From trevor at dev.open-bio.org Thu Feb 1 00:23:03 2007 From: trevor at dev.open-bio.org (Trevor Wennblom) Date: Thu, 01 Feb 2007 05:23:03 +0000 Subject: [BioRuby-cvs] bioruby/lib/bio/db lasergene.rb,1.1,1.2 Message-ID: <200702010523.l115N33r009261@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/lib/bio/db In directory dev.open-bio.org:/tmp/cvs-serv9241/lib/bio/db Modified Files: lasergene.rb Log Message: typo fix Index: lasergene.rb =================================================================== RCS file: /home/repository/bioruby/bioruby/lib/bio/db/lasergene.rb,v retrieving revision 1.1 retrieving revision 1.2 diff -C2 -d -r1.1 -r1.2 *** lasergene.rb 8 Jan 2007 06:39:14 -0000 1.1 --- lasergene.rb 1 Feb 2007 05:23:01 -0000 1.2 *************** *** 124,130 **** def initialize(lines) process(lines) ! end ! # * +cut_locations+: The cut locations in enzyme index notation. ! # Is the comment header recognized as standard Lasergene format? --- 124,128 ---- def initialize(lines) process(lines) ! end # Is the comment header recognized as standard Lasergene format? From trevor at dev.open-bio.org Fri Feb 2 01:10:56 2007 From: trevor at dev.open-bio.org (Trevor Wennblom) Date: Fri, 02 Feb 2007 06:10:56 +0000 Subject: [BioRuby-cvs] bioruby/test/data/soft - New directory Message-ID: <200702020610.l126AuBX012612@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/test/data/soft In directory dev.open-bio.org:/tmp/cvs-serv12592/soft Log Message: Directory /home/repository/bioruby/bioruby/test/data/soft added to the repository From trevor at dev.open-bio.org Fri Feb 2 01:13:12 2007 From: trevor at dev.open-bio.org (Trevor Wennblom) Date: Fri, 02 Feb 2007 06:13:12 +0000 Subject: [BioRuby-cvs] bioruby/lib bio.rb,1.80,1.81 Message-ID: <200702020613.l126DCCK012687@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/lib In directory dev.open-bio.org:/tmp/cvs-serv12663/lib Modified Files: bio.rb Log Message: Addition of Bio::SOFT for reading SOFT formatted files in NCBI GEO Index: bio.rb =================================================================== RCS file: /home/repository/bioruby/bioruby/lib/bio.rb,v retrieving revision 1.80 retrieving revision 1.81 diff -C2 -d -r1.80 -r1.81 *** bio.rb 8 Jan 2007 06:38:38 -0000 1.80 --- bio.rb 2 Feb 2007 06:13:10 -0000 1.81 *************** *** 117,120 **** --- 117,121 ---- autoload :NBRF, 'bio/db/nbrf' autoload :REBASE, 'bio/db/rebase' + autoload :SOFT, 'bio/db/soft' autoload :Lasergene, 'bio/db/lasergene' From trevor at dev.open-bio.org Fri Feb 2 01:13:12 2007 From: trevor at dev.open-bio.org (Trevor Wennblom) Date: Fri, 02 Feb 2007 06:13:12 +0000 Subject: [BioRuby-cvs] bioruby/test/unit/bio/db test_soft.rb,NONE,1.1 Message-ID: <200702020613.l126DC4a012697@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/test/unit/bio/db In directory dev.open-bio.org:/tmp/cvs-serv12663/test/unit/bio/db Added Files: test_soft.rb Log Message: Addition of Bio::SOFT for reading SOFT formatted files in NCBI GEO --- NEW FILE: test_soft.rb --- # # test/unit/bio/db/test_rebase.rb - Unit test for Bio::REBASE # # Author:: Trevor Wennblom # Copyright:: Copyright (c) 2005-2007 Midwinter Laboratories, LLC (http://midwinterlabs.com) # License:: Distributes under the same terms as Ruby # # $Id: test_soft.rb,v 1.1 2007/02/02 06:13:10 trevor Exp $ # require 'pathname' libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s $:.unshift(libpath) unless $:.include?(libpath) require 'test/unit' require 'bio/db/soft' module Bio #:nodoc: class TestSOFT < Test::Unit::TestCase #:nodoc: def setup @obj_series = Bio::SOFT.new( IO.readlines('../../../data/soft/GSE3457_family_partial.soft')) @obj_dataset = Bio::SOFT.new( IO.readlines('../../../data/soft/GDS100_partial.soft')) end def test_series assert_equal( @obj_series.platform[:geo_accession], 'GPL2092') assert_equal( @obj_series.platform[:organism], 'Populus') assert_equal( @obj_series.platform[:contributor], ["Jingyi,,Li", "Olga,,Shevchenko", "Steve,H,Strauss", "Amy,M,Brunner"]) assert_equal( @obj_series.platform[:data_row_count], '240') assert_equal( @obj_series.platform.keys.sort {|a,b| a.to_s <=> b.to_s}[0..2], [:contact_address, :contact_city, :contact_country]) assert_equal( @obj_series.platform[:"contact_zip/postal_code"], '97331') assert_equal( @obj_series.platform[:table].header, ["ID", "GB_ACC", "SPOT_ID", "Function/Family", "ORGANISM", "SEQUENCE"]) assert_equal( @obj_series.platform[:table].header_description, {"ORGANISM"=>"sequence sources", "SEQUENCE"=>"oligo sequence used", "Function/Family"=>"gene functions and family", "ID"=>"", "SPOT_ID"=>"", "GB_ACC"=>"Gene bank accession number"}) assert_equal( @obj_series.platform[:table].rows.size, 240) assert_equal( @obj_series.platform[:table].rows[5], ["A039P68U", "AI163321", "", "TF, flowering protein CONSTANS", "P. tremula x P. tremuloides", "AGAAAATTCGATATACTGTCCGTAAAGAGGTAGCACTTAGAATGCAACGGAATAAAGGGCAGTTCACCTC"]) assert_equal( @obj_series.platform[:table].rows[5][4], 'P. tremula x P. tremuloides') assert_equal( @obj_series.platform[:table].rows[5][:organism], 'P. tremula x P. tremuloides') assert_equal( @obj_series.platform[:table].rows[5]['ORGANISM'], 'P. tremula x P. tremuloides') assert_equal( @obj_series.series[:geo_accession], 'GSE3457') assert_equal( @obj_series.series[:contributor], ["Jingyi,,Li", "Olga,,Shevchenko", "Ove,,Nilsson", "Steve,H,Strauss", "Amy,M,Brunner"]) assert_equal( @obj_series.series[:platform_id], 'GPL2092') assert_equal( @obj_series.series[:sample_id].size, 74) assert_equal( @obj_series.series[:sample_id][0..4], ["GSM77557", "GSM77558", "GSM77559", "GSM77560", "GSM77561"]) assert_equal( @obj_series.database[:name], 'Gene Expression Omnibus (GEO)') assert_equal( @obj_series.database[:ref], 'Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6') assert_equal( @obj_series.database[:institute], 'NCBI NLM NIH') assert_equal( @obj_series.samples.size, 2) assert_equal( @obj_series.samples[:GSM77557][:series_id], 'GSE3457') assert_equal( @obj_series.samples['GSM77557'][:series_id], 'GSE3457') assert_equal( @obj_series.samples[:GSM77557][:platform_id], 'GPL2092') assert_equal( @obj_series.samples[:GSM77557][:type], 'RNA') assert_equal( @obj_series.samples[:GSM77557][:title], 'fb6a1') assert_equal( @obj_series.samples[:GSM77557][:table].header, ["ID_REF", "VALUE"]) assert_equal( @obj_series.samples[:GSM77557][:table].header_description, {"ID_REF"=>"", "VALUE"=>"normalized signal intensities"}) assert_equal( @obj_series.samples[:GSM77557][:table].rows.size, 217) assert_equal( @obj_series.samples[:GSM77557][:table].rows[5], ["A039P68U", "5.36"]) assert_equal( @obj_series.samples[:GSM77557][:table].rows[5][0], 'A039P68U') assert_equal( @obj_series.samples[:GSM77557][:table].rows[5][:id_ref], 'A039P68U') assert_equal( @obj_series.samples[:GSM77557][:table].rows[5]['ID_REF'], 'A039P68U') end def test_dataset assert_equal( @obj_dataset.database[:name], 'Gene Expression Omnibus (GEO)') assert_equal( @obj_dataset.database[:ref], 'Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6') assert_equal( @obj_dataset.database[:institute], 'NCBI NLM NIH') assert_equal( @obj_dataset.subsets.size, 8) assert_equal( @obj_dataset.subsets.keys, ["GDS100_1", "GDS100_2", "GDS100_3", "GDS100_4", "GDS100_5", "GDS100_6", "GDS100_7", "GDS100_8"]) assert_equal( @obj_dataset.subsets[:GDS100_7], {:sample_id=>"GSM548,GSM543", :dataset_id=>"GDS100", :description=>"60 minute", :type=>"time"}) assert_equal( @obj_dataset.subsets['GDS100_7'][:sample_id], 'GSM548,GSM543') assert_equal( @obj_dataset.subsets[:GDS100_7][:sample_id], 'GSM548,GSM543') assert_equal( @obj_dataset.subsets[:GDS100_7][:dataset_id], 'GDS100') assert_equal( @obj_dataset.dataset[:order], 'none') assert_equal( @obj_dataset.dataset[:sample_organism], 'Escherichia coli') assert_equal( @obj_dataset.dataset[:table].header, ["ID_REF", "IDENTIFIER", "GSM549", "GSM542", "GSM543", "GSM547", "GSM544", "GSM545", "GSM546", "GSM548"]) assert_equal( @obj_dataset.dataset[:table].rows.size, 15) assert_equal( @obj_dataset.dataset[:table].rows[5], ["6", "EMPTY", "0.097", "0.217", "0.242", "0.067", "0.104", "0.162", "0.104", "0.154"]) assert_equal( @obj_dataset.dataset[:table].rows[5][4], '0.242') assert_equal( @obj_dataset.dataset[:table].rows[5][:gsm549], '0.097') assert_equal( @obj_dataset.dataset[:table].rows[5][:GSM549], '0.097') assert_equal( @obj_dataset.dataset[:table].rows[5]['GSM549'], '0.097') end end end From trevor at dev.open-bio.org Fri Feb 2 01:13:12 2007 From: trevor at dev.open-bio.org (Trevor Wennblom) Date: Fri, 02 Feb 2007 06:13:12 +0000 Subject: [BioRuby-cvs] bioruby/lib/bio/db soft.rb,NONE,1.1 Message-ID: <200702020613.l126DCxP012692@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/lib/bio/db In directory dev.open-bio.org:/tmp/cvs-serv12663/lib/bio/db Added Files: soft.rb Log Message: Addition of Bio::SOFT for reading SOFT formatted files in NCBI GEO --- NEW FILE: soft.rb --- # # bio/db/soft.rb - Interface for SOFT formatted files # # Author:: Trevor Wennblom # Copyright:: Copyright (c) 2007 Midwinter Laboratories, LLC (http://midwinterlabs.com) # License:: Distributes under the same terms as Ruby # # $Id: soft.rb,v 1.1 2007/02/02 06:13:10 trevor Exp $ # module Bio #:nodoc: # # bio/db/soft.rb - Interface for SOFT formatted files # # Author:: Trevor Wennblom # Copyright:: Copyright (c) 2007 Midwinter Laboratories, LLC (http://midwinterlabs.com) # License:: Distributes under the same terms as Ruby # # # = Description # # "SOFT (Simple Omnibus in Text Format) is a compact, simple, line-based, # ASCII text format that incorporates experimental data and metadata." # -- GEO, National Center for Biotechnology Information # # The Bio::SOFT module reads SOFT Series or Platform formatted files that # contain information # describing one database, one series, one platform, and many samples (GEO # accessions). The data from the file can then be viewed with Ruby methods. # # Bio::SOFT also supports the reading of SOFT DataSet files which contain # one database, one dataset, and many subsets. # # Format specification is located here: # * http://www.ncbi.nlm.nih.gov/projects/geo/info/soft2.html#SOFTformat # # SOFT data files may be directly downloaded here: # * ftp://ftp.ncbi.nih.gov/pub/geo/DATA/SOFT # # NCBI's Gene Expression Omnibus (GEO) is here: # * http://www.ncbi.nlm.nih.gov/geo # # = Usage # # If an attribute has more than one value then the values are stored in an # Array of String objects. Otherwise the attribute is stored as a String. # # The platform and each sample may contain a table of data. A dataset from a # DataSet file may also contain a table. # # Attributes are dynamically created based on the data in the file. # Predefined keys have not been created in advance due to the variability of # SOFT files in-the-wild. # # Keys are generally stored as Symbols. In the case of keys for samples and # table headings may alternatively be accessed with Strings. # The names of samples (geo accessions) are case sensitive. Table headers # are case insensitive. # # require 'bio' # # lines = IO.readlines('GSE3457_family.soft') # soft = Bio::SOFT.new(lines) # # soft.platform[:geo_accession] # => "GPL2092" # soft.platform[:organism] # => "Populus" # soft.platform[:contributor] # => ["Jingyi,,Li", "Olga,,Shevchenko", "Steve,H,Strauss", "Amy,M,Brunner"] # soft.platform[:data_row_count] # => "240" # soft.platform.keys.sort {|a,b| a.to_s <=> b.to_s}[0..2] # => [:contact_address, :contact_city, :contact_country] # soft.platform[:"contact_zip/postal_code"] # => "97331" # soft.platform[:table].header # => ["ID", "GB_ACC", "SPOT_ID", "Function/Family", "ORGANISM", "SEQUENCE"] # soft.platform[:table].header_description # => {"ORGANISM"=>"sequence sources", "SEQUENCE"=>"oligo sequence used", "Function/Family"=>"gene functions and family", "ID"=>"", "SPOT_ID"=>"", "GB_ACC"=>"Gene bank accession number"} # soft.platform[:table].rows.size # => 240 # soft.platform[:table].rows[5] # => ["A039P68U", "AI163321", "", "TF, flowering protein CONSTANS", "P. tremula x P. tremuloides", "AGAAAATTCGATATACTGTCCGTAAAGAGGTAGCACTTAGAATGCAACGGAATAAAGGGCAGTTCACCTC"] # soft.platform[:table].rows[5][4] # => "P. tremula x P. tremuloides" # soft.platform[:table].rows[5][:organism] # => "P. tremula x P. tremuloides" # soft.platform[:table].rows[5]['ORGANISM'] # => "P. tremula x P. tremuloides" # # soft.series[:geo_accession] # => "GSE3457" # soft.series[:contributor] # => ["Jingyi,,Li", "Olga,,Shevchenko", "Ove,,Nilsson", "Steve,H,Strauss", "Amy,M,Brunner"] # soft.series[:platform_id] # => "GPL2092" # soft.series[:sample_id].size # => 74 # soft.series[:sample_id][0..4] # => ["GSM77557", "GSM77558", "GSM77559", "GSM77560", "GSM77561"] # # soft.database[:name] # => "Gene Expression Omnibus (GEO)" # soft.database[:ref] # => "Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6" # soft.database[:institute] # => "NCBI NLM NIH" # # soft.samples.size # => 74 # soft.samples[:GSM77600][:series_id] # => "GSE3457" # soft.samples['GSM77600'][:series_id] # => "GSE3457" # soft.samples[:GSM77600][:platform_id] # => "GPL2092" # soft.samples[:GSM77600][:type] # => "RNA" # soft.samples[:GSM77600][:title] # => "jst2b2" # soft.samples[:GSM77600][:table].header # => ["ID_REF", "VALUE"] # soft.samples[:GSM77600][:table].header_description # => {"ID_REF"=>"", "VALUE"=>"normalized signal intensities"} # soft.samples[:GSM77600][:table].rows.size # => 217 # soft.samples[:GSM77600][:table].rows[5] # => ["A039P68U", "8.19"] # soft.samples[:GSM77600][:table].rows[5][0] # => "A039P68U" # soft.samples[:GSM77600][:table].rows[5][:id_ref] # => "A039P68U" # soft.samples[:GSM77600][:table].rows[5]['ID_REF'] # => "A039P68U" # # # lines = IO.readlines('GDS100.soft') # soft = Bio::SOFT.new(lines) # # soft.database[:name] # => "Gene Expression Omnibus (GEO)" # soft.database[:ref] # => "Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6" # soft.database[:institute] # => "NCBI NLM NIH" # # soft.subsets.size # => 8 # soft.subsets.keys # => ["GDS100_1", "GDS100_2", "GDS100_3", "GDS100_4", "GDS100_5", "GDS100_6", "GDS100_7", "GDS100_8"] # soft.subsets[:GDS100_7] # => {:dataset_id=>"GDS100", :type=>"time", :sample_id=>"GSM548,GSM543", :description=>"60 minute"} # soft.subsets['GDS100_7'][:sample_id] # => "GSM548,GSM543" # soft.subsets[:GDS100_7][:sample_id] # => "GSM548,GSM543" # soft.subsets[:GDS100_7][:dataset_id] # => "GDS100" # # soft.dataset[:order] # => "none" # soft.dataset[:sample_organism] # => "Escherichia coli" # soft.dataset[:table].header # => ["ID_REF", "IDENTIFIER", "GSM549", "GSM542", "GSM543", "GSM547", "GSM544", "GSM545", "GSM546", "GSM548"] # soft.dataset[:table].rows.size # => 5764 # soft.dataset[:table].rows[5] # => ["6", "EMPTY", "0.097", "0.217", "0.242", "0.067", "0.104", "0.162", "0.104", "0.154"] # soft.dataset[:table].rows[5][4] # => "0.242" # soft.dataset[:table].rows[5][:gsm549] # => "0.097" # soft.dataset[:table].rows[5][:GSM549] # => "0.097" # soft.dataset[:table].rows[5]['GSM549'] # => "0.097" # class SOFT attr_accessor :database attr_accessor :series, :platform, :samples attr_accessor :dataset, :subsets LINE_TYPE_ENTITY_INDICATOR = '^' LINE_TYPE_ENTITY_ATTRIBUTE = '!' LINE_TYPE_TABLE_HEADER = '#' # data table row defined by absence of line type character TABLE_COLUMN_DELIMITER = "\t" # Constructor # # --- # *Arguments* # * +lines+: (_required_) contents of SOFT formatted file # *Returns*:: Bio::SOFT def initialize(lines=nil) @database = Database.new @series = Series.new @platform = Platform.new @samples = Samples.new @dataset = Dataset.new @subsets = Subsets.new process(lines) end # Classes for Platform and Series files class Samples < Hash #:nodoc: def [](x) x = x.to_s if x.kind_of?( Symbol ) super(x) end end class Entity < Hash #:nodoc: end class Sample < Entity #:nodoc: end class Platform < Entity #:nodoc: end class Series < Entity #:nodoc: end # Classes for DataSet files class Subsets < Samples #:nodoc: end class Subset < Entity #:nodoc: end class Dataset < Entity #:nodoc: end # Classes important for all types class Database < Entity #:nodoc: end class Table #:nodoc: attr_accessor :header attr_accessor :header_description attr_accessor :rows class Header < Array #:nodoc: # @column_index contains column name => numerical index of column attr_accessor :column_index def initialize @column_index = {} end end class Row < Array #:nodoc: attr_accessor :header_object def initialize( n, header_object=nil ) @header_object = header_object super(n) end def [](x) if x.kind_of?( Fixnum ) super(x) else begin x = x.to_s.downcase.to_sym z = @header_object.column_index[x] unless z.kind_of?( Fixnum ) raise IndexError, "#{x.inspect} is not a valid index. Contents of @header_object.column_index: #{@header_object.column_index.inspect}" end self[ z ] rescue NoMethodError unless @header_object $stderr.puts "Table::Row @header_object undefined!" end raise end end end end def initialize() @header_description = {} @header = Header.new @rows = [] end def add_header( line ) raise "Can only define one header" unless @header.empty? @header = @header.concat( parse_row( line ) ) # beware of clobbering this into an Array @header.each_with_index do |key, i| @header.column_index[key.downcase.to_sym] = i end end def add_row( line ) @rows << Row.new( parse_row( line ), @header ) end def add_header_or_row( line ) @header.empty? ? add_header( line ) : add_row( line ) end protected def parse_row( line ) line.split( TABLE_COLUMN_DELIMITER ) end end ######### protected ######### def process(lines) current_indicator = nil current_class_accessor = nil in_table = false lines.each_with_index do |line, line_number| line.strip! next if line.nil? or line.empty? case line[0].chr when LINE_TYPE_ENTITY_INDICATOR current_indicator, value = split_label_value_in( line[1..-1] ) case current_indicator when 'DATABASE' current_class_accessor = @database when 'DATASET' current_class_accessor = @dataset when 'PLATFORM' current_class_accessor = @platform when 'SERIES' current_class_accessor = @series when 'SAMPLE' @samples[value] = Sample.new current_class_accessor = @samples[value] when 'SUBSET' @subsets[value] = Subset.new current_class_accessor = @subsets[value] else custom_raise( line_number, error_msg(40, line) ) end when LINE_TYPE_ENTITY_ATTRIBUTE if( current_indicator == nil ) custom_raise( line_number, error_msg(30) ) end # Handle lines such as '!platform_table_begin' and '!platform_table_end' if in_table if line =~ %r{table_begin} next elsif line =~ %r{table_end} in_table = false next end end key, value = split_label_value_in( line, true ) key_s = key.to_sym if current_class_accessor.include?( key_s ) if current_class_accessor[ key_s ].class != Array current_class_accessor[ key_s ] = [ current_class_accessor[ key_s ] ] end current_class_accessor[key.to_sym] << value else current_class_accessor[key.to_sym] = value end when LINE_TYPE_TABLE_HEADER if( (current_indicator != 'SAMPLE') and (current_indicator != 'PLATFORM') and (current_indicator != 'DATASET') ) custom_raise( line_number, error_msg(20, current_indicator.inspect) ) end in_table = true # may be redundant, computationally not worth checking # We only expect one table per platform or sample current_class_accessor[:table] ||= Table.new key, value = split_label_value_in( line ) # key[1..-1] -- Remove first character which is the LINE_TYPE_TABLE_HEADER current_class_accessor[:table].header_description[ key[1..-1] ] = value else # Type: No line type - should be a row in a table. if( (current_indicator == nil) or (in_table == false) ) custom_raise( line_number, error_msg(10) ) end current_class_accessor[:table].add_header_or_row( line ) end end end def error_msg( i, extra_info=nil ) case i when 10 x = ["Lines without line-type characters are rows in a table, but", "a line containing an entity indicator such as", "\"#{LINE_TYPE_ENTITY_INDICATOR}SAMPLE\",", "\"#{LINE_TYPE_ENTITY_INDICATOR}PLATFORM\",", "or \"#{LINE_TYPE_ENTITY_INDICATOR}DATASET\" has not been", "previously encountered or it does not appear that this line is", "in a table."] when 20 # tables are allowed inside samples and platforms x = ["Tables are only allowed inside SAMPLE and PLATFORM.", "Current table information found inside #{extra_info}."] when 30 x = ["Entity attribute line (\"#{LINE_TYPE_ENTITY_ATTRIBUTE}\")", "found before entity indicator line (\"#{LINE_TYPE_ENTITY_INDICATOR}\")"] when 40 x = ["Unkown entity indicator. Must be DATABASE, SAMPLE, PLATFORM,", "SERIES, DATASET, or SUBSET."] else raise IndexError, "Unknown error message requested." end x.join(" ") end def custom_raise( line_number_with_0_based_indexing, msg ) raise ["Error processing input line: #{line_number_with_0_based_indexing+1}", msg].join("\t") end def split_label_value_in( line, shift_key=false ) line =~ %r{\s*=\s*} key, value = $`, $' if shift_key key =~ %r{_} key = $' end if( (key == nil) or (value == nil) ) puts line.inspect raise end [key, value] end end # SOFT end # Bio From trevor at dev.open-bio.org Fri Feb 2 01:19:53 2007 From: trevor at dev.open-bio.org (Trevor Wennblom) Date: Fri, 02 Feb 2007 06:19:53 +0000 Subject: [BioRuby-cvs] bioruby ChangeLog,1.57,1.58 Message-ID: <200702020619.l126Jrh3012821@dev.open-bio.org> Update of /home/repository/bioruby/bioruby In directory dev.open-bio.org:/tmp/cvs-serv12801 Modified Files: ChangeLog Log Message: Updated ChangeLog Index: ChangeLog =================================================================== RCS file: /home/repository/bioruby/bioruby/ChangeLog,v retrieving revision 1.57 retrieving revision 1.58 diff -C2 -d -r1.57 -r1.58 *** ChangeLog 28 Dec 2006 15:35:50 -0000 1.57 --- ChangeLog 2 Feb 2007 06:19:51 -0000 1.58 *************** *** 1,2 **** --- 1,8 ---- + 2007-02-02 Trevor Wennblom + + * lib/bio/db/soft.rb + + Bio::SOFT for reading SOFT formatted NCBI GEO files. + 2006-12-24 Toshiaki Katayama From trevor at dev.open-bio.org Fri Feb 2 01:23:07 2007 From: trevor at dev.open-bio.org (Trevor Wennblom) Date: Fri, 02 Feb 2007 06:23:07 +0000 Subject: [BioRuby-cvs] bioruby ChangeLog,1.58,1.59 Message-ID: <200702020623.l126N7Vc012849@dev.open-bio.org> Update of /home/repository/bioruby/bioruby In directory dev.open-bio.org:/tmp/cvs-serv12829 Modified Files: ChangeLog Log Message: Updated ChangeLog Index: ChangeLog =================================================================== RCS file: /home/repository/bioruby/bioruby/ChangeLog,v retrieving revision 1.58 retrieving revision 1.59 diff -C2 -d -r1.58 -r1.59 *** ChangeLog 2 Feb 2007 06:19:51 -0000 1.58 --- ChangeLog 2 Feb 2007 06:23:05 -0000 1.59 *************** *** 1,4 **** --- 1,10 ---- 2007-02-02 Trevor Wennblom + * lib/bio/db/lasergene.rb + + Bio::Lasergene Interface for DNAStar Lasergene sequence file format + + 2007-02-02 Trevor Wennblom + * lib/bio/db/soft.rb From trevor at dev.open-bio.org Fri Feb 2 01:42:16 2007 From: trevor at dev.open-bio.org (Trevor Wennblom) Date: Fri, 02 Feb 2007 06:42:16 +0000 Subject: [BioRuby-cvs] bioruby/lib/bio/util restriction_enzyme.rb, 1.11, 1.12 Message-ID: <200702020642.l126gGaG012897@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/lib/bio/util In directory dev.open-bio.org:/tmp/cvs-serv12877/lib/bio/util Modified Files: restriction_enzyme.rb Log Message: Index: restriction_enzyme.rb =================================================================== RCS file: /home/repository/bioruby/bioruby/lib/bio/util/restriction_enzyme.rb,v retrieving revision 1.11 retrieving revision 1.12 diff -C2 -d -r1.11 -r1.12 *** restriction_enzyme.rb 5 Jan 2007 06:33:01 -0000 1.11 --- restriction_enzyme.rb 2 Feb 2007 06:42:14 -0000 1.12 *************** *** 24,33 **** # License:: Distributes under the same terms as Ruby # - # NOTE: This documentation and the module are still very much under - # development. It has been released as it is relatively stable and - # comments would be appreciated. - # - # FIXME needs better docs - # # = Description # --- 24,27 ---- *************** *** 41,45 **** # enzymes to cut your sequence or you may construct your own unique enzymes # to use. ! # # # = Usage --- 35,43 ---- # enzymes to cut your sequence or you may construct your own unique enzymes # to use. ! # ! # Visit the documentaion for individual classes for more information. ! # ! # An examination of the unit tests will also reveal several interesting uses ! # for the curious programmer. # # = Usage *************** *** 47,183 **** # == Basic # ! # # EcoRI cut pattern: ! # # G|A A T T C ! # # +-------+ ! # # C T T A A|G ! # # ! # # This can also be written as: ! # # G^AATTC # ! # require 'bio' ! # require 'pp' # # seq = Bio::Sequence::NA.new('gaattc') # cuts = seq.cut_with_enzyme('EcoRI') ! # p cuts.primary # ["aattc", "g"] ! # p cuts.complement # ["g", "cttaa"] ! # pp cuts # ==> ! # # [#, ! # # #] ! # # seq = Bio::Sequence::NA.new('gaattc') # cuts = seq.cut_with_enzyme('g^aattc') ! # p cuts.primary # ["aattc", "g"] ! # p cuts.complement # ["g", "cttaa"] ! # # seq = Bio::Sequence::NA.new('gaattc') # cuts = seq.cut_with_enzyme('g^aattc', 'gaatt^c') ! # p cuts.primary # ["c", "aattc", "g", "gaatt"] ! # p cuts.complement # ["g", "c", "cttaa", "ttaag"] ! # # seq = Bio::Sequence::NA.new('gaattcgaattc') # cuts = seq.cut_with_enzyme('EcoRI') ! # p cuts.primary # ["aattc", "aattcg", "g"] ! # p cuts.complement # ["g", "gcttaa", "cttaa"] ! # # seq = Bio::Sequence::NA.new('gaattcgggaattc') # cuts = seq.cut_with_enzyme('EcoRI') ! # p cuts.primary # ["aattc", "aattcggg", "g"] ! # p cuts.complement # ["g", "gcccttaa", "cttaa"] ! # # == Advanced ! # # require 'bio' ! # require 'pp' # enzyme_1 = Bio::RestrictionEnzyme.new('anna', [1,1], [3,3]) # enzyme_2 = Bio::RestrictionEnzyme.new('gg', [1,1]) # a = Bio::RestrictionEnzyme::Analysis.cut('agga', enzyme_1, enzyme_2) ! # p a.primary # ["a", "ag", "g", "ga"] ! # ! # b = Bio::RestrictionEnzyme::Analysis.cut_and_return_by_permutations('agga', enzyme_1, enzyme_2) ! # pp b # # ! # Output (NOTE: to be cleaned): ! # ! # {[1, 0]=> ! # #, ! # #], ! # @__fragments_current=true, ! # @c_left=3, ! # @c_right=3, ! # @cut_ranges= ! # [#], ! # @left=0, ! # @p_left=0, ! # @p_right=0, ! # @right=3, ! # @size=4, ! # @tags={}>, ! # [0, 1]=> ! # #, ! # #, ! # #, ! # #], ! # @__fragments_current=true, ! # @c_left=3, ! # @c_right=3, ! # @cut_ranges= ! # [#, ! # #, ! # #], ! # @left=0, ! # @p_left=0, ! # @p_right=0, ! # @right=3, ! # @size=4, ! # @tags={}>} ! # ! # ! # = Currently under development # # * Circular DNA cutting --- 45,124 ---- # == Basic # ! # EcoRI cut pattern: ! # G|A A T T C ! # +-------+ ! # C T T A A|G # ! # This can also be written as: ! # G^AATTC ! # ! # Note that to use the method +cut_with_enzyme+ from a Bio::Sequence object ! # you currently must +require+ +bio/util/restriction_enzyme+ directly. If ! # instead you're going to directly call Bio::RestrictionEnzyme::Analysis ! # then only +bio+ needs to be +required+. # + # require 'bio' + # require 'bio/util/restriction_enzyme' + # # seq = Bio::Sequence::NA.new('gaattc') # cuts = seq.cut_with_enzyme('EcoRI') ! # cuts.primary # => ["aattc", "g"] ! # cuts.complement # => ["cttaa", "g"] ! # cuts.inspect # => "[#, #]" ! # # seq = Bio::Sequence::NA.new('gaattc') # cuts = seq.cut_with_enzyme('g^aattc') ! # cuts.primary # => ["aattc", "g"] ! # cuts.complement # => ["cttaa", "g"] ! # # seq = Bio::Sequence::NA.new('gaattc') # cuts = seq.cut_with_enzyme('g^aattc', 'gaatt^c') ! # cuts.primary # => ["aattc", "c", "g", "gaatt"] ! # cuts.complement # => ["c", "cttaa", "g", "ttaag"] ! # # seq = Bio::Sequence::NA.new('gaattcgaattc') # cuts = seq.cut_with_enzyme('EcoRI') ! # cuts.primary # => ["aattc", "aattcg", "g"] ! # cuts.complement # => ["cttaa", "g", "gcttaa"] ! # # seq = Bio::Sequence::NA.new('gaattcgggaattc') # cuts = seq.cut_with_enzyme('EcoRI') ! # cuts.primary # => ["aattc", "aattcggg", "g"] ! # cuts.complement # => ["cttaa", "g", "gcccttaa"] ! # ! # cuts[0].inspect # => "#" ! # ! # cuts[0].primary # => "g " ! # cuts[0].complement # => "cttaa" ! # ! # cuts[1].primary # => "aattcggg " ! # cuts[1].complement # => " gcccttaa" ! # ! # cuts[2].primary # => "aattc" ! # cuts[2].complement # => " g" ! # # == Advanced ! # # require 'bio' ! # # enzyme_1 = Bio::RestrictionEnzyme.new('anna', [1,1], [3,3]) # enzyme_2 = Bio::RestrictionEnzyme.new('gg', [1,1]) # a = Bio::RestrictionEnzyme::Analysis.cut('agga', enzyme_1, enzyme_2) ! # a.primary # => ["a", "ag", "g", "ga"] ! # a.complement # => ["c", "ct", "t", "tc"] # + # a[0].primary # => "ag" + # a[0].complement # => "tc" + # + # a[1].primary # => "ga" + # a[1].complement # => "ct" + # + # a[2].primary # => "a" + # a[2].complement # => "t" + # + # a[3].primary # => "g" + # a[3].complement # => "c" # ! # = Todo / under development # # * Circular DNA cutting From trevor at dev.open-bio.org Fri Feb 2 01:44:15 2007 From: trevor at dev.open-bio.org (Trevor Wennblom) Date: Fri, 02 Feb 2007 06:44:15 +0000 Subject: [BioRuby-cvs] bioruby ChangeLog,1.59,1.60 Message-ID: <200702020644.l126iF6k012925@dev.open-bio.org> Update of /home/repository/bioruby/bioruby In directory dev.open-bio.org:/tmp/cvs-serv12905 Modified Files: ChangeLog Log Message: Updated ChangeLog Index: ChangeLog =================================================================== RCS file: /home/repository/bioruby/bioruby/ChangeLog,v retrieving revision 1.59 retrieving revision 1.60 diff -C2 -d -r1.59 -r1.60 *** ChangeLog 2 Feb 2007 06:23:05 -0000 1.59 --- ChangeLog 2 Feb 2007 06:44:13 -0000 1.60 *************** *** 1,4 **** --- 1,10 ---- 2007-02-02 Trevor Wennblom + * lib/bio/util/restriction_enzyme* + + Bio::RestrictionEnzyme stabilized. + + 2007-02-02 Trevor Wennblom + * lib/bio/db/lasergene.rb From k at dev.open-bio.org Sun Feb 11 21:15:47 2007 From: k at dev.open-bio.org (Katayama Toshiaki) Date: Mon, 12 Feb 2007 02:15:47 +0000 Subject: [BioRuby-cvs] bioruby/lib/bio/io flatfile.rb,1.53,1.54 Message-ID: <200702120215.l1C2FltH009477@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/lib/bio/io In directory dev.open-bio.org:/tmp/cvs-serv9473/lib/bio/io Modified Files: flatfile.rb Log Message: * KEGG EGENES supported Index: flatfile.rb =================================================================== RCS file: /home/repository/bioruby/bioruby/lib/bio/io/flatfile.rb,v retrieving revision 1.53 retrieving revision 1.54 diff -C2 -d -r1.53 -r1.54 *** flatfile.rb 15 Dec 2006 16:54:25 -0000 1.53 --- flatfile.rb 12 Feb 2007 02:15:45 -0000 1.54 *************** *** 1156,1160 **** ], genes = RuleRegexp[ 'Bio::KEGG::GENES', ! /^ENTRY .+ (CDS|gene|.*RNA) / ], genome = RuleRegexp[ 'Bio::KEGG::GENOME', /^ENTRY [a-z]+$/ ], --- 1156,1160 ---- ], genes = RuleRegexp[ 'Bio::KEGG::GENES', ! /^ENTRY .+ (CDS|gene|.*RNA|Contig) / ], genome = RuleRegexp[ 'Bio::KEGG::GENOME', /^ENTRY [a-z]+$/ ], From ngoto at dev.open-bio.org Mon Feb 12 04:59:40 2007 From: ngoto at dev.open-bio.org (Naohisa Goto) Date: Mon, 12 Feb 2007 09:59:40 +0000 Subject: [BioRuby-cvs] bioruby/lib/bio/io flatfile.rb,1.54,1.55 Message-ID: <200702120959.l1C9xeER011212@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/lib/bio/io In directory dev.open-bio.org:/tmp/cvs-serv11192/lib/bio/io Modified Files: flatfile.rb Log Message: Bio::FlatFile#next_entry now raises UnknownDataFormatError when data format hasn't been specified due to the fail of file format autodetection. Index: flatfile.rb =================================================================== RCS file: /home/repository/bioruby/bioruby/lib/bio/io/flatfile.rb,v retrieving revision 1.54 retrieving revision 1.55 diff -C2 -d -r1.54 -r1.55 *** flatfile.rb 12 Feb 2007 02:15:45 -0000 1.54 --- flatfile.rb 12 Feb 2007 09:59:37 -0000 1.55 *************** *** 579,584 **** --- 579,590 ---- end + # Exception class to be raised when data format hasn't been specified. + class UnknownDataFormatError < IOError + end + # Get next entry. def next_entry + raise UnknownDataFormatError, + 'file format auto-detection failed?' unless @dbclass if @skip_leader_mode and ((@firsttime_flag and @skip_leader_mode == :firsttime) or From ngoto at dev.open-bio.org Mon Feb 12 05:05:01 2007 From: ngoto at dev.open-bio.org (Naohisa Goto) Date: Mon, 12 Feb 2007 10:05:01 +0000 Subject: [BioRuby-cvs] bioruby ChangeLog,1.60,1.61 Message-ID: <200702121005.l1CA517X011262@dev.open-bio.org> Update of /home/repository/bioruby/bioruby In directory dev.open-bio.org:/tmp/cvs-serv11222 Modified Files: ChangeLog Log Message: Changelog for bioruby/lib/bio/io flatfile.rb,1.54,1.55. Index: ChangeLog =================================================================== RCS file: /home/repository/bioruby/bioruby/ChangeLog,v retrieving revision 1.60 retrieving revision 1.61 diff -C2 -d -r1.60 -r1.61 *** ChangeLog 2 Feb 2007 06:44:13 -0000 1.60 --- ChangeLog 12 Feb 2007 10:04:59 -0000 1.61 *************** *** 1,2 **** --- 1,10 ---- + 2007-02-12 Naohisa Goto + + * lib/bio/io/flatfile.rb + + Exception class UnknownDataFormatError is added. + It will be raised before reading data from IO when data format + hasn't been specified due to failure of file format autodetection. + 2007-02-02 Trevor Wennblom From nakao at dev.open-bio.org Thu Feb 22 02:53:51 2007 From: nakao at dev.open-bio.org (Mitsuteru C. Nakao) Date: Thu, 22 Feb 2007 07:53:51 +0000 Subject: [BioRuby-cvs] bioruby/test/data/iprscan merged.txt,NONE,1.1 Message-ID: <200702220753.l1M7rpVF013893@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/test/data/iprscan In directory dev.open-bio.org:/tmp/cvs-serv13869/test/data/iprscan Added Files: merged.txt Log Message: * Added the txt format test file. * Added Bio::Iprscan::Report.parse_in_txt method. --- NEW FILE: merged.txt --- Sequence "Q9RHD9" crc64 checksum: D44DAE8C544CB7C1 length: 267 aa. InterPro IPR000110 Ribosomal protein S1 Molecular Function: RNA binding (GO:0003723), Molecular Function: structural constituent of ribosome (GO:0003735), Cellular Component: ribosome (GO:0005840), Biological Process: protein biosynthesis (GO:0006412) method AccNumber shortName location FPrintScan PR00681 RIBOSOMALS1 T[6-27] 1.5e-17 T[85-104] 1.5e-17 T[125-143] 1.5e-17 InterPro IPR003029 RNA binding S1 Molecular Function: RNA binding (GO:0003723) method AccNumber shortName location HMMPfam PF00575 S1 T[1-55] 1.3e-08 T[68-142] 1.6e-21 T[155-228] 6.8e-22 HMMSmart SM00316 S1 T[3-55] 1.2e-06 T[70-142] 1.4e-19 T[157-228] 2.6e-21 ProfileScan PS50126 S1 T[1-55] 14.869 T[72-142] 20.809 T[159-228] 22.541 InterPro IPR008994 Nucleic acid-binding OB-fold method AccNumber shortName location superfamily SSF50249 Nucleic acid-binding proteins T[147-257] 2.5e-24 T[59-145] 2.4e-22 T[3-58] 9.2e-14 InterPro NULL NULL method AccNumber shortName location Coil coil coiled-coil ?[225-246] Seg seg seg ?[29-40] ?[84-98] ?[222-237] Sequence "RS16_ECOLI" crc64 checksum: F94D07049A6D489D length: 82 aa. InterPro IPR000307 Ribosomal protein S16 Molecular Function: structural constituent of ribosome (GO:0003735), Cellular Component: intracellular (GO:0005622), Cellular Component: ribosome (GO:0005840), Biological Process: protein biosynthesis (GO:0006412) method AccNumber shortName location BlastProDom PD003791 sp_RS16_ECOLI_P02372; T[1-77] 3e-38 HMMPfam PF00886 Ribosomal_S16 T[8-68] 1.1e-35 HMMTigr TIGR00002 S16 T[2-81] 8.8e-33 ScanRegExp PS00732 RIBOSOMAL_S16 T[2-11] 8e-5 superfamily SSF54565 Ribosomal protein S16 T[1-79] 9.4e-28 Sequence "Y902_MYCTU" crc64 checksum: CD84A335CCFFE6D7 length: 446 aa. InterPro IPR003594 ATP-binding region, ATPase-like Molecular Function: ATP binding (GO:0005524) method AccNumber shortName location HMMPfam PF02518 HATPase_c T[338-445] 9.6e-29 HMMSmart SM00387 HATPase_c T[338-446] 5e-24 InterPro IPR003660 Histidine kinase, HAMP region Molecular Function: signal transducer activity (GO:0004871), Biological Process: signal transduction (GO:0007165), Cellular Component: membrane (GO:0016020) method AccNumber shortName location HMMPfam PF00672 HAMP T[151-219] 4.3e-11 HMMSmart SM00304 HAMP T[170-222] 3.1e-06 ProfileScan PS50885 HAMP T[170-222] 7.777 InterPro IPR003661 Histidine kinase A, N-terminal Molecular Function: two-component sensor molecule activity (GO:0000155), Biological Process: signal transduction (GO:0007165), Cellular Component: membrane (GO:0016020) method AccNumber shortName location HMMPfam PF00512 HisKA T[230-296] 9.2e-14 HMMSmart SM00388 HisKA T[230-296] 2.4e-12 InterPro IPR004358 Bacterial sensor protein, C-terminal Molecular Function: two-component sensor molecule activity (GO:0000155), Biological Process: signal transduction (GO:0007165) method AccNumber shortName location FPrintScan PR00344 BCTRLSENSOR T[374-388] 2e-12 T[392-402] 2e-12 T[406-424] 2e-12 T[430-443] 2e-12 InterPro IPR005467 Histidine kinase Biological Process: signal transduction (GO:0007165), Molecular Function: kinase activity (GO:0016301) method AccNumber shortName location ProfileScan PS50109 HIS_KIN T[237-446] 34.449 InterPro IPR009082 Histidine kinase, homodimeric method AccNumber shortName location superfamily SSF47384 Homodimeric domain of signal transducing histidine kinaseT[220-292] 2.7e-11 InterPro NULL NULL method AccNumber shortName location Seg seg seg ?[44-55] ?[108-120] ?[160-173] ?[308-319] ?[400-424] superfamily SSF55874 ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinaseT[295-444] 4.6e-30 From nakao at dev.open-bio.org Thu Feb 22 02:53:51 2007 From: nakao at dev.open-bio.org (Mitsuteru C. Nakao) Date: Thu, 22 Feb 2007 07:53:51 +0000 Subject: [BioRuby-cvs] bioruby/lib/bio/appl/iprscan report.rb,1.1,1.2 Message-ID: <200702220753.l1M7rpkW013895@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/lib/bio/appl/iprscan In directory dev.open-bio.org:/tmp/cvs-serv13869/lib/bio/appl/iprscan Modified Files: report.rb Log Message: * Added the txt format test file. * Added Bio::Iprscan::Report.parse_in_txt method. Index: report.rb =================================================================== RCS file: /home/repository/bioruby/bioruby/lib/bio/appl/iprscan/report.rb,v retrieving revision 1.1 retrieving revision 1.2 diff -C2 -d -r1.1 -r1.2 *** report.rb 14 Dec 2006 16:22:12 -0000 1.1 --- report.rb 22 Feb 2007 07:53:49 -0000 1.2 *************** *** 24,28 **** # == USAGE # # Read a marged.txt and split each entry. ! # Bio::Iprscan::Report.reports_in_txt(File.read("marged.txt") do |report| # report.query_id # report.matches.size --- 24,28 ---- # == USAGE # # Read a marged.txt and split each entry. ! # Bio::Iprscan::Report.reports_in_txt(File.read("marged.txt")) do |report| # report.query_id # report.matches.size *************** *** 41,45 **** # end # ! # Bio::Iprscan::Report.reports_in_raw(File.read("marged.raw") do |report| # report.class #=> Bio::Iprscan::Report # end --- 41,45 ---- # end # ! # Bio::Iprscan::Report.reports_in_raw(File.read("marged.raw")) do |report| # report.class #=> Bio::Iprscan::Report # end *************** *** 56,59 **** --- 56,62 ---- attr_accessor :query_length + # CRC64 checksum of query sequence. + attr_accessor :crc64 + # Matched InterPro motifs in Hash. Each InterPro motif have :name, # :definition, :accession and :motifs keys. And :motifs key contains *************** *** 129,133 **** end ! # Parser method for a txt formated entry. Retruns a Bio::Iprscan::Report # object. # --- 132,176 ---- end ! ! # Parser method for a txt formated entry. Returns a Bio::Iprscan::Report ! # object. ! # ! def self.parse_in_txt(str) ! header, *matches = str.split(/\n\n/) ! report = self.new ! report.query_id = if header =~ /Sequence \"(.+)\" / then $1 else '' end ! report.query_length = if header =~ /length: (\d+) aa./ then $1.to_i else nil end ! report.crc64 = if header =~ /crc64 checksum: (\S+) / then $1 else nil end ! ipr_line = '' ! go_annotation = '' ! matches.each do |m| ! m = m.split(/\n/).map {|x| x.split(/ +/) } ! m.each do |match| ! case match[0] ! when 'method' ! when /(Molecular Function|Cellular Component|Biological Process):/ ! go_annotation = match[0].scan(/([MCB]\w+ \w+): (\S.+?