From p.j.a.cock at googlemail.com  Wed Feb  1 12:22:18 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 1 Feb 2012 17:22:18 +0000
Subject: [Biopython] regarding retrieving antigen information of
 specific gene using Biopython
In-Reply-To: <CAMGxMGtwDkZfHzVVn2_RPotJ8XTrwe5UEiTyypd3uQ16DxE88w@mail.gmail.com>
References: <CAMGxMGtwDkZfHzVVn2_RPotJ8XTrwe5UEiTyypd3uQ16DxE88w@mail.gmail.com>
Message-ID: <CAKVJ-_5cE-GBb4BFEY=dxkOS3eQ3+L_Omn4nT+CGrKtrNSAzYA@mail.gmail.com>

On Tue, Jan 31, 2012 at 7:00 AM, shweta dubey <sweta.dubey31 at gmail.com> wrote:
> hello everyone,
>
> I am new to Biopython.I have a set of genes and i want information of
> antigens specific to these genes from a database(suppose, Antigen
> Database).
>
> How can i do the same using Biopython??
>
> Thanks in advance
>
> Shweta Dubey

Hi,

Which antigen database are you trying to use? If it is one of the
NCBI ones you can probably use their Entrez API via Biopython.

Peter

From bpkth2012 at gmail.com  Thu Feb  2 10:45:17 2012
From: bpkth2012 at gmail.com (Sarttu Bourvir)
Date: Thu, 2 Feb 2012 16:45:17 +0100
Subject: [Biopython] parsing Blast results (xml)
Message-ID: <CACvaKy1oK8upTa096h3PHE1ovqZgAfFD_7YHRV2fVWj9NbaUjA@mail.gmail.com>

Hi,
I am new to biopython and having problems parsing a blast reulst file (xml
format).
I can get out alignments, alignment length, title etc.
But I would additionally need to print the query title , percent
similarity, e-value.

How does one do that?  Is there anywhere else than Biopython cookbook and
help(Bio.Blast.NCBIXML.Record) to
look for information. I feel like I don't really understand the
Blast.Record and where in there things can be found.
Is the sequence query title in the header?

Example code would be greatly appreciated!
Thank you,

From p.j.a.cock at googlemail.com  Thu Feb  2 11:09:54 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 2 Feb 2012 16:09:54 +0000
Subject: [Biopython] parsing Blast results (xml)
In-Reply-To: <CACvaKy1oK8upTa096h3PHE1ovqZgAfFD_7YHRV2fVWj9NbaUjA@mail.gmail.com>
References: <CACvaKy1oK8upTa096h3PHE1ovqZgAfFD_7YHRV2fVWj9NbaUjA@mail.gmail.com>
Message-ID: <CAKVJ-_5VmVHHD6yGJurUf9mHrF4Q_ADZC1SB9oGx0h2GE91pzQ@mail.gmail.com>

On Thu, Feb 2, 2012 at 3:45 PM, Sarttu Bourvir <bpkth2012 at gmail.com> wrote:
> Hi,
> I am new to biopython and having problems parsing a blast reulst file (xml
> format).
> I can get out alignments, alignment length, title etc.
> But I would additionally need to print the query title , percent
> similarity, e-value.

Well e-value is easy, and covered in the tutorial - e.g.

for alignment in blast_record.alignments:
    for hsp in alignment.hsps:
            print '****Alignment****'
            print 'sequence:', alignment.title
            print 'length:', alignment.length
            print 'e value:', hsp.expect
            print hsp.query[0:75] + '...'
            print hsp.match[0:75] + '...'
            print hsp.sbjct[0:75] + '...'

For percentage similarity I think you must use hsp.positives
and the alignment length. Likewise hsp.identities can be used
to get the percentage identity.

> How does one do that? ?Is there anywhere else than Biopython
> cookbook and help(Bio.Blast.NCBIXML.Record) to look for information.

I assume you also know about dir(...) as well? e.g. try dir(hsp)
after the above example or dir(alignment) to see what attributes
these objects have.

> I feel like I don't really understand the
> Blast.Record and where in there things can be found.
> Is the sequence query title in the header?

