[Biopython] RNA secondary structure with RNAfold

[Jakub Stanislaw Nowak]

Hello everyone,

I am trying to model secondary structures of some RNA.

As I am not an expert in programming it is quite a challenge for me so far I found a way to access RNAfold from biopython via biomanycores.

I downloaded and installed both biomanycores and RNAfold tools in 
/usr/local/bin/

and wrote a simple test script in python before loading my dataset

> from Biomanycores import RNAFold
> 
> RNA = 'CUGCAUUGGCCAAAUUGGCCCUACUACGUAUGCUAGCAUGAGAUGUGACAGUACAGUGUACUUAC'
> 
> structure = RNAFold.execute(RNA)
> 
> print(structure)


 
Unfortunately it hasn’t work and generated this error message:

> Traceback (most recent call last):

>   File "/Users/user/Google Drive/Bioinformatics/smallRNAseq/Python secondary structure/RNAFoldtest", line 9, in <module>

>     structure = RNAFold.execute(RNA)

>   File "/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Biomanycores-1.1210-py2.7.egg/Biomanycores/RNAFold.py", line 221, in execute

>     handle, delta = rnafold_cmd.run(verbose=verbose)

>   File "/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Biomanycores-1.1210-py2.7.egg/Biomanycores/AbstractCommandline.py", line 141, in run

>     stderr=stderr_str)

> ApplicationError: Non-zero return code 1 from '/usr/local/bin/RNAfold -f', message '/usr/local/bin/RNAfold: invalid option -- f'

> >>> 


Do you know any solution for my problem? Alternatively maybe you know of some different approach to analyse secondary structure with biopython?

All best,

Jakub
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mailman.open-bio.org/pipermail/biopython/attachments/20141129/80067604/attachment.html>
-------------- next part --------------
An embedded and charset-unspecified text was scrubbed...
Name: not available
URL: <http://mailman.open-bio.org/pipermail/biopython/attachments/20141129/80067604/attachment.ksh>