\S) \((GO:\d+)\),*/) ! when 'InterPro' ! ipr_line = match ! else ! pos_scores = match[3].scan(/(\S)\[(\d+)-(\d+)\] (\S+) */) ! pos_scores.each do |pos_score| ! report.matches << Match.new(:ipr_id => ipr_line[1], ! :ipr_description => ipr_line[2], ! :method => match[0], ! :accession => match[1], ! :description => match[2], ! :evalue => pos_score[3], ! :match_start => pos_score[1].to_i, ! :match_end => pos_score[2].to_i, ! :go_terms => go_annotation) ! end ! end ! end ! end ! return report ! end ! ! # Parser method for a pseudo-txt formated entry. Retruns a Bio::Iprscan::Report # object. # *************** *** 135,142 **** # # File.read("marged.txt").each(Bio::Iprscan::Report::RS) do |e| ! # report = Bio::Iprscan::Report.parse_in_txt(e) # end # ! def self.parse_in_txt(str) report = self.new ipr_line = '' --- 178,185 ---- # # File.read("marged.txt").each(Bio::Iprscan::Report::RS) do |e| ! # report = Bio::Iprscan::Report.parse_in_ptxt(e) # end # ! def self.parse_in_ptxt(str) report = self.new ipr_line = '' *************** *** 168,171 **** --- 211,215 ---- @query_id = nil @query_length = nil + @crc64 = nil @matches = [] end From nakao at dev.open-bio.org Thu Feb 22 02:53:51 2007 From: nakao at dev.open-bio.org (Mitsuteru C. Nakao) Date: Thu, 22 Feb 2007 07:53:51 +0000 Subject: [BioRuby-cvs] bioruby/test/unit/bio/appl/iprscan test_report.rb, 1.1, 1.2 Message-ID: <200702220753.l1M7rpME013898@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/test/unit/bio/appl/iprscan In directory dev.open-bio.org:/tmp/cvs-serv13869/test/unit/bio/appl/iprscan Modified Files: test_report.rb Log Message: * Added the txt format test file. * Added Bio::Iprscan::Report.parse_in_txt method. Index: test_report.rb =================================================================== RCS file: /home/repository/bioruby/bioruby/test/unit/bio/appl/iprscan/test_report.rb,v retrieving revision 1.1 retrieving revision 1.2 diff -C2 -d -r1.1 -r1.2 *** test_report.rb 14 Dec 2006 16:22:12 -0000 1.1 --- test_report.rb 22 Feb 2007 07:53:49 -0000 1.2 *************** *** 22,29 **** File.open(File.join(TestDataIprscan, "merged.raw")) end end ! class TestIprscanTxtReport < Test::Unit::TestCase def setup --- 22,34 ---- File.open(File.join(TestDataIprscan, "merged.raw")) end + + def self.txt_format + File.open(File.join(TestDataIprscan, "merged.txt")) + end + end ! class TestIprscanPTxtReport < Test::Unit::TestCase def setup *************** *** 39,43 **** // END ! @obj = Bio::Iprscan::Report.parse_in_txt(test_entry) end --- 44,48 ---- // END ! @obj = Bio::Iprscan::Report.parse_in_ptxt(test_entry) end *************** *** 87,92 **** --- 92,168 ---- end + end # TestIprscanPTxtReport + + + + + class TestIprscanTxtReport < Test::Unit::TestCase + def setup + test_txt = Bio::TestIprscanData.txt_format.read.split(/\n\nSequence/)[0] + @obj = Bio::Iprscan::Report.parse_in_txt(test_txt) + end + + def test_iprscan_report_class + assert_equal(Bio::Iprscan::Report, @obj.class) + end + + def test_query_id + assert_equal('Q9RHD9', @obj.query_id) + end + + def test_query_length + assert_equal(267, @obj.query_length) + end + + def test_matches_size + assert_equal(16, @obj.matches.size) + end + + def test_match_ipr_id + assert_equal('IPR000110', @obj.matches.first.ipr_id) + end + + def test_match_ipr_description + assert_equal('Ribosomal protein S1', @obj.matches.first.ipr_description) + end + + def test_match_method + assert_equal('FPrintScan', @obj.matches.first.method) + end + + def test_match_accession + assert_equal('PR00681', @obj.matches.first.accession) + end + + def test_match_description + assert_equal('RIBOSOMALS1', @obj.matches.first.description) + end + + def test_match_evalue + assert_equal('1.5e-17', @obj.matches.first.evalue) + end + + def test_match_match_start + assert_equal(6, @obj.matches.first.match_start) + end + + def test_match_match_end + assert_equal(27, @obj.matches.first.match_end) + end + + def test_match_go_terms + ary = [["Molecular Function", "RNA binding", "GO:0003723"], + ["Molecular Function", "structural constituent of ribosome", "GO:0003735"], + ["Cellular Component", "ribosome", "GO:0005840"], + ["Biological Process", "protein biosynthesis", "GO:0006412"]] + assert_equal(ary, @obj.matches.first.go_terms) + end + + end # TestIprscanTxtReport + + + class TestIprscanRawReport < Test::Unit::TestCase def setup From nakao at dev.open-bio.org Thu Feb 22 03:44:36 2007 From: nakao at dev.open-bio.org (Mitsuteru C. Nakao) Date: Thu, 22 Feb 2007 08:44:36 +0000 Subject: [BioRuby-cvs] bioruby/lib/bio/appl/iprscan report.rb,1.2,1.3 Message-ID: <200702220844.l1M8iatq013999@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/lib/bio/appl/iprscan In directory dev.open-bio.org:/tmp/cvs-serv13975/lib/bio/appl/iprscan Modified Files: report.rb Log Message: * Added test codes. Index: report.rb =================================================================== RCS file: /home/repository/bioruby/bioruby/lib/bio/appl/iprscan/report.rb,v retrieving revision 1.2 retrieving revision 1.3 diff -C2 -d -r1.2 -r1.3 *** report.rb 22 Feb 2007 07:53:49 -0000 1.2 --- report.rb 22 Feb 2007 08:44:34 -0000 1.3 *************** *** 127,131 **** # end def self.reports_in_txt(io) ! io.each(/\n\/\/\n/m) do |entry| yield self.parse_in_txt(entry) end --- 127,137 ---- # end def self.reports_in_txt(io) ! io.each("\n\nSequence") do |entry| ! if entry =~ /Sequence$/ ! entry = entry.sub(/Sequence$/, '') ! end ! unless entry =~ /^Sequence/ ! entry = 'Sequence' + entry ! end yield self.parse_in_txt(entry) end *************** *** 133,140 **** --- 139,150 ---- + # Parser method for a txt formated entry. Returns a Bio::Iprscan::Report # object. # def self.parse_in_txt(str) + unless str =~ /^Sequence / + raise Exception, "Invalid format: \n\n#{str}" + end header, *matches = str.split(/\n\n/) report = self.new *************** *** 172,175 **** --- 182,198 ---- end + + # Splits entry stream. + # + # == Usage + # Bio::Iprscan::Report.reports_in_ptxt(File.open("merged.txt")) do |report| + # report + # end + def self.reports_in_ptxt(io) + io.each(/\n\/\/\n/m) do |entry| + yield self.parse_in_ptxt(entry) + end + end + # Parser method for a pseudo-txt formated entry. Retruns a Bio::Iprscan::Report # object. From nakao at dev.open-bio.org Thu Feb 22 03:44:36 2007 From: nakao at dev.open-bio.org (Mitsuteru C. Nakao) Date: Thu, 22 Feb 2007 08:44:36 +0000 Subject: [BioRuby-cvs] bioruby/test/unit/bio/appl/iprscan test_report.rb, 1.2, 1.3 Message-ID: <200702220844.l1M8iaF0014009@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/test/unit/bio/appl/iprscan In directory dev.open-bio.org:/tmp/cvs-serv13975/test/unit/bio/appl/iprscan Modified Files: test_report.rb Log Message: * Added test codes. Index: test_report.rb =================================================================== RCS file: /home/repository/bioruby/bioruby/test/unit/bio/appl/iprscan/test_report.rb,v retrieving revision 1.2 retrieving revision 1.3 diff -C2 -d -r1.2 -r1.3 *** test_report.rb 22 Feb 2007 07:53:49 -0000 1.2 --- test_report.rb 22 Feb 2007 08:44:34 -0000 1.3 *************** *** 95,101 **** ! ! ! class TestIprscanTxtReport < Test::Unit::TestCase def setup test_txt = Bio::TestIprscanData.txt_format.read.split(/\n\nSequence/)[0] --- 95,99 ---- ! class TestIprscanTxtEntry < Test::Unit::TestCase def setup test_txt = Bio::TestIprscanData.txt_format.read.split(/\n\nSequence/)[0] *************** *** 158,165 **** assert_equal(ary, @obj.matches.first.go_terms) end - end # TestIprscanTxtReport --- 156,176 ---- assert_equal(ary, @obj.matches.first.go_terms) end + end # TestIprscanTxtEntry + class TestIprscanTxtReport < Test::Unit::TestCase + def setup + @test_txt = Bio::TestIprscanData.txt_format + end + + def test_reports_in_txt + Bio::Iprscan::Report.reports_in_txt(@test_txt) do |report| + assert_equal(Bio::Iprscan::Report, report.class) + end + end + + + end # TestIprscanTxtReport From nakao at dev.open-bio.org Thu Feb 22 03:44:36 2007 From: nakao at dev.open-bio.org (Mitsuteru C. Nakao) Date: Thu, 22 Feb 2007 08:44:36 +0000 Subject: [BioRuby-cvs] bioruby/test/data/iprscan merged.txt,1.1,1.2 Message-ID: <200702220844.l1M8ia4T014004@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/test/data/iprscan In directory dev.open-bio.org:/tmp/cvs-serv13975/test/data/iprscan Modified Files: merged.txt Log Message: * Added test codes. Index: merged.txt =================================================================== RCS file: /home/repository/bioruby/bioruby/test/data/iprscan/merged.txt,v retrieving revision 1.1 retrieving revision 1.2 diff -C2 -d -r1.1 -r1.2 *** merged.txt 22 Feb 2007 07:53:49 -0000 1.1 --- merged.txt 22 Feb 2007 08:44:34 -0000 1.2 *************** *** 66,74 **** InterPro IPR009082 Histidine kinase, homodimeric method AccNumber shortName location ! superfamily SSF47384 Homodimeric domain of signal transducing histidine kinaseT[220-292] 2.7e-11 InterPro NULL NULL method AccNumber shortName location Seg seg seg ?[44-55] ?[108-120] ?[160-173] ?[308-319] ?[400-424] ! superfamily SSF55874 ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinaseT[295-444] 4.6e-30 --- 66,74 ---- InterPro IPR009082 Histidine kinase, homodimeric method AccNumber shortName location ! superfamily SSF47384 Homodimeric domain of signal transducing histidine kinase T[220-292] 2.7e-11 InterPro NULL NULL method AccNumber shortName location Seg seg seg ?[44-55] ?[108-120] ?[160-173] ?[308-319] ?[400-424] ! superfamily SSF55874 ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinase T[295-444] 4.6e-30 From nakao at dev.open-bio.org Thu Feb 22 05:15:03 2007 From: nakao at dev.open-bio.org (Mitsuteru C. Nakao) Date: Thu, 22 Feb 2007 10:15:03 +0000 Subject: [BioRuby-cvs] bioruby/test/unit/bio/appl/iprscan test_report.rb, 1.3, 1.4 Message-ID: <200702221015.l1MAF3qq016001@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/test/unit/bio/appl/iprscan In directory dev.open-bio.org:/tmp/cvs-serv15976/test/unit/bio/appl/iprscan Modified Files: test_report.rb Log Message: * Added list_of_interpro method. Index: test_report.rb =================================================================== RCS file: /home/repository/bioruby/bioruby/test/unit/bio/appl/iprscan/test_report.rb,v retrieving revision 1.3 retrieving revision 1.4 diff -C2 -d -r1.3 -r1.4 *** test_report.rb 22 Feb 2007 08:44:34 -0000 1.3 --- test_report.rb 22 Feb 2007 10:15:01 -0000 1.4 *************** *** 141,144 **** --- 141,152 ---- end + def test_match_status + assert_equal('T', @obj.matches.first.status) + end + + def test_match_date + assert_equal(nil, @obj.matches.first.date) + end + def test_match_match_start assert_equal(6, @obj.matches.first.match_start) *************** *** 159,162 **** --- 167,193 ---- + class TestIprscanTxtEntryList < Test::Unit::TestCase + def setup + test_txt = Bio::TestIprscanData.txt_format.read.split(/\n\nSequence/)[0] + @obj = Bio::Iprscan::Report.parse_in_txt(test_txt) + end + + def test_list_of_interpro + hsh = {"IPR008994"=>[12, 13, 14], + "IPR000110"=>[0, 1, 2], + "IPR003029"=>[3, 4, 5, 6, 7, 8, 9, 10, 11], + "NULL"=>[15]} + assert_equal(hsh, @obj.list_of_interpro) + end + + def test_list_of_interpro_match? + @obj.list_of_interpro.each do |ipr_id, indexes| + indexes.each do |index| + assert_equal(ipr_id, @obj.matches[index].ipr_id) + end + end + end + end # TestIprscanTxtEntryList + class TestIprscanTxtReport < Test::Unit::TestCase *************** *** 266,268 **** --- 297,312 ---- end + + class TestIprscanReport < Test::Unit::TestCase + def setup + test_txt = Bio::TestIprscanData.txt_format.read.split(/\n\nSequence/)[0] + @obj = Bio::Iprscan::Report.parse_in_txt(test_txt) + end + + def test_to_raw + # puts @obj.to_raw + end + + end # TestIprscanReport + end From nakao at dev.open-bio.org Thu Feb 22 05:15:03 2007 From: nakao at dev.open-bio.org (Mitsuteru C. Nakao) Date: Thu, 22 Feb 2007 10:15:03 +0000 Subject: [BioRuby-cvs] bioruby/lib/bio/appl/iprscan report.rb,1.3,1.4 Message-ID: <200702221015.l1MAF3tA015998@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/lib/bio/appl/iprscan In directory dev.open-bio.org:/tmp/cvs-serv15976/lib/bio/appl/iprscan Modified Files: report.rb Log Message: * Added list_of_interpro method. Index: report.rb =================================================================== RCS file: /home/repository/bioruby/bioruby/lib/bio/appl/iprscan/report.rb,v retrieving revision 1.3 retrieving revision 1.4 diff -C2 -d -r1.3 -r1.4 *** report.rb 22 Feb 2007 08:44:34 -0000 1.3 --- report.rb 22 Feb 2007 10:15:01 -0000 1.4 *************** *** 120,129 **** end ! # Splits entry stream. # # == Usage # Bio::Iprscan::Report.reports_in_txt(File.open("merged.txt")) do |report| ! # report # end def self.reports_in_txt(io) io.each("\n\nSequence") do |entry| --- 120,131 ---- end ! # Splits the entry stream. # # == Usage + # # Bio::Iprscan::Report.reports_in_txt(File.open("merged.txt")) do |report| ! # report.class #=> Bio::Iprscan::Report # end + # def self.reports_in_txt(io) io.each("\n\nSequence") do |entry| *************** *** 145,149 **** def self.parse_in_txt(str) unless str =~ /^Sequence / ! raise Exception, "Invalid format: \n\n#{str}" end header, *matches = str.split(/\n\n/) --- 147,151 ---- def self.parse_in_txt(str) unless str =~ /^Sequence / ! raise ArgumentError, "Invalid format: \n\n#{str}" end header, *matches = str.split(/\n\n/) *************** *** 172,175 **** --- 174,178 ---- :description => match[2], :evalue => pos_score[3], + :status => pos_score[0], :match_start => pos_score[1].to_i, :match_end => pos_score[2].to_i, *************** *** 246,250 **** end ! def to_ebihtml NotImplementedError end --- 249,253 ---- end ! def to_ebixml NotImplementedError end *************** *** 255,259 **** def to_raw ! NotImplementedError end --- 258,278 ---- def to_raw ! @matches.map { |match| ! [self.query_id, ! self.crc64, ! self.query_length, ! match.method, ! match.accession, ! match.description, ! match.match_start, ! match.match_end, ! match.evalue, ! match.status, ! match.date, ! match.ipr_id, ! match.ipr_description, ! match.go_terms.map {|x| x[0] + ': ' + x[1] + ' (' + x[2] + ')' }.join(', ') ! ].join("\t") ! }.join("\n") end *************** *** 262,273 **** end ! # == DESCRIPTION # Container class for InterProScan matches. # ! # == USAGE # match = Match.new(:query_id => ...) # # match.ipr_id = 'IPR001234' ! # match.ipr_id #=> 'IPR1234' # class Match --- 281,313 ---- end ! ! # Returns a Hash (key as an interpro id and value as index key for ! # matches (Array). ! # ! # report.list_of_interpro.each do |ipr_id, indexes| ! # indexes.each do |index| ! # report.matches[index].ipr_id == ipr_id #=> true ! # end ! # end ! # ! def list_of_interpro ! @ipr_ids = {} unless @ipr_ids ! @matches.each_with_index do |match, i| ! @ipr_ids[match.ipr_id] = [] unless @ipr_ids[match.ipr_id] ! @ipr_ids[match.ipr_id] << i ! end ! @ipr_ids ! end ! ! ! ! # == Description # Container class for InterProScan matches. # ! # == Usage # match = Match.new(:query_id => ...) # # match.ipr_id = 'IPR001234' ! # match.ipr_id #=> 'IPR001234' # class Match *************** *** 306,310 **** def match_start; @data[:match_start]; end # the descriotion of the InterPro entry. ! def ipr_description; @data[:ipr_description]; end def method_missing(name, arg = nil) --- 346,350 ---- def match_start; @data[:match_start]; end # the descriotion of the InterPro entry. ! def ipr_odescription; @data[:ipr_description]; end def method_missing(name, arg = nil) From ngoto at dev.open-bio.org Thu Feb 22 12:29:57 2007 From: ngoto at dev.open-bio.org (Naohisa Goto) Date: Thu, 22 Feb 2007 17:29:57 +0000 Subject: [BioRuby-cvs] bioruby/lib/bio/util sirna.rb,1.7,1.8 Message-ID: <200702221729.l1MHTvK4016826@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/lib/bio/util In directory dev.open-bio.org:/tmp/cvs-serv16806/lib/bio/util Modified Files: sirna.rb Log Message: changed license to Ruby's. Index: sirna.rb =================================================================== RCS file: /home/repository/bioruby/bioruby/lib/bio/util/sirna.rb,v retrieving revision 1.7 retrieving revision 1.8 diff -C2 -d -r1.7 -r1.8 *** sirna.rb 27 Dec 2005 17:27:38 -0000 1.7 --- sirna.rb 22 Feb 2007 17:29:55 -0000 1.8 *************** *** 4,8 **** # Copyright:: Copyright (C) 2004, 2005 # Itoshi NIKAIDO ! # License:: LGPL # # $Id$ --- 4,8 ---- # Copyright:: Copyright (C) 2004, 2005 # Itoshi NIKAIDO ! # License:: Ruby's # # $Id$ From ngoto at dev.open-bio.org Thu Feb 22 12:38:43 2007 From: ngoto at dev.open-bio.org (Naohisa Goto) Date: Thu, 22 Feb 2007 17:38:43 +0000 Subject: [BioRuby-cvs] bioruby/lib/bio/util sirna.rb,1.8,1.9 Message-ID: <200702221738.l1MHchGV016895@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/lib/bio/util In directory dev.open-bio.org:/tmp/cvs-serv16855/lib/bio/util Modified Files: sirna.rb Log Message: In lines 99 and 100, variable name gc_number is changed to au_number. Thanks to David P Thomas. Index: sirna.rb =================================================================== RCS file: /home/repository/bioruby/bioruby/lib/bio/util/sirna.rb,v retrieving revision 1.8 retrieving revision 1.9 diff -C2 -d -r1.8 -r1.9 *** sirna.rb 22 Feb 2007 17:29:55 -0000 1.8 --- sirna.rb 22 Feb 2007 17:38:41 -0000 1.9 *************** *** 97,102 **** start_pos = @target_size - one_third - 1 remain_seq = target.subseq(start_pos, @target_size - 2) ! gc_number = remain_seq.scan(/[AU]/i).size ! return false if gc_number < 5 return true --- 97,102 ---- start_pos = @target_size - one_third - 1 remain_seq = target.subseq(start_pos, @target_size - 2) ! au_number = remain_seq.scan(/[AU]/i).size ! return false if au_number < 5 return true From trevor at dev.open-bio.org Fri Feb 2 01:14:37 2007 From: trevor at dev.open-bio.org (Trevor Wennblom) Date: Fri, 02 Feb 2007 06:14:37 -0000 Subject: [BioRuby-cvs] bioruby/test/data/soft GDS100_partial.soft, NONE, 1.1 GSE3457_family_partial.soft, NONE, 1.1 Message-ID: <200702020614.l126EVjD012769@dev.open-bio.org> Update of /home/repository/bioruby/bioruby/test/data/soft In directory dev.open-bio.org:/tmp/cvs-serv12749/soft Added Files: GDS100_partial.soft GSE3457_family_partial.soft Log Message: Bio::SOFT data for unit test --- NEW FILE: GSE3457_family_partial.soft --- ^DATABASE = GeoMiame !Database_name = Gene Expression Omnibus (GEO) !Database_institute = NCBI NLM NIH !Database_web_link = http://www.ncbi.nlm.nih.gov/projects/geo !Database_email = geo at ncbi.nlm.nih.gov !Database_ref = Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6 ^SERIES = GSE3457 !Series_title = Poplar flowering and maturation GeneXp arrays !Series_geo_accession = GSE3457 !Series_status = Public on Oct 11 2006 !Series_submission_date = Oct 14 2005 !Series_last_update_date = Oct 17 2005 !Series_summary = To identify candidate genes involved in maturation and flowering, we conducted microarray expression studies using two poplar genotypes (Populus trichocarpa x P. deltoides hybrids) represented in continuous age gradients of one to six years. We designed 70-mers for 228 poplar genes and microarray studies were carried out using the microplate-based 96-well BioGridArray platform (GeneXP Biosciences). Floral buds, vegetative buds and shoot tips were collected at different seasonal time points from juvenile and adult trees and from both basal and upper branches of mature trees. !Series_overall_design = The experiment was carried out using the microplate-based 96-well BioGridArray platform (GeneXP Biosciences). Each of 228 oligonucletides were duplicated in each well. Two human genes, beta-actin and gapdh , were also printed on all arrays as negative controls. plus ten arabidopsis oligonucleotides selected by GeneXP and used to measure quality of hybridization. For each of 16 samples, two seperate RNA isolations were performed and were considered as biological replicates. Each biological replicate was labeled with Cy5, and hybridized to duplicated wells. !Series_type = Maturation and Flowering !Series_contributor = Jingyi,,Li !Series_contributor = Olga,,Shevchenko !Series_contributor = Ove,,Nilsson !Series_contributor = Steve,H,Strauss !Series_contributor = Amy,M,Brunner !Series_sample_id = GSM77557 !Series_sample_id = GSM77558 !Series_sample_id = GSM77559 !Series_sample_id = GSM77560 !Series_sample_id = GSM77561 !Series_sample_id = GSM77562 !Series_sample_id = GSM77563 !Series_sample_id = GSM77564 !Series_sample_id = GSM77565 !Series_sample_id = GSM77566 !Series_sample_id = GSM77567 !Series_sample_id = GSM77568 !Series_sample_id = GSM77569 !Series_sample_id = GSM77570 !Series_sample_id = GSM77571 !Series_sample_id = GSM77572 !Series_sample_id = GSM77573 !Series_sample_id = GSM77574 !Series_sample_id = GSM77575 !Series_sample_id = GSM77576 !Series_sample_id = GSM77577 !Series_sample_id = GSM77578 !Series_sample_id = GSM77579 !Series_sample_id = GSM77580 !Series_sample_id = GSM77581 !Series_sample_id = GSM77582 !Series_sample_id = GSM77583 !Series_sample_id = GSM77584 !Series_sample_id = GSM77585 !Series_sample_id = GSM77586 !Series_sample_id = GSM77587 !Series_sample_id = GSM77588 !Series_sample_id = GSM77589 !Series_sample_id = GSM77590 !Series_sample_id = GSM77591 !Series_sample_id = GSM77592 !Series_sample_id = GSM77593 !Series_sample_id = GSM77594 !Series_sample_id = GSM77595 !Series_sample_id = GSM77596 !Series_sample_id = GSM77597 !Series_sample_id = GSM77598 !Series_sample_id = GSM77599 !Series_sample_id = GSM77600 !Series_sample_id = GSM77601 !Series_sample_id = GSM77602 !Series_sample_id = GSM77603 !Series_sample_id = GSM77604 !Series_sample_id = GSM77605 !Series_sample_id = GSM77606 !Series_sample_id = GSM77607 !Series_sample_id = GSM77608 !Series_sample_id = GSM77609 !Series_sample_id = GSM77610 !Series_sample_id = GSM77611 !Series_sample_id = GSM77612 !Series_sample_id = GSM77613 !Series_sample_id = GSM77614 !Series_sample_id = GSM77615 !Series_sample_id = GSM77616 !Series_sample_id = GSM77617 !Series_sample_id = GSM77618 !Series_sample_id = GSM77619 !Series_sample_id = GSM77620 !Series_sample_id = GSM77621 !Series_sample_id = GSM77622 !Series_sample_id = GSM77623 !Series_sample_id = GSM77624 !Series_sample_id = GSM77625 !Series_sample_id = GSM77626 !Series_sample_id = GSM77627 !Series_sample_id = GSM77628 !Series_sample_id = GSM77629 !Series_sample_id = GSM77630 !Series_contact_name = Jingyi,,Li !Series_contact_email = JINGYI.LI at OREGONSTATE.EDU !Series_contact_phone = 541-737-8496 !Series_contact_institute = Oregon State University !Series_contact_address = !Series_contact_city = Corvallis !Series_contact_zip/postal_code = 97331 !Series_contact_country = USA !Series_platform_id = GPL2092 ^PLATFORM = GPL2092 !Platform_title = GeneXp BioGrid_poplar maturation !Platform_geo_accession = GPL2092 !Platform_status = Public on Dec 31 2005 !Platform_submission_date = May 17 2005 !Platform_last_update_date = Jun 16 2005 !Platform_technology = spotted oligonucleotide !Platform_distribution = non-commercial !Platform_organism = Populus !Platform_description = Single channel oligonucletide array for comparing gene expression among 16 tissue types to explore maturation and flowering in poplar !Platform_description = Keywords = poplar maturation !Platform_contributor = Jingyi,,Li !Platform_contributor = Olga,,Shevchenko !Platform_contributor = Steve,H,Strauss !Platform_contributor = Amy,M,Brunner !Platform_contact_name = Jingyi,,Li !Platform_contact_email = JINGYI.LI at OREGONSTATE.EDU !Platform_contact_phone = 541-737-8496 !Platform_contact_institute = Oregon State University !Platform_contact_address = !Platform_contact_city = Corvallis !Platform_contact_zip/postal_code = 97331 !Platform_contact_country = USA !Platform_data_row_count = 240 #ID = #GB_ACC = Gene bank accession number #SPOT_ID = #Function/Family = gene functions and family #ORGANISM = sequence sources #SEQUENCE = oligo sequence used !platform_table_begin ID GB_ACC SPOT_ID Function/Family ORGANISM SEQUENCE A001P54Um AI161490 TF, MADS-box P. tremula x P. tremuloides CATGGGTTATGTTTAGATTGTAAGCAATGATTGGTTACATAATCATGTGTGTTGCATAAGTAACAAACTT A003P34U AI161604 TF, Homeodomain(Knox class) P. tremula x P. tremuloides CATTAATCAAAGGAAGCGACATTGGAAACCATCTGAAGATATGCAATTCATGGTGATGGATGGCCTTCAT A009P50U AI161918 TF, NAC(no apical meristem) P. tremula x P. tremuloides AGAGCCCCAATGGGCAGAAAACTGACTGGATCATGCATGAATACCGGCTTGAATCCGATGAGATGGTCCT A010P29U AI161962 TF, MADS-box P. tremula x P. tremuloides ACCAAGACGCCACAAATATTACAAGACCGGCAAATTATCGAGGTGGAGACAGAATTGTTCATAGGTCCAC A031P05U AI163047 Transcriptional regulation, SNF2 subfamily P. tremula x P. tremuloides GTCATATATGATCCTGATCCGAATCCTAAGAATGAGGAACAGGCAGTTGCTAGAGCCCACCGGATTGGCA A039P68U AI163321 TF, flowering protein CONSTANS P. tremula x P. tremuloides AGAAAATTCGATATACTGTCCGTAAAGAGGTAGCACTTAGAATGCAACGGAATAAAGGGCAGTTCACCTC A047P36U AI163743 Polycomb transcriptional repressor P. tremula x P. tremuloides TTATTTATGATCAAACTGTGGAATCACGGACTACTTGATGCACGGACGATGAACATGTGTAATATGATTC A069P31U AI164824 TF, MADS-box P. tremula x P. tremuloides AGGAGTTGAACAATACCATTGTGTGATGAGTTAAAATATCTGTTGGAAGATTACTGTACCATATTGTAAT AF240445 AF240445 Ubiquitin P. tremula x P. tremuloides AGGCTTAGGGGAGGAACTATGATCAAGGTGAAGACTCTCACTGGAAAAGAAATTGAAATTGACATTGAAC B014P39U(UB21CPA06) BU821251 curlyleaf-like 1 homeotic protein; polycomb; set domain P. tremula TGCTGGACGCGAATGTGACCCAGATGTTTGTAGGAATTGCTGGGTTAGTTGCGGAGATGGCTCATTAGGA B016P21Um TF, MADS-box TF, MADS-box P. tremula CCAGTAGAATCTTGCGAGGAACAGATCTGCTATCGCTGGAAGATCGACTTATCCCTTGAGATACTGGTAT B020P33U Post-transc. regulation/ RNA-binding, C3H zincfinger Post-transc. regulation/ RNA-binding, C3H zincfinger P. tremula TATCAAACTATTGACTCCAGATTGTCTATGCTGGGAGTGGGACCGACCTTCTACCCTCAACGACCTGGAC C025P36U BI068662 Putative signal transduction, DENN domain, WD-40 repeat P. tremula x P. tremuloides CAGATCACAAGCTTTAGGGACACAAATGGATTCGGCAATAGAATGGTGGAGACCACTGATCTGGAGTGAT C025P42U BI068668 Transcriptional regulation, putative helicase P. tremula x P. tremuloides AAACCAGCTATTCCTGACCTGCCACCCACTGTATCAGCAATAGCTCAATCAGTTCGTGTGCTATATGGAG C036P25U BI069375 TF, salt-tolerance protein, CO P. tremula x P. tremuloides AAGACAGAGCCCTCTTTTGCCAGGATTGTGATGAACCAATCCATTCAGCTGGTAACCTTTCTGCGAATCA C054P45U BI071264 transcriptional. regulation, peroxiredoxin P. tremula x P. tremuloides AATCAGCTTCATTACATTGTGAGCGCGAGGAACAGATAGGAAGATGGGGTCCACAGACTGTCGGACCTAC C061P33U BI071641 Post-translational regulation, F-box protein P. tremula x P. tremuloides TATTGATGTTTGGGGGTTTGCTAAGAGAGGCCCCTTCGTTCCGCTCCAGCGATGTGTTACCATGGATCTA C067P63U BI072011 TF, GIA/RGA-like gibberellin response modulator P. tremula x P. tremuloides TCAGTGGAGAACTCGGTCGATTCGCTGGTTTGACCGGTTCATCTAGGGCGAATGCCTTAAACAAGCTACA C092P78U BI073104 reduced vernalization response 1 P. tremula x P. tremuloides ATGGGAAACAGTGGCCTGTTCGATGCCTTTACAGGGGAGGCAGAGCTAAATTTAGTCAGGGATGGTATGA F003P03Y BI119647 TF, MYB P. trichocarpa ATGAAGAGGACCTCATTATCAAGCTACATGCCCTCCTTGGAAATAGGTGGTCATTGATAGCAGGAAGATT F011P01Y BI120134 Transcriptional regulation, Bromodomain, WD-40 repeats P. trichocarpa AAGAAGCAGGCCCTTGGAAAATAATGAAGGGAAACATTAGGGCGGTCGAGTTCTGTAAGGTTGAAGCCCT F012P39Y BI120241 Transc. Reg.