From xiaochuan.liu at mssm.edu  Thu May  3 18:46:58 2012
From: xiaochuan.liu at mssm.edu (Liu, XiaoChuan)
Date: Thu, 3 May 2012 22:46:58 +0000
Subject: [Biopython] How to use SeqRecord to get the subseq location
	information
Message-ID: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8585@Exch-2KX-MBXAB3.ExchMail.mssm.edu>


Dear all,

I face a problem: How to use SeqRecord to get the subseq location information?

My code is like this:

>>> from Bio.Seq import Seq

>>> simple_seq = Seq("gugggaagagggguggggcccgggacuguacccaugugaggacuauucuugaguccugcucuuguucugagcaccaccccucucucaga")

>>> from Bio.SeqRecord import SeqRecord

>>> from Bio.SeqFeature import SeqFeature, FeatureLocation

>>> example_feature = SeqFeature(FeatureLocation(25382494, 25382583), type="mRNA", strand=-1)

>>> simple_seq_r = SeqRecord(simple_seq, id="17_329.4",features=[example_feature])

>>> simple_seq_r
SeqRecord(seq=Seq('gugggaagagggguggggcccgggacuguacccaugugaggacuauucuugagu...aga', Alphabet()), id='17_329.4', name='<unknown name>', description='<unknown description>', dbxrefs=[])

>>> simple_seq_r.features
[SeqFeature(FeatureLocation(ExactPosition(25382494),ExactPosition(25382583)), type='mRNA', strand=-1)]

>>> simple_seq_r.features[0]
SeqFeature(FeatureLocation(ExactPosition(25382494),ExactPosition(25382583)), type='mRNA', strand=-1)

>>> subseq=simple_seq_r[3:10]
>>> subseq
SeqRecord(seq=Seq('ggaagag', Alphabet()), id='17_329.4', name='<unknown name>', description='<unknown description>', dbxrefs=[])

But when I type ?subseq.features? like this:
>>> subseq.features
[]

I could not get the location information of subseq. Why? Do somebody know how to get these information? Thank you very much!

Best,

Xiaochuan


From w.arindrarto at gmail.com  Fri May  4 02:09:31 2012
From: w.arindrarto at gmail.com (Wibowo Arindrarto)
Date: Fri, 4 May 2012 08:09:31 +0200
Subject: [Biopython] How to use SeqRecord to get the subseq location
	information
In-Reply-To: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8585@Exch-2KX-MBXAB3.ExchMail.mssm.edu>
References: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8585@Exch-2KX-MBXAB3.ExchMail.mssm.edu>
Message-ID: <CADEGkF4wUbFv=H+Owym4vs93B7UJSkO8ja_YoDtnrii4-7V4Nw@mail.gmail.com>

Hi Liu,

It looks like the problem is caused by the values you put in your
SeqFeature. Your sequence length is less than the feature location
values. If you try plugging in a number in range, like this:

>>> example_feature = SeqFeature(FeatureLocation(5, 7), type="mRNA", strand=-1)

You should still keep the feature in your subsequence, like so:

>>> subseq = simple_seq_r[3:10]
>>> subseq.features
[SeqFeature(FeatureLocation(ExactPosition(2), ExactPosition(4),
strand=-1), type='mRNA')]

Hope that helps :),

cheers,
Bow

From xiaochuan.liu at mssm.edu  Fri May  4 12:19:47 2012
From: xiaochuan.liu at mssm.edu (Liu, XiaoChuan)
Date: Fri, 4 May 2012 16:19:47 +0000
Subject: [Biopython] How to use SeqRecord to get the subseq location
 information
In-Reply-To: <CADEGkF4wUbFv=H+Owym4vs93B7UJSkO8ja_YoDtnrii4-7V4Nw@mail.gmail.com>
References: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8585@Exch-2KX-MBXAB3.ExchMail.mssm.edu>
	<CADEGkF4wUbFv=H+Owym4vs93B7UJSkO8ja_YoDtnrii4-7V4Nw@mail.gmail.com>
Message-ID: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8794@Exch-2KX-MBXAB3.ExchMail.mssm.edu>

Hi Bow,

Thank you very much for your helps!
But according to your suggestion, I also face this problem. See below:

>>> example_feature = SeqFeature(FeatureLocation(0, 88), type="mRNA", strand=-1)
>>> simple_seq_r = SeqRecord(simple_seq, id="17_329.4",features=[example_feature])
>>> simple_seq_r
SeqRecord(seq=Seq('gugggaagagggguggggcccgggacuguacccaugugaggacuauucuugagu...aga', Alphabet()), id='17_329.4', name='<unknown name>', description='<unknown description>', dbxrefs=[])
>>> simple_seq_r.features
[SeqFeature(FeatureLocation(ExactPosition(0),ExactPosition(88)), type='mRNA', strand=-1)]
>>> subseq=simple_seq_r[3:10]
>>> subseq
SeqRecord(seq=Seq('ggaagag', Alphabet()), id='17_329.4', name='<unknown name>', description='<unknown description>', dbxrefs=[])
>>> subseq.features
[]

I could not get the location information of subseq yet. Why? Thank you very much!

Best,

Xiaochuan


-----Original Message-----
From: Wibowo Arindrarto [mailto:w.arindrarto at gmail.com] 
Sent: Friday, May 04, 2012 2:10 AM
To: Liu, XiaoChuan
Cc: biopython at biopython.org
Subject: Re: [Biopython] How to use SeqRecord to get the subseq location information

Hi Liu,

It looks like the problem is caused by the values you put in your SeqFeature. Your sequence length is less than the feature location values. If you try plugging in a number in range, like this:

>>> example_feature = SeqFeature(FeatureLocation(5, 7), type="mRNA", 
>>> strand=-1)

You should still keep the feature in your subsequence, like so:

>>> subseq = simple_seq_r[3:10]
>>> subseq.features
[SeqFeature(FeatureLocation(ExactPosition(2), ExactPosition(4), strand=-1), type='mRNA')]

Hope that helps :),

cheers,
Bow


From p.j.a.cock at googlemail.com  Fri May  4 12:31:07 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 4 May 2012 17:31:07 +0100
Subject: [Biopython] How to use SeqRecord to get the subseq location
	information
In-Reply-To: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8794@Exch-2KX-MBXAB3.ExchMail.mssm.edu>
References: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8585@Exch-2KX-MBXAB3.ExchMail.mssm.edu>
	<CADEGkF4wUbFv=H+Owym4vs93B7UJSkO8ja_YoDtnrii4-7V4Nw@mail.gmail.com>
	<DFBD6E5CF7E1D844AF54A7314165E14C4EDF8794@Exch-2KX-MBXAB3.ExchMail.mssm.edu>
Message-ID: <CAKVJ-_4gjqqj61i1aQOvC6_pEX_EX13m7p_kq35-B+RvKKDBkA@mail.gmail.com>

On Fri, May 4, 2012 at 5:19 PM, Liu, XiaoChuan <xiaochuan.liu at mssm.edu> wrote:
> Hi Bow,
>
> Thank you very much for your helps!
> But according to your suggestion, I also face this problem. See below:
>
>>>> example_feature = SeqFeature(FeatureLocation(0, 88), type="mRNA", strand=-1)
>>>> simple_seq_r = SeqRecord(simple_seq, id="17_329.4",features=[example_feature])
>>>> simple_seq_r
> SeqRecord(seq=Seq('gugggaagagggguggggcccgggacuguacccaugugaggacuauucuugagu...aga', Alphabet()), id='17_329.4', name='<unknown name>', description='<unknown description>', dbxrefs=[])
>>>> simple_seq_r.features
> [SeqFeature(FeatureLocation(ExactPosition(0),ExactPosition(88)), type='mRNA', strand=-1)]
>>>> subseq=simple_seq_r[3:10]
>>>> subseq
> SeqRecord(seq=Seq('ggaagag', Alphabet()), id='17_329.4', name='<unknown name>', description='<unknown description>', dbxrefs=[])
>>>> subseq.features
> []
>
> I could not get the location information of subseq yet. Why? Thank you very much!
>

What numbers are you trying to get?

In your example the parent sequence (simple_seq_r) has a feature from
0 to 88, but when you slice a SeqRecord only features fully inside the
slice are kept - so no features are kept for the child record
(subseq). We do not breakup larger features which straddle the cut
sites.

Peter

From p.j.a.cock at googlemail.com  Sun May  6 07:09:30 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Sun, 6 May 2012 12:09:30 +0100
Subject: [Biopython] Fwd: 2012 SciPy Bioinformatics Workshop
In-Reply-To: <1336063455.23270.YahooMailNeo@web111204.mail.gq1.yahoo.com>
References: <1336063455.23270.YahooMailNeo@web111204.mail.gq1.yahoo.com>
Message-ID: <CAKVJ-_4gGwnDePRfXOc96b+oOUDgwAu8EAnb-GL14CEwTDUVWw@mail.gmail.com>

Dear Biopythoneers,

Are any of us planning to attend the SciPy meeting? The 2012 SciPy
Bioinformatics Workshop is crying out for a Biopython related talk... and
from the email below it sounds like they're not just looking for a
developers perspectives, but also how Python is being used in
bioinformatics.

Is it quite close after BOSC and ISMB but July 19 doesn't actually clash:
http://www.open-bio.org/wiki/BOSC_2012

SciPy 2012 as a whole does clash with ISMB, and for those in Europe, it
clashes with the planned CodeFest too:
http://www.open-bio.org/wiki/EU_Codefest_2012

July is definitely conference season...

Peter

---------- Forwarded message ----------
From: *Chris Mueller*
Date: Thursday, May 3, 2012
Subject: [Numpy-discussion] 2012 SciPy Bioinformatics Workshop
To: "chris.mueller at lab7.io" <chris.mueller at lab7.io>


We are pleased to announce the 2012 SciPy Bioinformatics Workshop held in
conjunction with SciPy 2012 this July in Austin, TX.

Python in biology is not dead yet... in fact, it's alive and well!

Remember just a few short years ago when BioPerl ruled the world?  Just one
minor paradigm shift* later and Python now has a commanding presence in
bioinformatics. From Python bindings to common tools all the way to entire
Python-based informatics platforms, Python is used everywhere** in modern
bioinformatics.

If you use Python for bioinformatics or just want to learn more about how
its being used, join us at the 2012 SciPy Bioinformatics Workshop. We will
have speakers from both academia and industry showcasing how Python is
enabling biologists to effectively work with large, complex data sets.

The workshop will be held the evening of July 19 from 5-6:30.

More information about SciPy is available on the conference site:
  http://conference.scipy.org/scipy2012/

!! Participate !!

Are you using Python in bioinformatics?  We'd love to have you share your
story.  We are looking for 3-4 speakers to share their experiences using
Python for bioinformatics.

Please contact Chris Mueller at chris.mueller [at] lab7.io and Ray Roberts
at rroberts [at] enthought.com to volunteer. Please include a brief
description or link to a paper/topic which you would like to discuss.
Presentations will last for 15 minutes each and will be followed by a panel
Q&A.

--
* That would be next generation sequencing
** Yes, we aRe awaRe of that otheR language used eveRywhere, but let's
celebRate Python Right now.

_______________________________________________
NumPy-Discussion mailing list
NumPy-Discussion at scipy.org <javascript:;>
http://mail.scipy.org/mailman/listinfo/numpy-discussion

From tiagoantao at gmail.com  Sun May  6 07:16:36 2012
From: tiagoantao at gmail.com (=?ISO-8859-1?Q?Tiago_Ant=E3o?=)
Date: Sun, 6 May 2012 12:16:36 +0100
Subject: [Biopython] Fwd: 2012 SciPy Bioinformatics Workshop
In-Reply-To: <CAKVJ-_4gGwnDePRfXOc96b+oOUDgwAu8EAnb-GL14CEwTDUVWw@mail.gmail.com>
References: <1336063455.23270.YahooMailNeo@web111204.mail.gq1.yahoo.com>
	<CAKVJ-_4gGwnDePRfXOc96b+oOUDgwAu8EAnb-GL14CEwTDUVWw@mail.gmail.com>
Message-ID: <CAA9RGENs3f5h02NXetXWmqgK+kXfrBt3d2bMTSoBexFbCBvh1A@mail.gmail.com>

Hi,

On Sun, May 6, 2012 at 12:09 PM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
> SciPy 2012 as a whole does clash with ISMB, and for those in Europe, it
> clashes with the planned CodeFest too:
> http://www.open-bio.org/wiki/EU_Codefest_2012

Are any people from here going to the codefest?

Tiago

From cjfields at illinois.edu  Sun May  6 11:03:27 2012
From: cjfields at illinois.edu (Fields, Christopher J)
Date: Sun, 6 May 2012 15:03:27 +0000
Subject: [Biopython] Fwd: 2012 SciPy Bioinformatics Workshop
In-Reply-To: <CAKVJ-_4gGwnDePRfXOc96b+oOUDgwAu8EAnb-GL14CEwTDUVWw@mail.gmail.com>
References: <1336063455.23270.YahooMailNeo@web111204.mail.gq1.yahoo.com>,
	<CAKVJ-_4gGwnDePRfXOc96b+oOUDgwAu8EAnb-GL14CEwTDUVWw@mail.gmail.com>
Message-ID: <FAEC1445-4BE3-42E7-A4C1-A58FAB016E64@illinois.edu>



On May 6, 2012, at 6:12 AM, "Peter Cock" <p.j.a.cock at googlemail.com> wrote:
> ...
> Is it quite close after BOSC and ISMB but July 19 doesn't actually clash:
> http://www.open-bio.org/wiki/BOSC_2012
> 
> SciPy 2012 as a whole does clash with ISMB, and for those in Europe, it
> clashes with the planned CodeFest too:
> http://www.open-bio.org/wiki/EU_Codefest_2012
> 
> July is definitely conference season...

Galaxy community conference as well.

Chris 

> 
> Peter
> 
> ---------- Forwarded message ----------
> From: *Chris Mueller*
> Date: Thursday, May 3, 2012
> Subject: [Numpy-discussion] 2012 SciPy Bioinformatics Workshop
> To: "chris.mueller at lab7.io" <chris.mueller at lab7.io>
> 
> 
> We are pleased to announce the 2012 SciPy Bioinformatics Workshop held in
> conjunction with SciPy 2012 this July in Austin, TX.
> 
> Python in biology is not dead yet... in fact, it's alive and well!
> 
> Remember just a few short years ago when BioPerl ruled the world?  Just one
> minor paradigm shift* later and Python now has a commanding presence in
> bioinformatics. From Python bindings to common tools all the way to entire
> Python-based informatics platforms, Python is used everywhere** in modern
> bioinformatics.
> 
> If you use Python for bioinformatics or just want to learn more about how
> its being used, join us at the 2012 SciPy Bioinformatics Workshop. We will
> have speakers from both academia and industry showcasing how Python is
> enabling biologists to effectively work with large, complex data sets.
> 
> The workshop will be held the evening of July 19 from 5-6:30.
> 
> More information about SciPy is available on the conference site:
>  http://conference.scipy.org/scipy2012/
> 
> !! Participate !!
> 
> Are you using Python in bioinformatics?  We'd love to have you share your
> story.  We are looking for 3-4 speakers to share their experiences using
> Python for bioinformatics.
> 
> Please contact Chris Mueller at chris.mueller [at] lab7.io and Ray Roberts
> at rroberts [at] enthought.com to volunteer. Please include a brief
> description or link to a paper/topic which you would like to discuss.
> Presentations will last for 15 minutes each and will be followed by a panel
> Q&A.
> 
> --
> * That would be next generation sequencing
> ** Yes, we aRe awaRe of that otheR language used eveRywhere, but let's
> celebRate Python Right now.
> 
> _______________________________________________
> NumPy-Discussion mailing list
> NumPy-Discussion at scipy.org <javascript:;>
> http://mail.scipy.org/mailman/listinfo/numpy-discussion
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython


From arklenna at gmail.com  Sun May  6 17:26:30 2012
From: arklenna at gmail.com (Lenna Peterson)
Date: Sun, 6 May 2012 17:26:30 -0400
Subject: [Biopython] GSoC python variant update
Message-ID: <CAK610_5FZ1MoLzgALP7zeF=6Vkq2A4SxTWtp0ke31Mtg06iQFA@mail.gmail.com>

Hi all,

I've written a few new posts on my blog; here's the latest:

http://arklenna.tumblr.com/post/22542372076/spot-isa-dog

I will attach a UML diagram and include the part of the post
addressing the diagram. Click through to the full post for a bonus
Einstein quote!

-------

My main goals are not limited to:

 * Make the structure parser and file-format agnostic: an abstracted
OO design should allow anything to be slotted in (for example,
Marjan's C GFF parser?)
 * Maintain encapsulation: limit how much each object can see of
objects above and below it
 * Allow extension at multiple levels: some existing parsers may
process data in different ways; this structure should allow handling
both raw data and data in various formats.

The `Variant` object's constructor allows an end user to change the
default parsers. Practical implementation details of `parse()` and
`write()` will need to be finessed - for example, ways to help the
user sift through immense quantities of data. I'm still in the process
of comparing the data contained in VCF/GVF files as well as the APIs
of PyVCF and BCBio.GFF.

`Parser` and `Writer` are both abstract classes that will define all
methods found in known parsers/writers with `NotImplementedError`s.
I'm speculating on whether a Variant-specific exception would be
useful, but a custom message should suffice.

Continuing down the diagram, `PyVCFWrapper` and `BCBioGFFWrapper`
would each inherit from both `Parser` and `Writer`. As the name
implies, they would serve as the adapter between the generic `Variant`
and the specific parser.

I anticipate that this structure could easily be extended to allow
intermediate storage in DBs as well as innumerable
sorting/comparing/filtering methods inside `Variant`.

-------

I would appreciate any and all feedback about the overall structure.
Namespace is definitely flexible. I'd also appreciate any specific
genomic variant workflows, and if somebody can point me to smallish
sample files of the same data in both VCF and GVF, I'd be eternally
grateful.

Regards,

Lenna
-------------- next part --------------
A non-text attachment was scrubbed...
Name: Variant_UML.png
Type: image/png
Size: 23313 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/biopython/attachments/20120506/38c3290c/attachment-0001.png>

From p.j.a.cock at googlemail.com  Mon May  7 04:37:38 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 7 May 2012 09:37:38 +0100
Subject: [Biopython] Fwd: 2012 SciPy Bioinformatics Workshop
In-Reply-To: <CAA9RGENs3f5h02NXetXWmqgK+kXfrBt3d2bMTSoBexFbCBvh1A@mail.gmail.com>
References: <1336063455.23270.YahooMailNeo@web111204.mail.gq1.yahoo.com>
	<CAKVJ-_4gGwnDePRfXOc96b+oOUDgwAu8EAnb-GL14CEwTDUVWw@mail.gmail.com>
	<CAA9RGENs3f5h02NXetXWmqgK+kXfrBt3d2bMTSoBexFbCBvh1A@mail.gmail.com>
Message-ID: <CAKVJ-_4LNs1RGjTz8-58MLHdfWsWeSX9p3Lwanh6ustA3M2_RQ@mail.gmail.com>

On Sun, May 6, 2012 at 12:16 PM, Tiago Ant?o <tiagoantao at gmail.com> wrote:
> Hi,
>
> On Sun, May 6, 2012 at 12:09 PM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
>> SciPy 2012 as a whole does clash with ISMB, and for those in Europe, it
>> clashes with the planned CodeFest too:
>> http://www.open-bio.org/wiki/EU_Codefest_2012
>
> Are any people from here going to the codefest?
>
> Tiago

Brad is going to the pre-BOSC CodeFest in California,
http://www.open-bio.org/wiki/Codefest_2012

I'm not sure if we have any Biopython folk signed up for the post-BOSC
EU CodeFest in Italy yet.
http://www.open-bio.org/wiki/EU_Codefest_2012

I aim to attend one of the CodeFests - trying to firm up summer
travel plans now...

Peter


From devaniranjan at gmail.com  Mon May  7 18:25:46 2012
From: devaniranjan at gmail.com (George Devaniranjan)
Date: Mon, 7 May 2012 18:25:46 -0400
Subject: [Biopython] PDBParser
Message-ID: <CAFU65PfORVQ6bDCSJyXDfGUgEfqW1T3G67tvO1PfBSv1vJuDcw@mail.gmail.com>

Hi,

I have a question about using  PDBParser


from Bio.PDB.PDBParser import PDBParser

parser=PDBParser()

structure=parser.get_structure("test", "1fat.pdb")
model=structure[0]
chain=model["A"]
residue=chain[1]

I want to use it to extract and WRITE to a file the coordinates of residues
10 to 20 only.
(or whatever residue range I specify)

Using the PDB Parser file I can extract residue id  in the range but how to
I back trace and write the file in the exact format that is found in the
PDB so that I can view it in a program like VMD/Pymol?
(that is I want to write the coordinates and all information as found in
the PDB but only for selected residues that I pass into it )
I know I can do it using VMD but I want to do it for thousands of PDB and
would like to write a database of such extracted fragments.

The other alternative is of course to go line by line in each file and
write the lines that match the residue range specified but I was wondering
if there is a way of doing the same thing using the PDBParser?

Thank you,
George

From anaryin at gmail.com  Tue May  8 04:16:44 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 8 May 2012 10:16:44 +0200
Subject: [Biopython] PDBParser
In-Reply-To: <CAFU65PfORVQ6bDCSJyXDfGUgEfqW1T3G67tvO1PfBSv1vJuDcw@mail.gmail.com>
References: <CAFU65PfORVQ6bDCSJyXDfGUgEfqW1T3G67tvO1PfBSv1vJuDcw@mail.gmail.com>
Message-ID: <CAJ9sUYO9E+UKyr3TkryBYKRBSPe=DSMLGoa-9JzRYWg8ytpAkA@mail.gmail.com>

Hello George,

You want to write only a part of the PDB file? What do you mean by 'all the
info'? If it is header information as well, then this is not possible, but
coordinates it is. You can do it in two ways:

1. Delete all residues/chains/models that are not part of your region of
interest and then write the structure with PDBIO.

2. Use the 'Select' class from PDBIO.py and trim the region of interest.
For example, for residues 1-10 you could do something like this:

from Bio.PDB import PDBIO
from Bio.PDB import Select

class ResidueFilter(Select):
    def accept_residue(self, residue):
        if residue.id[1] in range(1,11):
            return 1

P = PDBParser()
s = P.get_structure('dummy', 'foo.pdb')

io = PDBIO()

io.set_structure(s)
io.save('foo_1-10.pdb', ResidueFilter())


Check the FAQ for a more detailed explanation:

http://biopython.org/DIST/docs/cookbook/biopdb_faq.pdf

Cheers,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



2012/5/8 George Devaniranjan <devaniranjan at gmail.com>

> Hi,
>
> I have a question about using  PDBParser
>
>
> from Bio.PDB.PDBParser import PDBParser
>
> parser=PDBParser()
>
> structure=parser.get_structure("test", "1fat.pdb")
> model=structure[0]
> chain=model["A"]
> residue=chain[1]
>
> I want to use it to extract and WRITE to a file the coordinates of residues
> 10 to 20 only.
> (or whatever residue range I specify)
>
> Using the PDB Parser file I can extract residue id  in the range but how to
> I back trace and write the file in the exact format that is found in the
> PDB so that I can view it in a program like VMD/Pymol?
> (that is I want to write the coordinates and all information as found in
> the PDB but only for selected residues that I pass into it )
> I know I can do it using VMD but I want to do it for thousands of PDB and
> would like to write a database of such extracted fragments.
>
> The other alternative is of course to go line by line in each file and
> write the lines that match the residue range specified but I was wondering
> if there is a way of doing the same thing using the PDBParser?
>
> Thank you,
> George
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From devaniranjan at gmail.com  Tue May  8 08:44:09 2012
From: devaniranjan at gmail.com (George Devaniranjan)
Date: Tue, 8 May 2012 08:44:09 -0400
Subject: [Biopython] PDBParser
In-Reply-To: <CAJ9sUYO9E+UKyr3TkryBYKRBSPe=DSMLGoa-9JzRYWg8ytpAkA@mail.gmail.com>
References: <CAFU65PfORVQ6bDCSJyXDfGUgEfqW1T3G67tvO1PfBSv1vJuDcw@mail.gmail.com>
	<CAJ9sUYO9E+UKyr3TkryBYKRBSPe=DSMLGoa-9JzRYWg8ytpAkA@mail.gmail.com>
Message-ID: <CAFU65PdDHKGBPP5Z628RunxGKWZYCD5BiO4fC-vT9qhJA_7Arg@mail.gmail.com>

Thank you everyone,

I just need the coordinates of certain fragments from PDB files and this
works for me.
I was trying to use the PDBParser only, but thank you for pointing out
PDBIO to me.

Thank you,
George

On Tue, May 8, 2012 at 4:16 AM, Jo?o Rodrigues <anaryin at gmail.com> wrote:

> Hello George,
>
> You want to write only a part of the PDB file? What do you mean by 'all
> the info'? If it is header information as well, then this is not possible,
> but coordinates it is. You can do it in two ways:
>
> 1. Delete all residues/chains/models that are not part of your region of
> interest and then write the structure with PDBIO.
>
> 2. Use the 'Select' class from PDBIO.py and trim the region of interest.
> For example, for residues 1-10 you could do something like this:
>
> from Bio.PDB import PDBIO
> from Bio.PDB import Select
>
> class ResidueFilter(Select):
>     def accept_residue(self, residue):
>         if residue.id[1] in range(1,11):
>             return 1
>
> P = PDBParser()
> s = P.get_structure('dummy', 'foo.pdb')
>
> io = PDBIO()
>
> io.set_structure(s)
> io.save('foo_1-10.pdb', ResidueFilter())
>
>
> Check the FAQ for a more detailed explanation:
>
> http://biopython.org/DIST/docs/cookbook/biopdb_faq.pdf
>
> Cheers,
>
> Jo?o [...] Rodrigues
> http://nmr.chem.uu.nl/~joao
>
>
>
> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>
>> Hi,
>>
>> I have a question about using  PDBParser
>>
>>
>> from Bio.PDB.PDBParser import PDBParser
>>
>> parser=PDBParser()
>>
>> structure=parser.get_structure("test", "1fat.pdb")
>> model=structure[0]
>> chain=model["A"]
>> residue=chain[1]
>>
>> I want to use it to extract and WRITE to a file the coordinates of
>> residues
>> 10 to 20 only.
>> (or whatever residue range I specify)
>>
>> Using the PDB Parser file I can extract residue id  in the range but how
>> to
>> I back trace and write the file in the exact format that is found in the
>> PDB so that I can view it in a program like VMD/Pymol?
>> (that is I want to write the coordinates and all information as found in
>> the PDB but only for selected residues that I pass into it )
>> I know I can do it using VMD but I want to do it for thousands of PDB and
>> would like to write a database of such extracted fragments.
>>
>> The other alternative is of course to go line by line in each file and
>> write the lines that match the residue range specified but I was wondering
>> if there is a way of doing the same thing using the PDBParser?
>>
>> Thank you,
>> George
>> _______________________________________________
>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biopython
>>
>
>


From devaniranjan at gmail.com  Tue May  8 15:12:22 2012
From: devaniranjan at gmail.com (George Devaniranjan)
Date: Tue, 8 May 2012 15:12:22 -0400
Subject: [Biopython] PDBParser-chain breaks
Message-ID: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>

Hi,

I thought using PERMISSIVE=0 would raise an exception if I pass a PDB with
chain breaks.
However, nothing like that seems to happen.....

For instance

P=PDBParser(PERMISSIVE=0)
structure=P.get_structure('test', '7ODC.pdb')


7ODC has 3 chain breaks but it does not raise an exception.

Thank you
George

From anaryin at gmail.com  Tue May  8 15:34:26 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 8 May 2012 22:34:26 +0300
Subject: [Biopython] PDBParser-chain breaks
In-Reply-To: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
References: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
Message-ID: <CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>

Hi George,

Chain breaks are pretty "harmless" and usually do not represent a faulty
PDB file. The PERMISSIVE flag is for "features" like missing b-factors.

Cheers,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



2012/5/8 George Devaniranjan <devaniranjan at gmail.com>

> Hi,
>
> I thought using PERMISSIVE=0 would raise an exception if I pass a PDB with
> chain breaks.
> However, nothing like that seems to happen.....
>
> For instance
>
> P=PDBParser(PERMISSIVE=0)
> structure=P.get_structure('test', '7ODC.pdb')
>
>
> 7ODC has 3 chain breaks but it does not raise an exception.
>
> Thank you
> George
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From devaniranjan at gmail.com  Tue May  8 15:37:47 2012
From: devaniranjan at gmail.com (George Devaniranjan)
Date: Tue, 8 May 2012 15:37:47 -0400
Subject: [Biopython] PDBParser-chain breaks
In-Reply-To: <CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>
References: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
	<CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>
Message-ID: <CAFU65Pf1W5Z243gL9yhLGVHwMoxPTi1oXJtmbK9LOPPmo4FfdA@mail.gmail.com>

Hi Jo?o,

Is there a way though to find PDB's with chain breaks? using biopython?

Thank you,
George

On Tue, May 8, 2012 at 3:34 PM, Jo?o Rodrigues <anaryin at gmail.com> wrote:

> Hi George,
>
> Chain breaks are pretty "harmless" and usually do not represent a faulty
> PDB file. The PERMISSIVE flag is for "features" like missing b-factors.
>
> Cheers,
>
> Jo?o [...] Rodrigues
> http://nmr.chem.uu.nl/~joao
>
>
>
> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>
>> Hi,
>>
>> I thought using PERMISSIVE=0 would raise an exception if I pass a PDB with
>> chain breaks.
>> However, nothing like that seems to happen.....
>>
>> For instance
>>
>> P=PDBParser(PERMISSIVE=0)
>> structure=P.get_structure('test', '7ODC.pdb')
>>
>>
>> 7ODC has 3 chain breaks but it does not raise an exception.
>>
>> Thank you
>> George
>> _______________________________________________
>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biopython
>>
>
>


From anaryin at gmail.com  Tue May  8 15:39:02 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 8 May 2012 22:39:02 +0300
Subject: [Biopython] PDBParser-chain breaks
In-Reply-To: <CAFU65Pf1W5Z243gL9yhLGVHwMoxPTi1oXJtmbK9LOPPmo4FfdA@mail.gmail.com>
References: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
	<CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>
	<CAFU65Pf1W5Z243gL9yhLGVHwMoxPTi1oXJtmbK9LOPPmo4FfdA@mail.gmail.com>
Message-ID: <CAJ9sUYNK6O1TeAe7Za_aUXHvLUp802FkdTkbD_TwMN5XyTdPpA@mail.gmail.com>

Of course. Since they throw a warning just make sure to count the warnings,
parse the chain break ones, and if they are more than 0, you have chain
breaks.

