[BioRuby-cvs] bioruby/lib/bio/db lasergene.rb,NONE,1.1
Trevor Wennblom
trevor at dev.open-bio.org
Mon Jan 8 01:39:16 EST 2007
Update of /home/repository/bioruby/bioruby/lib/bio/db
In directory dev.open-bio.org:/tmp/cvs-serv12185/lib/bio/db
Added Files:
lasergene.rb
Log Message:
Adding Bio::Lasergene file format
--- NEW FILE: lasergene.rb ---
#
# bio/db/lasergene.rb - Interface for DNAStar Lasergene sequence file format
#
# Author:: Trevor Wennblom <mailto:trevor at corevx.com>
# Copyright:: Copyright (c) 2007 Center for Biomedical Research Informatics, University of Minnesota (http://cbri.umn.edu)
# License:: Distributes under the same terms as Ruby
#
# $Id: lasergene.rb,v 1.1 2007/01/08 06:39:14 trevor Exp $
#
module Bio #:nodoc:
#
# bio/db/lasergene.rb - Interface for DNAStar Lasergene sequence file format
#
# Author:: Trevor Wennblom <mailto:trevor at corevx.com>
# Copyright:: Copyright (c) 2007 Center for Biomedical Research Informatics, University of Minnesota (http://cbri.umn.edu)
# License:: Distributes under the same terms as Ruby
#
# = Description
#
# Bio::Lasergene reads DNAStar Lasergene formatted sequence files, or +.seq+
# files. It only expects to find one sequence per file.
#
# = Usage
#
# require 'bio'
# filename = 'MyFile.seq'
# lseq = Bio::Lasergene.new( IO.readlines(filename) )
# lseq.entry_id # => "Contig 1"
# lseq.seq # => ATGACGTATCCAAAGAGGCGTTACC
#
# = Comments
#
# I'm only aware of the following three kinds of Lasergene file formats. Feel
# free to send me other examples that may not currently be accounted for.
#
# File format 1:
#
# ## begin ##
# "Contig 1" (1,934)
# Contig Length: 934 bases
# Average Length/Sequence: 467 bases
# Total Sequence Length: 1869 bases
# Top Strand: 2 sequences
# Bottom Strand: 2 sequences
# Total: 4 sequences
# ^^
# ATGACGTATCCAAAGAGGCGTTACCGGAGAAGAAGACACCGCCCCCGCAGTCCTCTTGGCCAGATCCTCCGCCGCCGCCCCTGGCTCGTCCACCCCCGCCACAGTTACCGCTGGAGAAGGAAAAATGGCATCTTCAWCACCCGCCTATCCCGCAYCTTCGGAWRTACTATCAAGCGAACCACAGTCAGAACGCCCTCCTGGGCGGTGGACATGATGAGATTCAATATTAATGACTTTCTTCCCCCAGGAGGGGGCTCAAACCCCCGCTCTGTGCCCTTTGAATACTACAGAATAAGAAAGGTTAAGGTTGAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGACAGGGGAATGGGCTCCAGTGCTGWTATTCTAGMTGATRRCTTKGTAACAAAGRCCACAGCCCTCACCTATGACCCCTATGTAAACTTCTCCTCCCGCCATACCATAACCCAGCCCTTCTCCTACCRCTCCCGYTACTTTACCCCCAAACCTGTCCTWGATKCCACTATKGATKACTKCCAACCAAACAACAAAAGAAACCAGCTGTGGSTGAGACTACAWACTGCTGGAAATGTAGACCWCGTAGGCCTSGGCACTGCGTKCGAAAACAGTATATACGACCAGGAATACAATATCCGTGTMACCATGTATGTACAATTCAGAGAATTTAATCTTAAAGACCCCCCRCTTMACCCKTAATGAATAATAAMAACCATTACGAAGTGATAAAAWAGWCTCAGTAATTTATTYCATATGGAAATTCWSGGCATGGGGGGGAAAGGGTGACGAACKKGCCCCCTTCCTCCSTSGMYTKTTCYGTAGCATTCYTCCAMAAYACCWAGGCAGYAMTCCTCCSATCAAGAGcYTSYACAGCTGGGACAGCAGTTGAGGAGGACCATTCAAAGGGGGTCGGATTGCTGGTAATCAGA