--Nucleosome/ chromatin assembly factor group B, CAF1 sbunit p150 P. trichocarpa TGATGGAACGCTTTCTAAAAAGAAGCAAAAGTAGTTCCCCATGTCAGAATGACCAGAGTTTAACTAAAGC F027P14Y BI121043 TF, Homeodomain-Leucine Zipper (HD-ZIP) P. trichocarpa ACCACCACCAACCCATCCACCACACACACACACACACATAGCACCACCAACTCTAAACCATTGTCACTAC F028P06Y BI121069 Transcriptional regulator, SET-domain P. trichocarpa TACCATACCTGTCACGTCTATCGTTATGCCTCCTGTTCATCTAAAACCTCCCCAATGTACTCACATATAA F044P04Y BI121667 RNA processing/post-transcriptional regulation, DEAD/DEAH box RNA helicase P. trichocarpa TGGTTTTGGGCAAACCGGCTCCTCTTGTTAGTACTTTCAGACTGAGCTACTATTCGATATTAAATCTAAT F052P94Y BI135499 Transcriptional regulation, zinc-finger helicase P. trichocarpa TCCTGAGGGAATGATGACACGGGCTTTGCATGGAAGCAGACCGTCAAAGTTTCAATCGCATCTGACAGAC F066P33Y BI136301 TF, MADS-box P. trichocarpa CGAGCAAGCACAATGGGAGCAGCAAAACCTTGGCCAGAACTCATCCTCTTTTATGCTACCACAAGCACAA F068P73Y BI136466 CYCLIN D P. trichocarpa GCTCGTCAAGAAGCTGTGGAGTGGATGCTTAAGGTCATTGCTCATCATGGATTTTCAGCTCTCACATCAA F070P70Y BI136615 TF, MYB P. trichocarpa GGTTCTCTCCCTCGGGTCTGTTTGGATGAACCCCGGTTCAAACTTTGTCATCTTCAACTAGCACCACAGT F093P10Y BI137760 transcriptional corepressor, regulates AGAMOUS P. trichocarpa AGCAGCAACAGCTTCAGCAGCACGTGCTTTCAAATCAGCAATCACAGAGTTCAAGTCACAATCTTCACCC F098P59Y BI138094 TF, homeodomain P. trichocarpa AGGAGATCCAAAGGCTGTCAGACCGTATTGATGGGGTTCCACTAATAGTCCTAGTTCATCCTTGTCGATG F099P36Y BI138136 Transcriptional regulation, p300/CBP acetyltransferase-related P. trichocarpa CATTCTAGGAATGCGCAGAATCCCCCTCATCCAGACCGACAGCATGACATGAGCTCATCATTGACCACAA F099P51Y BI138143 Signal transduction, ovule/fiber cell elongation P. trichocarpa GATTCATTGGGACACTCGCCCTGCTAATCTGTCCCATATTTACAAGTGGCTCAACTCTTGCAACCATTCT F100P70Y BI138195 RNA processing, post-transcriptional regulation, DEAD/DEAH box helicase carpel factory (CAF P. trichocarpa GAGATGCCTTCGTTATCATGGTTCGAGCGATAAATAGATCCATCGACATCGATAAGACCTCTGCATCCAG F101P21Y BI138212 SWI/SNF-related matrix-associated actin-dependent regulator P. trichocarpa AAATTGCAGAACATGTTGGAACCAAGTCAAAAGCACAATGCATCCTTCACTTTCTGCGTCTGCCTGTAGA F101P86Y BI138245 TF, C2H2 zinc-finger P. trichocarpa CTCTAAGCGTCCACGTCTCGACCACCAGCCTACTGAAGAAGAATATCTCGCTCTCTGTCTTGTCATGCTA F103P52Y BI138326 TF, MYB P. trichocarpa CACATGGTACAATGGGAGAGTGCTAGAGTTGAGGCTGAGGCCCGTTTGTCAAAGCAGTCATTGCTTATTA F103P87Y BI138344 Transcriptional regulation, histone deacetylase, plant specific HD2 type P. trichocarpa GGTTTTTCAGGCTTGGCAGCTTTATCCTTAGCGGTAGCAGCTTTCATAATATCAGCTTTCGCAAATTCAA F106P90Y BI138460 TF, auxin response factor P. trichocarpa TGTTGCGGGTGATGCGTTTATATTTCTAAGAGGTGAGAATGGAGAACTTCGAGTTGGTGTTAGACGTGCA F110P74Y BI138617 AMP-binding protein P. trichocarpa AGAACTTGAGTAGTGTAGAGGTTGAGTCAGTGCTATACACGTTTCCAGATATTAACGAGGCGGCGGTTGT F115P67Y BI138781 TF, homeodomain P. trichocarpa TCCACTTGTTCCTACTCGTGAAAGTTACTATGTCAGGTACTGTAAACAACATGCTGATGGGACTTGGGCT F117P40Y BI138846 Signal transduction, HPt phosphotransmitter P. trichocarpa GTGTGGATCGGTTACGAGCCGATATGAGCCGTTTGCTGGCAATACTATTCCACCAGGTTTGCTGTGTTAG F117P48Y BI138849 Signal transduction, receptor protein kinase P. trichocarpa CAAGCTCCACCTGCCCCACTCCCATCTGCGAAAGTCCCATGCTATATCGATGAGTATGCGAATATCAAGT F118P50Y BI138891 TF, squamosa-promoter binding protein (SPB) P. trichocarpa ACAAATGCTAATGTCACATTGTGTGACAACCATGCATGGTGTCAGGATTGCTAGCTGTGGCACTAGGCAT F119P13Y BI138915 Signal transduction, cryptochrome P. trichocarpa TTTTCCGTGGAATGACAATCAGGTCCATTTTAAGGCTTGGAGACAGGGGCGGACTGGTTACCCATTAGTT F119P74Y BI138950 nucleosome/ chromatin assembly, histone P. trichocarpa TTGCTAATGGCAAGCTTGTTAAGGTGAAGAACTCCTTCAAGCTCCCTCCTAAATCTCCCGCTGCTGGTGC F121P83Y BI139042 Transcriptional regualtion, chromomethylase P. trichocarpa TGTCGGGAAGCTATAAAGAACTTTGTCATGCATGGCTACCTGTCAAATATTCTACCATTACCCGGTGATG F128P16Y BI139280 SET domain P. trichocarpa TTTCGTGCAGCATACCTGTATCCACTTCTCAGCAACAAGTGGTAGGTACACTGTCTTGGCTAATCCCTCT F129P24Y BI139316 Transcriptional regualtion, chromomethylase P. trichocarpa GGCAAAAGCTATGCAAACGGTATGCGGTCAATGATGTAGGAAGGACACATAAGTCACGGTCAATGGCATC F131P79Y BI139444 TF, C2H2 zinc-finger P. trichocarpa ACAATGTTTGATACTTTCGGAGGACAAGGCATCCGTGTACCTCCTCCTTTCCCCTCAGATATAGCTCCTC G070P72Y BI128093 squamosa-promoter binding(SPB) P. tremula x P. tremuloides ATGGTTGCAACTCTGACCTCAGTACTTGCAGGGACTACCATAGGCGCCATAAGGTCTGTGAGCTTCATTC G074P09Y BI128315 Signal transduction, gigantea P. tremula x P. tremuloides GGAGACAGGTTGTTGACGCACTATGCAATGTTGTATCAGCATCACCAACAATAGCAGCCACAGCAGTTGT G095P48Y BI129777 TF, homeodomain P. tremula x P. tremuloides AGCATGCATGGAGGCCACAAAGGGGTCTGCCTGAAAGCTCTGTTTCAATTCTTCGTGCTTGGCTGTTTGA G105P48Y BI130427 TF, B3 DNA binding, PEST domains P. tremula x P. tremuloides AAGATACTATGCGGTTGACAAAGGGTTCTAACATTTCACAAGTTGCTAATGAATCAGCACGGAATGTAGG G126P33Y BI131829 TF, homeodomain P. tremula x P. tremuloides GTGCTGGGACCTCAGGGATAACAAAAGGTGAGACACCGAGGCTTAAGTTATTAGAGCAAAGTCTAAGACA G134P12Y BI132257 TF, MADS-box P. tremula x P. tremuloides AAAACTGAGCGAGCTTATCACTTTAACGGGGACGGAAGCTGCGTATCTCGTCTTTTCACCTGGGGGTAAG GA20-OX CAC00709 GA biosynthesis, gibberellin 20-oxidase P. tremula x P. tremuloides CGAGGAATACTTTCACAACAGAATGGGGGAAGATTTCGCTGAGTTCGGGACGGTGTATCAGGACTACTGT HB1 CAA09366 TF, Homeodomain P. tremula x P. tremuloides GAACTTACATTCACAAGGCTCATTAGGGCTTAGGACTATCGTTGTGGCATGCATTTTACTGATTGCCTAA HB2 CAA09367 TF, homeodomain P. tremula x P. tremuloides GGATCTTTTGTATGTGTTCATAGAGTATACAAATTTGCGGAGAAAAACCGATGGTATGTTAAGGGTGTGG I012P09P BI122720 TF, homeodomain P. tremula x P. tremuloides TGAGCTGTCCTATTTAGTGAGTATTGTGTTAGTTTATAAATTTTATCATGGCTGTGTCGGGTCTGTGAAT I017P76P BI123112 TF, MADS-box P. tremula x P. tremuloides CAACTGGAGCGACAGTTAAAGACAGGGGTTGAACGTATCCGCTGTAAGAAGAAACGAGCCATCTCAGAGC M101C08 BU867525 post-transcriptional regulation, E3 ubiquitin ligase, Skp1 P. trichocarpa AAGGAAAGGGGTTTAATCTATTTCTATAATTGCCTTTTTCTGTTGGACGTGGATTGATGTTAAGGTTTTA M101C11 BU867528 histone H1C P. trichocarpa CTACTGCTTAGATGTATAAATTTTGTACTAGCAGAACGGCAGTAGTTAGTTTCTGATGCTCTACGTTGGG M102E03 BU867630 putative LRP(lateral root primordia) 1 P. trichocarpa TTGGCTTAAATGCAGAAGGCGTGAACCCCACTTTTGTCCTAAATTCTACTACCATAAATGGCATGCCATT M102E09 BU867635 AP2 domain P. trichocarpa AGCTGCAAGGGCGTATGATGCTGAGGCGCGTAGAATTCGTGGCAAGAAAGCTAAGGTGAACTTTCCTGAT M103H01 BU867748 nucleosome/ chromatin assembly, histone H1 P. trichocarpa TTTAGGGCGTGTAGATGGGGGGTAGTGATTGTAAATTTGAAAGAAAAGGGAGGGTGCTAATGGTAGTTAG M104E08 BU867803 TF, MADS-box, YABBY P. trichocarpa GAATGACTTTAGCGTTACAGTTCGAGGAATGGCTGATCATGAACTTCCTAGGCCACCCGTTATCCACAGA M105A07 BU867841 Post-trasnlational regulation, HSP90; heat shock superfamily P. trichocarpa AACCACCAAGTCGGATGGTAAGTTGACATCACTTGATCAGTACATATCAAGAATGAAATCTGGGCAAAAG M111B12 BU868098 Post-translational regulation, E3 ubiquitin ligase subunit, SKP1 P. trichocarpa GCAAGAAACACGTTGAGACTCCAAAACCCGAGGATCGAGGAACTAACAGCGGCGATGATGAGCTTAAGAA M112C09 BU868189 TF, MADS-box P. trichocarpa AATGATGATCCCGAAAACCATGGTAGCTGGACTTTGGAATATGCGAAGCTCAAAGCTCGGGTAGATGTTC M116D03 BU868480 TF, MYB P. trichocarpa ATCATCGTCTGCTCCCCTTGAACCTGGATATGTCTTGAGGCCTGATTCGTCTTCAATACCTATGAACCCC M116E04 BU868491 TF, NAC P. trichocarpa AAACTTTAATGGGTTATTACAACTATAAGAAGTGTGCATGAGTTTTTAGACTTTGAGCTAGAATTGCGCA M118F07 BU868664 TF, MYB P. trichocarpa AGAATTCTGTACCAACACTAGATATTCTCAAAAAGGCTAGCCCTTTCAGGGAGTTCGTATCTTCACCGAA M120B06 BU868703 Ubiquitin P. trichocarpa AGAGCTAATCTACTAGGGCATGCGGTGGTAGTAGGGTCATAGGATTGTTGGCAGTGAACATATCTATTCG M122B12 BU868794 translation initiation, eIF-5A P. trichocarpa CTGGGTTTTTTTTATTGTTAGTGTTTTCTAGTTCTCTTGATCCATCGCCGCCATGTCTGATGAGGAGCAT M124B09 BU868951 TF, 1B3 DNA binding, PEST domains P. trichocarpa GCTAATGTTTCACAAGTGGCCAATGAATCGGCACGAAATGTATTTGCTCAATACAACGAGCATAAGAATT M125D02 BU869042 TF, homeodomain P. trichocarpa AAGTCTAAGCAACTCGAAAGAGACTACAGCATGCTACGAGCTAATTACAACAGCTTGGCTTCCCGGTTTG M127F08 BU869233 translation elongation factor eEF1Balpha P. trichocarpa ATGGGATGATGAGACAGACATGGTGGCGTTGGAGAAGGCAGTTAGGAGTATTGAGATGCCCGGTCTCTTT M129E09 BU869391 TF, MADS box P. trichocarpa TCCAGGATGGATGCTTTGAGTTTCGTGCTCTTCATTGCTCATAAAGGAACACCTACTATGTAACTTTCTC PCEN-L Signal transduction, PBP Signal transduction, PBP P. trichocarpa GTCATGACAGACCCTGATGTTCCTGGTCCTAGTGATCCATACCTCAGGGAGCACCTACACTGGATAGTAA PHYA AF024544 Signal transduction (red light receptor), Phytochrome P. trichocarpa AGAACTTGAAGCAGTGACTAGTGAGATGGTCCGTTTAATTGAAACAGCTACAGTGCCAATTTTGGCAGTT PHYB1 AF024545 Signal transduction, Phytochrome P. trichocarpa GCATATGGAGTTCAAGTATGCTCTCCTCAACTCTTTTGCATGTCTTCCTCCTGAATTAGTTCAAGACATG PHYB2 AF024546 Signal transduction, Phytochrome P. trichocarpa ACAGATATTGAAGATCATACGAGACATTGATCTTGAGAGCATTGAAAATGGTTCACTGGAGCTTGAGAAG PMFT Signal transduction, PBP, Phosphatidylethanolamine-binding Signal transduction, PBP, Phosphatidylethanolamine-binding P. trichocarpa TCATTTCAACACTCGACTCTATGCTGCTCATTTGGACCTGGGCCTGCCTGTTGCCACCGTCTACTTCAAT PTAG1 AAC06237 TF, MADS-box, AGAMOUS homolog P. trichocarpa GCTACATGTATGCTAAAAAACCTGAAGTAGCGTAAATCATATTTGTCTGGGTGGGAGGGCCTAGTACTCT PTAG2 AAC06238 TF, MADS-box, AGAMOUS homolog P. trichocarpa CAACCATTTGACTCTCGGAACTATTCTCAAGTTAATGGATTGCCGCCTGCCAATCATTACCCTCATGAAG PTAP1-1B AY615964 TF, MADS-box P. trichocarpa TGCTAAAAATGTAGTTTTTGGTTCGTTATGAAATTAGATTATATATATATACGCACCTTGTTATAACTAA PTAP1-2A AY615966 TF, MADS-box P. trichocarpa TGTTGTTGTTAAAAGTTGTATCTGAATCAATTAAGAAGACTCCTACAGCTATATAATTTTCATAATATAT PTB2 AAG45501 TF, teosinte-branched-like P. trichocarpa AATTTCATGACCACCCCGCATGCCCTAGAACCAAACTTAAGTACAATGATCATGACAACATTAAACGCCC PTBF1 AF288616 TF, leucine zipper P. trichocarpa x P. deltoides TCTTCCCACTAAAGACGCTGGGATGTTGGGACAGATAAATGCGAGTGAAATAGCATTTTCTAGTCTTTTT PTCO11 TF, CO(C2C2 zinc-finger, B-box) TF, CO(C2C2 zinc-finger, B-box) P. trichocarpa AAGGTTCGCTAAACGTACAGATACTGAAGTCGAGGTTGATCGAAGCAGTCTTTATGGATTCGGTGTCGTT PTCO12 TF, CO TF, CO P. trichocarpa AATGTTGTTGTATATAATTAAGGTGGAAGCCTTGAATTTGTACACGTTTTTATGCAGTAATGAGTTTTGT PTCRY1D Signal transduction (blue light receptor), cryptochrome Signal transduction (blue light receptor), cryptochrome P. trichocarpa GAGGGTTACAAATTTGACCTAAATGGAGAATATGTACGCCGGTGGCTTCCTGAACTTGCTAGGCTACCAA PTD AAC13695 TF, MADS-box P. trichocarpa GAGGTCGACCTTCCAGCTCTTCAGACATCTTATCTAAATGCGTGTGCTAACTAGAGATGCTATCTAATAT PTID1L1A TF, C2H2 zinc-finger TF, C2H2 zinc-finger P. trichocarpa TATGTTTGTCCAGAACCTTCATGTGTCCATCACAATCCGGCTCGAGCATTAGGCGATCTTACAGGGATTA PTID1L3 TF, C2H2 zinc-finger TF, C2H2 zinc-finger P. trichocarpa ATCTATGCCGTTCAATCAGATTGGAAGGCTCACTCTAAAACCTGTGGAACAAGAGAGTATAGATGTGACT PTID1L4 TF, C2H2 zinc-finger TF, C2H2 zinc-finger P. trichocarpa GTTCAATCAGACTGGAAAGCTCACTCTAAAATTTGTGGCACAAGAGAGTATAGATGTGATTGCGGTACTC PTIR1 AF139835 Post-translational regulation, F-box P. tremula x P. tremuloides CCTTGAAAACGTCTTAGAAAACGTTCTCTGGTTCCTAACCTCACGTAAGGACCGAAACGCTGCGTCATTG PTLF O04064 TF, unique P. trichocarpa AGGCAATTGCTCTCTGGTGATAATAATACAAATACTCTTGATGCTCTCTCCCAAGAAGGTTTCTCTGAGG PTPGM Starch metabolism, phospho-glucomutase Starch metabolism, phospho-glucomutase P. tremula x P. tremuloides TTTTCTTTTTGTCGCCTTACCAAAAAAGGCAGGAGTACGATTTACTAAAACACGCCGATCCAAAGTTTTG PttGA2-OX P. tremula x P. alba P. tremula x P. alba CAGCGAGAGACTAGTAGCTTGGGGGGGGGGGGTAATGGTAGCACTGTAGTTTAGCCGTTAGTGTAAAATT PttIAA1 AF373100 Signal transduction, AUX/IAA gene family P. tremula x P. tremuloides TATTGTCTTGCTTAATAATGACCATCATTATTGTTTCTAGCTGGCTAGGTTGTCGAGAGCGTGTTCTGTC PttIAA2 CAC84706 Signal transduction, AUX/IAA P. tremula x P. tremuloides TTGGGAGTGCAACTGCAATTCTATGCGTCGAGAGTCTGGATCGTTTCCTGTTTCGCACAGGACTTCAGTT PttIAA3 CAC84707 Signal transduction,aux/IAA P. tremula x P. tremuloides TGTTGAGGATGATAGAACAAAAGTTGGTCTTTTGTTGTAAATTAAGGATTTTCAGAGTTCATCAAAAAAA PttIAA4 CAC84708 Signal transduction,AUX/IAA P. tremula x P. tremuloides TTGACACATATATAATATGGCGAGTCGAAAATAAATAGGTAGTGGATAGCTAGGTAAACTCTATATCAAG PttIAA5 CAC84709 Signal transduction,AUX/IAA P. tremula x P. tremuloides AAAGTAATTAACGGTCCTCAGCGGCTTTGTGTTGGATTTTGGTTGCTGTATGGTCTTATTATACTATTTG PttIAA6 CAC84710 Signal transduction, AUX/IAA P. tremula x P. tremuloides GCCTTGCATCCATGTATGAAGACTAGCAGGCAAGGCACTTGCGCAACATGGATGGATCAGTAGTGGTGTT PTTPIN1 AF190881 Signal transduction, polar auxin efflux carrier, PIN1 P. tremula x P. tremuloides AGAAAAACACCTATGATATTGGAATCCATGGAGACCCTATTTAGGCTACTAGGTAGCGCATGGAAAAGTT PTTPIN2 AF515435 Signal tranduction, auxin efflux carrier, PIN1 P. tremula x P. tremuloides GAGCTCCGACGAGCATGGCATCGCAGGAGCTGATGAGCAACAATTAGTTATTACAGTAGTAGTACCTAAC PTTPIN3 AF515434 Signal transduction, auxin efflux carrier, PIN1 P. tremula x P. tremuloides TGCTGGTCGTGTGTCACATCTGGCAGTAGCATTGATTACTGCGCCAAAATATATGTTCTTATAACAAGAG R01B05 CA821929 Transcriptional regluation, DNA (cytosine-5-)-methyltransferase P. trichocarpa x P. deltoides TTCAGACCAGATGATATTTCACCTGAAAAGGCATATTGTTCTGATATTCCGTGAGATATATTATAGTGAA R02H01 CA822027 ELONGATION FACTOR 1-ALPHA P. trichocarpa x P. deltoides GTTTGGAACGGTCCCAATTGGTCATGTGGAACTGGTGCATCAAGCCTGGACCAATTGGAAATTTCAGGCC R07C07 CA822366 TF, chitin-inducible gibberellin-responsive protein; GRAS protein/scarecrow-like P. trichocarpa x P. deltoides AGAGTCATCAGGCGCTAATATTTATCGTACCCTTAAGTGCAGGGAGCCTGAAGGCAAGGACTTGCTGTCT R08A10 CA822419 TF, AP2 P. trichocarpa x P. deltoides AGAGAAGTGAATTTGAAACGGAAATGGGGAAAGACAATGAGTTCTTGGATAATATTGTAGACGAAGAGTT R15C07 CA822886 TF, GRAS/SCARECROW P. trichocarpa x P. deltoides CAATGAGTGGAAACTCGATGGCTCAAGCACAACTTATATTGAACATGTTCCCTCCTGCTCATGGCTATAA R22G04 CA823228 Argonaute (AGO1)-like protein P. trichocarpa x P. deltoides TTTTCAGCAGATGATCTGCAGGAACCTGTGCATTCCCTCTCATATGTATACCAAAGAAGCACGACTGCCA R22G10 CA823232 FPF1 P. trichocarpa x P. deltoides AGAACCGTAATATGTTTGAAGTAAGGGATATGTAGTACGTTGATTACGTACGTCCTCATATATAGTCCTT R24E07 CA823338 TF, GRAS/Scarecrow P. trichocarpa x P. deltoides TGATCTATGATGCTACCTAGCTCGAGAGGAACCTTATGGAGTTTTAGACTTGCAGTTGGTAACTACCATC R26F09 CA823471 TF, AP2 P. trichocarpa x P. deltoides GGAAAAATCTATACAGAGGTATAAGGGCAACGACCTTGGGGTAAATGGGCAGCTGAGATTCGTGACCCAA R29F11 CA823676 FPF1 P. trichocarpa x P. deltoides AGTGAGGGATATGTAGTGCGTTAAGTACTCATATATAGCCCTTTATTCATGTTTGTCTGCATTTTAGTCC R33C03 CA823904 polyubiquitin P. trichocarpa x P. deltoides CTCCGTCTTCGTGGAGGCATGCAGATATTTGTCAAGACCTTAACAGGGAGGACCATTACTCTAGAGGTGG R34B09 CA823967 TF, homeodomain P. trichocarpa x P. deltoides ACAATCTCTACAAAGTTTGACTGGCGTATCTCCTGGGGAAGGCACCGGTGCAACTATGTCTGATGACGAA R34G04 CA824001 Actin P. trichocarpa x P. deltoides TTATGGCCGGGGACAGCGAATGAAGAAAGAAACACAAAGAACAATTACAGTTATTCTGAACGGTGAGAGG R35H10 CA824066 TF, GRAS/Scarecrow P. trichocarpa x P. deltoides TGGAGGTAGGATATACTATATAGTTGTATTAATTACATATACTTTTCATAGGTGGGGATGGTGCATTACC R43C04 CA824489 Transcriptional regualtion, WD-40 repeat P. trichocarpa x P. deltoides GATCATGTGTATGCCTCTTGTTCTGTGGATGGGCATATTGCAATATGGGATGCGCGTCTGGGGAAGTCAC R43G01 CA824511 TF, AP2 P. trichocarpa x P. deltoides AAGGCGATGGGGCGGAAAGTTTACAGGGAGTTTCGAGTGGGGTATGTTATCAAACATCTGGTGTGTGGAC R46E01 CA824677 TF, GRAS P. trichocarpa x P. deltoides