Cheers,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



2012/5/8 George Devaniranjan <devaniranjan at gmail.com>

> Hi Jo?o,
>
> Is there a way though to find PDB's with chain breaks? using biopython?
>
> Thank you,
> George
>
> On Tue, May 8, 2012 at 3:34 PM, Jo?o Rodrigues <anaryin at gmail.com> wrote:
>
>> Hi George,
>>
>> Chain breaks are pretty "harmless" and usually do not represent a faulty
>> PDB file. The PERMISSIVE flag is for "features" like missing b-factors.
>>
>> Cheers,
>>
>> Jo?o [...] Rodrigues
>> http://nmr.chem.uu.nl/~joao
>>
>>
>>
>> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>>
>>>  Hi,
>>>
>>> I thought using PERMISSIVE=0 would raise an exception if I pass a PDB
>>> with
>>> chain breaks.
>>> However, nothing like that seems to happen.....
>>>
>>> For instance
>>>
>>> P=PDBParser(PERMISSIVE=0)
>>> structure=P.get_structure('test', '7ODC.pdb')
>>>
>>>
>>> 7ODC has 3 chain breaks but it does not raise an exception.
>>>
>>> Thank you
>>> George
>>> _______________________________________________
>>> Biopython mailing list  -  Biopython at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/biopython
>>>
>>
>>
>


From eric.talevich at gmail.com  Tue May  8 21:59:13 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Tue, 8 May 2012 21:59:13 -0400
Subject: [Biopython] PDBParser-chain breaks
In-Reply-To: <CAJ9sUYNK6O1TeAe7Za_aUXHvLUp802FkdTkbD_TwMN5XyTdPpA@mail.gmail.com>
References: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
	<CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>
	<CAFU65Pf1W5Z243gL9yhLGVHwMoxPTi1oXJtmbK9LOPPmo4FfdA@mail.gmail.com>
	<CAJ9sUYNK6O1TeAe7Za_aUXHvLUp802FkdTkbD_TwMN5XyTdPpA@mail.gmail.com>
Message-ID: <CAMC681kfqQXETXxNGjsZu+unoqcc2Te9-e5yTzn3N4nTj3cwrQ@mail.gmail.com>

The warnings module also lets you convert any warning to an error (or
ignore it, etc.). Use a regular expression to match the warning message:

from Bio import PDB
import warnings
warnings.filterwarnings('error', message='.*discontinuous at.*')
p = PDB.PDBParser()
s = p.get_structure("", "3BEG.pdb")


On Tue, May 8, 2012 at 3:39 PM, Jo?o Rodrigues <anaryin at gmail.com> wrote:

> Of course. Since they throw a warning just make sure to count the warnings,
> parse the chain break ones, and if they are more than 0, you have chain
> breaks.
>
> Cheers,
>
> Jo?o [...] Rodrigues
> http://nmr.chem.uu.nl/~joao
>
>
>
> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>
> > Hi Jo?o,
> >
> > Is there a way though to find PDB's with chain breaks? using biopython?
> >
> > Thank you,
> > George
> >
> > On Tue, May 8, 2012 at 3:34 PM, Jo?o Rodrigues <anaryin at gmail.com>
> wrote:
> >
> >> Hi George,
> >>
> >> Chain breaks are pretty "harmless" and usually do not represent a faulty
> >> PDB file. The PERMISSIVE flag is for "features" like missing b-factors.
> >>
> >> Cheers,
> >>
> >> Jo?o [...] Rodrigues
> >> http://nmr.chem.uu.nl/~joao
> >>
> >>
> >>
> >> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
> >>
> >>>  Hi,
> >>>
> >>> I thought using PERMISSIVE=0 would raise an exception if I pass a PDB
> >>> with
> >>> chain breaks.
> >>> However, nothing like that seems to happen.....
> >>>
> >>> For instance
> >>>
> >>> P=PDBParser(PERMISSIVE=0)
> >>> structure=P.get_structure('test', '7ODC.pdb')
> >>>
> >>>
> >>> 7ODC has 3 chain breaks but it does not raise an exception.
> >>>
> >>> Thank you
> >>> George
> >>> _______________________________________________
> >>> Biopython mailing list  -  Biopython at lists.open-bio.org
> >>> http://lists.open-bio.org/mailman/listinfo/biopython
> >>>
> >>
> >>
> >
>
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From anaryin at gmail.com  Wed May  9 01:39:40 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Wed, 9 May 2012 08:39:40 +0300
Subject: [Biopython] PDBParser-chain breaks
In-Reply-To: <CAMC681kfqQXETXxNGjsZu+unoqcc2Te9-e5yTzn3N4nTj3cwrQ@mail.gmail.com>
References: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
	<CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>
	<CAFU65Pf1W5Z243gL9yhLGVHwMoxPTi1oXJtmbK9LOPPmo4FfdA@mail.gmail.com>
	<CAJ9sUYNK6O1TeAe7Za_aUXHvLUp802FkdTkbD_TwMN5XyTdPpA@mail.gmail.com>
	<CAMC681kfqQXETXxNGjsZu+unoqcc2Te9-e5yTzn3N4nTj3cwrQ@mail.gmail.com>
Message-ID: <CAJ9sUYOicLscKvO2ybfuQ6=v=3Pe8cWJYEku3ejASHbTdYP0qA@mail.gmail.com>

For some reason however, I didn't get the discontinuous error .. That's why
I proposed this alternative.

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



2012/5/9 Eric Talevich <eric.talevich at gmail.com>

> The warnings module also lets you convert any warning to an error (or
> ignore it, etc.). Use a regular expression to match the warning message:
>
> from Bio import PDB
> import warnings
> warnings.filterwarnings('error', message='.*discontinuous at.*')
> p = PDB.PDBParser()
> s = p.get_structure("", "3BEG.pdb")
>
>
>
> On Tue, May 8, 2012 at 3:39 PM, Jo?o Rodrigues <anaryin at gmail.com> wrote:
>
>> Of course. Since they throw a warning just make sure to count the
>> warnings,
>> parse the chain break ones, and if they are more than 0, you have chain
>> breaks.
>>
>> Cheers,
>>
>> Jo?o [...] Rodrigues
>> http://nmr.chem.uu.nl/~joao
>>
>>
>>
>> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>>
>> > Hi Jo?o,
>> >
>> > Is there a way though to find PDB's with chain breaks? using biopython?
>> >
>> > Thank you,
>> > George
>> >
>> > On Tue, May 8, 2012 at 3:34 PM, Jo?o Rodrigues <anaryin at gmail.com>
>> wrote:
>> >
>> >> Hi George,
>> >>
>> >> Chain breaks are pretty "harmless" and usually do not represent a
>> faulty
>> >> PDB file. The PERMISSIVE flag is for "features" like missing b-factors.
>> >>
>> >> Cheers,
>> >>
>> >> Jo?o [...] Rodrigues
>> >> http://nmr.chem.uu.nl/~joao
>> >>
>> >>
>> >>
>> >> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>> >>
>> >>>  Hi,
>> >>>
>> >>> I thought using PERMISSIVE=0 would raise an exception if I pass a PDB
>> >>> with
>> >>> chain breaks.
>> >>> However, nothing like that seems to happen.....
>> >>>
>> >>> For instance
>> >>>
>> >>> P=PDBParser(PERMISSIVE=0)
>> >>> structure=P.get_structure('test', '7ODC.pdb')
>> >>>
>> >>>
>> >>> 7ODC has 3 chain breaks but it does not raise an exception.
>> >>>
>> >>> Thank you
>> >>> George
>> >>> _______________________________________________
>> >>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> >>> http://lists.open-bio.org/mailman/listinfo/biopython
>> >>>
>> >>
>> >>
>> >
>>
>> _______________________________________________
>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biopython
>>
>
>


From eric.talevich at gmail.com  Wed May  9 10:31:34 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Wed, 9 May 2012 10:31:34 -0400
Subject: [Biopython] PDBParser-chain breaks
In-Reply-To: <CAJ9sUYOicLscKvO2ybfuQ6=v=3Pe8cWJYEku3ejASHbTdYP0qA@mail.gmail.com>
References: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
	<CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>
	<CAFU65Pf1W5Z243gL9yhLGVHwMoxPTi1oXJtmbK9LOPPmo4FfdA@mail.gmail.com>
	<CAJ9sUYNK6O1TeAe7Za_aUXHvLUp802FkdTkbD_TwMN5XyTdPpA@mail.gmail.com>
	<CAMC681kfqQXETXxNGjsZu+unoqcc2Te9-e5yTzn3N4nTj3cwrQ@mail.gmail.com>
	<CAJ9sUYOicLscKvO2ybfuQ6=v=3Pe8cWJYEku3ejASHbTdYP0qA@mail.gmail.com>
Message-ID: <CAMC681kK8fX7W0gzf8-n7NXXe2x1vwUZJSx4RJL2etVUWde2Ag@mail.gmail.com>

Oh, there's a caveat to the warnings module -- if a given warning isn't
captured this way the first time, it's never issued again. So, parsing 3BEG
once normally, and again with the setup I gave, won't trigger the warning
again and therefore won't raise an error.

On Wed, May 9, 2012 at 1:39 AM, Jo?o Rodrigues <anaryin at gmail.com> wrote:

> For some reason however, I didn't get the discontinuous error .. That's
> why I proposed this alternative.
>
> Jo?o [...] Rodrigues
> http://nmr.chem.uu.nl/~joao
>
>
>
> 2012/5/9 Eric Talevich <eric.talevich at gmail.com>
>
>> The warnings module also lets you convert any warning to an error (or
>> ignore it, etc.). Use a regular expression to match the warning message:
>>
>> from Bio import PDB
>> import warnings
>> warnings.filterwarnings('error', message='.*discontinuous at.*')
>> p = PDB.PDBParser()
>> s = p.get_structure("", "3BEG.pdb")
>>
>>
>>
>> On Tue, May 8, 2012 at 3:39 PM, Jo?o Rodrigues <anaryin at gmail.com> wrote:
>>
>>> Of course. Since they throw a warning just make sure to count the
>>> warnings,
>>> parse the chain break ones, and if they are more than 0, you have chain
>>> breaks.
>>>
>>> Cheers,
>>>
>>> Jo?o [...] Rodrigues
>>> http://nmr.chem.uu.nl/~joao
>>>
>>>
>>>
>>> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>>>
>>> > Hi Jo?o,
>>> >
>>> > Is there a way though to find PDB's with chain breaks? using biopython?
>>> >
>>> > Thank you,
>>> > George
>>> >
>>> > On Tue, May 8, 2012 at 3:34 PM, Jo?o Rodrigues <anaryin at gmail.com>
>>> wrote:
>>> >
>>> >> Hi George,
>>> >>
>>> >> Chain breaks are pretty "harmless" and usually do not represent a
>>> faulty
>>> >> PDB file. The PERMISSIVE flag is for "features" like missing
>>> b-factors.
>>> >>
>>> >> Cheers,
>>> >>
>>> >> Jo?o [...] Rodrigues
>>> >> http://nmr.chem.uu.nl/~joao
>>> >>
>>> >>
>>> >>
>>> >> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>>> >>
>>> >>>  Hi,
>>> >>>
>>> >>> I thought using PERMISSIVE=0 would raise an exception if I pass a PDB
>>> >>> with
>>> >>> chain breaks.
>>> >>> However, nothing like that seems to happen.....
>>> >>>
>>> >>> For instance
>>> >>>
>>> >>> P=PDBParser(PERMISSIVE=0)
>>> >>> structure=P.get_structure('test', '7ODC.pdb')
>>> >>>
>>> >>>
>>> >>> 7ODC has 3 chain breaks but it does not raise an exception.
>>> >>>
>>> >>> Thank you
>>> >>> George
>>> >>> _______________________________________________
>>> >>> Biopython mailing list  -  Biopython at lists.open-bio.org
>>> >>> http://lists.open-bio.org/mailman/listinfo/biopython
>>> >>>
>>> >>
>>> >>
>>> >
>>>
>>> _______________________________________________
>>> Biopython mailing list  -  Biopython at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/biopython
>>>
>>
>>
>


From w.arindrarto at gmail.com  Wed May  9 12:24:43 2012
From: w.arindrarto at gmail.com (Wibowo Arindrarto)
Date: Wed, 9 May 2012 18:24:43 +0200
Subject: [Biopython] GSoC Project Update -- 1
Message-ID: <CADEGkF63OCsieC0YQNBW_2wX+UKyKcPrcYpZZ6DnvG0GZ6kJ9A@mail.gmail.com>

Hi everyone,

I just posted my latest blog updated here:
http://bow.web.id/blog/2012/05/warming-up-for-the-coding-period/

To summarize, I've spent most of my time getting to know the programs
I will support better. This has been done by:

1. Playing around with the programs to see how many different outputs
I can generate.
2. Writing scripts to automate test case generation for each of the programs.
3. Writing wrappers (for programs not yet wrapped by Biopython: FASTA,
HMMER, and BLAT) to ease writing the test case generators.
4. Continuing to complete my proposed SearchIO object naming scheme
(http://bit.ly/searchio-terms)

The test cases, their generators, and the wrappers I've written are
available in my non-Biopython gsoc repo here:
http://github.com/bow/gsoc/. Additionally, I've used the generated
test case to improve a recent bug report and submitted a fix for the
next release.

For the coming weeks prior to coding start, I'm planning to play
around more with XML and SQLite as I will use them in the code. I
might start to add more skeleton code to my current development branch
as well (https://github.com/bow/biopython).

cheers,
Bow

From mmokrejs at fold.natur.cuni.cz  Wed May  9 14:01:08 2012
From: mmokrejs at fold.natur.cuni.cz (Martin Mokrejs)
Date: Wed, 09 May 2012 20:01:08 +0200
Subject: [Biopython] Fwd: BlastParsing gives Value Error: Invalid header?
In-Reply-To: <87r4ynu3cx.fsf@fastmail.fm>
References: <mailman.2716.1327235387.3027.biopython@lists.open-bio.org>
	<CACvaKy0bi1WQSHHK0NSL0-rGitRSinCiRf81_qpRv3Mabomwjw@mail.gmail.com>
	<87r4ynu3cx.fsf@fastmail.fm>
Message-ID: <4FAAB0E4.30409@fold.natur.cuni.cz>

Hi Brad,
  I just got bitten by this myself as well. Could be the legacy blast parser
improved to give clearer error message? E.g. that it failed to find the LOCUS
line or whatever was it looking for? With the legacy BLAST documentation being
gone from current Tutorial it is easy to pick the wrong parser. ;)
  And BTW, please do not drop support for legacy BLAST. I just cannot make BLAST+
give me same alignment, no matter what arguments I use to adjust for the (it gives me
wider alignment than wanted and I can make it a look shorter, but shortening it just
a bit like legacy BLAST output .. is not doable).
  And, took me a while to find old biopython-1.52.tar.gz to lookup the old docs.
Could there be a hyperlink from Tutorial to these unpacked, browseable sources? ;)
I am speaking about http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc85 .
Thanks,
Martin
  

Brad Chapman wrote:
> 
> Sar;
> 
>> I am new to both python and biopython.
> 
> Welcome. Thanks for including your code along with the problem report.
> 
>> What I'm trying to do is to parse a blast result xml file (myblast.xml),
>> attached here.
>>
>> The code looks like this:
> [...]
>> blast_parser = NCBIStandalone.BlastParser()
> [...]
>> ValueError: Invalid header?
> 
> You are using NCBIStandalone, which parses plain text blast output. To
> parse the XML output, you should use the NCBIXML parser:
> 
> from Bio.Blast import NCBIXML
> blast_records = NCBIXML.parse(result_handle)
> 
> The tutorial has more details and examples:
> 
> http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc87
> 
> Hope this helps,
> Brad
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
> 
> 

From p.j.a.cock at googlemail.com  Wed May  9 14:25:36 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 9 May 2012 19:25:36 +0100
Subject: [Biopython] Fwd: BlastParsing gives Value Error: Invalid header?
In-Reply-To: <4FAAB0E4.30409@fold.natur.cuni.cz>
References: <mailman.2716.1327235387.3027.biopython@lists.open-bio.org>
	<CACvaKy0bi1WQSHHK0NSL0-rGitRSinCiRf81_qpRv3Mabomwjw@mail.gmail.com>
	<87r4ynu3cx.fsf@fastmail.fm> <4FAAB0E4.30409@fold.natur.cuni.cz>
Message-ID: <CAKVJ-_7W-zcdfkwMYa4gqNuRY_WK66JPV0XbnqGjeswnLu5OOg@mail.gmail.com>

On Wed, May 9, 2012 at 7:01 PM, Martin Mokrejs
<mmokrejs at fold.natur.cuni.cz> wrote:
> Hi Brad,
> ?I just got bitten by this myself as well. Could be the legacy blast parser
> improved to give clearer error message? E.g. that it failed to find the LOCUS
> line or whatever was it looking for? With the legacy BLAST documentation being
> gone from current Tutorial it is easy to pick the wrong parser. ;)
>
> ?And BTW, please do not drop support for legacy BLAST. I just cannot make BLAST+
> give me same alignment, no matter what arguments I use to adjust for the (it gives me
> wider alignment than wanted and I can make it a look shorter, but shortening it just
> a bit like legacy BLAST output .. is not doable).

Have you contacted the NCBI about this possible regression?

> ?And, took me a while to find old biopython-1.52.tar.gz to lookup the old docs.
> Could there be a hyperlink from Tutorial to these unpacked, browseable sources? ;)
> I am speaking about http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc85 .
> Thanks,
> Martin

Could you clarify if you are talking about documentation for calling
the 'legacy'
BLAST command line tools (e.g. blastall), or documentation for parsing the
plain text human readable output (which still exists in BLAST+)?

On a related point, Bow's just done a bit of work updating our plain
text parser to
cope with BLAST+ (specifically changes in BLAST 2.2.25+ and/or 2.2.26+).

One of the aims of Bow's GSoC project will make dealing with the different
BLAST formats a lot simpler.

Peter


From mmokrejs at fold.natur.cuni.cz  Wed May  9 14:48:19 2012
From: mmokrejs at fold.natur.cuni.cz (Martin Mokrejs)
Date: Wed, 09 May 2012 20:48:19 +0200
Subject: [Biopython] Fwd: BlastParsing gives Value Error: Invalid header?
In-Reply-To: <CAKVJ-_7W-zcdfkwMYa4gqNuRY_WK66JPV0XbnqGjeswnLu5OOg@mail.gmail.com>
References: <mailman.2716.1327235387.3027.biopython@lists.open-bio.org>
	<CACvaKy0bi1WQSHHK0NSL0-rGitRSinCiRf81_qpRv3Mabomwjw@mail.gmail.com>
	<87r4ynu3cx.fsf@fastmail.fm> <4FAAB0E4.30409@fold.natur.cuni.cz>
	<CAKVJ-_7W-zcdfkwMYa4gqNuRY_WK66JPV0XbnqGjeswnLu5OOg@mail.gmail.com>
Message-ID: <4FAABBF3.1030007@fold.natur.cuni.cz>

Hi Peter,

Peter Cock wrote:
> On Wed, May 9, 2012 at 7:01 PM, Martin Mokrejs
> <mmokrejs at fold.natur.cuni.cz> wrote:
>> Hi Brad,
>>  I just got bitten by this myself as well. Could be the legacy blast parser
>> improved to give clearer error message? E.g. that it failed to find the LOCUS
>> line or whatever was it looking for? With the legacy BLAST documentation being
>> gone from current Tutorial it is easy to pick the wrong parser. ;)
>>
>>  And BTW, please do not drop support for legacy BLAST. I just cannot make BLAST+
>> give me same alignment, no matter what arguments I use to adjust for the (it gives me
>> wider alignment than wanted and I can make it a look shorter, but shortening it just
>> a bit like legacy BLAST output .. is not doable).
> 
> Have you contacted the NCBI about this possible regression?

No, not yet.

>>  And, took me a while to find old biopython-1.52.tar.gz to lookup the old docs.
>> Could there be a hyperlink from Tutorial to these unpacked, browseable sources? ;)
>> I am speaking about http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc85 .
>> Thanks,
>> Martin
> 
> Could you clarify if you are talking about documentation for calling
> the 'legacy'
> BLAST command line tools (e.g. blastall), or documentation for parsing the

Yes, "blastall -p blastn ...", the default plaintext pairwise output (-m 0),
version 2.2.24.

> plain text human readable output (which still exists in BLAST+)?
> 
> On a related point, Bow's just done a bit of work updating our plain
> text parser to
> cope with BLAST+ (specifically changes in BLAST 2.2.25+ and/or 2.2.26+).
> 
> One of the aims of Bow's GSoC project will make dealing with the different
> BLAST formats a lot simpler.

Its great that we have GSoC students, would I have some spare time I would mentor
one. Good luck and thanks for your care, Peter!
Martin


From livingstonemark at gmail.com  Fri May 11 22:06:07 2012
From: livingstonemark at gmail.com (Mark Livingstone)
Date: Sat, 12 May 2012 12:06:07 +1000
Subject: [Biopython] Superposition
Message-ID: <CABGYGEwaPp-L-nn7n4_eUaQ49gNgigmgg7iwOxDnMKdpPRfghg@mail.gmail.com>

Hi Guys,

Thanks to Andrew and others for help in my previous message. I have
gone through various incarnations of my code, and suddenly found this
simple code works for the small test I have done.

I am using the datafiles from:

Kellogg, E. H., Leaver-Fay, A., & Baker, D. (2011). Role of
conformational sampling in computing mutation-induced changes in
protein structure and stability. Proteins, 79(3), 830?838.
doi:10.1002/prot.22921

These files have been modified so that there are matched PDBs which
vary only by one mutated residue, and I am trying to  carbon alpha
superimpose the PDB which is the Mutanttype over the Wildtype and save
to a PDB - which I seem to have fluked how to do. I am still working
on the code for directory traversal so I have not tried it on the
hundreds of matched PDBs yet.

Is there anything in this code which is going to bite me? How can I improve it?

------------------------------------------------------------------------------------
#!/usr/bin/env python

# Wildtype (wt) = reference, Mutanttype (mt) = alternate

from Bio.PDB import *

#parsing the PDBs
parser = PDBParser(PERMISSIVE=1)

l_wt_atoms = []
l_mt_atoms = []

pdb_out_filename = "./1bti_aligned.pdb"

wt_structure = parser.get_structure("1bpi", './1bpi.pdb')
mt_structure = parser.get_structure("1bti", './1bti.pdb')

wt_model = wt_structure[0]
mt_model = mt_structure[0]

wt_chain = wt_model["A"]
mt_chain = mt_model["A"]

for wt_residue in wt_chain:
    resnum = wt_residue.get_id()[1]
    l_wt_atoms.append( wt_residue['CA'])

for mt_residue in mt_chain:
    resnum = mt_residue.get_id()[1]
    l_mt_atoms.append( mt_residue['CA'])

##SuperImpose
sup = Superimposer()
## Specify the atom lists
## ""wildtype"" and ""mutanttype"" are lists of Atom objects
## The mt atoms will be put on the wt atoms
sup.set_atoms(l_wt_atoms, l_mt_atoms)
## Print rotation/translation/rmsd
print "ROTRAN: ", sup.rotran
print "RMS: ", sup.rms
## Apply rotation/translation to the moving atoms
sup.apply(l_mt_atoms)


print "Saving aligned structure as PDB file %s" % pdb_out_filename
io=PDBIO()
io.set_structure(mt_structure)
io.save(pdb_out_filename)

print "Done"

------------------------------------------------------------------------------------

Thanks in advance,

Mark Livingstone
B.InfoTech (Hons) Student
Griffith University
School of ICT
Southport Qld Australia


From livingstonemark at gmail.com  Sun May 13 02:54:28 2012
From: livingstonemark at gmail.com (Mark Livingstone)
Date: Sun, 13 May 2012 16:54:28 +1000
Subject: [Biopython] .ent versus .pdb files?
Message-ID: <CABGYGEx3Gr-jfU+ZegnZa_3zx_9vk62mb80R7UkeXcVi-uWjFA@mail.gmail.com>

Hi Guys,

I have a bunch of files which appear to be pdb file-like but have the
.ent file extension. Is there any difference of significance to
Bio.PDB?

Thanks in advance,

MarkL

From anaryin at gmail.com  Sun May 13 05:16:00 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Sun, 13 May 2012 11:16:00 +0200
Subject: [Biopython] .ent versus .pdb files?
In-Reply-To: <CABGYGEx3Gr-jfU+ZegnZa_3zx_9vk62mb80R7UkeXcVi-uWjFA@mail.gmail.com>
References: <CABGYGEx3Gr-jfU+ZegnZa_3zx_9vk62mb80R7UkeXcVi-uWjFA@mail.gmail.com>
Message-ID: <CAJ9sUYN1SBGs6BNW6PjVDkbUhsNKMCqdEiKg+3m0auEUhxix4A@mail.gmail.com>

Hi Mark,

Nope, not at all.

Cheers,

Jo?o
No dia 13 de Mai de 2012 08:55, "Mark Livingstone" <
livingstonemark at gmail.com> escreveu:

> Hi Guys,
>
> I have a bunch of files which appear to be pdb file-like but have the
> .ent file extension. Is there any difference of significance to
> Bio.PDB?
>
> Thanks in advance,
>
> MarkL
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From anubratadas at gmail.com  Mon May 14 08:03:29 2012
From: anubratadas at gmail.com (Anubrata Das)
Date: Mon, 14 May 2012 17:33:29 +0530
Subject: [Biopython] parsing genbank file
Message-ID: <CAHJBGA=hDZ6cjwOmZuDPYGeZPjsmM=Qi1pTCL41ZFLtM=5LDMg@mail.gmail.com>

i am new to biopython. i wanted to parse through individual records
from the genbank file of deinococcus radiodurans chromosome 1
sequence.for e.g i wanted the list of identifiers for each record
>>> identifiers=[seq_record.id for seq_record in SeqIO.parse("C:\\Dr1.gb","genbank")]
>>> identifiers[:10]
['NC_001263.1']
but i would get only one master entry. then if i wanted to parse thru
individual records
>>> record=SeqIO.parse("C:\\Dr1.gb","genbank")
>>> record.next()
SeqRecord(seq=UnknownSeq(2648638, alphabet = IUPACAmbiguousDNA(),
character = 'N'), id='NC_001263.1', name='NC_001263',
description='Deinococcus radiodurans R1 chromosome 1, complete
sequence.', dbxrefs=['Project:57665'])
>>> record.next()

Traceback (most recent call last):
  File "<pyshell#25>", line 1, in <module>
   record.next()
StopIteration
i get this output.
please tell me the correct method
regards
-- 
Anubrata Das
Scientific Officer
Molecular Biology Division
Bhabha Atomic Research Centre

From p.j.a.cock at googlemail.com  Mon May 14 09:48:39 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 14 May 2012 14:48:39 +0100
Subject: [Biopython] parsing genbank file
In-Reply-To: <CAHJBGA=hDZ6cjwOmZuDPYGeZPjsmM=Qi1pTCL41ZFLtM=5LDMg@mail.gmail.com>
References: <CAHJBGA=hDZ6cjwOmZuDPYGeZPjsmM=Qi1pTCL41ZFLtM=5LDMg@mail.gmail.com>
Message-ID: <CAKVJ-_655csWQ5VJvGowNczWmojb+oMhEKfbS-nCSpmvOGB6wA@mail.gmail.com>

On Mon, May 14, 2012 at 1:03 PM, Anubrata Das <anubratadas at gmail.com> wrote:
> i am new to biopython. i wanted to parse through individual records
> from the genbank file of deinococcus radiodurans chromosome 1
> sequence.

Probably your GenBank file only contains one record (for the
whole of chr1). You could use Bio.SeqIO.read(...) in this case:

from Bio import SeqIO
record = SeqIO.parse(r"C:\Dr1.gb","genbank")
print record.id
print len(record.features)

Peter

From David.Lapointe at umassmed.edu  Mon May 14 10:00:20 2012
From: David.Lapointe at umassmed.edu (Lapointe, David)
Date: Mon, 14 May 2012 14:00:20 +0000
Subject: [Biopython] parsing genbank file
In-Reply-To: <CAKVJ-_655csWQ5VJvGowNczWmojb+oMhEKfbS-nCSpmvOGB6wA@mail.gmail.com>
References: <CAHJBGA=hDZ6cjwOmZuDPYGeZPjsmM=Qi1pTCL41ZFLtM=5LDMg@mail.gmail.com>
	<CAKVJ-_655csWQ5VJvGowNczWmojb+oMhEKfbS-nCSpmvOGB6wA@mail.gmail.com>
Message-ID: <86BFEB1DFA6CB3448DB8AB1FC52F4059081148@ummscsmbx06.ad.umassmed.edu>

You might try looking for sequences here

ftp://ftp.ncbi.nlm.nih.gov/genomes/Bacteria/Deinococcus_radiodurans_R1_uid57665/

David

-----Original Message-----
From: biopython-bounces at lists.open-bio.org [mailto:biopython-bounces at lists.open-bio.org] On Behalf Of Peter Cock
Sent: Monday, May 14, 2012 9:49 AM
To: Anubrata Das
Cc: biopython at lists.open-bio.org
Subject: Re: [Biopython] parsing genbank file

On Mon, May 14, 2012 at 1:03 PM, Anubrata Das <anubratadas at gmail.com> wrote:
> i am new to biopython. i wanted to parse through individual records
> from the genbank file of deinococcus radiodurans chromosome 1
> sequence.

