[BioRuby-cvs] bioruby README.DEV,1.9,1.10
Jan Aerts
aerts at dev.open-bio.org
Thu May 11 06:53:27 EDT 2006
Update of /home/repository/bioruby/bioruby
In directory dev.open-bio.org:/tmp/cvs-serv26709
Modified Files:
README.DEV
Log Message:
Added documentation on standard documentation of files and modules (as requested by Toshiaki).
Index: README.DEV
===================================================================
RCS file: /home/repository/bioruby/bioruby/README.DEV,v
retrieving revision 1.9
retrieving revision 1.10
diff -C2 -d -r1.9 -r1.10
*** README.DEV 8 Feb 2006 12:02:09 -0000 1.9
--- README.DEV 11 May 2006 10:53:25 -0000 1.10
***************
*** 1,9 ****
! =begin
!
! $Id$
! Copyright (C) 2005, 2006 Toshiaki Katayama <k at bioruby.org>
! = How to contribute to the BioRuby project?
There are many possible ways to contribute to the BioRuby project,
--- 1,8 ----
! $Id$
! Copyright (C):: 2005, 2006 Toshiaki Katayama <k at bioruby.org>
! Copyright (C):: 2006 Jan Aerts <jan.aerts at bbsrc.ac.uk>
! = HOW TO CONTRIBUTE TO THE BIORUBY PROJECT?
There are many possible ways to contribute to the BioRuby project,
***************
*** 21,25 ****
your module meets the field of bioinformatics.
! == License
If you would like your module to be included in the BioRuby distribution,
--- 20,24 ----
your module meets the field of bioinformatics.
! = LICENSE
If you would like your module to be included in the BioRuby distribution,
***************
*** 30,38 ****
are changing the license to Ruby's.
! == Coding style
You will need to follow the typical coding styles of the BioRuby modules:
! === Use the following naming conventions
* CamelCase for module and class names
--- 29,37 ----
are changing the license to Ruby's.
! = CODING STYLE
You will need to follow the typical coding styles of the BioRuby modules:
! == Use the following naming conventions
* CamelCase for module and class names
***************
*** 41,101 ****
* all UPPERCASE for constants
! === Indentation must not include tabs
* Use 2 spaces for indentation.
* Don't replace spaces to tabs.
! === Comments
! Don't use =begin and =end blocks for comments. If you need to add
comments, include it in the RDoc documentation.
! === Each file must start with the following text
#
! # = bio/db/hoge.rb - Hoge database parser
#
- # Copyright:: Copyright (C) 2001, 2005
- # Bio R. Hacker <brh at example.org>,
- # Chem R. Hacker <crh at example.org>
# License:: Ruby's
#
# $Id$
#
! # == Blah blah blah
! #
! # See http://hoge.db/ for more details on the Hoge database.
! # ... blah blah blah ...
! #
! # == Examples
#
! # hoge = Bio::Hoge.new(entry)
! # puts hoge.entry_id
! # puts hoge.definition
#
! # == References
#
# * Hoge F. et al., The Hoge database, Nucleic. Acid. Res. 123:100--123 (2030)
- #
# * http://hoge.db/
#
! === Documentation should be written in the RDoc format in the source code
! The RDoc format is becoming the popular standard for Ruby documentation.
! We are now in transition from the previously used RD format to the RDoc
! format in API documentation.
! Additional tutorial documentation and working examples are encouraged
! with your contribution. You may use the header part of the file for
! this purpose as demonstrated in the previous section.
! === Testing code should use 'test/unit'
Unit tests should come with your modules by which you can assure what
you meant to do with each method. The test code is useful to make
! maintenance easy and ensure stability.
! === Using autoload
To quicken the initial load time we have replaced most of 'require' to
--- 40,205 ----
* all UPPERCASE for constants
! == Indentation must not include tabs
* Use 2 spaces for indentation.
* Don't replace spaces to tabs.
! == Comments
! Don't use <tt>=begin</tt> and <tt>=end</tt> blocks for comments. If you need to add
comments, include it in the RDoc documentation.
! == Documentation should be written in the RDoc format in the source code
!
! The RDoc format is becoming the popular standard for Ruby documentation.
! We are now in transition from the previously used RD format to the RDoc
! format in API documentation.
!
! Additional tutorial documentation and working examples are encouraged
! with your contribution. You may use the header part of the file for
! this purpose as demonstrated in the previous section.
!
! == Standard documentation
!
! === of files
!
! Each file should start with a header, which covers the following topics:
! * copyright
! * license
! * description of the file (_not_ the classes; see below)
! * any references, if appropriate
+ The header should be formatted as follows:
#
! # = bio/db/hoge.rb - Hoge database parser classes
! #
! # Copyright (C):: 2001, 2003-2005 Bio R. Hacker <brh at example.org>,
! # Copyright (C):: 2006 Chem R. Hacker <crh at example.org>
#
# License:: Ruby's
#
# $Id$
#
! # = Description
#
! # This file contains classes that implement an interface to the Hoge database.
