concerned that it may conflict with the LGPL. http://permutation.rubyforge.org/ Thanks, Trevor From trevor at corevx.com Fri Dec 9 14:20:50 2005 From: trevor at corevx.com (Trevor Wennblom) Date: Fri Dec 9 15:11:21 2005 Subject: [BioRuby] New 'bio/lib' directory suggestion, for comments Message-ID: <4399D912.6090609@corevx.com> I'm looking for comments as to if we should create a "bioruby/lib/bio/lib" directory. The purpose of this directory would be: * To contain code that some BioRuby modules depend on * that is unlikely to be on a users system * and is relatively small in size At the moment Permutation[1] is what makes ask the question, but I can see other math packages facing the same question in the future. Thanks, Trevor [1] http://permutation.rubyforge.org/ From ktym at hgc.jp Sat Dec 10 02:27:49 2005 From: ktym at hgc.jp (Toshiaki Katayama) Date: Sat Dec 10 02:37:00 2005 Subject: [BioRuby] New 'bio/lib' directory suggestion, for comments In-Reply-To: <4399D912.6090609@corevx.com> References: <4399D912.6090609@corevx.com> Message-ID: Hi Trevor, At the moment, I'm not willing to include other libraries in the BioRuby distribution, especially when the license of the library is incompatible. For what purpose do you want to use the permutation library? The library would be great (although I don't looked in it yet), but if you only need the part of its functionality, how about to write your own for your module to resolve the license problem? Other possible solutions: * Use gem to install dependent library. * Change the license of the dependent library. * To make the library bundled with Ruby itself as a standard library. * Distribute your application with the library + BioRuby included. etc. How do you think? Toshiaki On 2005/12/10, at 4:20, Trevor Wennblom wrote: > I'm looking for comments as to if we should create a "bioruby/lib/bio/lib" directory. The purpose of this directory would be: > * To contain code that some BioRuby modules depend on > * that is unlikely to be on a users system > * and is relatively small in size > > At the moment Permutation[1] is what makes ask the question, but I can see other math packages facing the same question in the future. > > Thanks, > Trevor > > [1] http://permutation.rubyforge.org/ > _______________________________________________ > BioRuby mailing list > BioRuby@open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioruby From ktym at hgc.jp Sat Dec 10 01:36:18 2005 From: ktym at hgc.jp (Toshiaki Katayama) Date: Sat Dec 10 02:37:02 2005 Subject: [BioRuby] New 'bio/lib' directory suggestion, for comments In-Reply-To: <4399D912.6090609@corevx.com> References: <4399D912.6090609@corevx.com> Message-ID: Hi Trevor, At the moment, I'm not willing to include other libraries in the BioRuby distribution, especially when the license of the library is incompatible. For what purpose do you want to use the permutation library? The library would be great (although I don't looked in it yet), but if you only need the part of its functionality, how about to write your own for your module to resolve the license problem? Other possible solutions: * Use gem to install dependent library. * Change the license of the dependent library. * To make the library bundled with Ruby itself as a standard library. * Distribute your application with the library + BioRuby included. etc. How do you thnk? Toshiaki On 2005/12/10, at 4:20, Trevor Wennblom wrote: > I'm looking for comments as to if we should create a "bioruby/lib/bio/lib" directory. The purpose of this directory would be: > * To contain code that some BioRuby modules depend on > * that is unlikely to be on a users system > * and is relatively small in size > > At the moment Permutation[1] is what makes ask the question, but I can see other math packages facing the same question in the future. > > Thanks, > Trevor > > [1] http://permutation.rubyforge.org/ > _______________________________________________ > BioRuby mailing list > BioRuby@open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioruby From pjotr at pckassa.com Sat Dec 10 04:21:11 2005 From: pjotr at pckassa.com (Pjotr Prins) Date: Sat Dec 10 04:18:38 2005 Subject: [BioRuby] Including GPL code? In-Reply-To: <4397BC9E.6090007@corevx.com> References: <4397BC9E.6090007@corevx.com> Message-ID: <20051210092111.GA31590@tm2.nmi-agro.nl> Maybe ask those guys to turn their code to LGPL for inclusion with BIORUBY? It may well be he/they will be OK with it. Pj On Wed, Dec 07, 2005 at 10:54:54PM -0600, Trevor Wennblom wrote: > So what is BioRuby's official position on including GPL'd code in the > project? I'd like to use the Permuation library which is GPL'd but I'm > concerned that it may conflict with the LGPL. > > http://permutation.rubyforge.org/ > > Thanks, > Trevor > _______________________________________________ > BioRuby mailing list > BioRuby@open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioruby From tsw5 at duke.edu Fri Dec 16 22:52:09 2005 From: tsw5 at duke.edu (Todd Wasson) Date: Fri Dec 16 23:57:17 2005 Subject: [BioRuby] bioruby genome browser? Message-ID: <43A38B69.7070605@duke.edu> I'm looking into easy to use generic genome representation and browser packages, and I'm curious if bioruby has any kind of browser capability akin to what Lincoln Stein's GBrowse is for bioperl. Googling digs up some old links to a now seemingly defunct http://gb.bioruby.org/ site, but that's not much help any more. Is something like this out there somewhere? Is it actually in bioruby and I just haven't managed to uncover it yet? If not, are there plans or this? I suspect it would be no minor task for me to implement myself, just to get where GBrowse is, so I'm really hoping something is available... Thanks for any information you can provide! Todd