Probably your GenBank file only contains one record (for the
whole of chr1). You could use Bio.SeqIO.read(...) in this case:

from Bio import SeqIO
record = SeqIO.parse(r"C:\Dr1.gb","genbank")
print record.id
print len(record.features)

Peter
_______________________________________________
Biopython mailing list  -  Biopython at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biopython



From mmokrejs at fold.natur.cuni.cz  Wed May 16 05:32:34 2012
From: mmokrejs at fold.natur.cuni.cz (Martin Mokrejs)
Date: Wed, 16 May 2012 11:32:34 +0200
Subject: [Biopython] Legacy blast XML parser returns prematurely
	StopIteration
Message-ID: <4FB37432.7060707@fold.natur.cuni.cz>

Hi,
  I am parsing some blast 2.2.24 XML output and the last record I get is the one from
iteration 124. I see that entry is followed by a new <Iteration_iter-num> section which
is probably the culprit. I will try newer legacy blast but still, biopython could maybe
overcome this bug in XML input?



blastall -p blastn -A 4 -i SRR068315.fasta -d my_targets.fasta -F 0 -S 1 -r 2 -e 10e-30 -m 7

<?xml version="1.0"?>
<!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd">
<BlastOutput>
  <BlastOutput_program>blastn</BlastOutput_program>
  <BlastOutput_version>blastn 2.2.24 [Aug-08-2010]</BlastOutput_version>
  <BlastOutput_reference>~Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, ~Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), ~&quot;Gapped BLAST and PSI-BLAST: a new generation of protein database search~programs&quot;,  Nucleic Acids Res. 25:3389-3402.</BlastOutput_reference>
  <BlastOutput_db>my_targets.fasta</BlastOutput_db>
  <BlastOutput_query-ID>lcl|1_0</BlastOutput_query-ID>
  <BlastOutput_query-def>FYUQ5C204IQCOE length=283 xy=3463_2076 region=4 run=R_2009_07_08_19_30_38_</BlastOutput_query-def>
  <BlastOutput_query-len>318</BlastOutput_query-len>
  <BlastOutput_param>
    <Parameters>
      <Parameters_expect>1e-29</Parameters_expect>
      <Parameters_sc-match>2</Parameters_sc-match>
      <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
      <Parameters_gap-open>5</Parameters_gap-open>
      <Parameters_gap-extend>2</Parameters_gap-extend>
      <Parameters_filter>F</Parameters_filter>
    </Parameters>
  </BlastOutput_param>
  <BlastOutput_iterations>
[cut]
    <Iteration>
      <Iteration_iter-num>124</Iteration_iter-num>
      <Iteration_query-ID>lcl|124_0</Iteration_query-ID>
      <Iteration_query-def>FYUQ5C204JXGMI length=44 xy=3954_2264 region=4 run=R_2009_07_08_19_30_38_</Iteration_query-def>
      <Iteration_query-len>350</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>22</Statistics_db-num>
          <Statistics_db-len>9262</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.41</Statistics_kappa>
          <Statistics_lambda>0.625</Statistics_lambda>
          <Statistics_entropy>0.78</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>22</Statistics_db-num>
          <Statistics_db-len>9262</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.41</Statistics_kappa>
          <Statistics_lambda>0.625</Statistics_lambda>
          <Statistics_entropy>0.78</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>125</Iteration_iter-num>
      <Iteration_query-ID>lcl|125_0</Iteration_query-ID>
      <Iteration_query-def>FYUQ5C204JFG82 length=173 xy=3749_2948 region=4 run=R_2009_07_08_19_30_38_</Iteration_query-def>
      <Iteration_query-len>208</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>22</Statistics_db-num>
          <Statistics_db-len>9262</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.41</Statistics_kappa>
          <Statistics_lambda>0.625</Statistics_lambda>
          <Statistics_entropy>0.78</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>126</Iteration_iter-num>
      <Iteration_query-ID>lcl|126_0</Iteration_query-ID>
      <Iteration_query-def>FYUQ5C204I2D3A length=146 xy=3600_2628 region=4 run=R_2009_07_08_19_30_38_</Iteration_query-def>
      <Iteration_query-len>205</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>22</Statistics_db-num>
          <Statistics_db-len>9262</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.41</Statistics_kappa>
          <Statistics_lambda>0.625</Statistics_lambda>
          <Statistics_entropy>0.78</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>



Grep-ping for the iteration numbers I foresee few more cases like that ahead in the XML file:

      <Iteration_iter-num>234</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>235</Iteration_iter-num>
      <Iteration_iter-num>236</Iteration_iter-num>

      <Iteration_iter-num>345</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>346</Iteration_iter-num>
      <Iteration_iter-num>347</Iteration_iter-num>

      <Iteration_iter-num>450</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>451</Iteration_iter-num>
      <Iteration_iter-num>452</Iteration_iter-num>

      <Iteration_iter-num>555</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>556</Iteration_iter-num>
      <Iteration_iter-num>557</Iteration_iter-num>

      <Iteration_iter-num>655</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>656</Iteration_iter-num>
      <Iteration_iter-num>657</Iteration_iter-num>

      <Iteration_iter-num>759</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>760</Iteration_iter-num>
      <Iteration_iter-num>761</Iteration_iter-num>

      <Iteration_iter-num>859</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>860</Iteration_iter-num>
      <Iteration_iter-num>861</Iteration_iter-num>

      <Iteration_iter-num>956</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>957</Iteration_iter-num>
      <Iteration_iter-num>958</Iteration_iter-num>

      <Iteration_iter-num>1050</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1051</Iteration_iter-num>
      <Iteration_iter-num>1052</Iteration_iter-num>

      <Iteration_iter-num>1145</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1146</Iteration_iter-num>
      <Iteration_iter-num>1147</Iteration_iter-num>

      <Iteration_iter-num>1239</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1240</Iteration_iter-num>
      <Iteration_iter-num>1241</Iteration_iter-num>

      <Iteration_iter-num>1333</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1334</Iteration_iter-num>
      <Iteration_iter-num>1335</Iteration_iter-num>

      <Iteration_iter-num>1430</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1431</Iteration_iter-num>
      <Iteration_iter-num>1432</Iteration_iter-num>

      <Iteration_iter-num>1523</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1524</Iteration_iter-num>
      <Iteration_iter-num>1525</Iteration_iter-num>

      <Iteration_iter-num>1610</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1611</Iteration_iter-num>
      <Iteration_iter-num>1612</Iteration_iter-num>

      <Iteration_iter-num>1703</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1704</Iteration_iter-num>
      <Iteration_iter-num>1705</Iteration_iter-num>

      <Iteration_iter-num>1792</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1793</Iteration_iter-num>
      <Iteration_iter-num>1794</Iteration_iter-num>

      <Iteration_iter-num>1881</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1882</Iteration_iter-num>
      <Iteration_iter-num>1883</Iteration_iter-num>


Then, no this problem anymore until end of the XML file at:
     <Iteration_iter-num>25698</Iteration_iter-num>


Thanks for comments,
Martin

From p.j.a.cock at googlemail.com  Wed May 16 05:48:10 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 16 May 2012 10:48:10 +0100
Subject: [Biopython] Legacy blast XML parser returns prematurely
	StopIteration
In-Reply-To: <4FB37432.7060707@fold.natur.cuni.cz>
References: <4FB37432.7060707@fold.natur.cuni.cz>
Message-ID: <CAKVJ-_7yOHV1Z2znsCBU+SRsiZWKyTiySO2an588NtNSWaHr6g@mail.gmail.com>

On Wed, May 16, 2012 at 10:32 AM, Martin Mokrejs
<mmokrejs at fold.natur.cuni.cz> wrote:
> Hi,
> ?I am parsing some blast 2.2.24 XML output and the last record I get is the one from
> iteration 124. I see that entry is followed by a new <Iteration_iter-num> section which
> is probably the culprit. I will try newer legacy blast but still, biopython could maybe
> overcome this bug in XML input?
>
> blastall -p blastn -A 4 -i SRR068315.fasta -d my_targets.fasta -F 0 -S 1 -r 2 -e 10e-30 -m 7
>

Could you file a bug here and attach the complete XML test case please?
http://redmine.open-bio.org/projects/biopython

Our XML parser should handle both NCBI  'legacy' BLAST and BLAST+

Thanks,

Peter


From josefergil at gmail.com  Wed May 23 10:18:44 2012
From: josefergil at gmail.com (jose gil)
Date: Wed, 23 May 2012 16:18:44 +0200
Subject: [Biopython] starting with biopython
Message-ID: <CAD_61-yTmZ3Mt8rr2FtqdtKV_ey0fJcmxTsjUQHwdB2LeAfvtA@mail.gmail.com>

Hello everyone,

I'm starting with the program and I have some problems, because I don't
know how download the files in order the program can load them.
from the python shell I follow the instructions in the tutorial in order to
load the sequence but I don't know actually where is the correct place to
save the files I download for example from GenBank.

Thank you very much for your help,

-- 
Jos? Fernando Gil R.


From p.j.a.cock at googlemail.com  Wed May 23 10:45:04 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 23 May 2012 15:45:04 +0100
Subject: [Biopython] starting with biopython
In-Reply-To: <CAD_61-yTmZ3Mt8rr2FtqdtKV_ey0fJcmxTsjUQHwdB2LeAfvtA@mail.gmail.com>
References: <CAD_61-yTmZ3Mt8rr2FtqdtKV_ey0fJcmxTsjUQHwdB2LeAfvtA@mail.gmail.com>
Message-ID: <CAKVJ-_4++y0cLwnsNnhe-f9Pvgc=nQCbLDdieWnezLn6Vn01Gg@mail.gmail.com>

On Wed, May 23, 2012 at 3:18 PM, jose gil <josefergil at gmail.com> wrote:
> Hello everyone,
>
> I'm starting with the program and I have some problems, because I don't
> know how download the files in order the program can load them.
> from the python shell I follow the instructions in the tutorial in order to
> load the sequence but I don't know actually where is the correct place to
> save the files I download for example from GenBank.
>
> Thank you very much for your help,

The simplest approach is to put your Python scripts and data files
all in the same folder together. Then you don't need to bother with
giving paths, just local filenames will be fine.

Some experience with working at the command line would help
with understanding paths, absolute paths, and relative paths.

Are you working on Windows?

Note that by default Windows hides the extension of known
file formats - I always turn this off so that in Explorer I see the
full file names. What I mean is I prefer to see "example.fasta"
and "example.gbk" instead of two files apparently called
"example" but with a different icon. You'll find there are lots
of file extensions in Bioinformatics, and they are important.

Peter

From animesh.agrawal at anu.edu.au  Thu May 24 01:58:12 2012
From: animesh.agrawal at anu.edu.au (Animesh Agrawal)
Date: Thu, 24 May 2012 15:58:12 +1000
Subject: [Biopython] Integrating SQL query to biopython
Message-ID: <000001cd3972$33fc4c40$9bf4e4c0$@agrawal@anu.edu.au>

Hi, 

I am running small SQL queries to select sequences from a local BIOSQL
database. One instance such query is as follows:

 

SELECT  biosequence.*

FROM    biosequence JOIN bioentry USING (bioentry_id)

WHERE   biosequence.seq NOT LIKE "%X%"

AND   biosequence.alphabet = 'protein' 

 

I am wondering, how do I integrate this SQL query with Biopython code to get
the output in form of SeqRecord or Seq objects.

 

Cheers,

Animesh  

 

Animesh Agrawal

PhD Scholar

Computational & Conceptual Biology, JCSMR 

Australian National University 

Canberra, Australia

Tel:    +61 2 6125 8303

Email:  animesh.agrawal at anu.edu.au

 


From p.j.a.cock at googlemail.com  Thu May 24 05:10:13 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 24 May 2012 10:10:13 +0100
Subject: [Biopython] Integrating SQL query to biopython
In-Reply-To: <4fbdcf67.ca48340a.3ba1.5c63SMTPIN_ADDED@mx.google.com>
References: <4fbdcf67.ca48340a.3ba1.5c63SMTPIN_ADDED@mx.google.com>
Message-ID: <CAKVJ-_5YdDGZB=DiY2QP2BfWR1CGOM2pJPrA54Ycg256GqqLOQ@mail.gmail.com>

On Thu, May 24, 2012 at 6:58 AM, Animesh Agrawal
<animesh.agrawal at anu.edu.au> wrote:
> Hi,
>
> I am running small SQL queries to select sequences from a local BIOSQL
> database. One instance such query is as follows:
>
>
>
> SELECT ?biosequence.*
>
> FROM ? ?biosequence JOIN bioentry USING (bioentry_id)
>
> WHERE ? biosequence.seq NOT LIKE "%X%"
>
> AND ? biosequence.alphabet = 'protein'
>
>
>
> I am wondering, how do I integrate this SQL query with Biopython code to get
> the output in form of SeqRecord or Seq objects.

>From your direct database access, get the bioentry table's primary ID,
and then use that to create a DBSeqRecord object (which is a subclass
of SeqRecord and will also load the sequence for you).

You will also need the adapter object as the other initialization argument,
which is how the DBSeqRecord knows which database to read from.
Get that by connecting to the BioSQL database through the Biopython
code as usual.

Something like this (untested):

from BioSQL import BioSeqDatabase
from BioSQL.BioSeq import DBSeqRecord
#Connect to BioSQL database as usual,
server = BioSeqDatabase.open_database(driver="MySQLdb", user="root",
                     passwd = "", host = "localhost", db="bioseqdb")
primary_id = .... #your code here
#Use Biopython's BioSQL SeqRecord loading:
record = DBSeqRecord(server.adapter, primary_id)

Peter


From chapmanb at 50mail.com  Thu May 24 05:15:02 2012
From: chapmanb at 50mail.com (Brad Chapman)
Date: Thu, 24 May 2012 05:15:02 -0400
Subject: [Biopython] Integrating SQL query to biopython
In-Reply-To: <000001cd3972$33fc4c40$9bf4e4c0$@agrawal@anu.edu.au>
References: <000001cd3972$33fc4c40$9bf4e4c0$@agrawal@anu.edu.au>
Message-ID: <87d35uos89.fsf@fastmail.fm>


Animesh;

> I am running small SQL queries to select sequences from a local BIOSQL
> database. One instance such query is as follows:
>
> SELECT  biosequence.*
> FROM    biosequence JOIN bioentry USING (bioentry_id)
> WHERE   biosequence.seq NOT LIKE "%X%"
> AND   biosequence.alphabet = 'protein' 
>
> I am wondering, how do I integrate this SQL query with Biopython code to get
> the output in form of SeqRecord or Seq objects.

If you have the interval bioentry IDs you can use the BioSQL code
directly to get SeqRecord compatible objects:

from BioSQL import BioSeqDatabase
from BioSQL.BioSeq import DBSeqRecord

server = BioSeqDatabase.open_database(driver="MySQLdb", user="root",
                     passwd = "", host = "localhost", db="bioseqdb")
rec = DBSeqRecord(server.adaptor, your_bioentry_id)

Hope this helps,
Brad

From p.j.a.cock at googlemail.com  Thu May 24 05:28:14 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 24 May 2012 10:28:14 +0100
Subject: [Biopython] Integrating SQL query to biopython
In-Reply-To: <87d35uos89.fsf@fastmail.fm>
References: <87d35uos89.fsf@fastmail.fm>
Message-ID: <CAKVJ-_7XzuBKLeY_Vj=OftWpESn4xpLD+YSn-WQmACi9yB7zmA@mail.gmail.com>

On Thu, May 24, 2012 at 10:15 AM, Brad Chapman <chapmanb at 50mail.com> wrote:
>
> Animesh;
>
>> I am running small SQL queries to select sequences from a local BIOSQL
>> database. One instance such query is as follows:
>>
>> SELECT ?biosequence.*
>> FROM ? ?biosequence JOIN bioentry USING (bioentry_id)
>> WHERE ? biosequence.seq NOT LIKE "%X%"
>> AND ? biosequence.alphabet = 'protein'
>>
>> I am wondering, how do I integrate this SQL query with Biopython code to get
>> the output in form of SeqRecord or Seq objects.
>
> If you have the interval bioentry IDs you can use the BioSQL code
> directly to get SeqRecord compatible objects:
>
> from BioSQL import BioSeqDatabase
> from BioSQL.BioSeq import DBSeqRecord
>
> server = BioSeqDatabase.open_database(driver="MySQLdb", user="root",
> ? ? ? ? ? ? ? ? ? ? passwd = "", host = "localhost", db="bioseqdb")
> rec = DBSeqRecord(server.adaptor, your_bioentry_id)
>
> Hope this helps,
> Brad

Good to see we gave the same answer :)

Peter


From livingstonemark at gmail.com  Sun May 27 21:55:25 2012
From: livingstonemark at gmail.com (Mark Livingstone)
Date: Mon, 28 May 2012 11:55:25 +1000
Subject: [Biopython] Getting the atom number of a CA residue
Message-ID: <CABGYGEy_2VsH8qP6MZGzGK6PS4GAmXmNZU7sOOVtdxH_bD95AQ@mail.gmail.com>

Hi Guys,

I want to use the Bio.PDB.NeighborSearch. To do so, it seems I need to
tell it what atom to center the search on. I have constructed this
convoluted center finding method ;-) and I'm wondering if there is
something simpler!!


    atoms = Bio.PDB.Selection.unfold_entities(mtc, "A")
    # we find the atom number of the mutation site residue's CA atom
which becomes the center of our search radius
    center = atoms[mtc[mutation_site].get_unpacked_list()[1].get_serial_number()].get_coord()
    bions = Bio.PDB.NeighborSearch(atoms)
    atoms_found = bions.search(center, 5.0, "A")
    residues_found = bions.search(center, 5.0, "R")


Using 1bti.pdb and asking for the Residue 22 [=mutation_site] CA [1]
does give me atom #187 coords which is correct. At the moment I am
only interested in CA, but I realise this somewhat hardcoded solution
will not scale!

Secondly, what I eventually want to get is more of a range function
where I can find e.g. what is between 5-10A from center. Since
neighborsearch doesn't give access to distances of the atoms /
residues, am I correct in thinking I will have to "roll my own"
neighbourhoodsearch and construct a sorted by distance list and
iterate through it getting e.g. 5 < distance < 10 or similar?

Thanks for your thoughts.

MarkL

From livingstonemark at gmail.com  Tue May 29 23:09:41 2012
From: livingstonemark at gmail.com (Mark Livingstone)
Date: Wed, 30 May 2012 13:09:41 +1000
Subject: [Biopython] Getting side chain atoms?
Message-ID: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>

Hi Guys,

I notice on the wiki that it says the mailing list is at
biopython at biopython.org, but when I suscribed it said to use
biopython at lists.open-bio.org, so I'm wondering what the difference is?

What is the simplest way to get a list of the side chain atoms given
say a residue number?

Also, not entirely related to Biopython, but I'm wondering if there is
some way to get a sense of the overall shape of a protein? Like is it
globular, a big string, a sheet or what? I can see if you looked at
the bounding box, that might be a starting point, but does anyone have
any other ideas? I habe been looking at it as a geometry type problem
but haven't gotten too far yet.

Thanks in advance,

MarkL

From livingstonemark at gmail.com  Tue May 29 23:09:41 2012
From: livingstonemark at gmail.com (Mark Livingstone)
Date: Wed, 30 May 2012 13:09:41 +1000
Subject: [Biopython] Getting side chain atoms?
Message-ID: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>

Hi Guys,

I notice on the wiki that it says the mailing list is at
biopython at biopython.org, but when I suscribed it said to use
biopython at lists.open-bio.org, so I'm wondering what the difference is?

What is the simplest way to get a list of the side chain atoms given
say a residue number?

Also, not entirely related to Biopython, but I'm wondering if there is
some way to get a sense of the overall shape of a protein? Like is it
globular, a big string, a sheet or what? I can see if you looked at
the bounding box, that might be a starting point, but does anyone have
any other ideas? I habe been looking at it as a geometry type problem
but haven't gotten too far yet.

Thanks in advance,

MarkL

From dilara.ally at gmail.com  Tue May 29 23:30:27 2012
From: dilara.ally at gmail.com (Dilara Ally)
Date: Tue, 29 May 2012 20:30:27 -0700
Subject: [Biopython] replace header
Message-ID: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>

Hi Guys, 

I'm interested in replacing just one part of the header for every read in a 40Gb fastq file.  Because the files are so huge I don't want to read the entire file into the memory just the single read and then rewrite to a new file.   The problem as it stands is that I'm  creating all new SeqRecord object, appending a list called newsolid.  And then once that list is complete with all records,  I write that list to a new file.  

Preferably I'd like to write each new SeqRecord immediately to a file.  Sorry if I've missed this lesson in the Biopython tutorial and cook book!  Any help would be greatly appreciated!

Here is the code. 

from Bio import SeqIO
from Bio.SeqRecord import SeqRecord
newsolid=[]
for seq_record in SeqIO.parse("solid_1.fastq", "fastq"):
   print seq_record.id
   original_header=seq_record.id
   import re
   subfind=r"(\w+)_(\w+)"
   result=re.search(subfind, original_header)
   print result.groups()
   subheader="_1"
   subreplace=r"\1_1"
   new_header=re.sub(subfind, subreplace, original_header)
   print new_header
   newfastqrecord=SeqRecord(seq_record.seq, id=new_header, letter_annotations=seq_record.letter_annotations)
   newsolid.append(newfastqrecord)

output="newsolid_1.fastq"
from Bio import SeqIO
SeqIO.write(newsolid, output, "fastq")


Cheers, Dilara


From arklenna at gmail.com  Tue May 29 23:44:41 2012
From: arklenna at gmail.com (Lenna Peterson)
Date: Tue, 29 May 2012 23:44:41 -0400
Subject: [Biopython] replace header
In-Reply-To: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>
References: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>
Message-ID: <CAK610_4GGZKe0PW_zRkd5uqZCenowmT++_HGqGcyE5j=tpfgzg@mail.gmail.com>

Hi Dilara,

Opening a file for append with 'a' allows successive writes to go to
the end of the file.

Before the loop:

    out_handle = open("newsolid_1.fastq", 'a')

In the loop:

    SeqIO.write(newfastqrecord, out_handle, "fastq")

After the loop:

    out_handle.close()


You may have to manually write newlines to the file but hopefully the
fastq writer handles that properly.

Hope that helps,

Lenna

From dilara.ally at gmail.com  Tue May 29 23:54:13 2012
From: dilara.ally at gmail.com (Dilara Ally)
Date: Tue, 29 May 2012 20:54:13 -0700
Subject: [Biopython] replace header
In-Reply-To: <CAK610_4GGZKe0PW_zRkd5uqZCenowmT++_HGqGcyE5j=tpfgzg@mail.gmail.com>
References: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>
	<CAK610_4GGZKe0PW_zRkd5uqZCenowmT++_HGqGcyE5j=tpfgzg@mail.gmail.com>
Message-ID: <A4360020-0E00-4F93-9DE0-B48E849C9416@gmail.com>

Thanks!  That worked. 

On May 29, 2012, at 8:44 PM, Lenna Peterson wrote:

> Hi Dilara,
> 
> Opening a file for append with 'a' allows successive writes to go to
> the end of the file.
> 
> Before the loop:
> 
>    out_handle = open("newsolid_1.fastq", 'a')
> 
> In the loop:
> 
>    SeqIO.write(newfastqrecord, out_handle, "fastq")
> 
> After the loop:
> 
>    out_handle.close()
> 
> 
> You may have to manually write newlines to the file but hopefully the
> fastq writer handles that properly.
> 
> Hope that helps,
> 
> Lenna


From anaryin at gmail.com  Wed May 30 02:04:14 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Wed, 30 May 2012 08:04:14 +0200
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
Message-ID: <CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>

Hi Mark,

The gyration tensor should give you the means of calculating how oblate or
prolate your molecule is.

Regarding the sidechain, i think you just have to manually do it, but since
the backbone atoms are always the same it shouldn't be too hard.

Cheers,

Jo?o
No dia 30 de Mai de 2012 05:10, "Mark Livingstone" <
livingstonemark at gmail.com> escreveu:

> Hi Guys,
>
> I notice on the wiki that it says the mailing list is at
> biopython at biopython.org, but when I suscribed it said to use
> biopython at lists.open-bio.org, so I'm wondering what the difference is?
>
> What is the simplest way to get a list of the side chain atoms given
> say a residue number?
>
> Also, not entirely related to Biopython, but I'm wondering if there is
> some way to get a sense of the overall shape of a protein? Like is it
> globular, a big string, a sheet or what? I can see if you looked at
> the bounding box, that might be a starting point, but does anyone have
> any other ideas? I habe been looking at it as a geometry type problem
> but haven't gotten too far yet.
>
> Thanks in advance,
>
> MarkL
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From anaryin at gmail.com  Wed May 30 02:04:14 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Wed, 30 May 2012 08:04:14 +0200
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
Message-ID: <CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>

Hi Mark,

The gyration tensor should give you the means of calculating how oblate or
prolate your molecule is.

Regarding the sidechain, i think you just have to manually do it, but since
the backbone atoms are always the same it shouldn't be too hard.

Cheers,

Jo?o
No dia 30 de Mai de 2012 05:10, "Mark Livingstone" <
livingstonemark at gmail.com> escreveu:

> Hi Guys,
>
> I notice on the wiki that it says the mailing list is at
> biopython at biopython.org, but when I suscribed it said to use
> biopython at lists.open-bio.org, so I'm wondering what the difference is?
>
> What is the simplest way to get a list of the side chain atoms given
> say a residue number?
>
> Also, not entirely related to Biopython, but I'm wondering if there is
> some way to get a sense of the overall shape of a protein? Like is it
> globular, a big string, a sheet or what? I can see if you looked at
> the bounding box, that might be a starting point, but does anyone have
> any other ideas? I habe been looking at it as a geometry type problem
> but haven't gotten too far yet.
>
> Thanks in advance,
>
> MarkL
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From p.j.a.cock at googlemail.com  Wed May 30 03:45:29 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 30 May 2012 08:45:29 +0100
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
Message-ID: <CAKVJ-_7S4mhdWGuAtiwzRxvvFxAWNeQHC3Z64gbmSACGrQqkSg@mail.gmail.com>

On Wednesday, May 30, 2012, Mark Livingstone wrote:

> Hi Guys,
>
> I notice on the wiki that it says the mailing list is at
> biopython at biopython.org <javascript:;>, but when I suscribed it said to
> use
> biopython at lists.open-bio.org <javascript:;>, so I'm wondering what the
> difference is?
>
>
They are the same - the OBF (open-bio.org) machine also
handles the BioPerl mailing lists etc as well.

Peter

From p.j.a.cock at googlemail.com  Wed May 30 03:45:29 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 30 May 2012 08:45:29 +0100
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
Message-ID: <CAKVJ-_7S4mhdWGuAtiwzRxvvFxAWNeQHC3Z64gbmSACGrQqkSg@mail.gmail.com>

On Wednesday, May 30, 2012, Mark Livingstone wrote:

> Hi Guys,
>
> I notice on the wiki that it says the mailing list is at
> biopython at biopython.org <javascript:;>, but when I suscribed it said to
> use
> biopython at lists.open-bio.org <javascript:;>, so I'm wondering what the
> difference is?
>
>
They are the same - the OBF (open-bio.org) machine also
handles the BioPerl mailing lists etc as well.

Peter

From p.j.a.cock at googlemail.com  Wed May 30 04:56:57 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 30 May 2012 09:56:57 +0100
Subject: [Biopython] replace header
In-Reply-To: <A4360020-0E00-4F93-9DE0-B48E849C9416@gmail.com>
References: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>
	<CAK610_4GGZKe0PW_zRkd5uqZCenowmT++_HGqGcyE5j=tpfgzg@mail.gmail.com>
	<A4360020-0E00-4F93-9DE0-B48E849C9416@gmail.com>
Message-ID: <CAKVJ-_4hHe=THg0ZLokt2mja15-vd+DBsB+a-YFZGNgiO2zADg@mail.gmail.com>

On Wed, May 30, 2012 at 4:54 AM, Dilara Ally <dilara.ally at gmail.com> wrote:
> Thanks! ?That worked.
>
> On May 29, 2012, at 8:44 PM, Lenna Peterson wrote:
>
>> Hi c,
>>
>> Opening a file for append with 'a' allows successive writes to go to
>> the end of the file.
>>
>> Before the loop:
>>
>> ? ?out_handle = open("newsolid_1.fastq", 'a')
>>
>> In the loop:
>>
>> ? ?SeqIO.write(newfastqrecord, out_handle, "fastq")
>>
>> After the loop:
>>
>> ? ?out_handle.close()

Hi Dilara & Lenna,

I would use append mode with caution - it will have side effects
like if you run this script twice, the output file will double in size
(the first run plus the second run). Wouldn't opening in write
mode work just as well here?
i.e. Open the handle, do the loop, close the handle.

There are some other further changes I would suggest.
First, you don't need to create a new SeqRecord, you can
modify the old record in situ. This will be faster as it avoids
extra object creation:

...
newfastqrecord=SeqRecord(seq_record.seq, id=new_header,
letter_annotations=seq_record.letter_annotations)
...

becomes just:

...
seq_record.id = new_header
...

Next, it is better to call SeqIO.write(...) once to do the whole
file. On simple file formats like FASTA, FASTQ, GenBank,
there is no header/footer structure so you can write each
record independently. In general this is not possible, e.g.
SFF files. Moreover, multiple calls to SeqIO.write(...) is
slower than one single call.

The key point about using SeqIO.write(...) once to do a whole
file is this requires an iterator based approach. For example,
using a generator expression and a function acting on a single
record:

def modify_record(record):
    #Do something sensible to the headers here:
    record.id = "modified"
    return record
#This is a generator expression:
modified = (modify_record(r) for r in SeqIO.parse("solid_1.fastq", "fastq"))
count = SeqIO.write(modified, "newsolid_1.fastq", "fastq")
print "Modified %i records" % count

Equivalently using a generator function which does the
looping itself:

def modify_records(records):
    for record in records:
        #Do something sensible to the headers here:
        record.id = "modified"
        yield record
count = SeqIO.write(modify_records(SeqIO.parse("solid_1.fastq",
"fastq")), "newsolid_1.fastq", "fastq")
print "Modified %i records" % count

Getting to gripes with iterators and thinking this way takes
a while - but it is extremely useful for dealing with large
datasets efficiently (without running out of memory).

Now, For FASTQ in particular, the files are usually very large,
and using SeqIO and SeqRecord objects can be too slow.
You might find this useful:
http://news.open-bio.org/news/2009/09/biopython-fast-fastq/

Peter


From ferreirafm at usp.br  Wed May 30 08:57:49 2012
From: ferreirafm at usp.br (Frederico Moras Ferreira)
Date: Wed, 30 May 2012 09:57:49 -0300
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
	<CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>
Message-ID: <4FC6194D.1060802@usp.br>

Hi Mark,
I'm also very interested in overall protein shape analysis. I'm 
completely new to Biopython and can't help you much. Regarding to your 
question itself, that's something not trivial. One of the approaches 
would be to calculate the center of mass of your protein and iteratively 
calculate the momentum of inertia along three mutually perpendicular 
axes so as it is maximum in one direction and minimum in another. 
Sampling the momentum of inertia of the third axis and comparing with 
the other two will give a good estimation of your protein overall shape.
Best of luck,
Fred

Em 30-05-2012 03:04, Jo?o Rodrigues escreveu:
> Hi Mark,
>
> The gyration tensor should give you the means of calculating how oblate or
> prolate your molecule is.
>
> Regarding the sidechain, i think you just have to manually do it, but since
> the backbone atoms are always the same it shouldn't be too hard.
>
> Cheers,
>
> Jo?o
> No dia 30 de Mai de 2012 05:10, "Mark Livingstone"<
> livingstonemark at gmail.com>  escreveu:
>
>> Hi Guys,
>>
>> I notice on the wiki that it says the mailing list is at
>> biopython at biopython.org, but when I suscribed it said to use
>> biopython at lists.open-bio.org, so I'm wondering what the difference is?
>>
>> What is the simplest way to get a list of the side chain atoms given
>> say a residue number?
>>
>> Also, not entirely related to Biopython, but I'm wondering if there is
>> some way to get a sense of the overall shape of a protein? Like is it
>> globular, a big string, a sheet or what? I can see if you looked at
>> the bounding box, that might be a starting point, but does anyone have
>> any other ideas? I habe been looking at it as a geometry type problem
>> but haven't gotten too far yet.
>>
>> Thanks in advance,
>>
>> MarkL
>> _______________________________________________
>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biopython
>>
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython


From golubchi at stats.ox.ac.uk  Wed May 30 09:40:38 2012
From: golubchi at stats.ox.ac.uk (Tanya Golubchik)
Date: Wed, 30 May 2012 14:40:38 +0100
Subject: [Biopython] Bio.Phylo: midpoint root?
Message-ID: <4FC62356.2030709@stats.ox.ac.uk>

Hello,

Does anyone have a quickie method for calculating the midpoint root of a
given tree?

Thanks,
Tanya

From eric.talevich at gmail.com  Wed May 30 10:55:11 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Wed, 30 May 2012 10:55:11 -0400
Subject: [Biopython] Bio.Phylo: midpoint root?
In-Reply-To: <4FC62356.2030709@stats.ox.ac.uk>
References: <4FC62356.2030709@stats.ox.ac.uk>
Message-ID: <CAMC681nufLjfBa4xwdQjcTFrv-DT237dFpfNei6_6QLXFm4iEw@mail.gmail.com>

On Wed, May 30, 2012 at 9:40 AM, Tanya Golubchik <golubchi at stats.ox.ac.uk>wrote:

> Hello,
>
> Does anyone have a quickie method for calculating the midpoint root of a
> given tree?
>
>
It's been on my to-do list. (The first step was adding the keyword argument
'outgroup_branch_length' to root_with_outgroup.) The tree method 'depths'
should also be handy.