Yes, the query details should be captured. Try dir(blast_record)
where blast_record is a Bio.Blast.Record from the parser.

Peter


From drobukow at UTMB.EDU  Tue Feb  7 09:41:50 2012
From: drobukow at UTMB.EDU (Obukowicz, Dennis R.)
Date: Tue, 7 Feb 2012 14:41:50 +0000
Subject: [Biopython] Problems Installing: Can't find modules Seq and
 Alphabet plus many others
Message-ID: <43C6C371D341DE44A81477FD432BA65854CB0B1F@GRMBX4.utmb.edu>

I am new to Biopython and have tried installing Biopython according to instructions. When I run the test after installing I get  many errors, 96 errors (see below some examples) in all out of 154 test runs. Two errors that keep popping up are  not being able to find module Seq and module Alphabet.

ImportError: No module named Seq

ImportError: No module named Alphabet

NameError: name 'Seq' is not defined

NameError: name 'record' is not defined

NameError: name 'protein_rec' is not defined

NameError: name 'protein_rec' is not defined


Dennis



From drobukow at UTMB.EDU  Tue Feb  7 11:01:21 2012
From: drobukow at UTMB.EDU (Obukowicz, Dennis R.)
Date: Tue, 7 Feb 2012 16:01:21 +0000
Subject: [Biopython] Problems Installing: Can't find modules Seq and
 Alphabet plus many others
In-Reply-To: <43C6C371D341DE44A81477FD432BA65854CB0B1F@GRMBX4.utmb.edu>
References: <43C6C371D341DE44A81477FD432BA65854CB0B1F@GRMBX4.utmb.edu>
Message-ID: <43C6C371D341DE44A81477FD432BA65854CB0B94@GRMBX4.utmb.edu>

I solved some of my earlier problems with adjusting the path with the sys.path.append, adding directories where packages are located. However, now I keep getting this error below. I've searched for this error but can't find any mention of it. Can anyone help?

ERROR: Bio.Wise
----------------------------------------------------------------------
Traceback (most recent call last):
  File "run_tests.py", line 327, in runTest
    module = __import__(name, None, None, name.split("."))
  File "/usr/local/biopython/biopython-1.58/build/lib.linux-x86_64-2.7/Bio/Wise/__init__.py", line 20, in <module>
    from Bio import SeqIO
  File "/usr/local/biopython/biopython-1.58/build/lib.linux-x86_64-2.7/Bio/SeqIO/__init__.py", line 308, in <module>
    import Seq
  File "/usr/local/biopython/biopython-1.58/Bio/Seq.py", line 31, in <module>
    import ambiguous_dna_complement, ambiguous_rna_complement
ImportError: No module named ambiguous_dna_complement

From: Obukowicz, Dennis R.
Sent: Tuesday, February 07, 2012 8:42 AM
To: 'biopython at lists.open-bio.org'
Subject: Problems Installing: Can't find modules Seq and Alphabet plus many others

I am new to Biopython and have tried installing Biopython according to instructions. When I run the test after installing I get  many errors, 96 errors (see below some examples) in all out of 154 test runs. Two errors that keep popping up are  not being able to find module Seq and module Alphabet.

ImportError: No module named Seq

ImportError: No module named Alphabet

NameError: name 'Seq' is not defined

NameError: name 'record' is not defined

NameError: name 'protein_rec' is not defined

NameError: name 'protein_rec' is not defined


Dennis



From devaniranjan at gmail.com  Tue Feb  7 20:01:31 2012
From: devaniranjan at gmail.com (George Devaniranjan)
Date: Tue, 7 Feb 2012 20:01:31 -0500
Subject: [Biopython] comparing sequences.qustion
Message-ID: <CAFU65Pc-CvB=68Dbznrgbs2OxZgcyz8GhSpwPrdrCZPJCeB5Mw@mail.gmail.com>

Hi,

I have a list of > 200, 000   UNIQUE short EQUAL length sequences.
I do the following

I am comparing ALL sequences against ALL sequences so there will be (200000
* 199999 )/2 comparisons
Once a sequence is compared, if they differ from one another by ONE letter
only . then I do another more detailed alignment using a BLOSUM matrix.

Currently I use the pairwise sequence comparison code found in BIOPYTHON
for both comparison, simple comparison where I set
match = 0
mismatch = -1
If the total alignment score is equal to -1 (meaning only one mismatch)
then I go a further step and do a BLOSUM alignment.

This works but its taking a long long time, I suspect its because I am
using TWO alignments but I think there could be a way to do the first
simple alignment WITHOUT using the pairwise alignment code for the first
part will speed up this calculation.
Unfortunately I don't have much more than a desktop to do this, so if
someone can suggest a quicker way to do this, I would appreciate it.

Thank you,
George

From eric.talevich at gmail.com  Tue Feb  7 20:50:28 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Tue, 7 Feb 2012 20:50:28 -0500
Subject: [Biopython] comparing sequences.qustion
In-Reply-To: <CAFU65Pc-CvB=68Dbznrgbs2OxZgcyz8GhSpwPrdrCZPJCeB5Mw@mail.gmail.com>
References: <CAFU65Pc-CvB=68Dbznrgbs2OxZgcyz8GhSpwPrdrCZPJCeB5Mw@mail.gmail.com>
Message-ID: <CAMC681=_4tnmyvEWopC=_W+MyLR5TiRRvZNE5_uaFqPPJ7k2XQ@mail.gmail.com>

On Tue, Feb 7, 2012 at 8:01 PM, George Devaniranjan
<devaniranjan at gmail.com>wrote:

> Hi,
>
> I have a list of > 200, 000   UNIQUE short EQUAL length sequences.
> I do the following
>
> I am comparing ALL sequences against ALL sequences so there will be (200000
> * 199999 )/2 comparisons
> Once a sequence is compared, if they differ from one another by ONE letter
> only . then I do another more detailed alignment using a BLOSUM matrix.
>
> Currently I use the pairwise sequence comparison code found in BIOPYTHON
> for both comparison, simple comparison where I set
> match = 0
> mismatch = -1
> If the total alignment score is equal to -1 (meaning only one mismatch)
> then I go a further step and do a BLOSUM alignment.
>
> This works but its taking a long long time, I suspect its because I am
> using TWO alignments but I think there could be a way to do the first
> simple alignment WITHOUT using the pairwise alignment code for the first
> part will speed up this calculation.
> Unfortunately I don't have much more than a desktop to do this, so if
> someone can suggest a quicker way to do this, I would appreciate it.
>
> Thank you,
> George
>
>
Hi George,

If your sequences are all equal length, and you're interested in the ones
that differ by 1 character, then the difference between any two of those
sequences of interest will be a single mismatched character. You don't need
to do an alignment at all.

Without Python: try clustering at whatever identify threshold corresponds
to edit distance 1 in your sequences. UCLUST/USEARCH and other programs can
do this quickly.

With Python: try an expression like:

seq_pairs_of_interest = []
for i, aseq in input_seq_list[:-1]:
    for j, bseq in input_seq_list[i+1:]:
        if sum(a != b for a, b in zip(aseq, bseq)) == 1:
            seq_pairs_of_interest.append((aseq, bseq))


Hope that helps,
Eric

From nje5 at georgetown.edu  Wed Feb  8 10:50:15 2012
From: nje5 at georgetown.edu (Nathan Edwards)
Date: Wed, 08 Feb 2012 10:50:15 -0500
Subject: [Biopython] comparing sequences.qustion
In-Reply-To: <CAMC681=_4tnmyvEWopC=_W+MyLR5TiRRvZNE5_uaFqPPJ7k2XQ@mail.gmail.com>
References: <CAFU65Pc-CvB=68Dbznrgbs2OxZgcyz8GhSpwPrdrCZPJCeB5Mw@mail.gmail.com>
	<CAMC681=_4tnmyvEWopC=_W+MyLR5TiRRvZNE5_uaFqPPJ7k2XQ@mail.gmail.com>
Message-ID: <4F3299B7.4090305@georgetown.edu>


Classical method (essentially BYP, obligatory reference to Goldberg):

* for each sequence, divide in two, get s1 and s2.
* place the sequences (or an reference/index) in a dictionary with list 
values at key s1 and s2.

This is linear time.

Any pair of sequences that differ in only one position _must_ have at 
least one of their halves in common, so do detailed alignment on all 
pairs of sequences with a common key. You specified unique, so each pair 
must be considered at most once. If you had duplicates, these would be 
aligned for each of their halves (and you'd have to normalize these out, 
somehow). This will be a small fraction of all pairs, assuming these are 
not pathological sequences.

This works well as long as the halves have enough specificity - for DNA 
length 10 halves should work. Note that this doesn't distinguish between 
left-halves and right-halves, which might have the same key values, but 
obviously won't differ by one. Fixing this is an easy modification. BTW, 
this works even for edit-distance. Only concern is the use of the 
in-memory dictionary data-structure, which can get big.

Untested pseudocode:

from collections import defaultdict
from itertools import combinations

n = 20
halves = defaultdict(list)
for s in sequences:
     s1 = s[:n/2]
     s2 = s[n/2:]
     halves[s1].append(s)
     halves[s2].append(s)

for k in halves.iterkeys():
     for seq1,seq2 in combinations(halves[k],2):
	# check for one-change before expensive alignment?
	align(seq1,seq2)

- n

On 2/7/2012 8:50 PM, Eric Talevich wrote:
> On Tue, Feb 7, 2012 at 8:01 PM, George Devaniranjan
> <devaniranjan at gmail.com>wrote:
>
>> Hi,
>>
>> I have a list of>  200, 000   UNIQUE short EQUAL length sequences.
>> I do the following
>>
>> I am comparing ALL sequences against ALL sequences so there will be (200000
>> * 199999 )/2 comparisons
>> Once a sequence is compared, if they differ from one another by ONE letter
>> only . then I do another more detailed alignment using a BLOSUM matrix.
>>
>> Currently I use the pairwise sequence comparison code found in BIOPYTHON
>> for both comparison, simple comparison where I set
>> match = 0
>> mismatch = -1
>> If the total alignment score is equal to -1 (meaning only one mismatch)
>> then I go a further step and do a BLOSUM alignment.
>>
>> This works but its taking a long long time, I suspect its because I am
>> using TWO alignments but I think there could be a way to do the first
>> simple alignment WITHOUT using the pairwise alignment code for the first
>> part will speed up this calculation.
>> Unfortunately I don't have much more than a desktop to do this, so if
>> someone can suggest a quicker way to do this, I would appreciate it.
>>
>> Thank you,
>> George
>>
>>
> Hi George,
>
> If your sequences are all equal length, and you're interested in the ones
> that differ by 1 character, then the difference between any two of those
> sequences of interest will be a single mismatched character. You don't need
> to do an alignment at all.
>
> Without Python: try clustering at whatever identify threshold corresponds
> to edit distance 1 in your sequences. UCLUST/USEARCH and other programs can
> do this quickly.
>
> With Python: try an expression like:
>
> seq_pairs_of_interest = []
> for i, aseq in input_seq_list[:-1]:
>      for j, bseq in input_seq_list[i+1:]:
>          if sum(a != b for a, b in zip(aseq, bseq)) == 1:
>              seq_pairs_of_interest.append((aseq, bseq))
>
>
> Hope that helps,
> Eric
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython


-- 
Dr. Nathan Edwards                      nje5 at georgetown.edu
Department of Biochemistry and Molecular & Cellular Biology
            Georgetown University Medical Center
Room 1215, Harris Building          Room 347, Basic Science
3300 Whitehaven St, NW              3900 Reservoir Road, NW
Washington DC 20007                     Washington DC 20007
Phone: 202-687-7042                     Phone: 202-687-1618
Fax: 202-687-0057                         Fax: 202-687-7186

From nje5 at georgetown.edu  Wed Feb  8 11:08:30 2012
From: nje5 at georgetown.edu (Nathan Edwards)
Date: Wed, 08 Feb 2012 11:08:30 -0500
Subject: [Biopython] comparing sequences.qustion
In-Reply-To: <4F3299B7.4090305@georgetown.edu>
References: <CAFU65Pc-CvB=68Dbznrgbs2OxZgcyz8GhSpwPrdrCZPJCeB5Mw@mail.gmail.com>
	<CAMC681=_4tnmyvEWopC=_W+MyLR5TiRRvZNE5_uaFqPPJ7k2XQ@mail.gmail.com>
	<4F3299B7.4090305@georgetown.edu>
Message-ID: <4F329DFE.6010607@georgetown.edu>


Argh, Gusfield "Algorithms on Strings, Trees, and Sequences" is the 
obligatory string matching reference...

- n

On 2/8/2012 10:50 AM, Nathan Edwards wrote:
>
> Classical method (essentially BYP, obligatory reference to Goldberg):
>
> * for each sequence, divide in two, get s1 and s2.
> * place the sequences (or an reference/index) in a dictionary with list
> values at key s1 and s2.
>
> This is linear time.
>
> Any pair of sequences that differ in only one position _must_ have at
> least one of their halves in common, so do detailed alignment on all
> pairs of sequences with a common key. You specified unique, so each pair
> must be considered at most once. If you had duplicates, these would be
> aligned for each of their halves (and you'd have to normalize these out,
> somehow). This will be a small fraction of all pairs, assuming these are
> not pathological sequences.
>
> This works well as long as the halves have enough specificity - for DNA
> length 10 halves should work. Note that this doesn't distinguish between
> left-halves and right-halves, which might have the same key values, but
> obviously won't differ by one. Fixing this is an easy modification. BTW,
> this works even for edit-distance. Only concern is the use of the
> in-memory dictionary data-structure, which can get big.
>
> Untested pseudocode:
>
> from collections import defaultdict
> from itertools import combinations
>
> n = 20
> halves = defaultdict(list)
> for s in sequences:
> s1 = s[:n/2]
> s2 = s[n/2:]
> halves[s1].append(s)
> halves[s2].append(s)
>
> for k in halves.iterkeys():
> for seq1,seq2 in combinations(halves[k],2):
> # check for one-change before expensive alignment?
> align(seq1,seq2)
>
> - n
>
> On 2/7/2012 8:50 PM, Eric Talevich wrote:
>> On Tue, Feb 7, 2012 at 8:01 PM, George Devaniranjan
>> <devaniranjan at gmail.com>wrote:
>>
>>> Hi,
>>>
>>> I have a list of> 200, 000 UNIQUE short EQUAL length sequences.
>>> I do the following
>>>
>>> I am comparing ALL sequences against ALL sequences so there will be
>>> (200000
>>> * 199999 )/2 comparisons
>>> Once a sequence is compared, if they differ from one another by ONE
>>> letter
>>> only . then I do another more detailed alignment using a BLOSUM matrix.
>>>
>>> Currently I use the pairwise sequence comparison code found in BIOPYTHON
>>> for both comparison, simple comparison where I set
>>> match = 0
>>> mismatch = -1
>>> If the total alignment score is equal to -1 (meaning only one mismatch)
>>> then I go a further step and do a BLOSUM alignment.
>>>
>>> This works but its taking a long long time, I suspect its because I am
>>> using TWO alignments but I think there could be a way to do the first
>>> simple alignment WITHOUT using the pairwise alignment code for the first
>>> part will speed up this calculation.
>>> Unfortunately I don't have much more than a desktop to do this, so if
>>> someone can suggest a quicker way to do this, I would appreciate it.
>>>
>>> Thank you,
>>> George
>>>
>>>
>> Hi George,
>>
>> If your sequences are all equal length, and you're interested in the ones
>> that differ by 1 character, then the difference between any two of those
>> sequences of interest will be a single mismatched character. You don't
>> need
>> to do an alignment at all.
>>
>> Without Python: try clustering at whatever identify threshold corresponds
>> to edit distance 1 in your sequences. UCLUST/USEARCH and other
>> programs can
>> do this quickly.
>>
>> With Python: try an expression like:
>>
>> seq_pairs_of_interest = []
>> for i, aseq in input_seq_list[:-1]:
>> for j, bseq in input_seq_list[i+1:]:
>> if sum(a != b for a, b in zip(aseq, bseq)) == 1:
>> seq_pairs_of_interest.append((aseq, bseq))
>>
>>
>> Hope that helps,
>> Eric
>> _______________________________________________
>> Biopython mailing list - Biopython at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biopython
>
>


-- 
Dr. Nathan Edwards                      nje5 at georgetown.edu
Department of Biochemistry and Molecular & Cellular Biology
            Georgetown University Medical Center
Room 1215, Harris Building          Room 347, Basic Science
3300 Whitehaven St, NW              3900 Reservoir Road, NW
Washington DC 20007                     Washington DC 20007
Phone: 202-687-7042                     Phone: 202-687-1618
Fax: 202-687-0057                         Fax: 202-687-7186

From d.m.a.martin at dundee.ac.uk  Thu Feb  9 09:36:42 2012
From: d.m.a.martin at dundee.ac.uk (David Martin)
Date: Thu, 9 Feb 2012 14:36:42 +0000
Subject: [Biopython] Proteomics tools in BioPython
Message-ID: <959CFF5060375249824CC633DDDF896F086CB9AD@AMSPRD0402MB109.eurprd04.prod.outlook.com>

We are planning to develop some proteomics tools in python and have a view to submit them as part of Biopython.
Primarily we will be writing wrappers/parsers for the OpenMS tools/output formats and analytic tools on top of that. If anyone else is working on python wrappers for openms then I'd be happy to share expertise.

..d

Dr David Martin
College of Life Sciences
University of Dundee


The University of Dundee is a registered Scottish Charity, No: SC015096



From p.j.a.cock at googlemail.com  Thu Feb  9 13:10:39 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 9 Feb 2012 18:10:39 +0000
Subject: [Biopython] Proteomics tools in BioPython
In-Reply-To: <959CFF5060375249824CC633DDDF896F086CB9AD@AMSPRD0402MB109.eurprd04.prod.outlook.com>
References: <959CFF5060375249824CC633DDDF896F086CB9AD@AMSPRD0402MB109.eurprd04.prod.outlook.com>
Message-ID: <CAKVJ-_6NTZLe4jp+Ww-GUa3kDNwG4t7sbuV2dqwpvV7GnXLS4w@mail.gmail.com>

On Thu, Feb 9, 2012 at 2:36 PM, David Martin <d.m.a.martin at dundee.ac.uk> wrote:
> We are planning to develop some proteomics tools in python and
> have a view to submit them as part of Biopython.
> Primarily we will be writing wrappers/parsers for the OpenMS
> tools/output formats and analytic tools on top of that. If anyone
> else is working on python wrappers for openms then I'd be happy
> to share expertise.
>
> ..d

Thanks David - that was quick, you must have sent this almost
straight after our chat this afternoon at the Dundee NextGenBUG
meeting :)

Peter

From eric.talevich at gmail.com  Thu Feb  9 15:41:02 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Thu, 9 Feb 2012 15:41:02 -0500
Subject: [Biopython] Proteomics tools in BioPython
In-Reply-To: <959CFF5060375249824CC633DDDF896F086CB9AD@AMSPRD0402MB109.eurprd04.prod.outlook.com>
References: <959CFF5060375249824CC633DDDF896F086CB9AD@AMSPRD0402MB109.eurprd04.prod.outlook.com>
Message-ID: <CAMC681mKVgAe0V0xjUZ8C524w3dSeCte91NEQCa5NVkkOnBYAA@mail.gmail.com>

On Thu, Feb 9, 2012 at 9:36 AM, David Martin <d.m.a.martin at dundee.ac.uk>wrote:

> We are planning to develop some proteomics tools in python and have a view
> to submit them as part of Biopython.
> Primarily we will be writing wrappers/parsers for the OpenMS tools/output
> formats and analytic tools on top of that. If anyone else is working on
> python wrappers for openms then I'd be happy to share expertise.
>
> ..d
>
>
Sounds great to me! Since Google Summer of Code is coming up soon, do you
see an opportunity to take on a student to help out with this work or build
something on top of it?

-Eric

From d.m.a.martin at dundee.ac.uk  Fri Feb 10 12:03:04 2012
From: d.m.a.martin at dundee.ac.uk (David Martin)
Date: Fri, 10 Feb 2012 17:03:04 +0000
Subject: [Biopython] Proteomics tools in biopython
Message-ID: <959CFF5060375249824CC633DDDF896F08709A95@AMSPRD0402MB113.eurprd04.prod.outlook.com>

There may be potential but I don't have the time to get organized for this year. We shall see how things progress.

..d

On Thu, Feb 9, 2012 at 9:36 AM, David Martin <d.m.a.martin at dundee.ac.uk>wrote:

> We are planning to develop some proteomics tools in python and have a
> view to submit them as part of Biopython.
> Primarily we will be writing wrappers/parsers for the OpenMS
> tools/output formats and analytic tools on top of that. If anyone else
> is working on python wrappers for openms then I'd be happy to share expertise.
>
> ..d
>
>
Sounds great to me! Since Google Summer of Code is coming up soon, do you see an opportunity to take on a student to help out with this work or build something on top of it?

-Eric


------------------------------

_______________________________________________
Biopython mailing list  -  Biopython at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/biopython


End of Biopython Digest, Vol 110, Issue 5
*****************************************


The University of Dundee is a registered Scottish Charity, No: SC015096



From rbuels at gmail.com  Fri Feb 10 12:51:12 2012
From: rbuels at gmail.com (Robert Buels)
Date: Fri, 10 Feb 2012 12:51:12 -0500
Subject: [Biopython] Google Summer of Code project ideas
Message-ID: <4F355910.4060203@gmail.com>

Hi all,

I'm going to be OBF project admin again this year for Google Summer of 
code.  OBF's application is due in a couple of weeks, and we need to 
update our project ideas on the OBF wiki page and on each project's 
individual wiki pages.

So, for each of the OBF projects that wants to do GSoC again this year, 
please:

a.) Update the list of project ideas on your project's GSoC page 
(BioPython, BioPerl, BioRuby, etc).  Add new ones, remove ones that have 
already been done or no longer relevant, etc.

b.) Update the list of project ideas on the main OBF GSoC page 
(http://www.open-bio.org/wiki/Google_Summer_of_Code) to match.

c.) Let me know via email that you have done so and it's ready for 
Google to peruse.

Please have the updates done, if possible, by this Friday (March 11). 
The number and quality of the project ideas are part of the evaluation 
process for whether OBF is accepted as a Summer of Code organization 
again this year, so let's come up with some good ones.  :-)

Rob

----
Robert Buels
(prospective) 2012 OBF GSoC Organization Admin

From mjldehoon at yahoo.com  Sat Feb 11 22:35:44 2012
From: mjldehoon at yahoo.com (Michiel de Hoon)
Date: Sat, 11 Feb 2012 19:35:44 -0800 (PST)
Subject: [Biopython] Digital gene expression
Message-ID: <1329017744.74960.YahooMailClassic@web161203.mail.bf1.yahoo.com>

Hi everybody,

EdgeR and DESeq are popular R packages to analyze differential expression in digital gene expression methodologies such as RNAseq and CAGE. Is something similar to these R packages available in Python (or is anybody working on such a module for Biopython)? Not that I don't like EdgeR / DESeq, but I'd prefer something in Python so that I can understand what I am doing.

Thanks,
-Michiel.

From p.j.a.cock at googlemail.com  Sun Feb 12 07:27:12 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Sun, 12 Feb 2012 12:27:12 +0000
Subject: [Biopython] Digital gene expression
In-Reply-To: <1329017744.74960.YahooMailClassic@web161203.mail.bf1.yahoo.com>
References: <1329017744.74960.YahooMailClassic@web161203.mail.bf1.yahoo.com>
Message-ID: <CAKVJ-_6SFFeMQCMhUhLLE=yu7=YxpY4AGC6=aUdGc+RrkGjoNw@mail.gmail.com>

On Sunday, February 12, 2012, Michiel de Hoon <mjldehoon at yahoo.com> wrote:
> Hi everybody,
>
> EdgeR and DESeq are popular R packages to analyze differential
> expression in digital gene expression methodologies such as
> RNAseq and CAGE. Is something similar to these R packages
> available in Python (or is anybody working on such a module
> for Biopython)? Not that I don't like EdgeR / DESeq, but I'd
> prefer something in Python so that I can understand what I
> am doing.
>
> