[BioRuby-cvs] bioruby/doc Tutorial.rd,1.16,1.17
Pjotr Prins
pjotr at dev.open-bio.org
Sun Feb 3 12:17:59 EST 2008
Update of /home/repository/bioruby/bioruby/doc
In directory dev.open-bio.org:/tmp/cvs-serv15881/doc
Modified Files:
Tutorial.rd
Log Message:
More doctests in Tutorial.rd
Index: Tutorial.rd
===================================================================
RCS file: /home/repository/bioruby/bioruby/doc/Tutorial.rd,v
retrieving revision 1.16
retrieving revision 1.17
diff -C2 -d -r1.16 -r1.17
*** Tutorial.rd 2 Feb 2008 14:15:08 -0000 1.16
--- Tutorial.rd 3 Feb 2008 17:17:48 -0000 1.17
***************
*** 13,16 ****
--- 13,17 ----
=begin
+ #doctest Testing bioruby
= BioRuby Tutorial
***************
*** 64,68 ****
following command
! ./bin/bioruby
and you should see a prompt
--- 65,70 ----
following command
! ./bin/bioruby or
! ruby -I lib bin/bioruby
and you should see a prompt
***************
*** 73,80 ****
bioruby> seq = Bio::Sequence::NA.new("atgcatgcaaaa")
! bioruby> puts seq
! atgcatgcaaaa
! bioruby> puts seq.complement
! ttttgcatgcat
== Working with nucleic / amino acid sequences (Bio::Sequence class)
--- 75,82 ----
bioruby> seq = Bio::Sequence::NA.new("atgcatgcaaaa")
! ==> "atgcatgcaaaa"
!
! bioruby> seq.complement
! ==> "ttttgcatgcat"
== Working with nucleic / amino acid sequences (Bio::Sequence class)
***************
*** 89,122 ****
defined in codontable.rb).
! #!/usr/bin/env ruby
!
! require 'bio'
!
! seq = Bio::Sequence::NA.new("atgcatgcaaaa")
!
! puts seq # original sequence
! puts seq.complement # complemental sequence (Bio::Sequence::NA object)
! puts seq.subseq(3,8) # gets subsequence of positions 3 to 8
! p seq.gc_percent # GC percent (BioRuby 0.6.X: Float, BioRuby 0.7 or later: Integer)
! p seq.composition # nucleic acid compositions (Hash)
! puts seq.translate # translation (Bio::Sequence::AA object)
! puts seq.translate(2) # translation from frame 2 (default is frame 1)
! puts seq.translate(1,11) # using codon table No.11
! # (see http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi)
! p seq.translate.codes # shows three-letter codes (Array)
! p seq.translate.names # shows amino acid names (Array)
! p seq.translate.composition # amino acid compositions (Hash)
! p seq.translate.molecular_weight # calculating molecular weight (Float)
! puts seq.complement.translate # translation of complemental strand
- # reshuffle sequence with same frequencies:
- counts = {'a'=>seq.count('a'),'c'=>seq.count('c'),
- 'g'=>seq.count('g'),'t'=>seq.count('t')}
- p randomseq = Bio::Sequence::NA.randomize(counts)
The p, print and puts methods are standard Ruby ways of outputting to
--- 91,136 ----
defined in codontable.rb).
+ bioruby> seq = Bio::Sequence::NA.new("atgcatgcaaaa")
+ ==> "atgcatgcaaaa"
! # complemental sequence (Bio::Sequence::NA object)
! bioruby> seq.complement
! ==> "ttttgcatgcat"
! bioruby> seq.subseq(3,8) # gets subsequence of positions 3 to 8
! ==> "gcatgc"
! bioruby> seq.gc_percent
! ==> 33
! bioruby> seq.composition
! ==> {"a"=>6, "c"=>2, "g"=>2, "t"=>2}
! bioruby> seq.translate
! ==> "MHAK"
! bioruby> seq.translate(2) # translate from frame 2
! ==> "CMQ"
! bioruby> seq.translate(1,11) # codon table 11
! ==> "MHAK"
! bioruby> seq.translate.codes
! ==> ["Met", "His", "Ala", "Lys"]
! bioruby> seq.translate.names
! ==> ["methionine", "histidine", "alanine", "lysine"]
! bioruby> seq.translate.composition
! ==> {"K"=>1, "A"=>1, "M"=>1, "H"=>1}
! bioruby> seq.translate.molecular_weight
! ==> 485.605
! bioruby> seq.complement.translate
! ==> "FCMH"
! get a random sequence with the same NA count:
! bioruby> counts = {'a'=>seq.count('a'),'c'=>seq.count('c'),'g'=>seq.count('g'),'t'=>seq.count('t')}
! ==> {"a"=>6, "c"=>2, "g"=>2, "t"=>2}
! bioruby!> randomseq = Bio::Sequence::NA.randomize(counts)
! ==!> "aaacatgaagtc"
! bioruby!> print counts
! a6c2g2t2
! bioruby!> p counts
! {"a"=>6, "c"=>2, "g"=>2, "t"=>2}
The p, print and puts methods are standard Ruby ways of outputting to
***************
*** 140,152 ****
has index 0, for example:
! s = 'abc'
! puts s[0].chr
!
! >a
!
! puts s[0..1]
!
! >ab
!
So when using String methods, you should subtract 1 from positions
--- 154,163 ----
has index 0, for example:
! bioruby> s = 'abc'
! ==> "abc"
! bioruby> s[0].chr
! ==> "a"
! bioruby> s[0..1]
! ==> "ab"
So when using String methods, you should subtract 1 from positions
***************
*** 160,169 ****
through a variable named +s+.
! * Shows average percentage of GC content for 100 bases (stepping
! the default one base at a time)
! seq.window_search(100) do |s|
! puts s.gc_percent
! end
Since the class of each subsequence is the same as original sequence
--- 171,182 ----
through a variable named +s+.
! * Shows average percentage of GC content for 20 bases (stepping the default one base at a time)
! bioruby> seq = Bio::Sequence::NA.new("atgcatgcaattaagctaatcccaattagatcatcccgatcatcaaaaaaaaaa")
! ==> "atgcatgcaattaagctaatcccaattagatcatcccgatcatcaaaaaaaaaa"
!
! bioruby> seq.window_search(20) { |s| print s.gc_percent,',' }
! 30,35,40,40,35,35,35,30,25,30,30,30,35,35,35,35,35,40,45,45,45,45,40,35,40,40,40,40,40,35,35,35,30,30,30, ==> ""
!
Since the class of each subsequence is the same as original sequence
***************
*** 1165,1168 ****
--- 1178,1192 ----
included - with output)
+ == Unit testing and doctests
+
+ BioRuby comes with an extensive testing framework with over 1300 tests and 2700
+ assertions. To run the unit tests:
+
+ cd test
+ ruby runner.rb
+
+ We have also started with doctest for Ruby. We are porting the examples
+ in this tutorial to doctest - more info upcoming.
+
== Further reading
More information about the bioruby-cvs
mailing list