The algorithm I had in mind looks like:
1. Take the depths() of each clade under the root.
2. Identify the deepest tip under each clade.
3. Assuming the tree is bifurcating, take the shallower tip as the
"out_tip" and the deeper tip as the "in_tip".
4. If the difference between the depths of "out_tip" and "in_tip" are
greater than the length of the branch connecting the two clades below the
root (tree.clade[0].branch_length + tree.clade[1].branch_length), there's a
possibility that a better out_tip is hiding inside the deeper clade. So,
repeat the operation on tree.clade[1], recursively, until meeting the stop
condition I just described.
5. To identify the midpoint, halve the distance between in_tip and out_tip,
and trace backward from in_tip by that distance to reach the new root.

With multifurcations, the algorithm looks similar, but with more loops.

I too would be delighted to see a better algorithm for this.

-E

From anaryin at gmail.com  Wed May 30 11:13:41 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Wed, 30 May 2012 17:13:41 +0200
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <4FC6194D.1060802@usp.br>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
	<CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>
	<4FC6194D.1060802@usp.br>
Message-ID: <CAJ9sUYMvTaYp3=1OmrT81KrFs6sLmJF6qe6pEu7L53o2aOsatg@mail.gmail.com>

Dear Frederico and Mark,

I have a few scripts to do exactly what Frederico described, that play with
Biopython. I will share them tomorrow and put an example here of how they
work. Eventually it will become part of Biopython, in a future release I
hope..

Cheers,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



2012/5/30 Frederico Moras Ferreira <ferreirafm at usp.br>

> Hi Mark,
> I'm also very interested in overall protein shape analysis. I'm completely
> new to Biopython and can't help you much. Regarding to your question
> itself, that's something not trivial. One of the approaches would be to
> calculate the center of mass of your protein and iteratively calculate the
> momentum of inertia along three mutually perpendicular axes so as it is
> maximum in one direction and minimum in another. Sampling the momentum of
> inertia of the third axis and comparing with the other two will give a good
> estimation of your protein overall shape.
> Best of luck,
> Fred
>
> Em 30-05-2012 03:04, Jo?o Rodrigues escreveu:
>
>  Hi Mark,
>>
>> The gyration tensor should give you the means of calculating how oblate or
>> prolate your molecule is.
>>
>> Regarding the sidechain, i think you just have to manually do it, but
>> since
>> the backbone atoms are always the same it shouldn't be too hard.
>>
>> Cheers,
>>
>> Jo?o
>> No dia 30 de Mai de 2012 05:10, "Mark Livingstone"<
>> livingstonemark at gmail.com>  escreveu:
>>
>>  Hi Guys,
>>>
>>> I notice on the wiki that it says the mailing list is at
>>> biopython at biopython.org, but when I suscribed it said to use
>>> biopython at lists.open-bio.org, so I'm wondering what the difference is?
>>>
>>> What is the simplest way to get a list of the side chain atoms given
>>> say a residue number?
>>>
>>> Also, not entirely related to Biopython, but I'm wondering if there is
>>> some way to get a sense of the overall shape of a protein? Like is it
>>> globular, a big string, a sheet or what? I can see if you looked at
>>> the bounding box, that might be a starting point, but does anyone have
>>> any other ideas? I habe been looking at it as a geometry type problem
>>> but haven't gotten too far yet.
>>>
>>> Thanks in advance,
>>>
>>> MarkL
>>> ______________________________**_________________
>>> Biopython mailing list  -  Biopython at lists.open-bio.org
>>> http://lists.open-bio.org/**mailman/listinfo/biopython<http://lists.open-bio.org/mailman/listinfo/biopython>
>>>
>>>  ______________________________**_________________
>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> http://lists.open-bio.org/**mailman/listinfo/biopython<http://lists.open-bio.org/mailman/listinfo/biopython>
>>
>
> ______________________________**_________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/**mailman/listinfo/biopython<http://lists.open-bio.org/mailman/listinfo/biopython>
>


From ferreirafm at usp.br  Wed May 30 12:55:23 2012
From: ferreirafm at usp.br (Frederico Moras Ferreira)
Date: Wed, 30 May 2012 13:55:23 -0300
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CAJ9sUYMvTaYp3=1OmrT81KrFs6sLmJF6qe6pEu7L53o2aOsatg@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
	<CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>
	<4FC6194D.1060802@usp.br>
	<CAJ9sUYMvTaYp3=1OmrT81KrFs6sLmJF6qe6pEu7L53o2aOsatg@mail.gmail.com>
Message-ID: <4FC650FB.8090502@usp.br>

That's great! Look forward hearing from you.
Cheers,
Fred

Em 30-05-2012 12:13, Jo?o Rodrigues escreveu:
> Dear Frederico and Mark,
>
> I have a few scripts to do exactly what Frederico described, that play 
> with Biopython. I will share them tomorrow and put an example here of 
> how they work. Eventually it will become part of Biopython, in a 
> future release I hope..
>
> Cheers,
>
> Jo?o [...] Rodrigues
> http://nmr.chem.uu.nl/~joao <http://nmr.chem.uu.nl/%7Ejoao>
>
>
>
> 2012/5/30 Frederico Moras Ferreira <ferreirafm at usp.br 
> <mailto:ferreirafm at usp.br>>
>
>     Hi Mark,
>     I'm also very interested in overall protein shape analysis. I'm
>     completely new to Biopython and can't help you much. Regarding to
>     your question itself, that's something not trivial. One of the
>     approaches would be to calculate the center of mass of your
>     protein and iteratively calculate the momentum of inertia along
>     three mutually perpendicular axes so as it is maximum in one
>     direction and minimum in another. Sampling the momentum of inertia
>     of the third axis and comparing with the other two will give a
>     good estimation of your protein overall shape.
>     Best of luck,
>     Fred
>
>     Em 30-05-2012 03:04, Jo?o Rodrigues escreveu:
>
>         Hi Mark,
>
>         The gyration tensor should give you the means of calculating
>         how oblate or
>         prolate your molecule is.
>
>         Regarding the sidechain, i think you just have to manually do
>         it, but since
>         the backbone atoms are always the same it shouldn't be too hard.
>
>         Cheers,
>
>         Jo?o
>         No dia 30 de Mai de 2012 05:10, "Mark Livingstone"<
>         livingstonemark at gmail.com <mailto:livingstonemark at gmail.com>>
>          escreveu:
>
>             Hi Guys,
>
>             I notice on the wiki that it says the mailing list is at
>             biopython at biopython.org <mailto:biopython at biopython.org>,
>             but when I suscribed it said to use
>             biopython at lists.open-bio.org
>             <mailto:biopython at lists.open-bio.org>, so I'm wondering
>             what the difference is?
>
>             What is the simplest way to get a list of the side chain
>             atoms given
>             say a residue number?
>
>             Also, not entirely related to Biopython, but I'm wondering
>             if there is
>             some way to get a sense of the overall shape of a protein?
>             Like is it
>             globular, a big string, a sheet or what? I can see if you
>             looked at
>             the bounding box, that might be a starting point, but does
>             anyone have
>             any other ideas? I habe been looking at it as a geometry
>             type problem
>             but haven't gotten too far yet.
>
>             Thanks in advance,
>
>             MarkL
>             _______________________________________________
>             Biopython mailing list  - Biopython at lists.open-bio.org
>             <mailto:Biopython at lists.open-bio.org>
>             http://lists.open-bio.org/mailman/listinfo/biopython
>
>         _______________________________________________
>         Biopython mailing list  - Biopython at lists.open-bio.org
>         <mailto:Biopython at lists.open-bio.org>
>         http://lists.open-bio.org/mailman/listinfo/biopython
>
>
>     _______________________________________________
>     Biopython mailing list  - Biopython at lists.open-bio.org
>     <mailto:Biopython at lists.open-bio.org>
>     http://lists.open-bio.org/mailman/listinfo/biopython
>
>


From eric.talevich at gmail.com  Thu May 31 00:36:49 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Thu, 31 May 2012 00:36:49 -0400
Subject: [Biopython] Bio.Phylo: midpoint root?
In-Reply-To: <CAMC681nufLjfBa4xwdQjcTFrv-DT237dFpfNei6_6QLXFm4iEw@mail.gmail.com>
References: <4FC62356.2030709@stats.ox.ac.uk>
	<CAMC681nufLjfBa4xwdQjcTFrv-DT237dFpfNei6_6QLXFm4iEw@mail.gmail.com>
Message-ID: <CAMC681mD0PbX8KHmBo4mUSLkMPhgKi=sbVq5O9w_bMdaz750Ow@mail.gmail.com>

On Wed, May 30, 2012 at 10:55 AM, Eric Talevich <eric.talevich at gmail.com>wrote:

> On Wed, May 30, 2012 at 9:40 AM, Tanya Golubchik <golubchi at stats.ox.ac.uk>wrote:
>
>> Hello,
>>
>> Does anyone have a quickie method for calculating the midpoint root of a
>> given tree?
>>
>>
> It's been on my to-do list. (The first step was adding the keyword
> argument 'outgroup_branch_length' to root_with_outgroup.) The tree method
> 'depths' should also be handy.
>
> The algorithm I had in mind looks like:
>
<madness>

>
> I too would be delighted to see a better algorithm for this.
>
>
I implemented this in an intuitive but very inefficient way, calculating
the pairwise distances between all tips of the tree. You can try it from
git:
https://github.com/biopython/biopython/commit/94c128bd428cc5d53b50edd1d2e4730ee212f530

It would still be nice to see a better algorithm, if anyone has one on hand.

-E

From francesco.strozzi at gmail.com  Thu May 31 05:11:25 2012
From: francesco.strozzi at gmail.com (Francesco Strozzi)
Date: Thu, 31 May 2012 11:11:25 +0200
Subject: [Biopython] EU Codefest 2012 Announcement
Message-ID: <CACtet2RtKqXavJ4C7An==MJP0MTW-yeHYwi9xKqWh6RP02Qp6w@mail.gmail.com>

The Open Bioinformatics Foundation (OBF) EU-CodeFest will be held in
Parco Tecnologico Padano (PTP) Lodi, Italy on the19th ? 20th of July.
The CodeFest is a small focused event under the auspices of the Open
Bioinformatics Foundation, and is a sister event of BOSC2012 being
held in California USA this year.
Three main topics will be worked on during the CodeFest:

- NGS and high performance parsers for OpenBio projects.
- RDF and semantic web for bioinformatics.
- Bioinformatics pipelines definition, execution and distribution.

The number of places is limited to 30 participants at maximum, on a
first come, first serve basis. Undergraduate and PhD students are
welcome to participate.
The cost of the event is EUR 100 per person, which includes also
lunches, coffee breaks and the social dinner on the 19th of July.
Only for students, we can sponsor a limited number of attendees that
will not pay for the registration fee. Those students, willing to
participate for free to the event, will be asked to submit their
qualifications and experience in software development. The organizing
committee will review students? applications before final acceptance.
Talks and abstracts may be presented during the CodeFest in sessions
of 10 minutes plus questions. Coding activities will continue during
the talks.

The City of Lodi is very close to Milano and has good hotel
facilities. The connections by air are excellent, via Milano Malpensa,
Milano Linate and Bergamo Orio Al Serio airports.

Please register soon using the form at this page
http://tecnoparco.org/codefest, places may run out quickly.


-- 

Francesco


From anaryin at gmail.com  Thu May 31 06:54:55 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Thu, 31 May 2012 12:54:55 +0200
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <4FC650FB.8090502@usp.br>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
	<CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>
	<4FC6194D.1060802@usp.br>
	<CAJ9sUYMvTaYp3=1OmrT81KrFs6sLmJF6qe6pEu7L53o2aOsatg@mail.gmail.com>
	<4FC650FB.8090502@usp.br>
Message-ID: <CAJ9sUYOWD1MJNLHXZV2Kdzrn6PPghHHU=J5iohVxSjzjFLM9dw@mail.gmail.com>

I included the header already as a biopython module, since parts of this
script are my work at GSOC 2010, and others are Ezgi's independent work
that she agreed to contribute. Just a safety measure :)

The usage of the code is very simple. Parse a structure with biopython and
use the calculate_shape_param function of this geometry module to calculate
all values required to compute the shape of your molecule. It will not tell
you what shape it is, but it will give you all the ingredients (if the
anisotropy is 0, your molecule is spherical, for example).

Let me know of any comments, and Ezgi too, as she is the main contributor
to this.

*Again, this should not be included, for now, in the main distribution, nor
considered an "official" addition.
*

Download here: http://nmr.chem.uu.nl/~joao/f/geometry.py

Cheers,

Jo?o


From golubchi at stats.ox.ac.uk  Thu May 31 08:10:21 2012
From: golubchi at stats.ox.ac.uk (Tanya Golubchik)
Date: Thu, 31 May 2012 13:10:21 +0100
Subject: [Biopython] Bio.Phylo: midpoint root?
In-Reply-To: <CAMC681mD0PbX8KHmBo4mUSLkMPhgKi=sbVq5O9w_bMdaz750Ow@mail.gmail.com>
References: <4FC62356.2030709@stats.ox.ac.uk>
	<CAMC681nufLjfBa4xwdQjcTFrv-DT237dFpfNei6_6QLXFm4iEw@mail.gmail.com>
	<CAMC681mD0PbX8KHmBo4mUSLkMPhgKi=sbVq5O9w_bMdaz750Ow@mail.gmail.com>
Message-ID: <4FC75FAD.2050909@stats.ox.ac.uk>

Thanks, Eric - will have a go!

T

On 31/05/12 05:36, Eric Talevich wrote:
> On Wed, May 30, 2012 at 10:55 AM, Eric Talevich <eric.talevich at gmail.com
> <mailto:eric.talevich at gmail.com>> wrote:
> 
>     On Wed, May 30, 2012 at 9:40 AM, Tanya Golubchik
>     <golubchi at stats.ox.ac.uk <mailto:golubchi at stats.ox.ac.uk>> wrote:
> 
>         Hello,
> 
>         Does anyone have a quickie method for calculating the midpoint
>         root of a
>         given tree?
> 
> 
>     It's been on my to-do list. (The first step was adding the keyword
>     argument 'outgroup_branch_length' to root_with_outgroup.) The tree
>     method 'depths' should also be handy.
> 
>     The algorithm I had in mind looks like:
> 
> <madness>
> 
> 
>     I too would be delighted to see a better algorithm for this.
> 
> 
> I implemented this in an intuitive but very inefficient way, calculating
> the pairwise distances between all tips of the tree. You can try it from
> git:
> https://github.com/biopython/biopython/commit/94c128bd428cc5d53b50edd1d2e4730ee212f530
> 
> It would still be nice to see a better algorithm, if anyone has one on hand.
> 
> -E

From ferreirafm at usp.br  Thu May 31 09:06:54 2012
From: ferreirafm at usp.br (Frederico Moraes Ferreira)
Date: Thu, 31 May 2012 10:06:54 -0300
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CAJ9sUYOWD1MJNLHXZV2Kdzrn6PPghHHU=J5iohVxSjzjFLM9dw@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
	<CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>
	<4FC6194D.1060802@usp.br>
	<CAJ9sUYMvTaYp3=1OmrT81KrFs6sLmJF6qe6pEu7L53o2aOsatg@mail.gmail.com>
	<4FC650FB.8090502@usp.br>
	<CAJ9sUYOWD1MJNLHXZV2Kdzrn6PPghHHU=J5iohVxSjzjFLM9dw@mail.gmail.com>
Message-ID: <4FC76CEE.1070300@usp.br>

Hi Jo?o and Ezgi,
That's a very nice piece code. I'll do some tests and let you know the 
results.
All the Best,
Fred

Em 31-05-2012 07:54, Jo?o Rodrigues escreveu:
> I included the header already as a biopython module, since parts of 
> this script are my work at GSOC 2010, and others are Ezgi's 
> independent work that she agreed to contribute. Just a safety measure :)
>
> The usage of the code is very simple. Parse a structure with biopython 
> and use the calculate_shape_param function of this geometry module to 
> calculate all values required to compute the shape of your molecule. 
> It will not tell you what shape it is, but it will give you all the 
> ingredients (if the anisotropy is 0, your molecule is spherical, for 
> example).
>
> Let me know of any comments, and Ezgi too, as she is the main 
> contributor to this.
>
> *_Again, this should not be included, for now, in the main 
> distribution, nor considered an "official" addition.
> _*
>
> Download here: http://nmr.chem.uu.nl/~joao/f/geometry.py 
> <http://nmr.chem.uu.nl/%7Ejoao/f/geometry.py>
>
> Cheers,
>
> Jo?o


From b.invergo at gmail.com  Thu May 31 09:31:21 2012
From: b.invergo at gmail.com (Brandon Invergo)
Date: Thu, 31 May 2012 15:31:21 +0200
Subject: [Biopython] Bio.Phylo: midpoint root?
In-Reply-To: <CAMC681mD0PbX8KHmBo4mUSLkMPhgKi=sbVq5O9w_bMdaz750Ow@mail.gmail.com>
References: <4FC62356.2030709@stats.ox.ac.uk>
	<CAMC681nufLjfBa4xwdQjcTFrv-DT237dFpfNei6_6QLXFm4iEw@mail.gmail.com>
	<CAMC681mD0PbX8KHmBo4mUSLkMPhgKi=sbVq5O9w_bMdaz750Ow@mail.gmail.com>
Message-ID: <1338471081.627.7.camel@localhost.localdomain>

On Thu, 2012-05-31 at 00:36 -0400, Eric Talevich wrote:
> On Wed, May 30, 2012 at 10:55 AM, Eric Talevich <eric.talevich at gmail.com>wrote:
> I implemented this in an intuitive but very inefficient way, calculating
> the pairwise distances between all tips of the tree. You can try it from
> git:
> https://github.com/biopython/biopython/commit/94c128bd428cc5d53b50edd1d2e4730ee212f530
> 
> It would still be nice to see a better algorithm, if anyone has one on hand.
> 
> -E

I sped it up a little bit by getting rid of those nested for loops:
https://github.com/brandoninvergo/biopython/commit/102189cd49d448423ee160a0a0ad891b58f56c26

According to a naive benchmark of comparing execution times for the unit
test, this version is about 40% faster (0.901s vs 0.524s on my
computer). I'll do a pull request...

As for the problem of accumulating floating point rounding errors,
perhaps you can do the root operations on copies of the tree instead...

-brandon


From eric.talevich at gmail.com  Thu May 31 12:30:07 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Thu, 31 May 2012 12:30:07 -0400
Subject: [Biopython] Bio.Phylo: midpoint root?
In-Reply-To: <1338471081.627.7.camel@localhost.localdomain>
References: <4FC62356.2030709@stats.ox.ac.uk>
	<CAMC681nufLjfBa4xwdQjcTFrv-DT237dFpfNei6_6QLXFm4iEw@mail.gmail.com>
	<CAMC681mD0PbX8KHmBo4mUSLkMPhgKi=sbVq5O9w_bMdaz750Ow@mail.gmail.com>
	<1338471081.627.7.camel@localhost.localdomain>
Message-ID: <CAMC681kdW0qJ8gfWbJkd4MVND7WkS2wsmSEr732JeVNtZk5P+g@mail.gmail.com>

On Thu, May 31, 2012 at 9:31 AM, Brandon Invergo <b.invergo at gmail.com>wrote:

> On Thu, 2012-05-31 at 00:36 -0400, Eric Talevich wrote:
> > On Wed, May 30, 2012 at 10:55 AM, Eric Talevich <eric.talevich at gmail.com
> >wrote:
> > I implemented this in an intuitive but very inefficient way, calculating
> > the pairwise distances between all tips of the tree. You can try it from
> > git:
> >
> https://github.com/biopython/biopython/commit/94c128bd428cc5d53b50edd1d2e4730ee212f530
> >
> > It would still be nice to see a better algorithm, if anyone has one on
> hand.
> >
> > -E
>
> I sped it up a little bit by getting rid of those nested for loops:
>
> https://github.com/brandoninvergo/biopython/commit/102189cd49d448423ee160a0a0ad891b58f56c26
>
> According to a naive benchmark of comparing execution times for the unit
> test, this version is about 40% faster (0.901s vs 0.524s on my
> computer). I'll do a pull request...
>
> As for the problem of accumulating floating point rounding errors,
> perhaps you can do the root operations on copies of the tree instead...
>
> -brandon
>
>
Looks better, thanks! I merged it.

I'll look into the rounding issue some more. It might be enough to make a
single copy of the tree, do all the rerooting and distance calculation
there, and use the original copy to calculate the outgroup branch length
and do a single rerooting.

Alternatively, I could add a separate tree method that generates pairwise
distances without rerooting the tree -- either producing a big dictionary,
or an iterable of ((node1, node2), distance) which could be easily fed to a
dictionary if needed.

From vinkurella at yahoo.com  Thu May 31 13:28:13 2012
From: vinkurella at yahoo.com (vinodh kurella)
Date: Thu, 31 May 2012 10:28:13 -0700 (PDT)
Subject: [Biopython] Help needed to fix an error in biopython on mac osx
Message-ID: <1338485293.26613.YahooMailNeo@web161302.mail.bf1.yahoo.com>

Hi Biopython community,

I am trying to install?biopython?onto my?mac osx?(10.7.4) but after downloading the?biopython 1.59.tar.gz?from?http://biopython.org/wiki/Download?and installation get some error which is pasted below.

$cd biopython-1.59
$sudo python?setup.py?install

It works until it gets to this error and aborts. Could anyone please let me know what is wrong ?

Thanks and appreciate your help. Below is the report, have cut out (......) the middle and have ?shown the start and the end output only.

Vinodh

running install
running build
running build_py
creating build
creating build/lib.macosx-10.7-intel-2.7
creating build/lib.macosx-10.7-intel-2.7/Bio
copying Bio/__init__.py -> build/lib.macosx-10.7-intel-2.7/Bio
copying Bio/_py3k.py -> build/lib.macosx-10.7-intel-2.7/Bio
.
.
.
.
copying Bio/PopGen/SimCoal/data/ssm_2d.par -> build/lib.macosx-10.7-intel-2.7/Bio/PopGen/SimCoal/data
running build_ext
building 'Bio.cpairwise2' extension
creating build/temp.macosx-10.7-intel-2.7
creating build/temp.macosx-10.7-intel-2.7/Bio
llvm-gcc-4.2 -fno-strict-aliasing -fno-common -dynamic -g -Os -pipe -fno-common -fno-strict-aliasing -fwrapv -mno-fused-madd -DENABLE_DTRACE -DMACOSX -DNDEBUG -Wall -Wstrict-prototypes -Wshorten-64-to-32 -DNDEBUG -g -fwrapv -Os -Wall -Wstrict-prototypes -DENABLE_DTRACE -arch i386 -arch x86_64 -pipe -IBio -I/System/Library/Frameworks/Python.framework/Versions/2.7/include/python2.7 -c Bio/cpairwise2module.c -o build/temp.macosx-10.7-intel-2.7/Bio/cpairwise2module.o
unable to execute llvm-gcc-4.2: No such file or directory
error: command 'llvm-gcc-4.2' failed with exit status 1


From arklenna at gmail.com  Thu May 31 13:46:05 2012
From: arklenna at gmail.com (Lenna Peterson)
Date: Thu, 31 May 2012 13:46:05 -0400
Subject: [Biopython] Help needed to fix an error in biopython on mac osx
In-Reply-To: <1338485293.26613.YahooMailNeo@web161302.mail.bf1.yahoo.com>
References: <1338485293.26613.YahooMailNeo@web161302.mail.bf1.yahoo.com>
Message-ID: <CAK610_4wEiJkXw0Ak32P2uzUQ8n6VL+UO5M2vtChaHHfSOnNSA@mail.gmail.com>

Hi Vinodh,

Do you have XCode installed? It's required to build Biopython on a
Mac. llvm-gcc-4.2 is a C compiler used by Apple.

Lenna

From anaryin at gmail.com  Thu May 31 13:49:17 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Thu, 31 May 2012 19:49:17 +0200
Subject: [Biopython] Help needed to fix an error in biopython on mac osx
In-Reply-To: <CAK610_4wEiJkXw0Ak32P2uzUQ8n6VL+UO5M2vtChaHHfSOnNSA@mail.gmail.com>
References: <1338485293.26613.YahooMailNeo@web161302.mail.bf1.yahoo.com>
	<CAK610_4wEiJkXw0Ak32P2uzUQ8n6VL+UO5M2vtChaHHfSOnNSA@mail.gmail.com>
Message-ID: <CAJ9sUYMTxjX8cChtb0_cSd2zu3m4A6qXaPJwBCq0T7_PBW5krA@mail.gmail.com>

Is this on Lion?

From arklenna at gmail.com  Thu May 31 13:55:40 2012
From: arklenna at gmail.com (Lenna Peterson)
Date: Thu, 31 May 2012 13:55:40 -0400
Subject: [Biopython] replace header
In-Reply-To: <CAKVJ-_4hHe=THg0ZLokt2mja15-vd+DBsB+a-YFZGNgiO2zADg@mail.gmail.com>
References: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>
	<CAK610_4GGZKe0PW_zRkd5uqZCenowmT++_HGqGcyE5j=tpfgzg@mail.gmail.com>
	<A4360020-0E00-4F93-9DE0-B48E849C9416@gmail.com>
	<CAKVJ-_4hHe=THg0ZLokt2mja15-vd+DBsB+a-YFZGNgiO2zADg@mail.gmail.com>
Message-ID: <CAK610_4wMj5C20ACSW52=H-f59v+R67=Kv9ZqwvXGbjqAH7OUg@mail.gmail.com>

On Wed, May 30, 2012 at 4:56 AM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
>
> Hi Dilara & Lenna,
>
> I would use append mode with caution - it will have side effects
> like if you run this script twice, the output file will double in size
> (the first run plus the second run). Wouldn't opening in write
> mode work just as well here?
> i.e. Open the handle, do the loop, close the handle.
>


Hi Peter,

Thanks for the warning. Python, making me adjust my thought patterns
every day. I'm used to shell, > vs >> for cat etc. I had never tried
multiple writes to a single open file. But the behavior is logical.


>
> The key point about using SeqIO.write(...) once to do a whole
> file is this requires an iterator based approach. For example,
> using a generator expression and a function acting on a single
> record:
>
> def modify_record(record):
> ? ?#Do something sensible to the headers here:
> ? ?record.id = "modified"
> ? ?return record
> #This is a generator expression:
> modified = (modify_record(r) for r in SeqIO.parse("solid_1.fastq", "fastq"))
> count = SeqIO.write(modified, "newsolid_1.fastq", "fastq")
> print "Modified %i records" % count
>
> Equivalently using a generator function which does the
> looping itself:
>
> def modify_records(records):
> ? ?for record in records:
> ? ? ? ?#Do something sensible to the headers here:
> ? ? ? ?record.id = "modified"
> ? ? ? ?yield record
> count = SeqIO.write(modify_records(SeqIO.parse("solid_1.fastq",
> "fastq")), "newsolid_1.fastq", "fastq")
> print "Modified %i records" % count


The generator function is nice, too. I presume this only works because
SeqIO.write knows how to write from an iterator?

Lenna


From p.j.a.cock at googlemail.com  Thu May 31 14:06:44 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 31 May 2012 19:06:44 +0100
Subject: [Biopython] Help needed to fix an error in biopython on mac osx
In-Reply-To: <CAJ9sUYMTxjX8cChtb0_cSd2zu3m4A6qXaPJwBCq0T7_PBW5krA@mail.gmail.com>
References: <1338485293.26613.YahooMailNeo@web161302.mail.bf1.yahoo.com>
	<CAK610_4wEiJkXw0Ak32P2uzUQ8n6VL+UO5M2vtChaHHfSOnNSA@mail.gmail.com>
	<CAJ9sUYMTxjX8cChtb0_cSd2zu3m4A6qXaPJwBCq0T7_PBW5krA@mail.gmail.com>
Message-ID: <CAKVJ-_7m0e3HYnEmyfb_a_mLFWk344i8H3F1W51mbdX6oa4kPg@mail.gmail.com>

On Thu, May 31, 2012 at 6:49 PM, Jo?o Rodrigues <anaryin at gmail.com> wrote:
> Is this on Lion?

Yes, he said OS X 10.7 which is Lion.

You can download Xcode free from the Apple Mac App Store (it just
takes a while, several GB in size).

Peter


From p.j.a.cock at googlemail.com  Thu May 31 14:10:11 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 31 May 2012 19:10:11 +0100
Subject: [Biopython] replace header
In-Reply-To: <CAK610_4wMj5C20ACSW52=H-f59v+R67=Kv9ZqwvXGbjqAH7OUg@mail.gmail.com>
References: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>
	<CAK610_4GGZKe0PW_zRkd5uqZCenowmT++_HGqGcyE5j=tpfgzg@mail.gmail.com>
	<A4360020-0E00-4F93-9DE0-B48E849C9416@gmail.com>
	<CAKVJ-_4hHe=THg0ZLokt2mja15-vd+DBsB+a-YFZGNgiO2zADg@mail.gmail.com>
	<CAK610_4wMj5C20ACSW52=H-f59v+R67=Kv9ZqwvXGbjqAH7OUg@mail.gmail.com>
Message-ID: <CAKVJ-_5Z2uLb-NFJhikdMMw--qNd2Nsb2=mVhPPjAmPkfKovpA@mail.gmail.com>

On Thu, May 31, 2012 at 6:55 PM, Lenna Peterson <arklenna at gmail.com> wrote:
>> The key point about using SeqIO.write(...) once to do a whole
>> file is this requires an iterator based approach. For example,
>> using a generator expression and a function acting on a single
>> record:
>>
>> def modify_record(record):
>> ? ?#Do something sensible to the headers here:
>> ? ?record.id = "modified"
>> ? ?return record
>> #This is a generator expression:
>> modified = (modify_record(r) for r in SeqIO.parse("solid_1.fastq", "fastq"))
>> count = SeqIO.write(modified, "newsolid_1.fastq", "fastq")
>> print "Modified %i records" % count
>>
>> Equivalently using a generator function which does the
>> looping itself:
>>
>> def modify_records(records):
>> ? ?for record in records:
>> ? ? ? ?#Do something sensible to the headers here:
>> ? ? ? ?record.id = "modified"
>> ? ? ? ?yield record
>> count = SeqIO.write(modify_records(SeqIO.parse("solid_1.fastq",
>> "fastq")), "newsolid_1.fastq", "fastq")
>> print "Modified %i records" % count
>
>
> The generator function is nice, too. I presume this only works because
> SeqIO.write knows how to write from an iterator?
>
> Lenna

Bio.SeqIO.write is *designed* to take a Python iterator of SeqRecord
objects. That can be a generator function, generator expression, a
custom class which supports iteration, or even a simple list or tuple
of SeqRecord objects all in memory.

As a special case connivence it also accepts a single SeqRecord.

Peter


From ferreirafm at usp.br  Thu May 31 14:52:00 2012
From: ferreirafm at usp.br (Frederico Moraes Ferreira)
Date: Thu, 31 May 2012 15:52:00 -0300
Subject: [Biopython] geometry.py
Message-ID: <4FC7BDD0.2020905@usp.br>

Hi Jo?o,
The gyration radio (Rg) is running just fine. They are in excellent 
agreement with those from some models I have tested.
However, the maximum dimensions do not match at all. Did orientate the 
model before tensor analysis?
Fred


From xiaochuan.liu at mssm.edu  Thu May  3 22:46:58 2012
From: xiaochuan.liu at mssm.edu (Liu, XiaoChuan)
Date: Thu, 3 May 2012 22:46:58 +0000
Subject: [Biopython] How to use SeqRecord to get the subseq location
	information
Message-ID: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8585@Exch-2KX-MBXAB3.ExchMail.mssm.edu>


Dear all,

I face a problem: How to use SeqRecord to get the subseq location information?

