[BioRuby-cvs] bioruby/doc Tutorial.rd,1.20,1.21

Pjotr Prins pjotr at dev.open-bio.org
Wed Feb 13 03:04:41 EST 2008


Update of /home/repository/bioruby/bioruby/doc
In directory dev.open-bio.org:/tmp/cvs-serv15580

Modified Files:
	Tutorial.rd 
Log Message:
Tutorial

Index: Tutorial.rd
===================================================================
RCS file: /home/repository/bioruby/bioruby/doc/Tutorial.rd,v
retrieving revision 1.20
retrieving revision 1.21
diff -C2 -d -r1.20 -r1.21
*** Tutorial.rd	11 Feb 2008 08:03:27 -0000	1.20
--- Tutorial.rd	13 Feb 2008 08:04:30 -0000	1.21
***************
*** 183,187 ****
  through a variable named +s+.
  
! * Show average percentage of GC content for 20 bases (stepping the default one base at a time)
  
    bioruby> seq = Bio::Sequence::NA.new("atgcatgcaattaagctaatcccaattagatcatcccgatcatcaaaaaaaaaa")
--- 183,187 ----
  through a variable named +s+.
  
! Show average percentage of GC content for 20 bases (stepping the default one base at a time)
  
    bioruby> seq = Bio::Sequence::NA.new("atgcatgcaattaagctaatcccaattagatcatcccgatcatcaaaaaaaaaa")
***************
*** 197,201 ****
  use all methods on the subsequence. For example,
  
! * Shows translation results for 15 bases shifting a codon at a time
  
    bioruby> a = []
--- 197,201 ----
  use all methods on the subsequence. For example,
  
! Shows translation results for 15 bases shifting a codon at a time
  
    bioruby> a = []
***************
*** 210,217 ****
  subsequence. This allows for example
  
! * Divide a genome sequence into sections of 10000bp and
!   output FASTA formatted sequences (line width 60 chars). The 1000bp at the
!   start and end of each subsequence overlapped. At the 3' end of the sequence
!   the leftover is also added:
  
      i = 1
--- 210,217 ----
  subsequence. This allows for example
  
! Divide a genome sequence into sections of 10000bp and
! output FASTA formatted sequences (line width 60 chars). The 1000bp at the
! start and end of each subsequence overlapped. At the 3' end of the sequence
! the leftover is also added:
  
      i = 1
***************
*** 230,234 ****
  Other examples
  
! * Count the codon usage
  
    bioruby> codon_usage = Hash.new(0)
--- 230,234 ----
  Other examples
  
! Count the codon usage
  
    bioruby> codon_usage = Hash.new(0)
***************
*** 240,244 ****
  
  
! * Calculate molecular weight for each 10-aa peptide (or 10-nt nucleic acid)
  
    bioruby> a = []
--- 240,244 ----
  
  
! Calculate molecular weight for each 10-aa peptide (or 10-nt nucleic acid)
  
    bioruby> a = []
***************
*** 399,408 ****
      end
  
! * Note: In this example Feature#assoc method makes a Hash from a
!   feature object. It is useful because you can get data from the hash
!   by using qualifiers as keys.
!   (But there is a risk some information is lost when two or more
!   qualifiers are the same. Therefore an Array is returned by
!   Feature#feature)
  
  Bio::Sequence#splicing splices subsequence from nucleic acid sequence
--- 399,408 ----
      end
  
! Note: In this example Feature#assoc method makes a Hash from a
! feature object. It is useful because you can get data from the hash
! by using qualifiers as keys.
! (But there is a risk some information is lost when two or more
! qualifiers are the same. Therefore an Array is returned by
! Feature#feature)
  
  Bio::Sequence#splicing splices subsequence from nucleic acid sequence
***************
*** 418,426 ****
  bio/location.rb.
  
! * Splice according to location string used in a GenBank entry
  
      naseq.splicing('join(2035..2050,complement(1775..1818),13..345')
  
! * Generate Bio::Locations object and pass the splicing method
  
      locs = Bio::Locations.new('join((8298.8300)..10206,1..855)')
--- 418,426 ----
  bio/location.rb.
  
! Splice according to location string used in a GenBank entry
  
      naseq.splicing('join(2035..2050,complement(1775..1818),13..345')
  
! Generate Bio::Locations object and pass the splicing method
  
      locs = Bio::Locations.new('join((8298.8300)..10206,1..855)')
***************
*** 430,434 ****
  (Bio::Sequence::AA objects).
  
! * Splicing peptide from a protein (e.g. signal peptide)
  
      aaseq.splicing('21..119')
--- 430,434 ----
  (Bio::Sequence::AA objects).
  
! Splicing peptide from a protein (e.g. signal peptide)
  
      aaseq.splicing('21..119')



More information about the bioruby-cvs mailing list