ATTCAATATGCTGATTCGAGATATGATGCGTGATCTAGTGAAGCAGGTGGGCAGTGGACTGTCTTCCAAG R48C03 CA824775 Argonaute (AGO1)-like protein P. trichocarpa x P. deltoides AAGGCGATACGAGAGGCATGTGGCACCCTGGAAGAAGGATATAAGTGCCTCGGGTTACCTTTGTGGTATT R49E04 CA824857 Post-transcriptional regulation/ RNA-binding, CCHC zinc fingern P. trichocarpa x P. deltoides TGATCAATTTGTACATAAGGTGGAGCAAGTTGCCGCTACGAAACGTGCGAAGATGTGTGTACGAGAATTG R50C10 CA824915 Transcriptional regulation. nucleosome/ chromatin assembly factor group C, WD-40 repeat P. trichocarpa x P. deltoides TTTCTCTATGACTTCGTTATCTCTCACCCTCTCGAGTGGCCATCTCTAACCGTCCAATGGGTACCTCTCG R51DF126P TF, Bzip TF, Bzip P. trichocarpa x P. deltoides ATCCTGATGATATTGTCTCCAAGAAACGGAGAAGGCAGTTGAGAAATAAGGACGCGGCAGTGAGATCAAG R54A05 CA825137 TF, C2H2 zinc finger P. trichocarpa x P. deltoides ACCAAACTACTTCCTGTACAACTACTTCTGCCACGACAACACCCGTGTCTAACGGAAGTGGCAGGGTTCA R56B07 CA825263 Translation initiation, eIF3p40 P. trichocarpa x P. deltoides TTGTTTTCAAACAGTGGAATTGATCGAGGCATTTATGAATTACCAGGAAAATATTAGTACGGTGTGTTTG R59E12 CA825474 cyclophilin P. trichocarpa x P. deltoides GAATTTCATAAAGAAACATACTGGGCCTGGAATTCTATCTATGGCAAATTCTGGGCCTGGCACTAATGGG R59F10 CA825478 TF, CONSTANS P. trichocarpa x P. deltoides ACAACCTATATAACTCTCCGAGCTCTGTCCCTTTCATGGCCGATACCCAATACGGTGTCGTTCCCTCGTT R63D08 CA825614 Translation initiation, eIF-4b P. trichocarpa x P. deltoides TTCTCCGTTATAATTTTGCGAGTTTTGCCAGGACTCTTGCTATAGTAGAACAGTGTTGAGACAATTTTGG R65B04 CA825708 TF, NAC-domain P. trichocarpa x P. deltoides TACAACATCCGGGTACTGGAAGGCCACAGGCTCTCCTGGTTATGTTTACTCGTCGGACAATCGTGTGATT R67C05 CA825769 TF, AP2 P. trichocarpa x P. deltoides ATTGACGGAGAGTACTGGGTCAGGTGGATCTTCGCCTTTGTCGGATCTGACGTTTCCGGATTTTGAGGAA R69F12 CA825916 TF, AP2 P. trichocarpa x P. deltoides AATAGATACGGGACATGCCATTTTTTGATATGGCAATGAGTACGAGTACGAGTAATCACCCCACAGAGTA R70F11 CA825986 Post-transcriptional regulation/ RNA-binding, zinc finger P. trichocarpa x P. deltoides TGCATCAAGCTTTGTAGTGTTCTAGGATCAACAAAGCCTAAGACTTTTAAACTTTCTCATCAAAACATGG R71A05 CA826000 FPF1 P. trichocarpa x P. deltoides TAATTTCCCAGTGTGTAGGAATAATAATTGGAACAAGGTTCAGGTCGTTCCTTCGTTGGGTATTTACTAA R73H10 CA826180 transcriptional regulation, histone acetyltransferas P. trichocarpa x P. deltoides TGTTGGGTGTTTACTGCGGTGTATGCGTTTTTATCATTACCCCGACAGCACACGTATTGCGGCTCAGTCA R74C06 CA826202 TF, homeodomain P. trichocarpa x P. deltoides AAGAAGAGAGGCATTGTCTCTTTGTACTCTATTTTCTGACTTGGAACCAAAGCTCCTTATCACTCTAGAA R74E10 CA826218 TF, AP2 P. trichocarpa x P. deltoides GATGTGGGATGGGCCGTTTTTGGATATGTTAATGAATACGGGTACGTGTAATCACTCCACGGAATATGGG R-AP2 TF, AP2 TF, AP2 P. trichocarpa x P. deltoides TGTAAATAATAAGGCTACATGTTAGGGAGTTTCATCTCTACCAAGATATTGGTTTACCTCTATTATGAAG UA13CPF12 BU817168 Starch metabolism, pyruvate phosphate dikinase, PEP/pyruvate binding domain P. tremula AACTTAACAGAAGGCAGTCCTTCACCTATAAAGTTGGTCAGAAAGGAGTTCAGTGGCAGATATGCCATAT UA35CPA11 BU818819 TF, GRAS P. tremula ATTCTTCAGATAACTTCTATGAGACCTGCCCTTATATGAAATTCGCTCACTTCACGGCCAATCAAGCAAT UA35CPG02 BU818875 Polycomb P. tremula TGCGCGTCATCAATGCCAGCAATGAAGAGATACACAAGAGTGGTGTAGGGCATGGGGACTCGATAAATGA UA52DPC04 BU820187 TF, C2H2 zinc finger P. tremula CGTGTCTATGTGTGTCCAGAGTCATCTTGTGTACATCACAACCCAGTTAGAGCTCTCGGGGACCTTACTG UA52DPD03 BU820198 TF, C2H2 zinc finger P. tremula GAAGGTCTATATATGCCCAGAAAAGACCTGCGTGCACCACGATTCATCTAGAGCTCTCGGAGACTTAACT UB10CPB06 BU820432 Signal transduction, LRR protein kinase P. tremula GATTCAGACCTTGGGCAGGATTAGGCACCGACACATTGTTAGATTGTTGGGGTTCTGCTCTAACCACGAG UB10CPB07 BU820433 Transcriptional co-regulator, LIM-domain binding P. tremula ATGGTATGGCTAATGTAAATAACTCACTCAACACTGCATCTGCAACTACCTATGCCAGCGCCCGAGAAAC UB10CPF10 BU820482 Transcriptional regualtion, ploycomb group; VEF P. tremula TTCATCGTTGTCTCATATCATTCGGTTGAGGGCAGGAAATGTGATTTTCAACTATAGGTATTACAATAAT UB11CPH11 BU820600 TF, AP2 P. tremula GCTGCCCTCAAGTACTGGGGACCTTCAACCCATATAAATTTTCCGTTAGAAAATTACCCGGAAGAACTTG UB18CPG04 BU821074 TF, MADS-box P. tremula CAAACTCAAGCATGGGGCAAGTGATTGAAAGGCGCAATCTGCATCCAAAGAACATCGACACGCTCGATCA UB27CP09(F131P66Y) BI139437 unknown P. trichocarpa AATGAAACACCGTGGGGAAACAAACTTTTACTTGTGTGAAATCAATCGCAATATGGTAATTGATGCTACT UB28CPA08 BU821799 Signal transduction, pseudo-response regulator P. tremula ATCTTGTTTTAACTGAGGTGGCCATGCCTTGTTTATCAGGCATTGGCCTTTTAAGCAAGATTATGAGCCA UB28CPB01 BU821803 TF, auxin response factor(ARF) P. tremula AAGTTAGTTGCGGGTGATGCATTCATCTTCCTAAGGGGAGAAAATGGCGAGCTTCGTGTGGGAGTAAGGA UB36DPH07 BU822399 Transcriptional reglation, p300/CBP acetyltransferase P. tremula CTTCATATCTACCGGTGAATGTAAGGCAAAGGTCACAGCGGCTAGGCTACCCTACTTTGATGGGGATTAT UB53CPD11 BU823521 Signal transduction, Ser/Thr protein kinase P. tremula TTTGCGTGAGAGAGACCGCTATGAACTGGAAAAGGGACGGCTTATACGTGAATTGAAAAGGATACGAGAT UB53CPE02 BU823524 Transcriptional regulation, nucleosome/ chromatin assembly factor group C, WD-40 repeat P. tremula TAAGATAGTGGCCACTCATACTGACAGCCCTGATGTTCTTATATGGGATGTCGAAGCACAGCCTAACCGC UB60BPD08 BU824105 TF, squamosa-promoter binding (SPB) P. tremula AGCAGATAATTGCACCTCTGATCTGACTGATGCCAAGCGATACCATAGACGCCATAAGGTTTGTGAGTTC UM37TC05 BU879772 Transcriptional regulation, N-acetyatranferase, silencing group B P. trichocarpa GAATCTACCGAATGTCACGGTCATATAACTTCTCTAGCTGTCCTCCGTACTCATCGTAAGCTTGGCCTCG UM42TF11 BU880195 TF, AP2 P. trichocarpa ACGTGCCTACGATACTGCCGCACGTGAGTTCCGTGGCTCTAAGGCAAAGACTAACTTTCCATATCCATCA UM43TE12 BU880261 TF, CONSTANS P. trichocarpa GCTGCCTTGTTATGCAAAGCAGATGCGGCATCTCTGTGTACTGCCTGTGATGCAGATATTCACTCTGCAA UM44TA01 BU880290 TF, homeodomain leucine zipper P. trichocarpa GATGGGGTACATTCCTCACTCTTAGAGGCAGGTGATACTTCACATGTCTTCGAGCCCGACCAATCGGATT UM53TE12 BU880682 Translation initiation, eIF-6a P. trichocarpa AAATGGGCTTCTTGTGCCTCACACCACCACTGATCAAGAGCTCCAGCATTTGAGAAACAGCCTACCTGAT UM54TA09 BU880731 Translation inititation, elongation factor 2 (EF-2). P. trichocarpa TCATCAAGTCTGACCCTGTTGTGTCGTTCCGTGAGACTGTCATAGATAAGTCCTGCCGTGTGGTGATGAG UM54TC12 BU880748 TF, NAC P. trichocarpa AAGCACTTGTATTTTACGCCGGCAAAGCTCCCAGAGGAATCAAAACCAATTGGATCATGCACGAATACCG UM54TF05 BU880770 ATP synthase beta chain, mitochondrial precursor P. trichocarpa GTTCTTAACACTGGATCTCCAATTACTGTGCCCGTGGGCAGGGCCACTCTTGGTCGCATAATCAATGTCA UM57TC10 BU880985 Signal transduction, guanine nucleotide-binding protein beta subunit 2. P. trichocarpa GATTTGGGCTTTTGGAGGGCACAGGCAGGTAATCTGATTCGAGCAGAAGGATCGAATCACATGTCTCATT UM61TC08 BU881322 Transcriptioanl regulation, WD-40 repeat, MSI type nucleosome/chromatin assembly factor C P. trichocarpa TGAATAGGGCACGGTATATACCACAAAACCCATTTATGATAGCTACCAAGACTGTTAGTGCTGAGGTATA UM62TB07 BU881396 Transcriptional regulation, histone deacetylase P. trichocarpa TGCTATTTCTACGATCCAGAAGTCGGCAATTACTATTATGGCCAAGGTCACCCCATGAAGCCCCACCGCA UM65TE06 BU881637 TF, AP2 P. trichocarpa TAAGGGGTCAGTCAGTTTTAGATTCTAAGTACTATTAATTATGCTGTCGATATGTATAGTAAGTCGCTCT UM66TB05 BU881681 Transcriptioanl regulation, PHD-type zinc finger P. trichocarpa CTTTAACGTTTTAAAGTTGATCAGAGCCAGTTGCCTACTTTAGTCAATGAATTCGAATGACTGCAGATTG UM67TB05 BU881759 translation initiation, eIF-1A P. trichocarpa CGGCGGGGCCTGATTGATTTTCTTTTTCTATCTATCTATCTATCAGCTTCCTCGCTCCTCTCTCACCTTA UM67TE05 BU881786 TF, homeobox-leucine zipper P. trichocarpa GCTATTTGGTTTCAAAACAGGAGGGCTAGATGGAAGACTAAGCAGTTAGAGAAAGACTACGAGGTCTTAA UM69TD03 BU881923 TF, MYB P. trichocarpa AAGTGTCAGGAATTGAATCTTGAGCTGAGGATATGCCCTCCCTATCAGCACCCAACTCAGTCAATGGAGA UM69TF07 BU881946 TF, NAC (no apical meristem) P. trichocarpa CTCCACGAGGGAGCAAAACGGATTGGGTCATGAATGAGTACAGATTGCCTAGCAACTGCTATTTATCGAA UM77TC04 BU882460 Post-transcriptioal regulation/ RNA-binding, C3H zinc finger P. trichocarpa TGATGAGCCTGATGTATCTTGGGTTAATACATTGGTTAAAGATGTCCCCCCTGCTGGAAGCACATTTTTT UM82TH11 BU882839 TF, MYB P. trichocarpa AAGCTGATTCTTTCGGCTCAGGAAGTGGCCATTCTAAGGGTGCTGCCCATATAAGCCACATGGCTCAATG UM83TC03 BU882863 TF, AP2 P. trichocarpa CTCTAGATATCTTCTAAATGTACAGACACTCGGATGGCACAATGCATGGACTGTGGACTTCATGACTCCC UM83TF04 BU882889 TF, MADS-box P. trichocarpa AATGCTACAGAATTCTAACAGGCACTTAATGGGCGATGCTGTAAGTAATTTATCTGTGAAAGAGCTTAAG UM89TG10 BU883381 TF, MADS-box P. trichocarpa ATGTATTTTCTAGATATTCTATGTTTATTTCGCTAGCAGAGACGTTTATTATCCTCTTATGTCTAACATT UM91TD06 BU883487 TF, AP2 P. trichocarpa TGGAGAAGTATCCTTCAGTTGAGATTGACTGGTCATCTATCTAAGTTCTAAATTATGATTATGTAATCTT UM93TD04 BU883572 TF, MYB P. trichocarpa CAATTAAATAGTACTGTACAACAGCTACAGTTTATACGATTTTCTTAGACATGAGGCAGGAATTCAGTTC V001E09 BU875027 cyclophilin; peptidyl-prolyl cis-trans isomerase P. trichocarpa TGTTGCTGACTGTGGTCAACTCTCTTAGAGTCCCTTGGTTGACATGTCGTTCGGGTGGTGTCTTTGTTTC V001G07 BU875049 nucleosome/ chromatin assembly, histone 3 P. trichocarpa TAGATATTTCTGGGTAGATGGACAACTCTTATCTCTGTTTGTATCTTCTAGGTATCATAAGTCTATTTCC V002G11 BU875143 S-adenosylmethionine synthetase P. trichocarpa GACAAGAAGAGGAACATCATTTTCTTTCAAGCAGAGCAGCAACTCTACTCTTTCTCCCTAATCTCTCAAG V003A12 BU875165 TF, MADS-box P. trichocarpa AGTATCCACAGGCAAGTTGGGGATTCAAACTTCGAGGAGCTGACCTTAAGCGACCTAGAACAAACGGAGA V006H03 BU875423 Polycomb transcriptional repressor, enhancer of polycomb-like protein P. trichocarpa CAGCTGTAACCGTGAAGCAAGAGTTTAGACGGCGGCATACACCACTTGGATGGCTCAATAAAATGGACCC V006H09 BU875429 nucleosome/ chromatin assembly, histone 2A P. trichocarpa CTCACATTTCGGTTCGACTATTTGTTCGAAAAGGGGCAATCAATGGCTGGCAGAGGCAAAACCCTAGGAT V007C11 BU875452 TF, MADS-box P. trichocarpa CTTACGGCCGGGGACTCCTTTAAACTTCTAACTTTCTCTTTCTTCAAACTTTTGTTGTTCTCTCTATTAT V007E07 BU875471 TF, PHD zinc finger P. trichocarpa GCTCCCCACAATATTCGAGGCCGTGTCTGGAAATGTTAAGCAACCTAAGGACCAAACTGCCACTCACAAC V008A10 BU875511 Transcriptional regulation, nucleosome assembly factor group A, NAP1 P. trichocarpa GCTACAGAGTTTGACTGGACAGCACTCTGAATTGCTCGAGAACCTATCTCCGACTGTTAGGAAGCGTGTT V008B11 BU875524 Post-translational regulation,ubiquitin activating enzyme, ThiF P. trichocarpa ACCAAATACGATCGCCAACTCAGTTGGCGGAAGACTCGATGATAAAGCTCGATAAAATCTGCAGGGAGGC V009A10 BU875600 tubulin beta-6 chain P. trichocarpa CTATGGACAGTATCAGGACCGGTCCATATGGGCAGATTTTCCGGCCTGATAACTTCGTTTTTGGGCAATC V009B10 BU875611 Transcriptional regulation, histone deacetylase HD2 P. trichocarpa ATGATGAATCTGACGATGACGATTCTGATGACGATTCTGATGAGGATGATTCAGGCGATGGATCCGAGGG V009G10 BU875666 TF, MADS-box P. trichocarpa GCAACACAAACAAGCAGACAAGCGAACTGAACATGGAGCAACTGAAGGGCGAAGCAGCTAGCATGATAAA V012F11 BU875887 TF, MYB P. trichocarpa GCTCATGCCAAGTATGGTAATAAATGGGCTACCATAGCAAGACTCCTCGATGGACGTACGGACAACGCAA V012H04 BU875916 Transcriptional regulation, arginine methyltransferase P. trichocarpa AAACCAGCGCCGATTATTACTTCGATTCTTACTCTCACTTTGGTATTCATGAACAAATGCTGAACGATGT V012H06 BU875918 TF, homeodomain P. trichocarpa CAAGACAAGTCGCTGTTTGGTTCCAAAACCGCCGTGCCCGGTGGAAAACCAAGCAATTGGAGAGAGATTA V015E04 BU876053 Transcriptional regulation, arginine methyltransferase P. trichocarpa TGGTGGGCTGACATCGATGCTCAAACTGCTACCTGTTAGCAGGATGTATTTGGAAACCTGCATCTATTTC V016C11 BU876112 TF, MYB P. trichocarpa GCAAAAGTTGCAGGCTTAGATGGACTAACTACCTCAGACCAGGAATTAAGCGAGGCAACTTCACACCCCA V016F11 BU876142 TF, SEP3-related MADS-box P. trichocarpa AGAAAGGTTGATGGAAGGTTACGAAGTAAATTCACTCCAGTTGAATCTAAGTGCAGAAGATGTGGGTTTT V017G04 BU876211 TF, AP2 P. trichocarpa CAGTGATACAACCGTTGGATCTTAATCTCGGTCCTGCTGTATCCACCGTGAGATTGCCGTTTCAGCCGAT V020F08 BU876433 Transcriptional regulation, histone deacetylase P. trichocarpa TGTTGTTGAGAGAATTGACTAGTCTAATGTGCTTGACCTTGTGAAGTCTGGGGCATGACTCGACATGAAT V021F11 BU876515 TF, MADS-box ; AGL20 P. trichocarpa AGCTCTATGAATTTGCAAGCACAAGCATGCAGGAGACCATTGAACGTTATCGAAGGCACGTGAAAGAAAA V025A02 BU876760 Transcriptional regulation, SNF5 P. trichocarpa CAATCCATACAGACACAATTGGCCGAGTTTCGATCCTATGAAGGTCAAGATATGCTGTACACTGGAGACA V025E01 BU876802 Transcriptional regulation, DEMETER; DNA Glycosylase Domain P. trichocarpa AGAGCACCCCGACCTCTCAAGGCCAGATTACACTTTCCAGTAAGTAGGTTGGTAAAGACAAAGAACGAGA V031H01 BU877253 Signal transduction, response regulator P. trichocarpa CATTGAAATTAACATGATCATTACAGATTACTGTATGCCAGGAATGACAGGCTACGATCTCCTAAAAAAG V032H12 BU877347 Alpha-3 tubulin P. trichocarpa TGGTTTGGGGTCTTTGCTGTTAGAACGCTTGTCTGTTGATTACGGAAAGAAGTTAAAGCTTGGATTCACC V037B10 BU877632 Transcriptional regualtionm PHD zinc finger P. trichocarpa AGGAAAAGGCTGTTCAGCCTGATCAATGATCTGCCTACTGTCTTTGAAGTTGTAACAGAAAGGAAGCCTG V037D09 BU877646 TF, C2H2 zinc finger P. trichocarpa GCAAGCCACCCGCCGCCTGGCTTTAGCTTCCTATGTTACCATACCAAATTCCATGTTCTCGACGTTTATT V039F10 BU877824 Transcriptional regualtion, polycomb, ESC P. trichocarpa CTTTAGTTGACTGGTTTAAGGCTAATGTAACTTATTTGGAATTCTAACAGCTATTTGACCCGTGATTAGT V041C10 BU877951 Transcriptional regualtion, helicase, SNF2-N P. trichocarpa AAACTCGAACCAGCATTTACTGCCACACCCCAAGTTGATTCATCGCAGATGCAATATCCACATGCAAATA V047A09 BU878423 Signal transduction, G-proein beta family P. trichocarpa TTGTTAAATTCTCGCCTAATGGAAAGTTCATTCTCGTTGCTACTCTTGATAGCACTCTTAAACTTTGGAA V049F05 BU878632 Transcriptional regulation, PHD zinc finger protein P. trichocarpa GAACTTACAGGATGCGCATTATGCAGAGGTTATGATTTTATGAGATCTGGATTTGGTCCACGCACAATTA V049F07 BU878634 Signal transduction, pseudo-response regulator P. trichocarpa AATTCCTTCGGAAACCACTCTCTGAAGATAAACTGAGGAATATATGGCAGCACGTCGTTCATAAGGCATT V053C07 BU878904 TF, MYB P. trichocarpa TCTACACTTGAACCCGAGTAGCCCATCCGGATCCGATTTGAGCGATTCAAGTATACCCGGCGTGAATTCA V056C05 BU879121 SET domain P. trichocarpa TTGCAAGTGTTCCACTTATTACCATGCAATGCGTGCTTCGAGGGCAGGATATCGCATGGAGTTGCACTGC V057G12 BU879250 TF, NAC P. trichocarpa TGATTGGTATTTCTTTAGTCACAAAGACAAGAAATATCCCACAGGGACTAGAACAAATCGAGCTACGGCT V059D02 BU879372 TF, MADS-box P. trichocarpa CTAGTTCTGGAAGGATGCATGAGTACTGCAGCCCTTCCACTACGGTGGTCGATCTGTTGGACAAGTATCA V060H07 BU879493 Transcriptional regulation, methyl-CpG binding P. trichocarpa AGATCGGATTAGGACCTCTGGCGTGACAGCTGGCACCGTAGATAAGTATTACATTGATCCTGCCTCAGGT V061D11 BU879538 nucleosome/ chromatin assembly, histone 4 P. trichocarpa TGAGGGATCGGGTTTAGATTTGCTAATCAGGTTTATTTTAGGTACTGTTTTGTAAGTATAAGTGCGTGAT V063A06 BU879671 SET domain P. trichocarpa AAAATTTGGCTGTTACACTTGACAAGGTGAGATATGTAATGAGGTGTATATTTGGTGACCCAAAGCTGGC V063C08 BU879695 Actin P. trichocarpa CCTCTGTCTCCGACTTCAAAAGAATTTGTAGAAAATGGCCGATGCCGAGGATATTCAACCCCTTGTCTGT V063H06 BU879746 Transcriptional regulation, methyl-binding P. trichocarpa GATGCTAGACCTCTTGAACCTGGTGAAGCAAATCCCCTTAAATGGGTTGGTCCAGGTGATTGTACAGAAC SR001 X56062 Photosystem I chlorophyll a/b-binding protein A. Thaliana from stratagen SR002 X14212 RUBISCO activase A. Thaliana from stratagen SR003 U91966 RUBISCO large subunit A. Thaliana from stratagen SR004 AF159801 lipid transfer protein 4 A. Thaliana from stratagen SR005 AF159803 lipid transfer protein 6 A. Thaliana from stratagen SR006 AF191028 papain-type cysteine endopenptidase A. Thaliana from stratagen SR007 AF168390 root cap 1 A. Thaliana from stratagen SR008 AF198054 NAC1 A. Thaliana from stratagen SR009 AF247559 triosphosphate isomerase A. Thaliana from stratagen SR010 X58149 PRKase gene for ribulose-5-phosphate kinase A. Thaliana from stratagen B.Actin X63432 ?