My code is like this:

>>> from Bio.Seq import Seq

>>> simple_seq = Seq("gugggaagagggguggggcccgggacuguacccaugugaggacuauucuugaguccugcucuuguucugagcaccaccccucucucaga")

>>> from Bio.SeqRecord import SeqRecord

>>> from Bio.SeqFeature import SeqFeature, FeatureLocation

>>> example_feature = SeqFeature(FeatureLocation(25382494, 25382583), type="mRNA", strand=-1)

>>> simple_seq_r = SeqRecord(simple_seq, id="17_329.4",features=[example_feature])

>>> simple_seq_r
SeqRecord(seq=Seq('gugggaagagggguggggcccgggacuguacccaugugaggacuauucuugagu...aga', Alphabet()), id='17_329.4', name='<unknown name>', description='<unknown description>', dbxrefs=[])

>>> simple_seq_r.features
[SeqFeature(FeatureLocation(ExactPosition(25382494),ExactPosition(25382583)), type='mRNA', strand=-1)]

>>> simple_seq_r.features[0]
SeqFeature(FeatureLocation(ExactPosition(25382494),ExactPosition(25382583)), type='mRNA', strand=-1)

>>> subseq=simple_seq_r[3:10]
>>> subseq
SeqRecord(seq=Seq('ggaagag', Alphabet()), id='17_329.4', name='<unknown name>', description='<unknown description>', dbxrefs=[])

But when I type ?subseq.features? like this:
>>> subseq.features
[]

I could not get the location information of subseq. Why? Do somebody know how to get these information? Thank you very much!

Best,

Xiaochuan



From w.arindrarto at gmail.com  Fri May  4 06:09:31 2012
From: w.arindrarto at gmail.com (Wibowo Arindrarto)
Date: Fri, 4 May 2012 08:09:31 +0200
Subject: [Biopython] How to use SeqRecord to get the subseq location
	information
In-Reply-To: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8585@Exch-2KX-MBXAB3.ExchMail.mssm.edu>
References: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8585@Exch-2KX-MBXAB3.ExchMail.mssm.edu>
Message-ID: <CADEGkF4wUbFv=H+Owym4vs93B7UJSkO8ja_YoDtnrii4-7V4Nw@mail.gmail.com>

Hi Liu,

It looks like the problem is caused by the values you put in your
SeqFeature. Your sequence length is less than the feature location
values. If you try plugging in a number in range, like this:

>>> example_feature = SeqFeature(FeatureLocation(5, 7), type="mRNA", strand=-1)

You should still keep the feature in your subsequence, like so:

>>> subseq = simple_seq_r[3:10]
>>> subseq.features
[SeqFeature(FeatureLocation(ExactPosition(2), ExactPosition(4),
strand=-1), type='mRNA')]

Hope that helps :),

cheers,
Bow


From xiaochuan.liu at mssm.edu  Fri May  4 16:19:47 2012
From: xiaochuan.liu at mssm.edu (Liu, XiaoChuan)
Date: Fri, 4 May 2012 16:19:47 +0000
Subject: [Biopython] How to use SeqRecord to get the subseq location
 information
In-Reply-To: <CADEGkF4wUbFv=H+Owym4vs93B7UJSkO8ja_YoDtnrii4-7V4Nw@mail.gmail.com>
References: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8585@Exch-2KX-MBXAB3.ExchMail.mssm.edu>
	<CADEGkF4wUbFv=H+Owym4vs93B7UJSkO8ja_YoDtnrii4-7V4Nw@mail.gmail.com>
Message-ID: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8794@Exch-2KX-MBXAB3.ExchMail.mssm.edu>

Hi Bow,

Thank you very much for your helps!
But according to your suggestion, I also face this problem. See below:

>>> example_feature = SeqFeature(FeatureLocation(0, 88), type="mRNA", strand=-1)
>>> simple_seq_r = SeqRecord(simple_seq, id="17_329.4",features=[example_feature])
>>> simple_seq_r
SeqRecord(seq=Seq('gugggaagagggguggggcccgggacuguacccaugugaggacuauucuugagu...aga', Alphabet()), id='17_329.4', name='<unknown name>', description='<unknown description>', dbxrefs=[])
>>> simple_seq_r.features
[SeqFeature(FeatureLocation(ExactPosition(0),ExactPosition(88)), type='mRNA', strand=-1)]
>>> subseq=simple_seq_r[3:10]
>>> subseq
SeqRecord(seq=Seq('ggaagag', Alphabet()), id='17_329.4', name='<unknown name>', description='<unknown description>', dbxrefs=[])
>>> subseq.features
[]

I could not get the location information of subseq yet. Why? Thank you very much!

Best,

Xiaochuan


-----Original Message-----
From: Wibowo Arindrarto [mailto:w.arindrarto at gmail.com] 
Sent: Friday, May 04, 2012 2:10 AM
To: Liu, XiaoChuan
Cc: biopython at biopython.org
Subject: Re: [Biopython] How to use SeqRecord to get the subseq location information

Hi Liu,

It looks like the problem is caused by the values you put in your SeqFeature. Your sequence length is less than the feature location values. If you try plugging in a number in range, like this:

>>> example_feature = SeqFeature(FeatureLocation(5, 7), type="mRNA", 
>>> strand=-1)

You should still keep the feature in your subsequence, like so:

>>> subseq = simple_seq_r[3:10]
>>> subseq.features
[SeqFeature(FeatureLocation(ExactPosition(2), ExactPosition(4), strand=-1), type='mRNA')]

Hope that helps :),

cheers,
Bow



From p.j.a.cock at googlemail.com  Fri May  4 16:31:07 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 4 May 2012 17:31:07 +0100
Subject: [Biopython] How to use SeqRecord to get the subseq location
	information
In-Reply-To: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8794@Exch-2KX-MBXAB3.ExchMail.mssm.edu>
References: <DFBD6E5CF7E1D844AF54A7314165E14C4EDF8585@Exch-2KX-MBXAB3.ExchMail.mssm.edu>
	<CADEGkF4wUbFv=H+Owym4vs93B7UJSkO8ja_YoDtnrii4-7V4Nw@mail.gmail.com>
	<DFBD6E5CF7E1D844AF54A7314165E14C4EDF8794@Exch-2KX-MBXAB3.ExchMail.mssm.edu>
Message-ID: <CAKVJ-_4gjqqj61i1aQOvC6_pEX_EX13m7p_kq35-B+RvKKDBkA@mail.gmail.com>

On Fri, May 4, 2012 at 5:19 PM, Liu, XiaoChuan <xiaochuan.liu at mssm.edu> wrote:
> Hi Bow,
>
> Thank you very much for your helps!
> But according to your suggestion, I also face this problem. See below:
>
>>>> example_feature = SeqFeature(FeatureLocation(0, 88), type="mRNA", strand=-1)
>>>> simple_seq_r = SeqRecord(simple_seq, id="17_329.4",features=[example_feature])
>>>> simple_seq_r
> SeqRecord(seq=Seq('gugggaagagggguggggcccgggacuguacccaugugaggacuauucuugagu...aga', Alphabet()), id='17_329.4', name='<unknown name>', description='<unknown description>', dbxrefs=[])
>>>> simple_seq_r.features
> [SeqFeature(FeatureLocation(ExactPosition(0),ExactPosition(88)), type='mRNA', strand=-1)]
>>>> subseq=simple_seq_r[3:10]
>>>> subseq
> SeqRecord(seq=Seq('ggaagag', Alphabet()), id='17_329.4', name='<unknown name>', description='<unknown description>', dbxrefs=[])
>>>> subseq.features
> []
>
> I could not get the location information of subseq yet. Why? Thank you very much!
>

What numbers are you trying to get?

In your example the parent sequence (simple_seq_r) has a feature from
0 to 88, but when you slice a SeqRecord only features fully inside the
slice are kept - so no features are kept for the child record
(subseq). We do not breakup larger features which straddle the cut
sites.

Peter


From p.j.a.cock at googlemail.com  Sun May  6 11:09:30 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Sun, 6 May 2012 12:09:30 +0100
Subject: [Biopython] Fwd: 2012 SciPy Bioinformatics Workshop
In-Reply-To: <1336063455.23270.YahooMailNeo@web111204.mail.gq1.yahoo.com>
References: <1336063455.23270.YahooMailNeo@web111204.mail.gq1.yahoo.com>
Message-ID: <CAKVJ-_4gGwnDePRfXOc96b+oOUDgwAu8EAnb-GL14CEwTDUVWw@mail.gmail.com>

Dear Biopythoneers,

Are any of us planning to attend the SciPy meeting? The 2012 SciPy
Bioinformatics Workshop is crying out for a Biopython related talk... and
from the email below it sounds like they're not just looking for a
developers perspectives, but also how Python is being used in
bioinformatics.

Is it quite close after BOSC and ISMB but July 19 doesn't actually clash:
http://www.open-bio.org/wiki/BOSC_2012

SciPy 2012 as a whole does clash with ISMB, and for those in Europe, it
clashes with the planned CodeFest too:
http://www.open-bio.org/wiki/EU_Codefest_2012

July is definitely conference season...

Peter

---------- Forwarded message ----------
From: *Chris Mueller*
Date: Thursday, May 3, 2012
Subject: [Numpy-discussion] 2012 SciPy Bioinformatics Workshop
To: "chris.mueller at lab7.io" <chris.mueller at lab7.io>


We are pleased to announce the 2012 SciPy Bioinformatics Workshop held in
conjunction with SciPy 2012 this July in Austin, TX.

Python in biology is not dead yet... in fact, it's alive and well!

Remember just a few short years ago when BioPerl ruled the world?  Just one
minor paradigm shift* later and Python now has a commanding presence in
bioinformatics. From Python bindings to common tools all the way to entire
Python-based informatics platforms, Python is used everywhere** in modern
bioinformatics.

If you use Python for bioinformatics or just want to learn more about how
its being used, join us at the 2012 SciPy Bioinformatics Workshop. We will
have speakers from both academia and industry showcasing how Python is
enabling biologists to effectively work with large, complex data sets.

The workshop will be held the evening of July 19 from 5-6:30.

More information about SciPy is available on the conference site:
  http://conference.scipy.org/scipy2012/

!! Participate !!

Are you using Python in bioinformatics?  We'd love to have you share your
story.  We are looking for 3-4 speakers to share their experiences using
Python for bioinformatics.

Please contact Chris Mueller at chris.mueller [at] lab7.io and Ray Roberts
at rroberts [at] enthought.com to volunteer. Please include a brief
description or link to a paper/topic which you would like to discuss.
Presentations will last for 15 minutes each and will be followed by a panel
Q&A.

--
* That would be next generation sequencing
** Yes, we aRe awaRe of that otheR language used eveRywhere, but let's
celebRate Python Right now.

_______________________________________________
NumPy-Discussion mailing list
NumPy-Discussion at scipy.org <javascript:;>
http://mail.scipy.org/mailman/listinfo/numpy-discussion


From tiagoantao at gmail.com  Sun May  6 11:16:36 2012
From: tiagoantao at gmail.com (=?ISO-8859-1?Q?Tiago_Ant=E3o?=)
Date: Sun, 6 May 2012 12:16:36 +0100
Subject: [Biopython] Fwd: 2012 SciPy Bioinformatics Workshop
In-Reply-To: <CAKVJ-_4gGwnDePRfXOc96b+oOUDgwAu8EAnb-GL14CEwTDUVWw@mail.gmail.com>
References: <1336063455.23270.YahooMailNeo@web111204.mail.gq1.yahoo.com>
	<CAKVJ-_4gGwnDePRfXOc96b+oOUDgwAu8EAnb-GL14CEwTDUVWw@mail.gmail.com>
Message-ID: <CAA9RGENs3f5h02NXetXWmqgK+kXfrBt3d2bMTSoBexFbCBvh1A@mail.gmail.com>

Hi,

On Sun, May 6, 2012 at 12:09 PM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
> SciPy 2012 as a whole does clash with ISMB, and for those in Europe, it
> clashes with the planned CodeFest too:
> http://www.open-bio.org/wiki/EU_Codefest_2012

Are any people from here going to the codefest?

Tiago


From cjfields at illinois.edu  Sun May  6 15:03:27 2012
From: cjfields at illinois.edu (Fields, Christopher J)
Date: Sun, 6 May 2012 15:03:27 +0000
Subject: [Biopython] Fwd: 2012 SciPy Bioinformatics Workshop
In-Reply-To: <CAKVJ-_4gGwnDePRfXOc96b+oOUDgwAu8EAnb-GL14CEwTDUVWw@mail.gmail.com>
References: <1336063455.23270.YahooMailNeo@web111204.mail.gq1.yahoo.com>,
	<CAKVJ-_4gGwnDePRfXOc96b+oOUDgwAu8EAnb-GL14CEwTDUVWw@mail.gmail.com>
Message-ID: <FAEC1445-4BE3-42E7-A4C1-A58FAB016E64@illinois.edu>



On May 6, 2012, at 6:12 AM, "Peter Cock" <p.j.a.cock at googlemail.com> wrote:
> ...
> Is it quite close after BOSC and ISMB but July 19 doesn't actually clash:
> http://www.open-bio.org/wiki/BOSC_2012
> 
> SciPy 2012 as a whole does clash with ISMB, and for those in Europe, it
> clashes with the planned CodeFest too:
> http://www.open-bio.org/wiki/EU_Codefest_2012
> 
> July is definitely conference season...

Galaxy community conference as well.

Chris 

> 
> Peter
> 
> ---------- Forwarded message ----------
> From: *Chris Mueller*
> Date: Thursday, May 3, 2012
> Subject: [Numpy-discussion] 2012 SciPy Bioinformatics Workshop
> To: "chris.mueller at lab7.io" <chris.mueller at lab7.io>
> 
> 
> We are pleased to announce the 2012 SciPy Bioinformatics Workshop held in
> conjunction with SciPy 2012 this July in Austin, TX.
> 
> Python in biology is not dead yet... in fact, it's alive and well!
> 
> Remember just a few short years ago when BioPerl ruled the world?  Just one
> minor paradigm shift* later and Python now has a commanding presence in
> bioinformatics. From Python bindings to common tools all the way to entire
> Python-based informatics platforms, Python is used everywhere** in modern
> bioinformatics.
> 
> If you use Python for bioinformatics or just want to learn more about how
> its being used, join us at the 2012 SciPy Bioinformatics Workshop. We will
> have speakers from both academia and industry showcasing how Python is
> enabling biologists to effectively work with large, complex data sets.
> 
> The workshop will be held the evening of July 19 from 5-6:30.
> 
> More information about SciPy is available on the conference site:
>  http://conference.scipy.org/scipy2012/
> 
> !! Participate !!
> 
> Are you using Python in bioinformatics?  We'd love to have you share your
> story.  We are looking for 3-4 speakers to share their experiences using
> Python for bioinformatics.
> 
> Please contact Chris Mueller at chris.mueller [at] lab7.io and Ray Roberts
> at rroberts [at] enthought.com to volunteer. Please include a brief
> description or link to a paper/topic which you would like to discuss.
> Presentations will last for 15 minutes each and will be followed by a panel
> Q&A.
> 
> --
> * That would be next generation sequencing
> ** Yes, we aRe awaRe of that otheR language used eveRywhere, but let's
> celebRate Python Right now.
> 
> _______________________________________________
> NumPy-Discussion mailing list
> NumPy-Discussion at scipy.org <javascript:;>
> http://mail.scipy.org/mailman/listinfo/numpy-discussion
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython



From arklenna at gmail.com  Sun May  6 21:26:30 2012
From: arklenna at gmail.com (Lenna Peterson)
Date: Sun, 6 May 2012 17:26:30 -0400
Subject: [Biopython] GSoC python variant update
Message-ID: <CAK610_5FZ1MoLzgALP7zeF=6Vkq2A4SxTWtp0ke31Mtg06iQFA@mail.gmail.com>

Hi all,

I've written a few new posts on my blog; here's the latest:

http://arklenna.tumblr.com/post/22542372076/spot-isa-dog

I will attach a UML diagram and include the part of the post
addressing the diagram. Click through to the full post for a bonus
Einstein quote!

-------

My main goals are not limited to:

 * Make the structure parser and file-format agnostic: an abstracted
OO design should allow anything to be slotted in (for example,
Marjan's C GFF parser?)
 * Maintain encapsulation: limit how much each object can see of
objects above and below it
 * Allow extension at multiple levels: some existing parsers may
process data in different ways; this structure should allow handling
both raw data and data in various formats.

The `Variant` object's constructor allows an end user to change the
default parsers. Practical implementation details of `parse()` and
`write()` will need to be finessed - for example, ways to help the
user sift through immense quantities of data. I'm still in the process
of comparing the data contained in VCF/GVF files as well as the APIs
of PyVCF and BCBio.GFF.

`Parser` and `Writer` are both abstract classes that will define all
methods found in known parsers/writers with `NotImplementedError`s.
I'm speculating on whether a Variant-specific exception would be
useful, but a custom message should suffice.

Continuing down the diagram, `PyVCFWrapper` and `BCBioGFFWrapper`
would each inherit from both `Parser` and `Writer`. As the name
implies, they would serve as the adapter between the generic `Variant`
and the specific parser.

I anticipate that this structure could easily be extended to allow
intermediate storage in DBs as well as innumerable
sorting/comparing/filtering methods inside `Variant`.

-------

I would appreciate any and all feedback about the overall structure.
Namespace is definitely flexible. I'd also appreciate any specific
genomic variant workflows, and if somebody can point me to smallish
sample files of the same data in both VCF and GVF, I'd be eternally
grateful.

Regards,

Lenna
-------------- next part --------------
A non-text attachment was scrubbed...
Name: Variant_UML.png
Type: image/png
Size: 23313 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/biopython/attachments/20120506/38c3290c/attachment-0002.png>

From p.j.a.cock at googlemail.com  Mon May  7 08:37:38 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 7 May 2012 09:37:38 +0100
Subject: [Biopython] Fwd: 2012 SciPy Bioinformatics Workshop
In-Reply-To: <CAA9RGENs3f5h02NXetXWmqgK+kXfrBt3d2bMTSoBexFbCBvh1A@mail.gmail.com>
References: <1336063455.23270.YahooMailNeo@web111204.mail.gq1.yahoo.com>
	<CAKVJ-_4gGwnDePRfXOc96b+oOUDgwAu8EAnb-GL14CEwTDUVWw@mail.gmail.com>
	<CAA9RGENs3f5h02NXetXWmqgK+kXfrBt3d2bMTSoBexFbCBvh1A@mail.gmail.com>
Message-ID: <CAKVJ-_4LNs1RGjTz8-58MLHdfWsWeSX9p3Lwanh6ustA3M2_RQ@mail.gmail.com>

On Sun, May 6, 2012 at 12:16 PM, Tiago Ant?o <tiagoantao at gmail.com> wrote:
> Hi,
>
> On Sun, May 6, 2012 at 12:09 PM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
>> SciPy 2012 as a whole does clash with ISMB, and for those in Europe, it
>> clashes with the planned CodeFest too:
>> http://www.open-bio.org/wiki/EU_Codefest_2012
>
> Are any people from here going to the codefest?
>
> Tiago

Brad is going to the pre-BOSC CodeFest in California,
http://www.open-bio.org/wiki/Codefest_2012

I'm not sure if we have any Biopython folk signed up for the post-BOSC
EU CodeFest in Italy yet.
http://www.open-bio.org/wiki/EU_Codefest_2012

I aim to attend one of the CodeFests - trying to firm up summer
travel plans now...

Peter



From devaniranjan at gmail.com  Mon May  7 22:25:46 2012
From: devaniranjan at gmail.com (George Devaniranjan)
Date: Mon, 7 May 2012 18:25:46 -0400
Subject: [Biopython] PDBParser
Message-ID: <CAFU65PfORVQ6bDCSJyXDfGUgEfqW1T3G67tvO1PfBSv1vJuDcw@mail.gmail.com>

Hi,

I have a question about using  PDBParser


from Bio.PDB.PDBParser import PDBParser

parser=PDBParser()

structure=parser.get_structure("test", "1fat.pdb")
model=structure[0]
chain=model["A"]
residue=chain[1]

I want to use it to extract and WRITE to a file the coordinates of residues
10 to 20 only.
(or whatever residue range I specify)

Using the PDB Parser file I can extract residue id  in the range but how to
I back trace and write the file in the exact format that is found in the
PDB so that I can view it in a program like VMD/Pymol?
(that is I want to write the coordinates and all information as found in
the PDB but only for selected residues that I pass into it )
I know I can do it using VMD but I want to do it for thousands of PDB and
would like to write a database of such extracted fragments.

The other alternative is of course to go line by line in each file and
write the lines that match the residue range specified but I was wondering
if there is a way of doing the same thing using the PDBParser?

Thank you,
George


From anaryin at gmail.com  Tue May  8 08:16:44 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 8 May 2012 10:16:44 +0200
Subject: [Biopython] PDBParser
In-Reply-To: <CAFU65PfORVQ6bDCSJyXDfGUgEfqW1T3G67tvO1PfBSv1vJuDcw@mail.gmail.com>
References: <CAFU65PfORVQ6bDCSJyXDfGUgEfqW1T3G67tvO1PfBSv1vJuDcw@mail.gmail.com>
Message-ID: <CAJ9sUYO9E+UKyr3TkryBYKRBSPe=DSMLGoa-9JzRYWg8ytpAkA@mail.gmail.com>

Hello George,

You want to write only a part of the PDB file? What do you mean by 'all the
info'? If it is header information as well, then this is not possible, but
coordinates it is. You can do it in two ways:

1. Delete all residues/chains/models that are not part of your region of
interest and then write the structure with PDBIO.

2. Use the 'Select' class from PDBIO.py and trim the region of interest.
For example, for residues 1-10 you could do something like this:

from Bio.PDB import PDBIO
from Bio.PDB import Select

class ResidueFilter(Select):
    def accept_residue(self, residue):
        if residue.id[1] in range(1,11):
            return 1

P = PDBParser()
s = P.get_structure('dummy', 'foo.pdb')

io = PDBIO()

io.set_structure(s)
io.save('foo_1-10.pdb', ResidueFilter())


Check the FAQ for a more detailed explanation:

http://biopython.org/DIST/docs/cookbook/biopdb_faq.pdf

Cheers,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



2012/5/8 George Devaniranjan <devaniranjan at gmail.com>

> Hi,
>
> I have a question about using  PDBParser
>
>
> from Bio.PDB.PDBParser import PDBParser
>
> parser=PDBParser()
>
> structure=parser.get_structure("test", "1fat.pdb")
> model=structure[0]
> chain=model["A"]
> residue=chain[1]
>
> I want to use it to extract and WRITE to a file the coordinates of residues
> 10 to 20 only.
> (or whatever residue range I specify)
>
> Using the PDB Parser file I can extract residue id  in the range but how to
> I back trace and write the file in the exact format that is found in the
> PDB so that I can view it in a program like VMD/Pymol?
> (that is I want to write the coordinates and all information as found in
> the PDB but only for selected residues that I pass into it )
> I know I can do it using VMD but I want to do it for thousands of PDB and
> would like to write a database of such extracted fragments.
>
> The other alternative is of course to go line by line in each file and
> write the lines that match the residue range specified but I was wondering
> if there is a way of doing the same thing using the PDBParser?
>
> Thank you,
> George
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



From devaniranjan at gmail.com  Tue May  8 12:44:09 2012
From: devaniranjan at gmail.com (George Devaniranjan)
Date: Tue, 8 May 2012 08:44:09 -0400
Subject: [Biopython] PDBParser
In-Reply-To: <CAJ9sUYO9E+UKyr3TkryBYKRBSPe=DSMLGoa-9JzRYWg8ytpAkA@mail.gmail.com>
References: <CAFU65PfORVQ6bDCSJyXDfGUgEfqW1T3G67tvO1PfBSv1vJuDcw@mail.gmail.com>
	<CAJ9sUYO9E+UKyr3TkryBYKRBSPe=DSMLGoa-9JzRYWg8ytpAkA@mail.gmail.com>
Message-ID: <CAFU65PdDHKGBPP5Z628RunxGKWZYCD5BiO4fC-vT9qhJA_7Arg@mail.gmail.com>

Thank you everyone,

I just need the coordinates of certain fragments from PDB files and this
works for me.
I was trying to use the PDBParser only, but thank you for pointing out
PDBIO to me.

Thank you,
George

On Tue, May 8, 2012 at 4:16 AM, Jo?o Rodrigues <anaryin at gmail.com> wrote:

> Hello George,
>
> You want to write only a part of the PDB file? What do you mean by 'all
> the info'? If it is header information as well, then this is not possible,
> but coordinates it is. You can do it in two ways:
>
> 1. Delete all residues/chains/models that are not part of your region of
> interest and then write the structure with PDBIO.
>
> 2. Use the 'Select' class from PDBIO.py and trim the region of interest.
> For example, for residues 1-10 you could do something like this:
>
> from Bio.PDB import PDBIO
> from Bio.PDB import Select
>
> class ResidueFilter(Select):
>     def accept_residue(self, residue):
>         if residue.id[1] in range(1,11):
>             return 1
>
> P = PDBParser()
> s = P.get_structure('dummy', 'foo.pdb')
>
> io = PDBIO()
>
> io.set_structure(s)
> io.save('foo_1-10.pdb', ResidueFilter())
>
>
> Check the FAQ for a more detailed explanation:
>
> http://biopython.org/DIST/docs/cookbook/biopdb_faq.pdf
>
> Cheers,
>
> Jo?o [...] Rodrigues
> http://nmr.chem.uu.nl/~joao
>
>
>
> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>
>> Hi,
>>
>> I have a question about using  PDBParser
>>
>>
>> from Bio.PDB.PDBParser import PDBParser
>>
>> parser=PDBParser()
>>
>> structure=parser.get_structure("test", "1fat.pdb")
>> model=structure[0]
>> chain=model["A"]
>> residue=chain[1]
>>
>> I want to use it to extract and WRITE to a file the coordinates of
>> residues
>> 10 to 20 only.
>> (or whatever residue range I specify)
>>
>> Using the PDB Parser file I can extract residue id  in the range but how
>> to
>> I back trace and write the file in the exact format that is found in the
>> PDB so that I can view it in a program like VMD/Pymol?
>> (that is I want to write the coordinates and all information as found in
>> the PDB but only for selected residues that I pass into it )
>> I know I can do it using VMD but I want to do it for thousands of PDB and
>> would like to write a database of such extracted fragments.
>>
>> The other alternative is of course to go line by line in each file and
>> write the lines that match the residue range specified but I was wondering
>> if there is a way of doing the same thing using the PDBParser?
>>
>> Thank you,
>> George
>> _______________________________________________
>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biopython
>>
>
>



From devaniranjan at gmail.com  Tue May  8 19:12:22 2012
From: devaniranjan at gmail.com (George Devaniranjan)
Date: Tue, 8 May 2012 15:12:22 -0400
Subject: [Biopython] PDBParser-chain breaks
Message-ID: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>

Hi,

I thought using PERMISSIVE=0 would raise an exception if I pass a PDB with
chain breaks.
However, nothing like that seems to happen.....

For instance

P=PDBParser(PERMISSIVE=0)
structure=P.get_structure('test', '7ODC.pdb')


7ODC has 3 chain breaks but it does not raise an exception.

Thank you
George


From anaryin at gmail.com  Tue May  8 19:34:26 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 8 May 2012 22:34:26 +0300
Subject: [Biopython] PDBParser-chain breaks
In-Reply-To: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
References: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
Message-ID: <CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>

Hi George,

Chain breaks are pretty "harmless" and usually do not represent a faulty
PDB file. The PERMISSIVE flag is for "features" like missing b-factors.

Cheers,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



2012/5/8 George Devaniranjan <devaniranjan at gmail.com>

> Hi,
>
> I thought using PERMISSIVE=0 would raise an exception if I pass a PDB with
> chain breaks.
> However, nothing like that seems to happen.....
>
> For instance
>
> P=PDBParser(PERMISSIVE=0)
> structure=P.get_structure('test', '7ODC.pdb')
>
>
> 7ODC has 3 chain breaks but it does not raise an exception.
>
> Thank you
> George
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



From devaniranjan at gmail.com  Tue May  8 19:37:47 2012
From: devaniranjan at gmail.com (George Devaniranjan)
Date: Tue, 8 May 2012 15:37:47 -0400
Subject: [Biopython] PDBParser-chain breaks
In-Reply-To: <CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>
References: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
	<CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>
Message-ID: <CAFU65Pf1W5Z243gL9yhLGVHwMoxPTi1oXJtmbK9LOPPmo4FfdA@mail.gmail.com>

Hi Jo?o,

Is there a way though to find PDB's with chain breaks? using biopython?

Thank you,
George

On Tue, May 8, 2012 at 3:34 PM, Jo?o Rodrigues <anaryin at gmail.com> wrote:

> Hi George,
>
> Chain breaks are pretty "harmless" and usually do not represent a faulty
> PDB file. The PERMISSIVE flag is for "features" like missing b-factors.
>
> Cheers,
>
> Jo?o [...] Rodrigues
> http://nmr.chem.uu.nl/~joao
>
>
>
> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>
>> Hi,
>>
>> I thought using PERMISSIVE=0 would raise an exception if I pass a PDB with
>> chain breaks.
>> However, nothing like that seems to happen.....
>>
>> For instance
>>
>> P=PDBParser(PERMISSIVE=0)
>> structure=P.get_structure('test', '7ODC.pdb')
>>
>>
>> 7ODC has 3 chain breaks but it does not raise an exception.
>>
>> Thank you
>> George
>> _______________________________________________
>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biopython
>>
>
>



From anaryin at gmail.com  Tue May  8 19:39:02 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 8 May 2012 22:39:02 +0300
Subject: [Biopython] PDBParser-chain breaks
In-Reply-To: <CAFU65Pf1W5Z243gL9yhLGVHwMoxPTi1oXJtmbK9LOPPmo4FfdA@mail.gmail.com>
References: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
	<CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>
	<CAFU65Pf1W5Z243gL9yhLGVHwMoxPTi1oXJtmbK9LOPPmo4FfdA@mail.gmail.com>
Message-ID: <CAJ9sUYNK6O1TeAe7Za_aUXHvLUp802FkdTkbD_TwMN5XyTdPpA@mail.gmail.com>

Of course. Since they throw a warning just make sure to count the warnings,
parse the chain break ones, and if they are more than 0, you have chain
breaks.