# ## end ##
#
#
# File format 2:
#
# ## begin ##
# ^^: 350,935
# Contig 1 (1,935)
# Contig Length: 935 bases
# Average Length/Sequence: 580 bases
# Total Sequence Length: 2323 bases
# Top Strand: 2 sequences
# Bottom Strand: 2 sequences
# Total: 4 sequences
# ^^
# ATGTCGGGGAAATGCTTGACCGCGGGCTACTGCTCATCATTGCTTTCTTTGTGGTATATCGTGCCGTTCTGTTTTGCTGTGCTCGTCAACGCCAGCGGCGACAGCAGCTCTCATTTTCAGTCGATTTATAACTTGACGTTATGTGAGCTGAATGGCACGAACTGGCTGGCAGACAACTTTAACTGGGCTGTGGAGACTTTTGTCATCTTCCCCGTGTTGACTCACATTGTTTCCTATGGTGCACTCACTACCAGTCATTTTCTTGACACAGTTGGTCTAGTTACTGTGTCTACCGCCGGGTTTTATCACGGGCGGTACGTCTTGAGTAGCATCTACGCGGTCTGTGCTCTGGCTGCGTTGATTTGCTTCGCCATCAGGTTTGCGAAGAACTGCATGTCCTGGCGCTACTCTTGCACTAGATACACCAACTTCCTCCTGGACACCAAGGGCAGACTCTATCGTTGGCGGTCGCCTGTCATCATAGAGAAAGGGGGTAAGGTTGAGGTCGAAGGTCATCTGATCGATCTCAAAAGAGTTGTGCTTGATGGCTCTGTGGCGACACCTTTAACCAGAGTTTCAGCGGAACAATGGGGTCGTCCCTAGACGACTTTTGCCATGATAGTACAGCCCCACAGAAGGTGCTCTTGGCGTTTTCCATCACCTACACGCCAGTGATGATATATGCCCTAAAGGTAAGCCGCGGCCGACTTTTGGGGCTTCTGCACCTTTTGATTTTTTTGAACTGTGCCTTTACTTTCGGGTACATGACATTCGTGCACTTTCGGAGCACGAACAAGGTCGCGCTCACTATGGGAGCAGTAGTCGCACTCCTTTGGGGGGTGTACTCAGCCATAGAAACCTGGAAATTCATCACCTCCAGATGCCGTTGTGCTTGCTAGGCCGCAAGTACATTCTGGCCCCTGCCCACCACGTTG
# ## end ##
#
# File format 3 (non-standard Lasergene header):
#
# ## begin ##
# LOCUS PRU87392 15411 bp RNA linear VRL 17-NOV-2000
# DEFINITION Porcine reproductive and respiratory syndrome virus strain VR-2332,
# complete genome.
# ACCESSION U87392 AF030244 U00153
# VERSION U87392.3 GI:11192298
# [...cut...]
# 3'UTR 15261..15411
# polyA_site 15409
# ORIGIN
# ^^
# atgacgtataggtgttggctctatgccttggcatttgtattgtcaggagctgtgaccattggcacagcccaaaacttgctgcacagaaacacccttctgtgatagcctccttcaggggagcttagggtttgtccctagcaccttgcttccggagttgcactgctttacggtctctccacccctttaaccatgtctgggatacttgatcggtgcacgtgtacccccaatgccagggtgtttatggcggagggccaagtctactgcacacgatgcctcagtgcacggtctctccttcccctgaacctccaagtttctgagctcggggtgctaggcctattctacaggcccgaagagccactccggtggacgttgccacgtgcattccccactgttgagtgctcccccgccggggcctgctggctttctgcaatctttccaatcgcacgaatgaccagtggaaacctgaacttccaacaaagaatggtacgggtcgcagctgagctttacagagccggccagctcacccctgcagtcttgaaggctctacaagtttatgaacggggttgccgctggtaccccattgttggacctgtccctggagtggccgttttcgccaattccctacatgtgagtgataaacctttcccgggagcaactcacgtgttgaccaacctgccgctcccgcagagacccaagcctgaagacttttgcccctttgagtgtgctatggctactgtctatgacattggtcatgacgccgtcatgtatgtggccgaaaggaaagtctcctgggcccctcgtggcggggatgaagtgaaatttgaagctgtccccggggagttgaagttgattgcgaaccggctccgcacctccttcccgccccaccacacagtggacatgtctaagttcgccttcacagcccctgggtgtggtgtttctatgcgggtcgaacgccaacacggctgccttcccgctgacactgtcc!
ctgaaggcaactgctggtggagcttgtttgacttgcttccactggaagttcagaacaaagaaattcgccatgctaaccaatttggctaccagaccaagcatggtgtctctggcaagtacctacagcggaggctgca[...cut...]