#
! # = References
#
# * Hoge F. et al., The Hoge database, Nucleic. Acid. Res. 123:100--123 (2030)
# * http://hoge.db/
#
! In the above sample, the
! $Id$
! will be automatically changed into something like
! $Id$
! when commiting to the CVS repository for the first time.
! === of classes and methods within those files
! Classes and methods should be documented in a standardized format, as in the
! following example (from lib/bio/sequence.rb):
! # = DESCRIPTION
! # Bio::Sequence objects represent annotated sequences in bioruby.
! # A Bio::Sequence object is a wrapper around the actual sequence,
! # represented as either a Bio::Sequence::NA or a Bio::Sequence::AA object.
! # For most users, this encapsulation will be completely transparent.
! # Bio::Sequence responds to all methods defined for Bio::Sequence::NA/AA
! # objects using the same arguments and returning the same values (even though
! # these methods are not documented specifically for Bio::Sequence).
! #
! # = USAGE
! # require 'bio'
! #
! # # Create a nucleic or amino acid sequence
! # dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA')
! # rna = Bio::Sequence.auto('augcaugcaugcaugcaaaa')
! # aa = Bio::Sequence.auto('ACDEFGHIKLMNPQRSTVWYU')
! #
! # # Print in FASTA format
! # puts dna.output(:fasta)
! #
! # # Print all codons
! # dna.window_search(3,3) do |codon|
! # puts codon
! # end
! #
! class Sequence
!
! # Create a new Bio::Sequence object
! #
! # s = Bio::Sequence.new('atgc')
! # puts s #=> 'atgc'
! #
! # Note that this method does not intialize the contained sequence
! # as any kind of bioruby object, only as a simple string
! #
! # puts s.seq.class #=> String
! #
! # See Bio::Sequence#na, Bio::Sequence#aa, and Bio::Sequence#auto
! # for methods to transform the basic String of a just created
! # Bio::Sequence object to a proper bioruby object
! # ---
! # *Arguments*:
! # * (required) _str_: String or Bio::Sequence::NA/AA object
! # *Returns*:: Bio::Sequence object
! def initialize(str)
! @seq = str
! end
!
! # The sequence identifier. For example, for a sequence
! # of Genbank origin, this is the accession number.
! attr_accessor :entry_id
!
! # An Array of Bio::Feature objects
! attr_accessor :features
! end # Sequence
!
! Preceding the class definition (<tt>class Sequence</tt>), there is at least a
! description and a usage example. Please use the +Description+ and +Usage+
! headings. If appropriate, refer to other classes that interact with or are
! related to the class.
!
! The code in the usage example should, if possible, be in a format that a user
! can copy-and-paste into a new script to run. It should illustrate the most
! important uses of the class. If possible and if it would not clutter up the
! example too much, try to provide any input data directly into the usage example,
! instead of refering to ARGV or ARGF for input.
! dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA')
! Otherwise, describe the input shortly, for example:
! # input should be string consisting of nucleotides
! dna = Bio::Sequence.auto(ARGF.read)
!
! Methods should be preceded by a comment that describes what the method does,
! including any relevant usage examples. (In contrast to the documentation for
! the class itself, headings are not required.) In addition, any arguments should
! be listed, as well as the type of thing that is returned by the method. The
! format of this information is as follows:
! # ---
! # *Arguments*:
! # * (required) _str_: String or Bio::Sequence::NA
! # * (optional) _nr_: a number that means something
! # *Returns*:: true or false
!
! Attribute accessors can be preceded by a short description.
!
! == Exception handling
!
! Don't use
! $stderr.puts "WARNING"
! in your code. Instead, try to avoid printing error messages. For fatal errors,
! use +raise+ with an appropriate message.
!
! == Testing code should use 'test/unit'
Unit tests should come with your modules by which you can assure what
you meant to do with each method. The test code is useful to make
! maintenance easy and ensure stability. The use of
! if __FILE__ == $0
! is deprecated.
! == Using autoload
To quicken the initial load time we have replaced most of 'require' to
***************
*** 135,139 ****
so autoload can be written in 1 line.
! == Name space
Your module should be located under the top-level module Bio and put under
--- 239,243 ----
so autoload can be written in 1 line.
! = NAMESPACE
Your module should be located under the top-level module Bio and put under
***************
*** 151,161 ****
If your module doesn't match any of the above, please propose
! an appropriate directory name when you contribute.
! == Maintenance
Finally, please maintain the code you've contributed. The BioRuby
staff is willing to give you CVS privileges if needed.
!
! =end
--- 255,267 ----
If your module doesn't match any of the above, please propose
! an appropriate directory name when you contribute. Please let the staff
! discuss on namespaces (class names), API (method names) before commiting
! a new module or making changes on existing modules.
! = MAINTENANCE
Finally, please maintain the code you've contributed. The BioRuby
staff is willing to give you CVS privileges if needed.
! Please let us know (on the bioruby list) before you commit, so that users
! can discuss on the change.
More information about the bioruby-cvs
mailing list