Cheers,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



2012/5/8 George Devaniranjan <devaniranjan at gmail.com>

> Hi Jo?o,
>
> Is there a way though to find PDB's with chain breaks? using biopython?
>
> Thank you,
> George
>
> On Tue, May 8, 2012 at 3:34 PM, Jo?o Rodrigues <anaryin at gmail.com> wrote:
>
>> Hi George,
>>
>> Chain breaks are pretty "harmless" and usually do not represent a faulty
>> PDB file. The PERMISSIVE flag is for "features" like missing b-factors.
>>
>> Cheers,
>>
>> Jo?o [...] Rodrigues
>> http://nmr.chem.uu.nl/~joao
>>
>>
>>
>> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>>
>>>  Hi,
>>>
>>> I thought using PERMISSIVE=0 would raise an exception if I pass a PDB
>>> with
>>> chain breaks.
>>> However, nothing like that seems to happen.....
>>>
>>> For instance
>>>
>>> P=PDBParser(PERMISSIVE=0)
>>> structure=P.get_structure('test', '7ODC.pdb')
>>>
>>>
>>> 7ODC has 3 chain breaks but it does not raise an exception.
>>>
>>> Thank you
>>> George
>>> _______________________________________________
>>> Biopython mailing list  -  Biopython at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/biopython
>>>
>>
>>
>



From eric.talevich at gmail.com  Wed May  9 01:59:13 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Tue, 8 May 2012 21:59:13 -0400
Subject: [Biopython] PDBParser-chain breaks
In-Reply-To: <CAJ9sUYNK6O1TeAe7Za_aUXHvLUp802FkdTkbD_TwMN5XyTdPpA@mail.gmail.com>
References: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
	<CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>
	<CAFU65Pf1W5Z243gL9yhLGVHwMoxPTi1oXJtmbK9LOPPmo4FfdA@mail.gmail.com>
	<CAJ9sUYNK6O1TeAe7Za_aUXHvLUp802FkdTkbD_TwMN5XyTdPpA@mail.gmail.com>
Message-ID: <CAMC681kfqQXETXxNGjsZu+unoqcc2Te9-e5yTzn3N4nTj3cwrQ@mail.gmail.com>

The warnings module also lets you convert any warning to an error (or
ignore it, etc.). Use a regular expression to match the warning message:

from Bio import PDB
import warnings
warnings.filterwarnings('error', message='.*discontinuous at.*')
p = PDB.PDBParser()
s = p.get_structure("", "3BEG.pdb")


On Tue, May 8, 2012 at 3:39 PM, Jo?o Rodrigues <anaryin at gmail.com> wrote:

> Of course. Since they throw a warning just make sure to count the warnings,
> parse the chain break ones, and if they are more than 0, you have chain
> breaks.
>
> Cheers,
>
> Jo?o [...] Rodrigues
> http://nmr.chem.uu.nl/~joao
>
>
>
> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>
> > Hi Jo?o,
> >
> > Is there a way though to find PDB's with chain breaks? using biopython?
> >
> > Thank you,
> > George
> >
> > On Tue, May 8, 2012 at 3:34 PM, Jo?o Rodrigues <anaryin at gmail.com>
> wrote:
> >
> >> Hi George,
> >>
> >> Chain breaks are pretty "harmless" and usually do not represent a faulty
> >> PDB file. The PERMISSIVE flag is for "features" like missing b-factors.
> >>
> >> Cheers,
> >>
> >> Jo?o [...] Rodrigues
> >> http://nmr.chem.uu.nl/~joao
> >>
> >>
> >>
> >> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
> >>
> >>>  Hi,
> >>>
> >>> I thought using PERMISSIVE=0 would raise an exception if I pass a PDB
> >>> with
> >>> chain breaks.
> >>> However, nothing like that seems to happen.....
> >>>
> >>> For instance
> >>>
> >>> P=PDBParser(PERMISSIVE=0)
> >>> structure=P.get_structure('test', '7ODC.pdb')
> >>>
> >>>
> >>> 7ODC has 3 chain breaks but it does not raise an exception.
> >>>
> >>> Thank you
> >>> George
> >>> _______________________________________________
> >>> Biopython mailing list  -  Biopython at lists.open-bio.org
> >>> http://lists.open-bio.org/mailman/listinfo/biopython
> >>>
> >>
> >>
> >
>
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



From anaryin at gmail.com  Wed May  9 05:39:40 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Wed, 9 May 2012 08:39:40 +0300
Subject: [Biopython] PDBParser-chain breaks
In-Reply-To: <CAMC681kfqQXETXxNGjsZu+unoqcc2Te9-e5yTzn3N4nTj3cwrQ@mail.gmail.com>
References: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
	<CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>
	<CAFU65Pf1W5Z243gL9yhLGVHwMoxPTi1oXJtmbK9LOPPmo4FfdA@mail.gmail.com>
	<CAJ9sUYNK6O1TeAe7Za_aUXHvLUp802FkdTkbD_TwMN5XyTdPpA@mail.gmail.com>
	<CAMC681kfqQXETXxNGjsZu+unoqcc2Te9-e5yTzn3N4nTj3cwrQ@mail.gmail.com>
Message-ID: <CAJ9sUYOicLscKvO2ybfuQ6=v=3Pe8cWJYEku3ejASHbTdYP0qA@mail.gmail.com>

For some reason however, I didn't get the discontinuous error .. That's why
I proposed this alternative.

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



2012/5/9 Eric Talevich <eric.talevich at gmail.com>

> The warnings module also lets you convert any warning to an error (or
> ignore it, etc.). Use a regular expression to match the warning message:
>
> from Bio import PDB
> import warnings
> warnings.filterwarnings('error', message='.*discontinuous at.*')
> p = PDB.PDBParser()
> s = p.get_structure("", "3BEG.pdb")
>
>
>
> On Tue, May 8, 2012 at 3:39 PM, Jo?o Rodrigues <anaryin at gmail.com> wrote:
>
>> Of course. Since they throw a warning just make sure to count the
>> warnings,
>> parse the chain break ones, and if they are more than 0, you have chain
>> breaks.
>>
>> Cheers,
>>
>> Jo?o [...] Rodrigues
>> http://nmr.chem.uu.nl/~joao
>>
>>
>>
>> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>>
>> > Hi Jo?o,
>> >
>> > Is there a way though to find PDB's with chain breaks? using biopython?
>> >
>> > Thank you,
>> > George
>> >
>> > On Tue, May 8, 2012 at 3:34 PM, Jo?o Rodrigues <anaryin at gmail.com>
>> wrote:
>> >
>> >> Hi George,
>> >>
>> >> Chain breaks are pretty "harmless" and usually do not represent a
>> faulty
>> >> PDB file. The PERMISSIVE flag is for "features" like missing b-factors.
>> >>
>> >> Cheers,
>> >>
>> >> Jo?o [...] Rodrigues
>> >> http://nmr.chem.uu.nl/~joao
>> >>
>> >>
>> >>
>> >> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>> >>
>> >>>  Hi,
>> >>>
>> >>> I thought using PERMISSIVE=0 would raise an exception if I pass a PDB
>> >>> with
>> >>> chain breaks.
>> >>> However, nothing like that seems to happen.....
>> >>>
>> >>> For instance
>> >>>
>> >>> P=PDBParser(PERMISSIVE=0)
>> >>> structure=P.get_structure('test', '7ODC.pdb')
>> >>>
>> >>>
>> >>> 7ODC has 3 chain breaks but it does not raise an exception.
>> >>>
>> >>> Thank you
>> >>> George
>> >>> _______________________________________________
>> >>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> >>> http://lists.open-bio.org/mailman/listinfo/biopython
>> >>>
>> >>
>> >>
>> >
>>
>> _______________________________________________
>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biopython
>>
>
>



From eric.talevich at gmail.com  Wed May  9 14:31:34 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Wed, 9 May 2012 10:31:34 -0400
Subject: [Biopython] PDBParser-chain breaks
In-Reply-To: <CAJ9sUYOicLscKvO2ybfuQ6=v=3Pe8cWJYEku3ejASHbTdYP0qA@mail.gmail.com>
References: <CAFU65PezajNbhaXjvqKknL2s4oj1pk7G5=_Q6c1OYAnVDc9HOA@mail.gmail.com>
	<CAJ9sUYNN7FJiJguK6gCYnao=CBvn36KCYE9=50mMce-FnP08+A@mail.gmail.com>
	<CAFU65Pf1W5Z243gL9yhLGVHwMoxPTi1oXJtmbK9LOPPmo4FfdA@mail.gmail.com>
	<CAJ9sUYNK6O1TeAe7Za_aUXHvLUp802FkdTkbD_TwMN5XyTdPpA@mail.gmail.com>
	<CAMC681kfqQXETXxNGjsZu+unoqcc2Te9-e5yTzn3N4nTj3cwrQ@mail.gmail.com>
	<CAJ9sUYOicLscKvO2ybfuQ6=v=3Pe8cWJYEku3ejASHbTdYP0qA@mail.gmail.com>
Message-ID: <CAMC681kK8fX7W0gzf8-n7NXXe2x1vwUZJSx4RJL2etVUWde2Ag@mail.gmail.com>

Oh, there's a caveat to the warnings module -- if a given warning isn't
captured this way the first time, it's never issued again. So, parsing 3BEG
once normally, and again with the setup I gave, won't trigger the warning
again and therefore won't raise an error.

On Wed, May 9, 2012 at 1:39 AM, Jo?o Rodrigues <anaryin at gmail.com> wrote:

> For some reason however, I didn't get the discontinuous error .. That's
> why I proposed this alternative.
>
> Jo?o [...] Rodrigues
> http://nmr.chem.uu.nl/~joao
>
>
>
> 2012/5/9 Eric Talevich <eric.talevich at gmail.com>
>
>> The warnings module also lets you convert any warning to an error (or
>> ignore it, etc.). Use a regular expression to match the warning message:
>>
>> from Bio import PDB
>> import warnings
>> warnings.filterwarnings('error', message='.*discontinuous at.*')
>> p = PDB.PDBParser()
>> s = p.get_structure("", "3BEG.pdb")
>>
>>
>>
>> On Tue, May 8, 2012 at 3:39 PM, Jo?o Rodrigues <anaryin at gmail.com> wrote:
>>
>>> Of course. Since they throw a warning just make sure to count the
>>> warnings,
>>> parse the chain break ones, and if they are more than 0, you have chain
>>> breaks.
>>>
>>> Cheers,
>>>
>>> Jo?o [...] Rodrigues
>>> http://nmr.chem.uu.nl/~joao
>>>
>>>
>>>
>>> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>>>
>>> > Hi Jo?o,
>>> >
>>> > Is there a way though to find PDB's with chain breaks? using biopython?
>>> >
>>> > Thank you,
>>> > George
>>> >
>>> > On Tue, May 8, 2012 at 3:34 PM, Jo?o Rodrigues <anaryin at gmail.com>
>>> wrote:
>>> >
>>> >> Hi George,
>>> >>
>>> >> Chain breaks are pretty "harmless" and usually do not represent a
>>> faulty
>>> >> PDB file. The PERMISSIVE flag is for "features" like missing
>>> b-factors.
>>> >>
>>> >> Cheers,
>>> >>
>>> >> Jo?o [...] Rodrigues
>>> >> http://nmr.chem.uu.nl/~joao
>>> >>
>>> >>
>>> >>
>>> >> 2012/5/8 George Devaniranjan <devaniranjan at gmail.com>
>>> >>
>>> >>>  Hi,
>>> >>>
>>> >>> I thought using PERMISSIVE=0 would raise an exception if I pass a PDB
>>> >>> with
>>> >>> chain breaks.
>>> >>> However, nothing like that seems to happen.....
>>> >>>
>>> >>> For instance
>>> >>>
>>> >>> P=PDBParser(PERMISSIVE=0)
>>> >>> structure=P.get_structure('test', '7ODC.pdb')
>>> >>>
>>> >>>
>>> >>> 7ODC has 3 chain breaks but it does not raise an exception.
>>> >>>
>>> >>> Thank you
>>> >>> George
>>> >>> _______________________________________________
>>> >>> Biopython mailing list  -  Biopython at lists.open-bio.org
>>> >>> http://lists.open-bio.org/mailman/listinfo/biopython
>>> >>>
>>> >>
>>> >>
>>> >
>>>
>>> _______________________________________________
>>> Biopython mailing list  -  Biopython at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/biopython
>>>
>>
>>
>



From w.arindrarto at gmail.com  Wed May  9 16:24:43 2012
From: w.arindrarto at gmail.com (Wibowo Arindrarto)
Date: Wed, 9 May 2012 18:24:43 +0200
Subject: [Biopython] GSoC Project Update -- 1
Message-ID: <CADEGkF63OCsieC0YQNBW_2wX+UKyKcPrcYpZZ6DnvG0GZ6kJ9A@mail.gmail.com>

Hi everyone,

I just posted my latest blog updated here:
http://bow.web.id/blog/2012/05/warming-up-for-the-coding-period/

To summarize, I've spent most of my time getting to know the programs
I will support better. This has been done by:

1. Playing around with the programs to see how many different outputs
I can generate.
2. Writing scripts to automate test case generation for each of the programs.
3. Writing wrappers (for programs not yet wrapped by Biopython: FASTA,
HMMER, and BLAT) to ease writing the test case generators.
4. Continuing to complete my proposed SearchIO object naming scheme
(http://bit.ly/searchio-terms)

The test cases, their generators, and the wrappers I've written are
available in my non-Biopython gsoc repo here:
http://github.com/bow/gsoc/. Additionally, I've used the generated
test case to improve a recent bug report and submitted a fix for the
next release.

For the coming weeks prior to coding start, I'm planning to play
around more with XML and SQLite as I will use them in the code. I
might start to add more skeleton code to my current development branch
as well (https://github.com/bow/biopython).

cheers,
Bow


From mmokrejs at fold.natur.cuni.cz  Wed May  9 18:01:08 2012
From: mmokrejs at fold.natur.cuni.cz (Martin Mokrejs)
Date: Wed, 09 May 2012 20:01:08 +0200
Subject: [Biopython] Fwd: BlastParsing gives Value Error: Invalid header?
In-Reply-To: <87r4ynu3cx.fsf@fastmail.fm>
References: <mailman.2716.1327235387.3027.biopython@lists.open-bio.org>
	<CACvaKy0bi1WQSHHK0NSL0-rGitRSinCiRf81_qpRv3Mabomwjw@mail.gmail.com>
	<87r4ynu3cx.fsf@fastmail.fm>
Message-ID: <4FAAB0E4.30409@fold.natur.cuni.cz>

Hi Brad,
  I just got bitten by this myself as well. Could be the legacy blast parser
improved to give clearer error message? E.g. that it failed to find the LOCUS
line or whatever was it looking for? With the legacy BLAST documentation being
gone from current Tutorial it is easy to pick the wrong parser. ;)
  And BTW, please do not drop support for legacy BLAST. I just cannot make BLAST+
give me same alignment, no matter what arguments I use to adjust for the (it gives me
wider alignment than wanted and I can make it a look shorter, but shortening it just
a bit like legacy BLAST output .. is not doable).
  And, took me a while to find old biopython-1.52.tar.gz to lookup the old docs.
Could there be a hyperlink from Tutorial to these unpacked, browseable sources? ;)
I am speaking about http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc85 .
Thanks,
Martin
  

Brad Chapman wrote:
> 
> Sar;
> 
>> I am new to both python and biopython.
> 
> Welcome. Thanks for including your code along with the problem report.
> 
>> What I'm trying to do is to parse a blast result xml file (myblast.xml),
>> attached here.
>>
>> The code looks like this:
> [...]
>> blast_parser = NCBIStandalone.BlastParser()
> [...]
>> ValueError: Invalid header?
> 
> You are using NCBIStandalone, which parses plain text blast output. To
> parse the XML output, you should use the NCBIXML parser:
> 
> from Bio.Blast import NCBIXML
> blast_records = NCBIXML.parse(result_handle)
> 
> The tutorial has more details and examples:
> 
> http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc87
> 
> Hope this helps,
> Brad
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
> 
> 


From p.j.a.cock at googlemail.com  Wed May  9 18:25:36 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 9 May 2012 19:25:36 +0100
Subject: [Biopython] Fwd: BlastParsing gives Value Error: Invalid header?
In-Reply-To: <4FAAB0E4.30409@fold.natur.cuni.cz>
References: <mailman.2716.1327235387.3027.biopython@lists.open-bio.org>
	<CACvaKy0bi1WQSHHK0NSL0-rGitRSinCiRf81_qpRv3Mabomwjw@mail.gmail.com>
	<87r4ynu3cx.fsf@fastmail.fm> <4FAAB0E4.30409@fold.natur.cuni.cz>
Message-ID: <CAKVJ-_7W-zcdfkwMYa4gqNuRY_WK66JPV0XbnqGjeswnLu5OOg@mail.gmail.com>

On Wed, May 9, 2012 at 7:01 PM, Martin Mokrejs
<mmokrejs at fold.natur.cuni.cz> wrote:
> Hi Brad,
> ?I just got bitten by this myself as well. Could be the legacy blast parser
> improved to give clearer error message? E.g. that it failed to find the LOCUS
> line or whatever was it looking for? With the legacy BLAST documentation being
> gone from current Tutorial it is easy to pick the wrong parser. ;)
>
> ?And BTW, please do not drop support for legacy BLAST. I just cannot make BLAST+
> give me same alignment, no matter what arguments I use to adjust for the (it gives me
> wider alignment than wanted and I can make it a look shorter, but shortening it just
> a bit like legacy BLAST output .. is not doable).

Have you contacted the NCBI about this possible regression?

> ?And, took me a while to find old biopython-1.52.tar.gz to lookup the old docs.
> Could there be a hyperlink from Tutorial to these unpacked, browseable sources? ;)
> I am speaking about http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc85 .
> Thanks,
> Martin

Could you clarify if you are talking about documentation for calling
the 'legacy'
BLAST command line tools (e.g. blastall), or documentation for parsing the
plain text human readable output (which still exists in BLAST+)?

On a related point, Bow's just done a bit of work updating our plain
text parser to
cope with BLAST+ (specifically changes in BLAST 2.2.25+ and/or 2.2.26+).

One of the aims of Bow's GSoC project will make dealing with the different
BLAST formats a lot simpler.

Peter



From mmokrejs at fold.natur.cuni.cz  Wed May  9 18:48:19 2012
From: mmokrejs at fold.natur.cuni.cz (Martin Mokrejs)
Date: Wed, 09 May 2012 20:48:19 +0200
Subject: [Biopython] Fwd: BlastParsing gives Value Error: Invalid header?
In-Reply-To: <CAKVJ-_7W-zcdfkwMYa4gqNuRY_WK66JPV0XbnqGjeswnLu5OOg@mail.gmail.com>
References: <mailman.2716.1327235387.3027.biopython@lists.open-bio.org>
	<CACvaKy0bi1WQSHHK0NSL0-rGitRSinCiRf81_qpRv3Mabomwjw@mail.gmail.com>
	<87r4ynu3cx.fsf@fastmail.fm> <4FAAB0E4.30409@fold.natur.cuni.cz>
	<CAKVJ-_7W-zcdfkwMYa4gqNuRY_WK66JPV0XbnqGjeswnLu5OOg@mail.gmail.com>
Message-ID: <4FAABBF3.1030007@fold.natur.cuni.cz>

Hi Peter,

Peter Cock wrote:
> On Wed, May 9, 2012 at 7:01 PM, Martin Mokrejs
> <mmokrejs at fold.natur.cuni.cz> wrote:
>> Hi Brad,
>>  I just got bitten by this myself as well. Could be the legacy blast parser
>> improved to give clearer error message? E.g. that it failed to find the LOCUS
>> line or whatever was it looking for? With the legacy BLAST documentation being
>> gone from current Tutorial it is easy to pick the wrong parser. ;)
>>
>>  And BTW, please do not drop support for legacy BLAST. I just cannot make BLAST+
>> give me same alignment, no matter what arguments I use to adjust for the (it gives me
>> wider alignment than wanted and I can make it a look shorter, but shortening it just
>> a bit like legacy BLAST output .. is not doable).
> 
> Have you contacted the NCBI about this possible regression?

No, not yet.

>>  And, took me a while to find old biopython-1.52.tar.gz to lookup the old docs.
>> Could there be a hyperlink from Tutorial to these unpacked, browseable sources? ;)
>> I am speaking about http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc85 .
>> Thanks,
>> Martin
> 
> Could you clarify if you are talking about documentation for calling
> the 'legacy'
> BLAST command line tools (e.g. blastall), or documentation for parsing the

Yes, "blastall -p blastn ...", the default plaintext pairwise output (-m 0),
version 2.2.24.

> plain text human readable output (which still exists in BLAST+)?
> 
> On a related point, Bow's just done a bit of work updating our plain
> text parser to
> cope with BLAST+ (specifically changes in BLAST 2.2.25+ and/or 2.2.26+).
> 
> One of the aims of Bow's GSoC project will make dealing with the different
> BLAST formats a lot simpler.

Its great that we have GSoC students, would I have some spare time I would mentor
one. Good luck and thanks for your care, Peter!
Martin



From livingstonemark at gmail.com  Sat May 12 02:06:07 2012
From: livingstonemark at gmail.com (Mark Livingstone)
Date: Sat, 12 May 2012 12:06:07 +1000
Subject: [Biopython] Superposition
Message-ID: <CABGYGEwaPp-L-nn7n4_eUaQ49gNgigmgg7iwOxDnMKdpPRfghg@mail.gmail.com>

Hi Guys,

Thanks to Andrew and others for help in my previous message. I have
gone through various incarnations of my code, and suddenly found this
simple code works for the small test I have done.

I am using the datafiles from:

Kellogg, E. H., Leaver-Fay, A., & Baker, D. (2011). Role of
conformational sampling in computing mutation-induced changes in
protein structure and stability. Proteins, 79(3), 830?838.
doi:10.1002/prot.22921

These files have been modified so that there are matched PDBs which
vary only by one mutated residue, and I am trying to  carbon alpha
superimpose the PDB which is the Mutanttype over the Wildtype and save
to a PDB - which I seem to have fluked how to do. I am still working
on the code for directory traversal so I have not tried it on the
hundreds of matched PDBs yet.

Is there anything in this code which is going to bite me? How can I improve it?

------------------------------------------------------------------------------------
#!/usr/bin/env python

# Wildtype (wt) = reference, Mutanttype (mt) = alternate

from Bio.PDB import *

#parsing the PDBs
parser = PDBParser(PERMISSIVE=1)

l_wt_atoms = []
l_mt_atoms = []

pdb_out_filename = "./1bti_aligned.pdb"

wt_structure = parser.get_structure("1bpi", './1bpi.pdb')
mt_structure = parser.get_structure("1bti", './1bti.pdb')

wt_model = wt_structure[0]
mt_model = mt_structure[0]

wt_chain = wt_model["A"]
mt_chain = mt_model["A"]

for wt_residue in wt_chain:
    resnum = wt_residue.get_id()[1]
    l_wt_atoms.append( wt_residue['CA'])

for mt_residue in mt_chain:
    resnum = mt_residue.get_id()[1]
    l_mt_atoms.append( mt_residue['CA'])

##SuperImpose
sup = Superimposer()
## Specify the atom lists
## ""wildtype"" and ""mutanttype"" are lists of Atom objects
## The mt atoms will be put on the wt atoms
sup.set_atoms(l_wt_atoms, l_mt_atoms)
## Print rotation/translation/rmsd
print "ROTRAN: ", sup.rotran
print "RMS: ", sup.rms
## Apply rotation/translation to the moving atoms
sup.apply(l_mt_atoms)


print "Saving aligned structure as PDB file %s" % pdb_out_filename
io=PDBIO()
io.set_structure(mt_structure)
io.save(pdb_out_filename)

print "Done"

------------------------------------------------------------------------------------

Thanks in advance,

Mark Livingstone
B.InfoTech (Hons) Student
Griffith University
School of ICT
Southport Qld Australia



From livingstonemark at gmail.com  Sun May 13 06:54:28 2012
From: livingstonemark at gmail.com (Mark Livingstone)
Date: Sun, 13 May 2012 16:54:28 +1000
Subject: [Biopython] .ent versus .pdb files?
Message-ID: <CABGYGEx3Gr-jfU+ZegnZa_3zx_9vk62mb80R7UkeXcVi-uWjFA@mail.gmail.com>

Hi Guys,

I have a bunch of files which appear to be pdb file-like but have the
.ent file extension. Is there any difference of significance to
Bio.PDB?

Thanks in advance,

MarkL


From anaryin at gmail.com  Sun May 13 09:16:00 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Sun, 13 May 2012 11:16:00 +0200
Subject: [Biopython] .ent versus .pdb files?
In-Reply-To: <CABGYGEx3Gr-jfU+ZegnZa_3zx_9vk62mb80R7UkeXcVi-uWjFA@mail.gmail.com>
References: <CABGYGEx3Gr-jfU+ZegnZa_3zx_9vk62mb80R7UkeXcVi-uWjFA@mail.gmail.com>
Message-ID: <CAJ9sUYN1SBGs6BNW6PjVDkbUhsNKMCqdEiKg+3m0auEUhxix4A@mail.gmail.com>

Hi Mark,

Nope, not at all.

Cheers,

Jo?o
No dia 13 de Mai de 2012 08:55, "Mark Livingstone" <
livingstonemark at gmail.com> escreveu:

> Hi Guys,
>
> I have a bunch of files which appear to be pdb file-like but have the
> .ent file extension. Is there any difference of significance to
> Bio.PDB?
>
> Thanks in advance,
>
> MarkL
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



From anubratadas at gmail.com  Mon May 14 12:03:29 2012
From: anubratadas at gmail.com (Anubrata Das)
Date: Mon, 14 May 2012 17:33:29 +0530
Subject: [Biopython] parsing genbank file
Message-ID: <CAHJBGA=hDZ6cjwOmZuDPYGeZPjsmM=Qi1pTCL41ZFLtM=5LDMg@mail.gmail.com>

i am new to biopython. i wanted to parse through individual records
from the genbank file of deinococcus radiodurans chromosome 1
sequence.for e.g i wanted the list of identifiers for each record
>>> identifiers=[seq_record.id for seq_record in SeqIO.parse("C:\\Dr1.gb","genbank")]
>>> identifiers[:10]
['NC_001263.1']
but i would get only one master entry. then if i wanted to parse thru
individual records
>>> record=SeqIO.parse("C:\\Dr1.gb","genbank")
>>> record.next()
SeqRecord(seq=UnknownSeq(2648638, alphabet = IUPACAmbiguousDNA(),
character = 'N'), id='NC_001263.1', name='NC_001263',
description='Deinococcus radiodurans R1 chromosome 1, complete
sequence.', dbxrefs=['Project:57665'])
>>> record.next()

Traceback (most recent call last):
  File "<pyshell#25>", line 1, in <module>
   record.next()
StopIteration
i get this output.
please tell me the correct method
regards
-- 
Anubrata Das
Scientific Officer
Molecular Biology Division
Bhabha Atomic Research Centre


From p.j.a.cock at googlemail.com  Mon May 14 13:48:39 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 14 May 2012 14:48:39 +0100
Subject: [Biopython] parsing genbank file
In-Reply-To: <CAHJBGA=hDZ6cjwOmZuDPYGeZPjsmM=Qi1pTCL41ZFLtM=5LDMg@mail.gmail.com>
References: <CAHJBGA=hDZ6cjwOmZuDPYGeZPjsmM=Qi1pTCL41ZFLtM=5LDMg@mail.gmail.com>
Message-ID: <CAKVJ-_655csWQ5VJvGowNczWmojb+oMhEKfbS-nCSpmvOGB6wA@mail.gmail.com>

On Mon, May 14, 2012 at 1:03 PM, Anubrata Das <anubratadas at gmail.com> wrote:
> i am new to biopython. i wanted to parse through individual records
> from the genbank file of deinococcus radiodurans chromosome 1
> sequence.

Probably your GenBank file only contains one record (for the
whole of chr1). You could use Bio.SeqIO.read(...) in this case:

from Bio import SeqIO
record = SeqIO.parse(r"C:\Dr1.gb","genbank")
print record.id
print len(record.features)

Peter


From David.Lapointe at umassmed.edu  Mon May 14 14:00:20 2012
From: David.Lapointe at umassmed.edu (Lapointe, David)
Date: Mon, 14 May 2012 14:00:20 +0000
Subject: [Biopython] parsing genbank file
In-Reply-To: <CAKVJ-_655csWQ5VJvGowNczWmojb+oMhEKfbS-nCSpmvOGB6wA@mail.gmail.com>
References: <CAHJBGA=hDZ6cjwOmZuDPYGeZPjsmM=Qi1pTCL41ZFLtM=5LDMg@mail.gmail.com>
	<CAKVJ-_655csWQ5VJvGowNczWmojb+oMhEKfbS-nCSpmvOGB6wA@mail.gmail.com>
Message-ID: <86BFEB1DFA6CB3448DB8AB1FC52F4059081148@ummscsmbx06.ad.umassmed.edu>

You might try looking for sequences here

ftp://ftp.ncbi.nlm.nih.gov/genomes/Bacteria/Deinococcus_radiodurans_R1_uid57665/

David

-----Original Message-----
From: biopython-bounces at lists.open-bio.org [mailto:biopython-bounces at lists.open-bio.org] On Behalf Of Peter Cock
Sent: Monday, May 14, 2012 9:49 AM
To: Anubrata Das
Cc: biopython at lists.open-bio.org
Subject: Re: [Biopython] parsing genbank file

On Mon, May 14, 2012 at 1:03 PM, Anubrata Das <anubratadas at gmail.com> wrote:
> i am new to biopython. i wanted to parse through individual records
> from the genbank file of deinococcus radiodurans chromosome 1
> sequence.