# ## end ##
#
class Lasergene
# Entire header before the sequence
attr_reader :comments
# Sequence
#
# Bio::Sequence::NA or Bio::Sequence::AA object
attr_reader :sequence
# Name of sequence
# * Parsed from standard Lasergene header
attr_reader :name
# Contig length, length of present sequence
# * Parsed from standard Lasergene header
attr_reader :contig_length
# Average length per sequence
# * Parsed from standard Lasergene header
attr_reader :average_length
# Length of parent sequence
# * Parsed from standard Lasergene header
attr_reader :total_length
# Number of top strand sequences
# * Parsed from standard Lasergene header
attr_reader :top_strand_sequences
# Number of bottom strand sequences
# * Parsed from standard Lasergene header
attr_reader :bottom_strand_sequences
# Number of sequences
# * Parsed from standard Lasergene header
attr_reader :total_sequences
DELIMITER_1 = '^\^\^:' # Match '^^:' at the beginning of a line
DELIMITER_2 = '^\^\^' # Match '^^' at the beginning of a line
def initialize(lines)
process(lines)
end
# * +cut_locations+: The cut locations in enzyme index notation.
# Is the comment header recognized as standard Lasergene format?
#
# ---
# *Arguments*
# * _none_
# *Returns*:: +true+ _or_ +false+
def standard_comment?
@standard_comment
end
# Sequence
#
# Bio::Sequence::NA or Bio::Sequence::AA object
def seq
@sequence
end
# Name of sequence
# * Parsed from standard Lasergene header
def entry_id
@name
end
#########
protected
#########
def process(lines)
delimiter_1_indices = []
delimiter_2_indices = []
# If the data from the file is passed as one big String instead of
# broken into an Array, convert lines to an Array
if lines.kind_of? String
lines = lines.tr("\r", '').split("\n")
end
lines.each_with_index do |line, index|
if line.match DELIMITER_1
delimiter_1_indices << index
elsif line.match DELIMITER_2
delimiter_2_indices << index
end
end
raise InputError, "More than one delimiter of type '#{DELIMITER_1}'" if delimiter_1_indices.size > 1
raise InputError, "More than one delimiter of type '#{DELIMITER_2}'" if delimiter_2_indices.size > 1
raise InputError, "No comment to data separator of type '#{DELIMITER_2}'" if delimiter_2_indices.size < 1
if !delimiter_1_indices.empty?
# toss out DELIMETER_1 and anything preceding it
@comments = lines[ (delimiter_1_indices[0] + 1) .. (delimiter_2_indices[0] - 1) ]
else
@comments = lines[ 0 .. (delimiter_2_indices[0] - 1) ]
end
@standard_comment = false
if @comments[0] =~ %r{(.+)\s+\(\d+,\d+\)} # if we have a standard Lasergene comment
@standard_comment = true
@name = $1
comments.each do |comment|
if comment.match('Contig Length:\s+(\d+)')
@contig_length = $1.to_i
elsif comment.match('Average Length/Sequence:\s+(\d+)')
@average_length = $1.to_i
elsif comment.match('Total Sequence Length:\s+(\d+)')
@total_length = $1.to_i
elsif comment.match('Top Strand:\s+(\d+)')
@top_strand_sequences = $1.to_i
elsif comment.match('Bottom Strand:\s+(\d+)')
@bottom_strand_sequences = $1.to_i
elsif comment.match('Total:\s+(\d+)')
@total_sequences = $1.to_i
end
end
end
@comments = @comments.join('')
@sequence = Bio::Sequence.auto( lines[ (delimiter_2_indices[0] + 1) .. -1 ].join('') )
end
end # Lasergene
end # Bio
More information about the bioruby-cvs
mailing list