[Biopython] Parsing DNA coordinate files in the pdb

[Peter Cock]

1JO7 is an RNA structure, Solution Structure of Influenza A Virus Promoter.

And yes, you can parse it with Biopython:

$ python3
Python 3.6.0 (v3.6.0:41df79263a11, Dec 22 2016, 17:23:13)
[GCC 4.2.1 (Apple Inc. build 5666) (dot 3)] on darwin
Type "help", "copyright", "credits" or "license" for more information.
>>> from Bio.PDB import PDBParser
>>> parser = PDBParser()
>>> structure = parser.get_structure("1JO7", "1jo7.pdb")
>>> len(structure)
32
>>> model = structure[0]
>>> for chain in model:
...    for residue in chain:
...         print(residue)
...
<Residue   A het=  resseq=1 icode= >
<Residue   G het=  resseq=2 icode= >
<Residue   U het=  resseq=3 icode= >
<Residue   A het=  resseq=4 icode= >
<Residue   G het=  resseq=5 icode= >
<Residue   A het=  resseq=6 icode= >
<Residue   A het=  resseq=7 icode= >
<Residue   A het=  resseq=8 icode= >
<Residue   C het=  resseq=9 icode= >
<Residue   A het=  resseq=10 icode= >
<Residue   A het=  resseq=11 icode= >
<Residue   G het=  resseq=12 icode= >
<Residue   G het=  resseq=13 icode= >
<Residue   C het=  resseq=14 icode= >
<Residue   U het=  resseq=15 icode= >
<Residue   U het=  resseq=16 icode= >
<Residue   C het=  resseq=17 icode= >
<Residue   G het=  resseq=18 icode= >
<Residue   G het=  resseq=19 icode= >
<Residue   C het=  resseq=20 icode= >
<Residue   C het=  resseq=21 icode= >
<Residue   U het=  resseq=22 icode= >
<Residue   G het=  resseq=23 icode= >
<Residue   C het=  resseq=24 icode= >
<Residue   U het=  resseq=25 icode= >
<Residue   U het=  resseq=26 icode= >
<Residue   U het=  resseq=27 icode= >
<Residue   U het=  resseq=28 icode= >
<Residue   G het=  resseq=29 icode= >
<Residue   C het=  resseq=30 icode= >
<Residue   U het=  resseq=31 icode= >


The 32 models here are the 32 conformers submitted, according
to the website they are those with Lowest Energy and Acceptable
Covalent Geometry.

By co-incidence there are also 32 residues, RNA bases A, G, U,
..., G, C, U.

This matches the FASTA sequence available from the PDB:

>1JO7:A|PDBID|CHAIN|SEQUENCE
AGUAGAAACAAGGCUUCGGCCUGCUUUUGCU

Regards,

Peter

On Thu, May 4, 2017 at 4:40 AM, Ahmad Abdelzaher <underoath006 at gmail.com> wrote:
> Is there a way in Biopython to parse .pdb files that contain the
> crystal structure of molecules other than proteins, for example
> 1jo7.pdb?
>
> Regards.
> _______________________________________________
> Biopython mailing list  -  Biopython at mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/biopython