-actin Human from stratagen GapDh NM_002046 Glyseraldehyde-3-phosphate dehydrogenase Human from stratagen !platform_table_end ^SAMPLE = GSM77557 !Sample_title = fb6a1 !Sample_geo_accession = GSM77557 !Sample_status = Public on Oct 11 2006 !Sample_submission_date = Oct 11 2005 !Sample_last_update_date = Oct 17 2005 !Sample_type = RNA !Sample_channel_count = 1 !Sample_source_name_ch1 = floral bud from six year old poplar !Sample_organism_ch1 = Populus trichocarpa !Sample_organism_ch1 = Populus deltoides !Sample_characteristics_ch1 = floral bud at age six !Sample_molecule_ch1 = total RNA !Sample_label_ch1 = cy5 !Sample_description = wild type poplar floral bud at age six !Sample_data_processing = GeneXp !Sample_platform_id = GPL2092 !Sample_contact_name = Jingyi,,Li !Sample_contact_email = JINGYI.LI at OREGONSTATE.EDU !Sample_contact_phone = 541-737-8496 !Sample_contact_institute = Oregon State University !Sample_contact_address = !Sample_contact_city = Corvallis !Sample_contact_zip/postal_code = 97331 !Sample_contact_country = USA !Sample_series_id = GSE3457 !Sample_data_row_count = 217 #ID_REF = #VALUE = normalized signal intensities !sample_table_begin ID_REF VALUE A001P54Um 5.31 A003P34U 8.62 A009P50U 9.09 A010P29U 4.84 A031P05U 4.45 A039P68U 5.36 A047P36U 9.35 A069P31U 5.81 AF240445 10.54 B014P39U(UB21CPA06) 8.9 B016P21Um 7.96 B020P33U 8.31 C025P36U 7.48 C025P42U 8.74 C036P25U 10.31 C061P33U 8.04 C067P63U 5.54 C092P78U 8.9 F003P03Y 7.97 F011P01Y 6.7 F012P39Y 5.66 F027P14Y 10.57 F028P06Y 6.23 F044P04Y 7.83 F052P94Y 7.67 F066P33Y 9.01 F068P73Y 10.3 F070P70Y 8.62 F093P10Y 8.45 F098P59Y 9.44 F099P36Y 6.74 F100P70Y 4.77 F101P21Y 9.51 F101P86Y 9.86 F103P52Y 4.04 F103P87Y 5.41 F106P90Y 9.47 F110P74Y 9.95 F115P67Y 7.55 F117P40Y 5.1 F117P48Y 10.87 F118P50Y F119P13Y 8.66 F119P74Y 10.45 F121P83Y 7.11 F128P16Y 5.21 F129P24Y 5.36 F131P79Y 10.04 G070P72Y 6.6 G074P09Y 8.87 G095P48Y 8.83 G105P48Y 8.06 G126P33Y 7.37 G134P12Y 5.1 GA20-OX 4.84 HB1 7.83 HB2 9.34 I012P09P 9.5 I017P76P 8.27 M101C08 12.67 M101C11 13.32 M102E03 7.18 M102E09 11.57 M103H01 11.84 M104E08 9.41 M111B12 11.14 M112C09 10.76 M116D03 11.9 M116E04 8.34 M118F07 7.38 M120B06 11.76 M122B12 11.32 M124B09 7.47 M125D02 9.84 M127F08 12.91 M129E09 12.37 PCEN-L 6.74 PHYA 6.26 PHYB1 8.12 PHYB2 6.99 PMFT 7.75 PTAG1 10.85 PTAG2 10.97 PTAP1-1B 11.38 PTAP1-2A 13.85 PTB2 6.7 PTBF1 5.36 PTCO11 13.09 PTCO12 12.72 PTCRY1D 8.35 PTD 8 PTID1L1A 9.2 PTID1L3 7.07 PTID1L4 9.21 PTIR1 4.45 PTLF 10.62 PTPGM 11.01 PttGA2-OX 7.71 PttIAA1 9.14 PttIAA2 11.8 PttIAA4 6.86 PttIAA5 9.98 PttIAA6 6.54 PTTPIN1 7.69 PTTPIN2 8.72 PTTPIN3 5.54 R01B05 5.94 R02H01 7.87 R07C07 8.25 R15C07 7.58 R22G04 10.36 R22G10 4.36 R24E07 9.95 R26F09 10.48 R29F11 5.58 R33C03 12.59 R34B09 9.04 R35H10 8.98 R43C04 9.36 R43G01 7.72 R46E01 4.91 R48C03 6.04 R49E04 6.12 R50C10 7.96 R51DF126P 10.29 R54A05 8.69 R56B07 9.62 R59E12 12 R59F10 10.93 R63D08 11.03 R65B04 7.02 R67C05 9.34 R70F11 10.31 R71A05 5.58 R73H10 8.64 R74E10 4.91 R-AP2 12.43 UA13CPF12 9.34 UA35CPA11 8.42 UA35CPG02 5.54 UA52DPC04 8.55 UA52DPD03 8.02 UB10CPB06 9.02 UB10CPB07 9.04 UB10CPF10 7.99 UB11CPH11 8.74 UB18CPG04 8.51 UB27CP09(F131P66Y) 8.84 UB28CPA08 7.31 UB28CPB01 8.42 UB36DPH07 5.45 UB53CPE02 8.99 UB60BPD08 7.94 UM37TC05 9.6 UM42TF11 8.54 UM43TE12 9.33 UM44TA01 8.96 UM53TE12 9.54 UM54TA09 12.36 UM54TC12 10.19 UM54TF05 8.19 UM57TC10 8.17 UM61TC08 9.51 UM62TB07 9.12 UM65TE06 11.15 UM66TB05 10.42 UM67TB05 10.24 UM67TE05 7.85 UM69TD03 7.68 UM69TF07 UM77TC04 9.76 UM82TH11 5.91 UM83TC03 8.23 UM83TF04 4.04 UM89TG10 10.73 UM91TD06 8.54 UM93TD04 8.88 V001E09 13.39 V001G07 10.17 V002G11 11.51 V003A12 6.36 V006H03 7.64 V006H09 9.09 V007E07 11.16 V008A10 7.58 V009A10 7.74 V009B10 12.04 V009G10 7.79 V012F11 6.43 V012H04 9.41 V012H06 8.46 V015E04 8.06 V016C11 6.94 V016F11 9.46 V017G04 8.58 V020F08 4.7 V021F11 7.73 V025A02 9.54 V025E01 8.81 V031H01 5.88 V032H12 11.6 V037B10 10.1 V037D09 7.72 V039F10 9.18 V041C10 8.43 V047A09 8.85 V049F05 9.08 V049F07 9.71 V053C07 9.33 V056C05 6.58 V057G12 3.04 V059D02 11.35 V060H07 6.72 V061D11 12.81 V063A06 8.83 V063C08 10.53 V063H06 7.73 !sample_table_end ^SAMPLE = GSM77558 !Sample_title = fb6a2 !Sample_geo_accession = GSM77558 !Sample_status = Public on Oct 11 2006 !Sample_submission_date = Oct 11 2005 !Sample_last_update_date = Oct 17 2005 !Sample_type = RNA !Sample_channel_count = 1 !Sample_source_name_ch1 = floral bud from six year old poplar !Sample_organism_ch1 = Populus trichocarpa !Sample_organism_ch1 = Populus deltoides !Sample_characteristics_ch1 = floral bud at age six !Sample_molecule_ch1 = total RNA !Sample_label_ch1 = cy5 !Sample_description = wild type poplar floral bud at age six !Sample_data_processing = GeneXp !Sample_platform_id = GPL2092 !Sample_contact_name = Jingyi,,Li !Sample_contact_email = JINGYI.LI at OREGONSTATE.EDU !Sample_contact_phone = 541-737-8496 !Sample_contact_institute = Oregon State University !Sample_contact_address = !Sample_contact_city = Corvallis !Sample_contact_zip/postal_code = 97331 !Sample_contact_country = USA !Sample_series_id = GSE3457 !Sample_data_row_count = 217 #ID_REF = latform] #VALUE = normalized signal intensities !sample_table_begin ID_REF VALUE A001P54Um 4.89 A003P34U 8.01 A009P50U 9.16 A010P29U 5.02 A031P05U 5.7 A039P68U 5.99 A047P36U 9.18 A069P31U 5.49 AF240445 10.88 B014P39U(UB21CPA06) 8.56 B016P21Um 7.96 B020P33U 8.4 C025P36U 7.8 C025P42U 9.14 C036P25U 10.27 C061P33U 7.78 C067P63U 6.54 C092P78U 10.17 F003P03Y 8.44 F011P01Y 6.43 F012P39Y 5.62 F027P14Y 10.32 F028P06Y 6.52 F044P04Y 7.73 F052P94Y 7.51 F066P33Y 9.24 F068P73Y 9.14 F070P70Y 8.5 F093P10Y 8.53 F098P59Y 8.96 F099P36Y 6.68 F100P70Y 4.66 F101P21Y 8.64 F101P86Y 10.14 F103P52Y 4.49 F103P87Y 5.14 F106P90Y 9.48 F110P74Y 9.64 F115P67Y 8.18 F117P40Y 4.3 F117P48Y 10.64 F118P50Y 7.44 F119P13Y 8.63 F119P74Y 9.94 F121P83Y 7.61 F128P16Y 5.92 F129P24Y 6.54 F131P79Y 9.96 G070P72Y 6.56 G074P09Y 9.08 G095P48Y 8.84 G105P48Y 8.33 G126P33Y 7.17 G134P12Y 5.62 GA20-OX 5.25 HB1 7.92 HB2 9.27 I012P09P 9.47 I017P76P 8.29 M101C08 12.44 M101C11 13.51 M102E03 7.4 M102E09 11.38 M103H01 11.97 M104E08 9.51 M111B12 10.88 M112C09 11.16 M116D03 11.95 M116E04 8.83 M118F07 7.18 M120B06 11.85 M122B12 11.08 M124B09 6.66 M125D02 9.71 M127F08 12.09 M129E09 12.45 PCEN-L 6.33 PHYA 5.85 PHYB1 8.48 PHYB2 7.53 PMFT 7.91 PTAG1 11.19 PTAG2 10.9 PTAP1-1B 11.37 PTAP1-2A 14.15 PTB2 7.02 PTBF1 5.58 PTCO11 13.22 PTCO12 12.42 PTCRY1D 8.3 PTD 10.43 PTID1L1A 9.38 PTID1L3 6.99 PTID1L4 9.06 PTIR1 3.49 PTLF 10.63 PTPGM 11 PttGA2-OX 7.82 PttIAA1 9.2 PttIAA2 11.91 PttIAA4 6.45 PttIAA5 9.91 PttIAA6 7.39 PTTPIN1 7.9 PTTPIN2 8.61 PTTPIN3 5.25 R01B05 6.14 R02H01 7.68 R07C07 7.99 R15C07 7.89 R22G04 10.53 R22G10 5.4 R24E07 9.86 R26F09 10.67 R29F11 6.02 R33C03 12.75 R34B09 9.15 R35H10 8.78 R43C04 9.23 R43G01 7.68 R46E01 3.08 R48C03 6.33 R49E04 6.66 R50C10 7.95 R51DF126P 10.39 R54A05 8.61 R56B07 9.86 R59E12 12.14 R59F10 10.71 R63D08 11.46 R65B04 7.11 R67C05 9.54 R70F11 10.02 R71A05 4.95 R73H10 8.64 R74E10 5.14 R-AP2 12.44 UA13CPF12 9.45 UA35CPA11 8.51 UA35CPG02 5.08 UA52DPC04 9.02 UA52DPD03 7.83 UB10CPB06 9.26 UB10CPB07 9.03 UB10CPF10 7.86 UB11CPH11 8.93 UB18CPG04 8.57 UB27CP09(F131P66Y) 8.82 UB28CPA08 7.67 UB28CPB01 8.92 UB36DPH07 4.82 UB53CPE02 9.03 UB60BPD08 7.87 UM37TC05 9.35 UM42TF11 8.79 UM43TE12 9.23 UM44TA01 8.87 UM53TE12 9.93 UM54TA09 12.56 UM54TC12 10.51 UM54TF05 8.24 UM57TC10 8.32 UM61TC08 9.61 UM62TB07 9.58 UM65TE06 11.05 UM66TB05 10.17 UM67TB05 UM67TE05 7.85 UM69TD03 7.55 UM69TF07 5.89 UM77TC04 10 UM82TH11 5.82 UM83TC03 8.35 UM83TF04 4.74 UM89TG10 10.73 UM91TD06 8.99 UM93TD04 9.03 V001E09 13.43 V001G07 10.04 V002G11 11.22 V003A12 5.7 V006H03 7.34 V006H09 9.08 V007E07 11 V008A10 7.57 V009A10 8.22 V009B10 12.01 V009G10 7.99 V012F11 5.74 V012H04 9.23 V012H06 8.17 V015E04 7.97 V016C11 5.62 V016F11 9.51 V017G04 8.33 V020F08 5.49 V021F11 8.06 V025A02 9.77 V025E01 8.65 V031H01 6.49 V032H12 11.74 V037B10 10.47 V037D09 7.91 V039F10 9.48 V041C10 8.43 V047A09 9.08 V049F05 9.32 V049F07 9.93 V053C07 9.59 V056C05 6.14 V057G12 3.82 V059D02 11.53 V060H07 7.02 V061D11 11.67 V063A06 8.76 V063C08 10.07 V063H06 7.3 !sample_table_end --- NEW FILE: GDS100_partial.soft --- ^DATABASE = Geo !Database_name = Gene Expression Omnibus (GEO) !Database_institute = NCBI NLM NIH !Database_web_link = http://www.ncbi.nlm.nih.gov/projects/geo !Database_email = geo at ncbi.nlm.nih.gov !Database_ref = Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6 ^DATASET = GDS100 !dataset_title = UV exposure time course (ecoli_8.0) !dataset_description = Time course of UV-responsive genes and their role in cellular recovery. lexA SOS-deficient strains analyzed. !dataset_type = gene expression array-based !dataset_pubmed_id = 11333217 !dataset_platform = GPL18 !dataset_platform_organism = Escherichia coli !dataset_platform_technology_type = spotted DNA/cDNA !dataset_feature_count = 5764 !dataset_sample_organism = Escherichia coli !dataset_sample_type = RNA !dataset_channel_count = 2 !dataset_sample_count = 8 !dataset_value_type = log ratio !dataset_reference_series = GSE9 !dataset_order = none !dataset_update_date = Apr 06 2003 ^SUBSET = GDS100_1 !subset_dataset_id = GDS100 !subset_description = irradiated !subset_sample_id = GSM544,GSM545,GSM546,GSM547,GSM548 !subset_type = protocol ^SUBSET = GDS100_2 !subset_dataset_id = GDS100 !subset_description = not irradiated !subset_sample_id = GSM542,GSM543,GSM549 !subset_type = protocol ^SUBSET = GDS100_3 !subset_dataset_id = GDS100 !subset_description = 5 minute !subset_sample_id = GSM547 !subset_type = time ^SUBSET = GDS100_4 !subset_dataset_id = GDS100 !subset_description = 10 minute !subset_sample_id = GSM544 !subset_type = time ^SUBSET = GDS100_5 !subset_dataset_id = GDS100 !subset_description = 20 minute !subset_sample_id = GSM545,GSM542 !subset_type = time ^SUBSET = GDS100_6 !subset_dataset_id = GDS100 !subset_description = 40 minute !subset_sample_id = GSM546 !subset_type = time ^SUBSET = GDS100_7 !subset_dataset_id = GDS100 !subset_description = 60 minute !subset_sample_id = GSM548,GSM543 !subset_type = time ^SUBSET = GDS100_8 !subset_dataset_id = GDS100 !subset_description = 0 minute !subset_sample_id = GSM549 !subset_type = time ^DATASET = GDS100 #ID_REF = Platform reference identifier #IDENTIFIER = identifier #GSM549 = Value for GSM549: lexA vs. wt, before UV treatment, MG1655; src: 0' wt, before UV treatment, 25 ug total RNA, 2 ug pdN6; src: 0' lexA, before UV 25 ug total RNA, 2 ug pdN6 #GSM542 = Value for GSM542: lexA 20' after NOuv vs. 0', MG1655; src: 0', before UV treatment, 25 ug total RNA, 2 ug pdN6; src: lexA 20 min after NOuv, 25 ug total RNA, 2 ug pdN6 #GSM543 = Value for GSM543: lexA 60' after NOuv vs. 0', MG1655; src: 0', before UV treatment, 25 ug total RNA, 2 ug pdN6; src: lexA 60 min after NOuv, 25 ug total RNA, 2 ug pdN6 #GSM547 = Value for GSM547: lexA 5' after UV vs. 0', MG1655; src: 0', before UV treatment, 25 ug total RNA, 2 ug pdN6; src: lexA 5 min after UV treatment, 25 ug total RNA, 2 ug pdN6 #GSM544 = Value for GSM544: lexA 10' after UV vs. 0', MG1655; src: 0', before UV treatment, 25 ug total RNA, 2 ug pdN6; src: lexA 10 min after UV treatment, 25 ug total RNA, 2 ug pdN6 #GSM545 = Value for GSM545: lexA 20' after UV vs. 0', MG1655; src: 0', before UV treatment, 25 ug total RNA, 2 ug pdN6; src: lexA 20 min after UV treatment, 25 ug total RNA, 2 ug pdN6 #GSM546 = Value for GSM546: lexA 40' after UV vs. 0', MG1655; src: 0', before UV treatment, 25 ug total RNA, 2 ug pdN6; src: lexA 40 min after UV treatment, 25 ug total RNA, 2 ug pdN6 #GSM548 = Value for GSM548: lexA 60' after UV vs. 0', MG1655; src: 0', before UV treatment, 25 ug total RNA, 2 ug pdN6; src: lexA 60 min after UV treatment, 25 ug total RNA, 2 ug pdN6 !dataset_table_begin ID_REF IDENTIFIER GSM549 GSM542 GSM543 GSM547 GSM544 GSM545 GSM546 GSM548 1 EMPTY 0.211 0.240 0.306 0.098 0.101 0.208 0.167 0.190 2 EMPTY 0.045 0.097 0.142 0.107 0.074 0.202 0.019 0.266 3 EMPTY 0.191 0.243 0.312 0.023 0.158 0.261 0.255 0.128 4 EMPTY -0.013 -0.041 0.112 -0.028 0.175 0.111 0.139 0.137 5 EMPTY 0.046 0.101 0.183 0.052 0.115 0.225 0.092 0.051 6 EMPTY 0.097 0.217 0.242 0.067 0.104 0.162 0.104 0.154 7 EMPTY 0.699 1.789 null null null null null null 8 EMPTY 1.026 1.509 -0.585 0.813 0.105 -0.280 1.242 0.336 9 EMPTY 0.816 null -1.322 null 1.327 null 1.242 null 10 EMPTY -0.756 null 2.585 -0.234 2.564 -3.087 0.444 null 11 EMPTY 0.157 -1.036 2.000 1.877 -0.813 3.115 null 0.599 12 EMPTY -1.084 2.608 null 1.614 -1.033 1.138 1.564 1.599 13 EMPTY null null 0.166 null null 1.322 -0.758 null 14 EMPTY -0.406 null 0.628 null -3.802 null 0.757 1.216 15 EMPTY null -1.714 1.794 null null 1.858 2.049 0.932 !dataset_table_end