[BioRuby-cvs] bioruby/doc Tutorial.rd,1.20,1.21
Pjotr Prins
pjotr at dev.open-bio.org
Wed Feb 13 03:04:41 EST 2008
Update of /home/repository/bioruby/bioruby/doc
In directory dev.open-bio.org:/tmp/cvs-serv15580
Modified Files:
Tutorial.rd
Log Message:
Tutorial
Index: Tutorial.rd
===================================================================
RCS file: /home/repository/bioruby/bioruby/doc/Tutorial.rd,v
retrieving revision 1.20
retrieving revision 1.21
diff -C2 -d -r1.20 -r1.21
*** Tutorial.rd 11 Feb 2008 08:03:27 -0000 1.20
--- Tutorial.rd 13 Feb 2008 08:04:30 -0000 1.21
***************
*** 183,187 ****
through a variable named +s+.
! * Show average percentage of GC content for 20 bases (stepping the default one base at a time)
bioruby> seq = Bio::Sequence::NA.new("atgcatgcaattaagctaatcccaattagatcatcccgatcatcaaaaaaaaaa")
--- 183,187 ----
through a variable named +s+.
! Show average percentage of GC content for 20 bases (stepping the default one base at a time)
bioruby> seq = Bio::Sequence::NA.new("atgcatgcaattaagctaatcccaattagatcatcccgatcatcaaaaaaaaaa")
***************
*** 197,201 ****
use all methods on the subsequence. For example,
! * Shows translation results for 15 bases shifting a codon at a time
bioruby> a = []
--- 197,201 ----
use all methods on the subsequence. For example,
! Shows translation results for 15 bases shifting a codon at a time
bioruby> a = []
***************
*** 210,217 ****
subsequence. This allows for example
! * Divide a genome sequence into sections of 10000bp and
! output FASTA formatted sequences (line width 60 chars). The 1000bp at the
! start and end of each subsequence overlapped. At the 3' end of the sequence
! the leftover is also added:
i = 1
--- 210,217 ----
subsequence. This allows for example
! Divide a genome sequence into sections of 10000bp and
! output FASTA formatted sequences (line width 60 chars). The 1000bp at the
! start and end of each subsequence overlapped. At the 3' end of the sequence
! the leftover is also added:
i = 1
***************
*** 230,234 ****
Other examples
! * Count the codon usage
bioruby> codon_usage = Hash.new(0)
--- 230,234 ----
Other examples
! Count the codon usage
bioruby> codon_usage = Hash.new(0)
***************
*** 240,244 ****
! * Calculate molecular weight for each 10-aa peptide (or 10-nt nucleic acid)
bioruby> a = []
--- 240,244 ----
! Calculate molecular weight for each 10-aa peptide (or 10-nt nucleic acid)
bioruby> a = []
***************
*** 399,408 ****
end
! * Note: In this example Feature#assoc method makes a Hash from a
! feature object. It is useful because you can get data from the hash
! by using qualifiers as keys.
! (But there is a risk some information is lost when two or more
! qualifiers are the same. Therefore an Array is returned by
! Feature#feature)
Bio::Sequence#splicing splices subsequence from nucleic acid sequence
--- 399,408 ----
end
! Note: In this example Feature#assoc method makes a Hash from a
! feature object. It is useful because you can get data from the hash
! by using qualifiers as keys.
! (But there is a risk some information is lost when two or more
! qualifiers are the same. Therefore an Array is returned by
! Feature#feature)
Bio::Sequence#splicing splices subsequence from nucleic acid sequence
***************
*** 418,426 ****
bio/location.rb.
! * Splice according to location string used in a GenBank entry
naseq.splicing('join(2035..2050,complement(1775..1818),13..345')
! * Generate Bio::Locations object and pass the splicing method
locs = Bio::Locations.new('join((8298.8300)..10206,1..855)')
--- 418,426 ----
bio/location.rb.
! Splice according to location string used in a GenBank entry
naseq.splicing('join(2035..2050,complement(1775..1818),13..345')
! Generate Bio::Locations object and pass the splicing method
locs = Bio::Locations.new('join((8298.8300)..10206,1..855)')
***************
*** 430,434 ****
(Bio::Sequence::AA objects).
! * Splicing peptide from a protein (e.g. signal peptide)
aaseq.splicing('21..119')
--- 430,434 ----
(Bio::Sequence::AA objects).
! Splicing peptide from a protein (e.g. signal peptide)
aaseq.splicing('21..119')
More information about the bioruby-cvs
mailing list