Probably your GenBank file only contains one record (for the
whole of chr1). You could use Bio.SeqIO.read(...) in this case:

from Bio import SeqIO
record = SeqIO.parse(r"C:\Dr1.gb","genbank")
print record.id
print len(record.features)

Peter
_______________________________________________
Biopython mailing list  -  Biopython at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biopython




From mmokrejs at fold.natur.cuni.cz  Wed May 16 09:32:34 2012
From: mmokrejs at fold.natur.cuni.cz (Martin Mokrejs)
Date: Wed, 16 May 2012 11:32:34 +0200
Subject: [Biopython] Legacy blast XML parser returns prematurely
	StopIteration
Message-ID: <4FB37432.7060707@fold.natur.cuni.cz>

Hi,
  I am parsing some blast 2.2.24 XML output and the last record I get is the one from
iteration 124. I see that entry is followed by a new <Iteration_iter-num> section which
is probably the culprit. I will try newer legacy blast but still, biopython could maybe
overcome this bug in XML input?



blastall -p blastn -A 4 -i SRR068315.fasta -d my_targets.fasta -F 0 -S 1 -r 2 -e 10e-30 -m 7

<?xml version="1.0"?>
<!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd">
<BlastOutput>
  <BlastOutput_program>blastn</BlastOutput_program>
  <BlastOutput_version>blastn 2.2.24 [Aug-08-2010]</BlastOutput_version>
  <BlastOutput_reference>~Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, ~Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), ~&quot;Gapped BLAST and PSI-BLAST: a new generation of protein database search~programs&quot;,  Nucleic Acids Res. 25:3389-3402.</BlastOutput_reference>
  <BlastOutput_db>my_targets.fasta</BlastOutput_db>
  <BlastOutput_query-ID>lcl|1_0</BlastOutput_query-ID>
  <BlastOutput_query-def>FYUQ5C204IQCOE length=283 xy=3463_2076 region=4 run=R_2009_07_08_19_30_38_</BlastOutput_query-def>
  <BlastOutput_query-len>318</BlastOutput_query-len>
  <BlastOutput_param>
    <Parameters>
      <Parameters_expect>1e-29</Parameters_expect>
      <Parameters_sc-match>2</Parameters_sc-match>
      <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
      <Parameters_gap-open>5</Parameters_gap-open>
      <Parameters_gap-extend>2</Parameters_gap-extend>
      <Parameters_filter>F</Parameters_filter>
    </Parameters>
  </BlastOutput_param>
  <BlastOutput_iterations>
[cut]
    <Iteration>
      <Iteration_iter-num>124</Iteration_iter-num>
      <Iteration_query-ID>lcl|124_0</Iteration_query-ID>
      <Iteration_query-def>FYUQ5C204JXGMI length=44 xy=3954_2264 region=4 run=R_2009_07_08_19_30_38_</Iteration_query-def>
      <Iteration_query-len>350</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>22</Statistics_db-num>
          <Statistics_db-len>9262</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.41</Statistics_kappa>
          <Statistics_lambda>0.625</Statistics_lambda>
          <Statistics_entropy>0.78</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>22</Statistics_db-num>
          <Statistics_db-len>9262</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.41</Statistics_kappa>
          <Statistics_lambda>0.625</Statistics_lambda>
          <Statistics_entropy>0.78</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>125</Iteration_iter-num>
      <Iteration_query-ID>lcl|125_0</Iteration_query-ID>
      <Iteration_query-def>FYUQ5C204JFG82 length=173 xy=3749_2948 region=4 run=R_2009_07_08_19_30_38_</Iteration_query-def>
      <Iteration_query-len>208</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>22</Statistics_db-num>
          <Statistics_db-len>9262</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.41</Statistics_kappa>
          <Statistics_lambda>0.625</Statistics_lambda>
          <Statistics_entropy>0.78</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>126</Iteration_iter-num>
      <Iteration_query-ID>lcl|126_0</Iteration_query-ID>
      <Iteration_query-def>FYUQ5C204I2D3A length=146 xy=3600_2628 region=4 run=R_2009_07_08_19_30_38_</Iteration_query-def>
      <Iteration_query-len>205</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>22</Statistics_db-num>
          <Statistics_db-len>9262</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.41</Statistics_kappa>
          <Statistics_lambda>0.625</Statistics_lambda>
          <Statistics_entropy>0.78</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>



Grep-ping for the iteration numbers I foresee few more cases like that ahead in the XML file:

      <Iteration_iter-num>234</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>235</Iteration_iter-num>
      <Iteration_iter-num>236</Iteration_iter-num>

      <Iteration_iter-num>345</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>346</Iteration_iter-num>
      <Iteration_iter-num>347</Iteration_iter-num>

      <Iteration_iter-num>450</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>451</Iteration_iter-num>
      <Iteration_iter-num>452</Iteration_iter-num>

      <Iteration_iter-num>555</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>556</Iteration_iter-num>
      <Iteration_iter-num>557</Iteration_iter-num>

      <Iteration_iter-num>655</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>656</Iteration_iter-num>
      <Iteration_iter-num>657</Iteration_iter-num>

      <Iteration_iter-num>759</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>760</Iteration_iter-num>
      <Iteration_iter-num>761</Iteration_iter-num>

      <Iteration_iter-num>859</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>860</Iteration_iter-num>
      <Iteration_iter-num>861</Iteration_iter-num>

      <Iteration_iter-num>956</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>957</Iteration_iter-num>
      <Iteration_iter-num>958</Iteration_iter-num>

      <Iteration_iter-num>1050</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1051</Iteration_iter-num>
      <Iteration_iter-num>1052</Iteration_iter-num>

      <Iteration_iter-num>1145</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1146</Iteration_iter-num>
      <Iteration_iter-num>1147</Iteration_iter-num>

      <Iteration_iter-num>1239</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1240</Iteration_iter-num>
      <Iteration_iter-num>1241</Iteration_iter-num>

      <Iteration_iter-num>1333</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1334</Iteration_iter-num>
      <Iteration_iter-num>1335</Iteration_iter-num>

      <Iteration_iter-num>1430</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1431</Iteration_iter-num>
      <Iteration_iter-num>1432</Iteration_iter-num>

      <Iteration_iter-num>1523</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1524</Iteration_iter-num>
      <Iteration_iter-num>1525</Iteration_iter-num>

      <Iteration_iter-num>1610</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1611</Iteration_iter-num>
      <Iteration_iter-num>1612</Iteration_iter-num>

      <Iteration_iter-num>1703</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1704</Iteration_iter-num>
      <Iteration_iter-num>1705</Iteration_iter-num>

      <Iteration_iter-num>1792</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1793</Iteration_iter-num>
      <Iteration_iter-num>1794</Iteration_iter-num>

      <Iteration_iter-num>1881</Iteration_iter-num>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_iter-num>1882</Iteration_iter-num>
      <Iteration_iter-num>1883</Iteration_iter-num>


Then, no this problem anymore until end of the XML file at:
     <Iteration_iter-num>25698</Iteration_iter-num>


Thanks for comments,
Martin


From p.j.a.cock at googlemail.com  Wed May 16 09:48:10 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 16 May 2012 10:48:10 +0100
Subject: [Biopython] Legacy blast XML parser returns prematurely
	StopIteration
In-Reply-To: <4FB37432.7060707@fold.natur.cuni.cz>
References: <4FB37432.7060707@fold.natur.cuni.cz>
Message-ID: <CAKVJ-_7yOHV1Z2znsCBU+SRsiZWKyTiySO2an588NtNSWaHr6g@mail.gmail.com>

On Wed, May 16, 2012 at 10:32 AM, Martin Mokrejs
<mmokrejs at fold.natur.cuni.cz> wrote:
> Hi,
> ?I am parsing some blast 2.2.24 XML output and the last record I get is the one from
> iteration 124. I see that entry is followed by a new <Iteration_iter-num> section which
> is probably the culprit. I will try newer legacy blast but still, biopython could maybe
> overcome this bug in XML input?
>
> blastall -p blastn -A 4 -i SRR068315.fasta -d my_targets.fasta -F 0 -S 1 -r 2 -e 10e-30 -m 7
>

Could you file a bug here and attach the complete XML test case please?
http://redmine.open-bio.org/projects/biopython

Our XML parser should handle both NCBI  'legacy' BLAST and BLAST+

Thanks,

Peter



From josefergil at gmail.com  Wed May 23 14:18:44 2012
From: josefergil at gmail.com (jose gil)
Date: Wed, 23 May 2012 16:18:44 +0200
Subject: [Biopython] starting with biopython
Message-ID: <CAD_61-yTmZ3Mt8rr2FtqdtKV_ey0fJcmxTsjUQHwdB2LeAfvtA@mail.gmail.com>

Hello everyone,

I'm starting with the program and I have some problems, because I don't
know how download the files in order the program can load them.
from the python shell I follow the instructions in the tutorial in order to
load the sequence but I don't know actually where is the correct place to
save the files I download for example from GenBank.

Thank you very much for your help,

-- 
Jos? Fernando Gil R.



From p.j.a.cock at googlemail.com  Wed May 23 14:45:04 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 23 May 2012 15:45:04 +0100
Subject: [Biopython] starting with biopython
In-Reply-To: <CAD_61-yTmZ3Mt8rr2FtqdtKV_ey0fJcmxTsjUQHwdB2LeAfvtA@mail.gmail.com>
References: <CAD_61-yTmZ3Mt8rr2FtqdtKV_ey0fJcmxTsjUQHwdB2LeAfvtA@mail.gmail.com>
Message-ID: <CAKVJ-_4++y0cLwnsNnhe-f9Pvgc=nQCbLDdieWnezLn6Vn01Gg@mail.gmail.com>

On Wed, May 23, 2012 at 3:18 PM, jose gil <josefergil at gmail.com> wrote:
> Hello everyone,
>
> I'm starting with the program and I have some problems, because I don't
> know how download the files in order the program can load them.
> from the python shell I follow the instructions in the tutorial in order to
> load the sequence but I don't know actually where is the correct place to
> save the files I download for example from GenBank.
>
> Thank you very much for your help,

The simplest approach is to put your Python scripts and data files
all in the same folder together. Then you don't need to bother with
giving paths, just local filenames will be fine.

Some experience with working at the command line would help
with understanding paths, absolute paths, and relative paths.

Are you working on Windows?

Note that by default Windows hides the extension of known
file formats - I always turn this off so that in Explorer I see the
full file names. What I mean is I prefer to see "example.fasta"
and "example.gbk" instead of two files apparently called
"example" but with a different icon. You'll find there are lots
of file extensions in Bioinformatics, and they are important.

Peter


From animesh.agrawal at anu.edu.au  Thu May 24 05:58:12 2012
From: animesh.agrawal at anu.edu.au (Animesh Agrawal)
Date: Thu, 24 May 2012 15:58:12 +1000
Subject: [Biopython] Integrating SQL query to biopython
Message-ID: <000001cd3972$33fc4c40$9bf4e4c0$@agrawal@anu.edu.au>

Hi, 

I am running small SQL queries to select sequences from a local BIOSQL
database. One instance such query is as follows:

 

SELECT  biosequence.*

FROM    biosequence JOIN bioentry USING (bioentry_id)

WHERE   biosequence.seq NOT LIKE "%X%"

AND   biosequence.alphabet = 'protein' 

 

I am wondering, how do I integrate this SQL query with Biopython code to get
the output in form of SeqRecord or Seq objects.

 

Cheers,

Animesh  

 

Animesh Agrawal

PhD Scholar

Computational & Conceptual Biology, JCSMR 

Australian National University 

Canberra, Australia

Tel:    +61 2 6125 8303

Email:  animesh.agrawal at anu.edu.au

 



From p.j.a.cock at googlemail.com  Thu May 24 09:10:13 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 24 May 2012 10:10:13 +0100
Subject: [Biopython] Integrating SQL query to biopython
In-Reply-To: <4fbdcf67.ca48340a.3ba1.5c63SMTPIN_ADDED@mx.google.com>
References: <4fbdcf67.ca48340a.3ba1.5c63SMTPIN_ADDED@mx.google.com>
Message-ID: <CAKVJ-_5YdDGZB=DiY2QP2BfWR1CGOM2pJPrA54Ycg256GqqLOQ@mail.gmail.com>

On Thu, May 24, 2012 at 6:58 AM, Animesh Agrawal
<animesh.agrawal at anu.edu.au> wrote:
> Hi,
>
> I am running small SQL queries to select sequences from a local BIOSQL
> database. One instance such query is as follows:
>
>
>
> SELECT ?biosequence.*
>
> FROM ? ?biosequence JOIN bioentry USING (bioentry_id)
>
> WHERE ? biosequence.seq NOT LIKE "%X%"
>
> AND ? biosequence.alphabet = 'protein'
>
>
>
> I am wondering, how do I integrate this SQL query with Biopython code to get
> the output in form of SeqRecord or Seq objects.

>From your direct database access, get the bioentry table's primary ID,
and then use that to create a DBSeqRecord object (which is a subclass
of SeqRecord and will also load the sequence for you).

You will also need the adapter object as the other initialization argument,
which is how the DBSeqRecord knows which database to read from.
Get that by connecting to the BioSQL database through the Biopython
code as usual.

Something like this (untested):

from BioSQL import BioSeqDatabase
from BioSQL.BioSeq import DBSeqRecord
#Connect to BioSQL database as usual,
server = BioSeqDatabase.open_database(driver="MySQLdb", user="root",
                     passwd = "", host = "localhost", db="bioseqdb")
primary_id = .... #your code here
#Use Biopython's BioSQL SeqRecord loading:
record = DBSeqRecord(server.adapter, primary_id)

Peter



From chapmanb at 50mail.com  Thu May 24 09:15:02 2012
From: chapmanb at 50mail.com (Brad Chapman)
Date: Thu, 24 May 2012 05:15:02 -0400
Subject: [Biopython] Integrating SQL query to biopython
In-Reply-To: <000001cd3972$33fc4c40$9bf4e4c0$@agrawal@anu.edu.au>
References: <000001cd3972$33fc4c40$9bf4e4c0$@agrawal@anu.edu.au>
Message-ID: <87d35uos89.fsf@fastmail.fm>


Animesh;

> I am running small SQL queries to select sequences from a local BIOSQL
> database. One instance such query is as follows:
>
> SELECT  biosequence.*
> FROM    biosequence JOIN bioentry USING (bioentry_id)
> WHERE   biosequence.seq NOT LIKE "%X%"
> AND   biosequence.alphabet = 'protein' 
>
> I am wondering, how do I integrate this SQL query with Biopython code to get
> the output in form of SeqRecord or Seq objects.

If you have the interval bioentry IDs you can use the BioSQL code
directly to get SeqRecord compatible objects:

from BioSQL import BioSeqDatabase
from BioSQL.BioSeq import DBSeqRecord

server = BioSeqDatabase.open_database(driver="MySQLdb", user="root",
                     passwd = "", host = "localhost", db="bioseqdb")
rec = DBSeqRecord(server.adaptor, your_bioentry_id)

Hope this helps,
Brad


From p.j.a.cock at googlemail.com  Thu May 24 09:28:14 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 24 May 2012 10:28:14 +0100
Subject: [Biopython] Integrating SQL query to biopython
In-Reply-To: <87d35uos89.fsf@fastmail.fm>
References: <87d35uos89.fsf@fastmail.fm>
Message-ID: <CAKVJ-_7XzuBKLeY_Vj=OftWpESn4xpLD+YSn-WQmACi9yB7zmA@mail.gmail.com>

On Thu, May 24, 2012 at 10:15 AM, Brad Chapman <chapmanb at 50mail.com> wrote:
>
> Animesh;
>
>> I am running small SQL queries to select sequences from a local BIOSQL
>> database. One instance such query is as follows:
>>
>> SELECT ?biosequence.*
>> FROM ? ?biosequence JOIN bioentry USING (bioentry_id)
>> WHERE ? biosequence.seq NOT LIKE "%X%"
>> AND ? biosequence.alphabet = 'protein'
>>
>> I am wondering, how do I integrate this SQL query with Biopython code to get
>> the output in form of SeqRecord or Seq objects.
>
> If you have the interval bioentry IDs you can use the BioSQL code
> directly to get SeqRecord compatible objects:
>
> from BioSQL import BioSeqDatabase
> from BioSQL.BioSeq import DBSeqRecord
>
> server = BioSeqDatabase.open_database(driver="MySQLdb", user="root",
> ? ? ? ? ? ? ? ? ? ? passwd = "", host = "localhost", db="bioseqdb")
> rec = DBSeqRecord(server.adaptor, your_bioentry_id)
>
> Hope this helps,
> Brad

Good to see we gave the same answer :)

Peter



From livingstonemark at gmail.com  Mon May 28 01:55:25 2012
From: livingstonemark at gmail.com (Mark Livingstone)
Date: Mon, 28 May 2012 11:55:25 +1000
Subject: [Biopython] Getting the atom number of a CA residue
Message-ID: <CABGYGEy_2VsH8qP6MZGzGK6PS4GAmXmNZU7sOOVtdxH_bD95AQ@mail.gmail.com>

Hi Guys,

I want to use the Bio.PDB.NeighborSearch. To do so, it seems I need to
tell it what atom to center the search on. I have constructed this
convoluted center finding method ;-) and I'm wondering if there is
something simpler!!


    atoms = Bio.PDB.Selection.unfold_entities(mtc, "A")
    # we find the atom number of the mutation site residue's CA atom
which becomes the center of our search radius
    center = atoms[mtc[mutation_site].get_unpacked_list()[1].get_serial_number()].get_coord()
    bions = Bio.PDB.NeighborSearch(atoms)
    atoms_found = bions.search(center, 5.0, "A")
    residues_found = bions.search(center, 5.0, "R")


Using 1bti.pdb and asking for the Residue 22 [=mutation_site] CA [1]
does give me atom #187 coords which is correct. At the moment I am
only interested in CA, but I realise this somewhat hardcoded solution
will not scale!

Secondly, what I eventually want to get is more of a range function
where I can find e.g. what is between 5-10A from center. Since
neighborsearch doesn't give access to distances of the atoms /
residues, am I correct in thinking I will have to "roll my own"
neighbourhoodsearch and construct a sorted by distance list and
iterate through it getting e.g. 5 < distance < 10 or similar?

Thanks for your thoughts.

MarkL


From livingstonemark at gmail.com  Wed May 30 03:09:41 2012
From: livingstonemark at gmail.com (Mark Livingstone)
Date: Wed, 30 May 2012 13:09:41 +1000
Subject: [Biopython] Getting side chain atoms?
Message-ID: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>

Hi Guys,

I notice on the wiki that it says the mailing list is at
biopython at biopython.org, but when I suscribed it said to use
biopython at lists.open-bio.org, so I'm wondering what the difference is?

What is the simplest way to get a list of the side chain atoms given
say a residue number?

Also, not entirely related to Biopython, but I'm wondering if there is
some way to get a sense of the overall shape of a protein? Like is it
globular, a big string, a sheet or what? I can see if you looked at
the bounding box, that might be a starting point, but does anyone have
any other ideas? I habe been looking at it as a geometry type problem
but haven't gotten too far yet.

Thanks in advance,

MarkL


From livingstonemark at gmail.com  Wed May 30 03:09:41 2012
From: livingstonemark at gmail.com (Mark Livingstone)
Date: Wed, 30 May 2012 13:09:41 +1000
Subject: [Biopython] Getting side chain atoms?
Message-ID: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>

Hi Guys,

I notice on the wiki that it says the mailing list is at
biopython at biopython.org, but when I suscribed it said to use
biopython at lists.open-bio.org, so I'm wondering what the difference is?

What is the simplest way to get a list of the side chain atoms given
say a residue number?

Also, not entirely related to Biopython, but I'm wondering if there is
some way to get a sense of the overall shape of a protein? Like is it
globular, a big string, a sheet or what? I can see if you looked at
the bounding box, that might be a starting point, but does anyone have
any other ideas? I habe been looking at it as a geometry type problem
but haven't gotten too far yet.

Thanks in advance,

MarkL


From dilara.ally at gmail.com  Wed May 30 03:30:27 2012
From: dilara.ally at gmail.com (Dilara Ally)
Date: Tue, 29 May 2012 20:30:27 -0700
Subject: [Biopython] replace header
Message-ID: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>

Hi Guys, 

I'm interested in replacing just one part of the header for every read in a 40Gb fastq file.  Because the files are so huge I don't want to read the entire file into the memory just the single read and then rewrite to a new file.   The problem as it stands is that I'm  creating all new SeqRecord object, appending a list called newsolid.  And then once that list is complete with all records,  I write that list to a new file.  

Preferably I'd like to write each new SeqRecord immediately to a file.  Sorry if I've missed this lesson in the Biopython tutorial and cook book!  Any help would be greatly appreciated!

Here is the code. 

from Bio import SeqIO
from Bio.SeqRecord import SeqRecord
newsolid=[]
for seq_record in SeqIO.parse("solid_1.fastq", "fastq"):
   print seq_record.id
   original_header=seq_record.id
   import re
   subfind=r"(\w+)_(\w+)"
   result=re.search(subfind, original_header)
   print result.groups()
   subheader="_1"
   subreplace=r"\1_1"
   new_header=re.sub(subfind, subreplace, original_header)
   print new_header
   newfastqrecord=SeqRecord(seq_record.seq, id=new_header, letter_annotations=seq_record.letter_annotations)
   newsolid.append(newfastqrecord)

output="newsolid_1.fastq"
from Bio import SeqIO
SeqIO.write(newsolid, output, "fastq")


Cheers, Dilara



From arklenna at gmail.com  Wed May 30 03:44:41 2012
From: arklenna at gmail.com (Lenna Peterson)
Date: Tue, 29 May 2012 23:44:41 -0400
Subject: [Biopython] replace header
In-Reply-To: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>
References: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>
Message-ID: <CAK610_4GGZKe0PW_zRkd5uqZCenowmT++_HGqGcyE5j=tpfgzg@mail.gmail.com>

Hi Dilara,

Opening a file for append with 'a' allows successive writes to go to
the end of the file.

Before the loop:

    out_handle = open("newsolid_1.fastq", 'a')

In the loop:

    SeqIO.write(newfastqrecord, out_handle, "fastq")

After the loop:

    out_handle.close()


You may have to manually write newlines to the file but hopefully the
fastq writer handles that properly.

Hope that helps,

Lenna


From dilara.ally at gmail.com  Wed May 30 03:54:13 2012
From: dilara.ally at gmail.com (Dilara Ally)
Date: Tue, 29 May 2012 20:54:13 -0700
Subject: [Biopython] replace header
In-Reply-To: <CAK610_4GGZKe0PW_zRkd5uqZCenowmT++_HGqGcyE5j=tpfgzg@mail.gmail.com>
References: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>
	<CAK610_4GGZKe0PW_zRkd5uqZCenowmT++_HGqGcyE5j=tpfgzg@mail.gmail.com>
Message-ID: <A4360020-0E00-4F93-9DE0-B48E849C9416@gmail.com>

Thanks!  That worked. 

On May 29, 2012, at 8:44 PM, Lenna Peterson wrote:

> Hi Dilara,
> 
> Opening a file for append with 'a' allows successive writes to go to
> the end of the file.
> 
> Before the loop:
> 
>    out_handle = open("newsolid_1.fastq", 'a')
> 
> In the loop:
> 
>    SeqIO.write(newfastqrecord, out_handle, "fastq")
> 
> After the loop:
> 
>    out_handle.close()
> 
> 
> You may have to manually write newlines to the file but hopefully the
> fastq writer handles that properly.
> 
> Hope that helps,
> 
> Lenna



From anaryin at gmail.com  Wed May 30 06:04:14 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Wed, 30 May 2012 08:04:14 +0200
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
Message-ID: <CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>

Hi Mark,

The gyration tensor should give you the means of calculating how oblate or
prolate your molecule is.

Regarding the sidechain, i think you just have to manually do it, but since
the backbone atoms are always the same it shouldn't be too hard.

Cheers,

Jo?o
No dia 30 de Mai de 2012 05:10, "Mark Livingstone" <
livingstonemark at gmail.com> escreveu:

> Hi Guys,
>
> I notice on the wiki that it says the mailing list is at
> biopython at biopython.org, but when I suscribed it said to use
> biopython at lists.open-bio.org, so I'm wondering what the difference is?
>
> What is the simplest way to get a list of the side chain atoms given
> say a residue number?
>
> Also, not entirely related to Biopython, but I'm wondering if there is
> some way to get a sense of the overall shape of a protein? Like is it
> globular, a big string, a sheet or what? I can see if you looked at
> the bounding box, that might be a starting point, but does anyone have
> any other ideas? I habe been looking at it as a geometry type problem
> but haven't gotten too far yet.
>
> Thanks in advance,
>
> MarkL
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



From anaryin at gmail.com  Wed May 30 06:04:14 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Wed, 30 May 2012 08:04:14 +0200
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
Message-ID: <CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>

Hi Mark,

The gyration tensor should give you the means of calculating how oblate or
prolate your molecule is.

Regarding the sidechain, i think you just have to manually do it, but since
the backbone atoms are always the same it shouldn't be too hard.

Cheers,

Jo?o
No dia 30 de Mai de 2012 05:10, "Mark Livingstone" <
livingstonemark at gmail.com> escreveu:

> Hi Guys,
>
> I notice on the wiki that it says the mailing list is at
> biopython at biopython.org, but when I suscribed it said to use
> biopython at lists.open-bio.org, so I'm wondering what the difference is?
>
> What is the simplest way to get a list of the side chain atoms given
> say a residue number?
>
> Also, not entirely related to Biopython, but I'm wondering if there is
> some way to get a sense of the overall shape of a protein? Like is it
> globular, a big string, a sheet or what? I can see if you looked at
> the bounding box, that might be a starting point, but does anyone have
> any other ideas? I habe been looking at it as a geometry type problem
> but haven't gotten too far yet.
>
> Thanks in advance,
>
> MarkL
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



From p.j.a.cock at googlemail.com  Wed May 30 07:45:29 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 30 May 2012 08:45:29 +0100
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
Message-ID: <CAKVJ-_7S4mhdWGuAtiwzRxvvFxAWNeQHC3Z64gbmSACGrQqkSg@mail.gmail.com>

On Wednesday, May 30, 2012, Mark Livingstone wrote:

> Hi Guys,
>
> I notice on the wiki that it says the mailing list is at
> biopython at biopython.org <javascript:;>, but when I suscribed it said to
> use
> biopython at lists.open-bio.org <javascript:;>, so I'm wondering what the
> difference is?
>
>
They are the same - the OBF (open-bio.org) machine also
handles the BioPerl mailing lists etc as well.

Peter


From p.j.a.cock at googlemail.com  Wed May 30 07:45:29 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 30 May 2012 08:45:29 +0100
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
Message-ID: <CAKVJ-_7S4mhdWGuAtiwzRxvvFxAWNeQHC3Z64gbmSACGrQqkSg@mail.gmail.com>

On Wednesday, May 30, 2012, Mark Livingstone wrote:

> Hi Guys,
>
> I notice on the wiki that it says the mailing list is at
> biopython at biopython.org <javascript:;>, but when I suscribed it said to
> use
> biopython at lists.open-bio.org <javascript:;>, so I'm wondering what the
> difference is?
>
>
They are the same - the OBF (open-bio.org) machine also
handles the BioPerl mailing lists etc as well.

Peter


From p.j.a.cock at googlemail.com  Wed May 30 08:56:57 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 30 May 2012 09:56:57 +0100
Subject: [Biopython] replace header
In-Reply-To: <A4360020-0E00-4F93-9DE0-B48E849C9416@gmail.com>
References: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>
	<CAK610_4GGZKe0PW_zRkd5uqZCenowmT++_HGqGcyE5j=tpfgzg@mail.gmail.com>
	<A4360020-0E00-4F93-9DE0-B48E849C9416@gmail.com>
Message-ID: <CAKVJ-_4hHe=THg0ZLokt2mja15-vd+DBsB+a-YFZGNgiO2zADg@mail.gmail.com>

On Wed, May 30, 2012 at 4:54 AM, Dilara Ally <dilara.ally at gmail.com> wrote:
> Thanks! ?That worked.
>
> On May 29, 2012, at 8:44 PM, Lenna Peterson wrote:
>
>> Hi c,
>>
>> Opening a file for append with 'a' allows successive writes to go to
>> the end of the file.
>>
>> Before the loop:
>>
>> ? ?out_handle = open("newsolid_1.fastq", 'a')
>>
>> In the loop:
>>
>> ? ?SeqIO.write(newfastqrecord, out_handle, "fastq")
>>
>> After the loop:
>>
>> ? ?out_handle.close()

Hi Dilara & Lenna,

I would use append mode with caution - it will have side effects
like if you run this script twice, the output file will double in size
(the first run plus the second run). Wouldn't opening in write
mode work just as well here?
i.e. Open the handle, do the loop, close the handle.

There are some other further changes I would suggest.
First, you don't need to create a new SeqRecord, you can
modify the old record in situ. This will be faster as it avoids
extra object creation:

...
newfastqrecord=SeqRecord(seq_record.seq, id=new_header,
letter_annotations=seq_record.letter_annotations)
...

becomes just:

...
seq_record.id = new_header
...

Next, it is better to call SeqIO.write(...) once to do the whole
file. On simple file formats like FASTA, FASTQ, GenBank,
there is no header/footer structure so you can write each
record independently. In general this is not possible, e.g.
SFF files. Moreover, multiple calls to SeqIO.write(...) is
slower than one single call.

The key point about using SeqIO.write(...) once to do a whole
file is this requires an iterator based approach. For example,
using a generator expression and a function acting on a single
record:

def modify_record(record):
    #Do something sensible to the headers here:
    record.id = "modified"
    return record
#This is a generator expression:
modified = (modify_record(r) for r in SeqIO.parse("solid_1.fastq", "fastq"))
count = SeqIO.write(modified, "newsolid_1.fastq", "fastq")
print "Modified %i records" % count

Equivalently using a generator function which does the
looping itself:

def modify_records(records):
    for record in records:
        #Do something sensible to the headers here:
        record.id = "modified"
        yield record
count = SeqIO.write(modify_records(SeqIO.parse("solid_1.fastq",
"fastq")), "newsolid_1.fastq", "fastq")
print "Modified %i records" % count

Getting to gripes with iterators and thinking this way takes
a while - but it is extremely useful for dealing with large
datasets efficiently (without running out of memory).

Now, For FASTQ in particular, the files are usually very large,
and using SeqIO and SeqRecord objects can be too slow.
You might find this useful:
http://news.open-bio.org/news/2009/09/biopython-fast-fastq/

Peter



From ferreirafm at usp.br  Wed May 30 12:57:49 2012
From: ferreirafm at usp.br (Frederico Moras Ferreira)
Date: Wed, 30 May 2012 09:57:49 -0300
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
	<CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>
Message-ID: <4FC6194D.1060802@usp.br>

Hi Mark,
I'm also very interested in overall protein shape analysis. I'm 
completely new to Biopython and can't help you much. Regarding to your 
question itself, that's something not trivial. One of the approaches 
would be to calculate the center of mass of your protein and iteratively 
calculate the momentum of inertia along three mutually perpendicular 
axes so as it is maximum in one direction and minimum in another. 
Sampling the momentum of inertia of the third axis and comparing with 
the other two will give a good estimation of your protein overall shape.
Best of luck,
Fred

Em 30-05-2012 03:04, Jo?o Rodrigues escreveu:
> Hi Mark,
>
> The gyration tensor should give you the means of calculating how oblate or
> prolate your molecule is.
>
> Regarding the sidechain, i think you just have to manually do it, but since
> the backbone atoms are always the same it shouldn't be too hard.
>
> Cheers,
>
> Jo?o
> No dia 30 de Mai de 2012 05:10, "Mark Livingstone"<
> livingstonemark at gmail.com>  escreveu:
>
>> Hi Guys,
>>
>> I notice on the wiki that it says the mailing list is at
>> biopython at biopython.org, but when I suscribed it said to use
>> biopython at lists.open-bio.org, so I'm wondering what the difference is?
>>
>> What is the simplest way to get a list of the side chain atoms given
>> say a residue number?
>>
>> Also, not entirely related to Biopython, but I'm wondering if there is
>> some way to get a sense of the overall shape of a protein? Like is it
>> globular, a big string, a sheet or what? I can see if you looked at
>> the bounding box, that might be a starting point, but does anyone have
>> any other ideas? I habe been looking at it as a geometry type problem
>> but haven't gotten too far yet.
>>
>> Thanks in advance,
>>
>> MarkL
>> _______________________________________________
>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biopython
>>
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython



From golubchi at stats.ox.ac.uk  Wed May 30 13:40:38 2012
From: golubchi at stats.ox.ac.uk (Tanya Golubchik)
Date: Wed, 30 May 2012 14:40:38 +0100
Subject: [Biopython] Bio.Phylo: midpoint root?
Message-ID: <4FC62356.2030709@stats.ox.ac.uk>

Hello,

Does anyone have a quickie method for calculating the midpoint root of a
given tree?

Thanks,
Tanya


From eric.talevich at gmail.com  Wed May 30 14:55:11 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Wed, 30 May 2012 10:55:11 -0400
Subject: [Biopython] Bio.Phylo: midpoint root?
In-Reply-To: <4FC62356.2030709@stats.ox.ac.uk>
References: <4FC62356.2030709@stats.ox.ac.uk>
Message-ID: <CAMC681nufLjfBa4xwdQjcTFrv-DT237dFpfNei6_6QLXFm4iEw@mail.gmail.com>

On Wed, May 30, 2012 at 9:40 AM, Tanya Golubchik <golubchi at stats.ox.ac.uk>wrote:

> Hello,
>
> Does anyone have a quickie method for calculating the midpoint root of a
> given tree?
>
>
It's been on my to-do list. (The first step was adding the keyword argument
'outgroup_branch_length' to root_with_outgroup.) The tree method 'depths'
should also be handy.

The algorithm I had in mind looks like:
1. Take the depths() of each clade under the root.
2. Identify the deepest tip under each clade.
3. Assuming the tree is bifurcating, take the shallower tip as the
"out_tip" and the deeper tip as the "in_tip".
4. If the difference between the depths of "out_tip" and "in_tip" are
greater than the length of the branch connecting the two clades below the
root (tree.clade[0].branch_length + tree.clade[1].branch_length), there's a
possibility that a better out_tip is hiding inside the deeper clade. So,
repeat the operation on tree.clade[1], recursively, until meeting the stop
condition I just described.
5. To identify the midpoint, halve the distance between in_tip and out_tip,
and trace backward from in_tip by that distance to reach the new root.

With multifurcations, the algorithm looks similar, but with more loops.

I too would be delighted to see a better algorithm for this.

-E


From anaryin at gmail.com  Wed May 30 15:13:41 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Wed, 30 May 2012 17:13:41 +0200
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <4FC6194D.1060802@usp.br>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
	<CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>
	<4FC6194D.1060802@usp.br>
Message-ID: <CAJ9sUYMvTaYp3=1OmrT81KrFs6sLmJF6qe6pEu7L53o2aOsatg@mail.gmail.com>

Dear Frederico and Mark,

I have a few scripts to do exactly what Frederico described, that play with
Biopython. I will share them tomorrow and put an example here of how they
work. Eventually it will become part of Biopython, in a future release I
hope..

Cheers,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



2012/5/30 Frederico Moras Ferreira <ferreirafm at usp.br>

> Hi Mark,
> I'm also very interested in overall protein shape analysis. I'm completely
> new to Biopython and can't help you much. Regarding to your question
> itself, that's something not trivial. One of the approaches would be to
> calculate the center of mass of your protein and iteratively calculate the
> momentum of inertia along three mutually perpendicular axes so as it is
> maximum in one direction and minimum in another. Sampling the momentum of
> inertia of the third axis and comparing with the other two will give a good
> estimation of your protein overall shape.
> Best of luck,
> Fred
>
> Em 30-05-2012 03:04, Jo?o Rodrigues escreveu:
>
>  Hi Mark,
>>
>> The gyration tensor should give you the means of calculating how oblate or
>> prolate your molecule is.
>>
>> Regarding the sidechain, i think you just have to manually do it, but
>> since
>> the backbone atoms are always the same it shouldn't be too hard.
>>
>> Cheers,
>>
>> Jo?o
>> No dia 30 de Mai de 2012 05:10, "Mark Livingstone"<
>> livingstonemark at gmail.com>  escreveu:
>>
>>  Hi Guys,
>>>
>>> I notice on the wiki that it says the mailing list is at
>>> biopython at biopython.org, but when I suscribed it said to use
>>> biopython at lists.open-bio.org, so I'm wondering what the difference is?
>>>
>>> What is the simplest way to get a list of the side chain atoms given
>>> say a residue number?
>>>
>>> Also, not entirely related to Biopython, but I'm wondering if there is
>>> some way to get a sense of the overall shape of a protein? Like is it
>>> globular, a big string, a sheet or what? I can see if you looked at
>>> the bounding box, that might be a starting point, but does anyone have
>>> any other ideas? I habe been looking at it as a geometry type problem
>>> but haven't gotten too far yet.
>>>
>>> Thanks in advance,
>>>
>>> MarkL
>>> ______________________________**_________________
>>> Biopython mailing list  -  Biopython at lists.open-bio.org
>>> http://lists.open-bio.org/**mailman/listinfo/biopython<http://lists.open-bio.org/mailman/listinfo/biopython>
>>>
>>>  ______________________________**_________________
>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> http://lists.open-bio.org/**mailman/listinfo/biopython<http://lists.open-bio.org/mailman/listinfo/biopython>
>>
>
> ______________________________**_________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/**mailman/listinfo/biopython<http://lists.open-bio.org/mailman/listinfo/biopython>
>



From ferreirafm at usp.br  Wed May 30 16:55:23 2012
From: ferreirafm at usp.br (Frederico Moras Ferreira)
Date: Wed, 30 May 2012 13:55:23 -0300
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CAJ9sUYMvTaYp3=1OmrT81KrFs6sLmJF6qe6pEu7L53o2aOsatg@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
	<CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>
	<4FC6194D.1060802@usp.br>
	<CAJ9sUYMvTaYp3=1OmrT81KrFs6sLmJF6qe6pEu7L53o2aOsatg@mail.gmail.com>
Message-ID: <4FC650FB.8090502@usp.br>

That's great! Look forward hearing from you.
Cheers,
Fred

Em 30-05-2012 12:13, Jo?o Rodrigues escreveu:
> Dear Frederico and Mark,
>
> I have a few scripts to do exactly what Frederico described, that play 
> with Biopython. I will share them tomorrow and put an example here of 
> how they work. Eventually it will become part of Biopython, in a 
> future release I hope..
>
> Cheers,
>
> Jo?o [...] Rodrigues
> http://nmr.chem.uu.nl/~joao <http://nmr.chem.uu.nl/%7Ejoao>
>
>
>
> 2012/5/30 Frederico Moras Ferreira <ferreirafm at usp.br 
> <mailto:ferreirafm at usp.br>>
>
>     Hi Mark,
>     I'm also very interested in overall protein shape analysis. I'm
>     completely new to Biopython and can't help you much. Regarding to
>     your question itself, that's something not trivial. One of the
>     approaches would be to calculate the center of mass of your
>     protein and iteratively calculate the momentum of inertia along
>     three mutually perpendicular axes so as it is maximum in one
>     direction and minimum in another. Sampling the momentum of inertia
>     of the third axis and comparing with the other two will give a
>     good estimation of your protein overall shape.
>     Best of luck,
>     Fred
>
>     Em 30-05-2012 03:04, Jo?o Rodrigues escreveu:
>
>         Hi Mark,
>
>         The gyration tensor should give you the means of calculating
>         how oblate or
>         prolate your molecule is.
>
>         Regarding the sidechain, i think you just have to manually do
>         it, but since
>         the backbone atoms are always the same it shouldn't be too hard.
>
>         Cheers,
>
>         Jo?o
>         No dia 30 de Mai de 2012 05:10, "Mark Livingstone"<
>         livingstonemark at gmail.com <mailto:livingstonemark at gmail.com>>
>          escreveu:
>
>             Hi Guys,
>
>             I notice on the wiki that it says the mailing list is at
>             biopython at biopython.org <mailto:biopython at biopython.org>,
>             but when I suscribed it said to use
>             biopython at lists.open-bio.org
>             <mailto:biopython at lists.open-bio.org>, so I'm wondering
>             what the difference is?
>
>             What is the simplest way to get a list of the side chain
>             atoms given
>             say a residue number?
>
>             Also, not entirely related to Biopython, but I'm wondering
>             if there is
>             some way to get a sense of the overall shape of a protein?
>             Like is it
>             globular, a big string, a sheet or what? I can see if you
>             looked at
>             the bounding box, that might be a starting point, but does
>             anyone have
>             any other ideas? I habe been looking at it as a geometry
>             type problem
>             but haven't gotten too far yet.
>
>             Thanks in advance,
>
>             MarkL
>             _______________________________________________
>             Biopython mailing list  - Biopython at lists.open-bio.org
>             <mailto:Biopython at lists.open-bio.org>
>             http://lists.open-bio.org/mailman/listinfo/biopython
>
>         _______________________________________________
>         Biopython mailing list  - Biopython at lists.open-bio.org
>         <mailto:Biopython at lists.open-bio.org>
>         http://lists.open-bio.org/mailman/listinfo/biopython
>
>
>     _______________________________________________
>     Biopython mailing list  - Biopython at lists.open-bio.org
>     <mailto:Biopython at lists.open-bio.org>
>     http://lists.open-bio.org/mailman/listinfo/biopython
>
>



From eric.talevich at gmail.com  Thu May 31 04:36:49 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Thu, 31 May 2012 00:36:49 -0400
Subject: [Biopython] Bio.Phylo: midpoint root?
In-Reply-To: <CAMC681nufLjfBa4xwdQjcTFrv-DT237dFpfNei6_6QLXFm4iEw@mail.gmail.com>
References: <4FC62356.2030709@stats.ox.ac.uk>
	<CAMC681nufLjfBa4xwdQjcTFrv-DT237dFpfNei6_6QLXFm4iEw@mail.gmail.com>
Message-ID: <CAMC681mD0PbX8KHmBo4mUSLkMPhgKi=sbVq5O9w_bMdaz750Ow@mail.gmail.com>

On Wed, May 30, 2012 at 10:55 AM, Eric Talevich <eric.talevich at gmail.com>wrote:

> On Wed, May 30, 2012 at 9:40 AM, Tanya Golubchik <golubchi at stats.ox.ac.uk>wrote:
>
>> Hello,
>>
>> Does anyone have a quickie method for calculating the midpoint root of a
>> given tree?
>>
>>
> It's been on my to-do list. (The first step was adding the keyword
> argument 'outgroup_branch_length' to root_with_outgroup.) The tree method
> 'depths' should also be handy.
>
> The algorithm I had in mind looks like:
>
<madness>

>
> I too would be delighted to see a better algorithm for this.
>
>
I implemented this in an intuitive but very inefficient way, calculating
the pairwise distances between all tips of the tree. You can try it from
git:
https://github.com/biopython/biopython/commit/94c128bd428cc5d53b50edd1d2e4730ee212f530

It would still be nice to see a better algorithm, if anyone has one on hand.

-E


From francesco.strozzi at gmail.com  Thu May 31 09:11:25 2012
From: francesco.strozzi at gmail.com (Francesco Strozzi)
Date: Thu, 31 May 2012 11:11:25 +0200
Subject: [Biopython] EU Codefest 2012 Announcement
Message-ID: <CACtet2RtKqXavJ4C7An==MJP0MTW-yeHYwi9xKqWh6RP02Qp6w@mail.gmail.com>

The Open Bioinformatics Foundation (OBF) EU-CodeFest will be held in
Parco Tecnologico Padano (PTP) Lodi, Italy on the19th ? 20th of July.
The CodeFest is a small focused event under the auspices of the Open
Bioinformatics Foundation, and is a sister event of BOSC2012 being
held in California USA this year.
Three main topics will be worked on during the CodeFest:

- NGS and high performance parsers for OpenBio projects.
- RDF and semantic web for bioinformatics.
- Bioinformatics pipelines definition, execution and distribution.

The number of places is limited to 30 participants at maximum, on a
first come, first serve basis. Undergraduate and PhD students are
welcome to participate.
The cost of the event is EUR 100 per person, which includes also
lunches, coffee breaks and the social dinner on the 19th of July.
Only for students, we can sponsor a limited number of attendees that
will not pay for the registration fee. Those students, willing to
participate for free to the event, will be asked to submit their
qualifications and experience in software development. The organizing
committee will review students? applications before final acceptance.
Talks and abstracts may be presented during the CodeFest in sessions
of 10 minutes plus questions. Coding activities will continue during
the talks.

The City of Lodi is very close to Milano and has good hotel
facilities. The connections by air are excellent, via Milano Malpensa,
Milano Linate and Bergamo Orio Al Serio airports.

Please register soon using the form at this page
http://tecnoparco.org/codefest, places may run out quickly.


-- 

Francesco



From anaryin at gmail.com  Thu May 31 10:54:55 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Thu, 31 May 2012 12:54:55 +0200
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <4FC650FB.8090502@usp.br>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
	<CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>
	<4FC6194D.1060802@usp.br>
	<CAJ9sUYMvTaYp3=1OmrT81KrFs6sLmJF6qe6pEu7L53o2aOsatg@mail.gmail.com>
	<4FC650FB.8090502@usp.br>
Message-ID: <CAJ9sUYOWD1MJNLHXZV2Kdzrn6PPghHHU=J5iohVxSjzjFLM9dw@mail.gmail.com>

I included the header already as a biopython module, since parts of this
script are my work at GSOC 2010, and others are Ezgi's independent work
that she agreed to contribute. Just a safety measure :)

The usage of the code is very simple. Parse a structure with biopython and
use the calculate_shape_param function of this geometry module to calculate
all values required to compute the shape of your molecule. It will not tell
you what shape it is, but it will give you all the ingredients (if the
anisotropy is 0, your molecule is spherical, for example).

Let me know of any comments, and Ezgi too, as she is the main contributor
to this.

*Again, this should not be included, for now, in the main distribution, nor
considered an "official" addition.
*

Download here: http://nmr.chem.uu.nl/~joao/f/geometry.py

Cheers,

Jo?o



From golubchi at stats.ox.ac.uk  Thu May 31 12:10:21 2012
From: golubchi at stats.ox.ac.uk (Tanya Golubchik)
Date: Thu, 31 May 2012 13:10:21 +0100
Subject: [Biopython] Bio.Phylo: midpoint root?
In-Reply-To: <CAMC681mD0PbX8KHmBo4mUSLkMPhgKi=sbVq5O9w_bMdaz750Ow@mail.gmail.com>
References: <4FC62356.2030709@stats.ox.ac.uk>
	<CAMC681nufLjfBa4xwdQjcTFrv-DT237dFpfNei6_6QLXFm4iEw@mail.gmail.com>
	<CAMC681mD0PbX8KHmBo4mUSLkMPhgKi=sbVq5O9w_bMdaz750Ow@mail.gmail.com>
Message-ID: <4FC75FAD.2050909@stats.ox.ac.uk>

Thanks, Eric - will have a go!

T

On 31/05/12 05:36, Eric Talevich wrote:
> On Wed, May 30, 2012 at 10:55 AM, Eric Talevich <eric.talevich at gmail.com
> <mailto:eric.talevich at gmail.com>> wrote:
> 
>     On Wed, May 30, 2012 at 9:40 AM, Tanya Golubchik
>     <golubchi at stats.ox.ac.uk <mailto:golubchi at stats.ox.ac.uk>> wrote:
> 
>         Hello,
> 
>         Does anyone have a quickie method for calculating the midpoint
>         root of a
>         given tree?
> 
> 
>     It's been on my to-do list. (The first step was adding the keyword
>     argument 'outgroup_branch_length' to root_with_outgroup.) The tree
>     method 'depths' should also be handy.
> 
>     The algorithm I had in mind looks like:
> 
> <madness>
> 
> 
>     I too would be delighted to see a better algorithm for this.
> 
> 
> I implemented this in an intuitive but very inefficient way, calculating
> the pairwise distances between all tips of the tree. You can try it from
> git:
> https://github.com/biopython/biopython/commit/94c128bd428cc5d53b50edd1d2e4730ee212f530
> 
> It would still be nice to see a better algorithm, if anyone has one on hand.
> 
> -E


From ferreirafm at usp.br  Thu May 31 13:06:54 2012
From: ferreirafm at usp.br (Frederico Moraes Ferreira)
Date: Thu, 31 May 2012 10:06:54 -0300
Subject: [Biopython] Getting side chain atoms?
In-Reply-To: <CAJ9sUYOWD1MJNLHXZV2Kdzrn6PPghHHU=J5iohVxSjzjFLM9dw@mail.gmail.com>
References: <CABGYGEzpR7rGCwDpGK-zn+7SdjU1YRDS83B1gjBLNaj_+rrueg@mail.gmail.com>
	<CAJ9sUYOt11mmzMPizUcM8pXA93_GEK3urcJP0Hqjd+VrumU1gA@mail.gmail.com>
	<4FC6194D.1060802@usp.br>
	<CAJ9sUYMvTaYp3=1OmrT81KrFs6sLmJF6qe6pEu7L53o2aOsatg@mail.gmail.com>
	<4FC650FB.8090502@usp.br>
	<CAJ9sUYOWD1MJNLHXZV2Kdzrn6PPghHHU=J5iohVxSjzjFLM9dw@mail.gmail.com>
Message-ID: <4FC76CEE.1070300@usp.br>

Hi Jo?o and Ezgi,
That's a very nice piece code. I'll do some tests and let you know the 
results.
All the Best,
Fred

Em 31-05-2012 07:54, Jo?o Rodrigues escreveu:
> I included the header already as a biopython module, since parts of 
> this script are my work at GSOC 2010, and others are Ezgi's 
> independent work that she agreed to contribute. Just a safety measure :)
>
> The usage of the code is very simple. Parse a structure with biopython 
> and use the calculate_shape_param function of this geometry module to 
> calculate all values required to compute the shape of your molecule. 
> It will not tell you what shape it is, but it will give you all the 
> ingredients (if the anisotropy is 0, your molecule is spherical, for 
> example).
>
> Let me know of any comments, and Ezgi too, as she is the main 
> contributor to this.
>
> *_Again, this should not be included, for now, in the main 
> distribution, nor considered an "official" addition.
> _*
>
> Download here: http://nmr.chem.uu.nl/~joao/f/geometry.py 
> <http://nmr.chem.uu.nl/%7Ejoao/f/geometry.py>
>
> Cheers,
>
> Jo?o



From b.invergo at gmail.com  Thu May 31 13:31:21 2012
From: b.invergo at gmail.com (Brandon Invergo)
Date: Thu, 31 May 2012 15:31:21 +0200
Subject: [Biopython] Bio.Phylo: midpoint root?
In-Reply-To: <CAMC681mD0PbX8KHmBo4mUSLkMPhgKi=sbVq5O9w_bMdaz750Ow@mail.gmail.com>
References: <4FC62356.2030709@stats.ox.ac.uk>
	<CAMC681nufLjfBa4xwdQjcTFrv-DT237dFpfNei6_6QLXFm4iEw@mail.gmail.com>
	<CAMC681mD0PbX8KHmBo4mUSLkMPhgKi=sbVq5O9w_bMdaz750Ow@mail.gmail.com>
Message-ID: <1338471081.627.7.camel@localhost.localdomain>

On Thu, 2012-05-31 at 00:36 -0400, Eric Talevich wrote:
> On Wed, May 30, 2012 at 10:55 AM, Eric Talevich <eric.talevich at gmail.com>wrote:
> I implemented this in an intuitive but very inefficient way, calculating
> the pairwise distances between all tips of the tree. You can try it from
> git:
> https://github.com/biopython/biopython/commit/94c128bd428cc5d53b50edd1d2e4730ee212f530
> 
> It would still be nice to see a better algorithm, if anyone has one on hand.
> 
> -E

I sped it up a little bit by getting rid of those nested for loops:
https://github.com/brandoninvergo/biopython/commit/102189cd49d448423ee160a0a0ad891b58f56c26

According to a naive benchmark of comparing execution times for the unit
test, this version is about 40% faster (0.901s vs 0.524s on my
computer). I'll do a pull request...

As for the problem of accumulating floating point rounding errors,
perhaps you can do the root operations on copies of the tree instead...

-brandon



From eric.talevich at gmail.com  Thu May 31 16:30:07 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Thu, 31 May 2012 12:30:07 -0400
Subject: [Biopython] Bio.Phylo: midpoint root?
In-Reply-To: <1338471081.627.7.camel@localhost.localdomain>
References: <4FC62356.2030709@stats.ox.ac.uk>
	<CAMC681nufLjfBa4xwdQjcTFrv-DT237dFpfNei6_6QLXFm4iEw@mail.gmail.com>
	<CAMC681mD0PbX8KHmBo4mUSLkMPhgKi=sbVq5O9w_bMdaz750Ow@mail.gmail.com>
	<1338471081.627.7.camel@localhost.localdomain>
Message-ID: <CAMC681kdW0qJ8gfWbJkd4MVND7WkS2wsmSEr732JeVNtZk5P+g@mail.gmail.com>

On Thu, May 31, 2012 at 9:31 AM, Brandon Invergo <b.invergo at gmail.com>wrote:

> On Thu, 2012-05-31 at 00:36 -0400, Eric Talevich wrote:
> > On Wed, May 30, 2012 at 10:55 AM, Eric Talevich <eric.talevich at gmail.com
> >wrote:
> > I implemented this in an intuitive but very inefficient way, calculating
> > the pairwise distances between all tips of the tree. You can try it from
> > git:
> >
> https://github.com/biopython/biopython/commit/94c128bd428cc5d53b50edd1d2e4730ee212f530
> >
> > It would still be nice to see a better algorithm, if anyone has one on
> hand.
> >
> > -E
>
> I sped it up a little bit by getting rid of those nested for loops:
>
> https://github.com/brandoninvergo/biopython/commit/102189cd49d448423ee160a0a0ad891b58f56c26
>
> According to a naive benchmark of comparing execution times for the unit
> test, this version is about 40% faster (0.901s vs 0.524s on my
> computer). I'll do a pull request...
>
> As for the problem of accumulating floating point rounding errors,
> perhaps you can do the root operations on copies of the tree instead...
>
> -brandon
>
>
Looks better, thanks! I merged it.

I'll look into the rounding issue some more. It might be enough to make a
single copy of the tree, do all the rerooting and distance calculation
there, and use the original copy to calculate the outgroup branch length
and do a single rerooting.

Alternatively, I could add a separate tree method that generates pairwise
distances without rerooting the tree -- either producing a big dictionary,
or an iterable of ((node1, node2), distance) which could be easily fed to a
dictionary if needed.


From vinkurella at yahoo.com  Thu May 31 17:28:13 2012
From: vinkurella at yahoo.com (vinodh kurella)
Date: Thu, 31 May 2012 10:28:13 -0700 (PDT)
Subject: [Biopython] Help needed to fix an error in biopython on mac osx
Message-ID: <1338485293.26613.YahooMailNeo@web161302.mail.bf1.yahoo.com>

Hi Biopython community,

I am trying to install?biopython?onto my?mac osx?(10.7.4) but after downloading the?biopython 1.59.tar.gz?from?http://biopython.org/wiki/Download?and installation get some error which is pasted below.

$cd biopython-1.59
$sudo python?setup.py?install

It works until it gets to this error and aborts. Could anyone please let me know what is wrong ?

Thanks and appreciate your help. Below is the report, have cut out (......) the middle and have ?shown the start and the end output only.

Vinodh

running install
running build
running build_py
creating build
creating build/lib.macosx-10.7-intel-2.7
creating build/lib.macosx-10.7-intel-2.7/Bio
copying Bio/__init__.py -> build/lib.macosx-10.7-intel-2.7/Bio
copying Bio/_py3k.py -> build/lib.macosx-10.7-intel-2.7/Bio
.
.
.
.
copying Bio/PopGen/SimCoal/data/ssm_2d.par -> build/lib.macosx-10.7-intel-2.7/Bio/PopGen/SimCoal/data
running build_ext
building 'Bio.cpairwise2' extension
creating build/temp.macosx-10.7-intel-2.7
creating build/temp.macosx-10.7-intel-2.7/Bio
llvm-gcc-4.2 -fno-strict-aliasing -fno-common -dynamic -g -Os -pipe -fno-common -fno-strict-aliasing -fwrapv -mno-fused-madd -DENABLE_DTRACE -DMACOSX -DNDEBUG -Wall -Wstrict-prototypes -Wshorten-64-to-32 -DNDEBUG -g -fwrapv -Os -Wall -Wstrict-prototypes -DENABLE_DTRACE -arch i386 -arch x86_64 -pipe -IBio -I/System/Library/Frameworks/Python.framework/Versions/2.7/include/python2.7 -c Bio/cpairwise2module.c -o build/temp.macosx-10.7-intel-2.7/Bio/cpairwise2module.o
unable to execute llvm-gcc-4.2: No such file or directory
error: command 'llvm-gcc-4.2' failed with exit status 1



From arklenna at gmail.com  Thu May 31 17:46:05 2012
From: arklenna at gmail.com (Lenna Peterson)
Date: Thu, 31 May 2012 13:46:05 -0400
Subject: [Biopython] Help needed to fix an error in biopython on mac osx
In-Reply-To: <1338485293.26613.YahooMailNeo@web161302.mail.bf1.yahoo.com>
References: <1338485293.26613.YahooMailNeo@web161302.mail.bf1.yahoo.com>
Message-ID: <CAK610_4wEiJkXw0Ak32P2uzUQ8n6VL+UO5M2vtChaHHfSOnNSA@mail.gmail.com>

Hi Vinodh,

Do you have XCode installed? It's required to build Biopython on a
Mac. llvm-gcc-4.2 is a C compiler used by Apple.

Lenna


From anaryin at gmail.com  Thu May 31 17:49:17 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Thu, 31 May 2012 19:49:17 +0200
Subject: [Biopython] Help needed to fix an error in biopython on mac osx
In-Reply-To: <CAK610_4wEiJkXw0Ak32P2uzUQ8n6VL+UO5M2vtChaHHfSOnNSA@mail.gmail.com>
References: <1338485293.26613.YahooMailNeo@web161302.mail.bf1.yahoo.com>
	<CAK610_4wEiJkXw0Ak32P2uzUQ8n6VL+UO5M2vtChaHHfSOnNSA@mail.gmail.com>
Message-ID: <CAJ9sUYMTxjX8cChtb0_cSd2zu3m4A6qXaPJwBCq0T7_PBW5krA@mail.gmail.com>

Is this on Lion?


From arklenna at gmail.com  Thu May 31 17:55:40 2012
From: arklenna at gmail.com (Lenna Peterson)
Date: Thu, 31 May 2012 13:55:40 -0400
Subject: [Biopython] replace header
In-Reply-To: <CAKVJ-_4hHe=THg0ZLokt2mja15-vd+DBsB+a-YFZGNgiO2zADg@mail.gmail.com>
References: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>
	<CAK610_4GGZKe0PW_zRkd5uqZCenowmT++_HGqGcyE5j=tpfgzg@mail.gmail.com>
	<A4360020-0E00-4F93-9DE0-B48E849C9416@gmail.com>
	<CAKVJ-_4hHe=THg0ZLokt2mja15-vd+DBsB+a-YFZGNgiO2zADg@mail.gmail.com>
Message-ID: <CAK610_4wMj5C20ACSW52=H-f59v+R67=Kv9ZqwvXGbjqAH7OUg@mail.gmail.com>

On Wed, May 30, 2012 at 4:56 AM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
>
> Hi Dilara & Lenna,
>
> I would use append mode with caution - it will have side effects
> like if you run this script twice, the output file will double in size
> (the first run plus the second run). Wouldn't opening in write
> mode work just as well here?
> i.e. Open the handle, do the loop, close the handle.
>


Hi Peter,

Thanks for the warning. Python, making me adjust my thought patterns
every day. I'm used to shell, > vs >> for cat etc. I had never tried
multiple writes to a single open file. But the behavior is logical.


>
> The key point about using SeqIO.write(...) once to do a whole
> file is this requires an iterator based approach. For example,
> using a generator expression and a function acting on a single
> record:
>
> def modify_record(record):
> ? ?#Do something sensible to the headers here:
> ? ?record.id = "modified"
> ? ?return record
> #This is a generator expression:
> modified = (modify_record(r) for r in SeqIO.parse("solid_1.fastq", "fastq"))
> count = SeqIO.write(modified, "newsolid_1.fastq", "fastq")
> print "Modified %i records" % count
>
> Equivalently using a generator function which does the
> looping itself:
>
> def modify_records(records):
> ? ?for record in records:
> ? ? ? ?#Do something sensible to the headers here:
> ? ? ? ?record.id = "modified"
> ? ? ? ?yield record
> count = SeqIO.write(modify_records(SeqIO.parse("solid_1.fastq",
> "fastq")), "newsolid_1.fastq", "fastq")
> print "Modified %i records" % count


The generator function is nice, too. I presume this only works because
SeqIO.write knows how to write from an iterator?

Lenna



From p.j.a.cock at googlemail.com  Thu May 31 18:06:44 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 31 May 2012 19:06:44 +0100
Subject: [Biopython] Help needed to fix an error in biopython on mac osx
In-Reply-To: <CAJ9sUYMTxjX8cChtb0_cSd2zu3m4A6qXaPJwBCq0T7_PBW5krA@mail.gmail.com>
References: <1338485293.26613.YahooMailNeo@web161302.mail.bf1.yahoo.com>
	<CAK610_4wEiJkXw0Ak32P2uzUQ8n6VL+UO5M2vtChaHHfSOnNSA@mail.gmail.com>
	<CAJ9sUYMTxjX8cChtb0_cSd2zu3m4A6qXaPJwBCq0T7_PBW5krA@mail.gmail.com>
Message-ID: <CAKVJ-_7m0e3HYnEmyfb_a_mLFWk344i8H3F1W51mbdX6oa4kPg@mail.gmail.com>

On Thu, May 31, 2012 at 6:49 PM, Jo?o Rodrigues <anaryin at gmail.com> wrote:
> Is this on Lion?

Yes, he said OS X 10.7 which is Lion.

You can download Xcode free from the Apple Mac App Store (it just
takes a while, several GB in size).

Peter



From p.j.a.cock at googlemail.com  Thu May 31 18:10:11 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 31 May 2012 19:10:11 +0100
Subject: [Biopython] replace header
In-Reply-To: <CAK610_4wMj5C20ACSW52=H-f59v+R67=Kv9ZqwvXGbjqAH7OUg@mail.gmail.com>
References: <CFB330D6-2032-4BE0-A83E-2CE02CFEF6CB@gmail.com>
	<CAK610_4GGZKe0PW_zRkd5uqZCenowmT++_HGqGcyE5j=tpfgzg@mail.gmail.com>
	<A4360020-0E00-4F93-9DE0-B48E849C9416@gmail.com>
	<CAKVJ-_4hHe=THg0ZLokt2mja15-vd+DBsB+a-YFZGNgiO2zADg@mail.gmail.com>
	<CAK610_4wMj5C20ACSW52=H-f59v+R67=Kv9ZqwvXGbjqAH7OUg@mail.gmail.com>
Message-ID: <CAKVJ-_5Z2uLb-NFJhikdMMw--qNd2Nsb2=mVhPPjAmPkfKovpA@mail.gmail.com>

On Thu, May 31, 2012 at 6:55 PM, Lenna Peterson <arklenna at gmail.com> wrote:
>> The key point about using SeqIO.write(...) once to do a whole
>> file is this requires an iterator based approach. For example,
>> using a generator expression and a function acting on a single
>> record:
>>
>> def modify_record(record):
>> ? ?#Do something sensible to the headers here:
>> ? ?record.id = "modified"
>> ? ?return record
>> #This is a generator expression:
>> modified = (modify_record(r) for r in SeqIO.parse("solid_1.fastq", "fastq"))
>> count = SeqIO.write(modified, "newsolid_1.fastq", "fastq")
>> print "Modified %i records" % count
>>
>> Equivalently using a generator function which does the
>> looping itself:
>>
>> def modify_records(records):
>> ? ?for record in records:
>> ? ? ? ?#Do something sensible to the headers here:
>> ? ? ? ?record.id = "modified"
>> ? ? ? ?yield record
>> count = SeqIO.write(modify_records(SeqIO.parse("solid_1.fastq",
>> "fastq")), "newsolid_1.fastq", "fastq")
>> print "Modified %i records" % count
>
>
> The generator function is nice, too. I presume this only works because
> SeqIO.write knows how to write from an iterator?
>
> Lenna

Bio.SeqIO.write is *designed* to take a Python iterator of SeqRecord
objects. That can be a generator function, generator expression, a
custom class which supports iteration, or even a simple list or tuple
of SeqRecord objects all in memory.

As a special case connivence it also accepts a single SeqRecord.

Peter



From ferreirafm at usp.br  Thu May 31 18:52:00 2012
From: ferreirafm at usp.br (Frederico Moraes Ferreira)
Date: Thu, 31 May 2012 15:52:00 -0300
Subject: [Biopython] geometry.py
Message-ID: <4FC7BDD0.2020905@usp.br>

Hi Jo?o,
The gyration radio (Rg) is running just fine. They are in excellent 
agreement with those from some models I have tested.
However, the maximum dimensions do not match at all. Did orientate the 
model before tensor analysis?
Fred