[BioRuby-cvs] bioruby/test/unit/bio/sequence test_aa.rb, 1.4, 1.5 test_common.rb, 1.4, 1.5 test_na.rb, 1.5, 1.6
Mitsuteru C. Nakao
nakao at dev.open-bio.org
Mon Dec 3 01:19:14 EST 2007
Update of /home/repository/bioruby/bioruby/test/unit/bio/sequence
In directory dev.open-bio.org:/tmp/cvs-serv11507/test/unit/bio/sequence
Modified Files:
test_aa.rb test_common.rb test_na.rb
Log Message:
* Fixed Bio::Sequence::NA#concat bug reported by Dr. M. Matsuzaki.
* Added tests for concat and << for Bio::Sequence::NA and AA.
Index: test_common.rb
===================================================================
RCS file: /home/repository/bioruby/bioruby/test/unit/bio/sequence/test_common.rb,v
retrieving revision 1.4
retrieving revision 1.5
diff -C2 -d -r1.4 -r1.5
*** test_common.rb 5 Apr 2007 23:35:44 -0000 1.4
--- test_common.rb 3 Dec 2007 06:19:12 -0000 1.5
***************
*** 32,35 ****
--- 32,39 ----
end
+ def test_to_str
+ assert_equal('atgcatgcatgcatgcaaaa', @obj.to_str)
+ end
+
def test_seq
str = "atgcatgcatgcatgcaaaa"
***************
*** 37,41 ****
end
-
# <<(*arg)
def test_push
--- 41,44 ----
***************
*** 44,47 ****
--- 47,56 ----
end
+ # concat(*arg)
+ def test_concat
+ str = "atgcatgcatgcatgcaaaaA"
+ assert_equal(str, @obj.concat("A"))
+ end
+
# +(*arg)
def test_sum
Index: test_na.rb
===================================================================
RCS file: /home/repository/bioruby/bioruby/test/unit/bio/sequence/test_na.rb,v
retrieving revision 1.5
retrieving revision 1.6
diff -C2 -d -r1.5 -r1.6
*** test_na.rb 5 Apr 2007 23:35:44 -0000 1.5
--- test_na.rb 3 Dec 2007 06:19:12 -0000 1.6
***************
*** 176,179 ****
--- 176,241 ----
end
+ class TestSequenceCommon < Test::Unit::TestCase
+
+ def setup
+ @obj = Bio::Sequence::NA.new('atgcatgcatgcatgcaaaa')
+ end
+
+ def test_to_s
+ assert_equal('atgcatgcatgcatgcaaaa', @obj.to_s)
+ end
+
+ def test_to_str
+ assert_equal('atgcatgcatgcatgcaaaa', @obj.to_str)
+ end
+
+ def test_seq
+ str = "atgcatgcatgcatgcaaaa"
+ assert_equal(str, @obj.seq)
+ end
+
+ # <<(*arg)
+ def test_push
+ str = "atgcatgcatgcatgcaaaaa"
+ assert_equal(str, @obj << "A")
+ end
+
+ # concat(*arg)
+ def test_concat
+ str = "atgcatgcatgcatgcaaaaa"
+ assert_equal(str, @obj.concat("A"))
+ end
+
+ # +(*arg)
+ def test_sum
+ str = "atgcatgcatgcatgcaaaaatgcatgcatgcatgcaaaa"
+ assert_equal(str, @obj + @obj)
+ end
+
+ # window_search(window_size, step_size = 1)
+ def test_window_search
+ @obj.window_search(4) do |subseq|
+ assert_equal(20, @obj.size)
+ end
+ end
+
+ #total(hash)
+ def test_total
+ hash = {'a' => 1, 'c' => 2, 'g' => 4, 't' => 3}
+ assert_equal(44.0, @obj.total(hash))
+ end
+
+ def test_composition
+ composition = {"a"=>8, "c"=>4, "g"=>4, "t"=>4}
+ assert_equal(composition, @obj.composition)
+ end
+
+ def test_splicing
+ #(position)
+ assert_equal("atgcatgc", @obj.splicing("join(1..4, 13..16)"))
+ end
+ end
+
+
class TestSequenceNATranslation < Test::Unit::TestCase
def setup
Index: test_aa.rb
===================================================================
RCS file: /home/repository/bioruby/bioruby/test/unit/bio/sequence/test_aa.rb,v
retrieving revision 1.4
retrieving revision 1.5
diff -C2 -d -r1.4 -r1.5
*** test_aa.rb 14 Apr 2007 05:09:23 -0000 1.4
--- test_aa.rb 3 Dec 2007 06:19:12 -0000 1.5
***************
*** 20,25 ****
module Bio
-
class TestSequenceAANew < Test::Unit::TestCase
def test_new
str = "RRLEHTFVFL RNFSLMLLRY"
--- 20,25 ----
module Bio
class TestSequenceAANew < Test::Unit::TestCase
+
def test_new
str = "RRLEHTFVFL RNFSLMLLRY"
***************
*** 87,90 ****
--- 87,91 ----
assert_equal(ary, @obj.names)
end
+
end
More information about the bioruby-cvs
mailing list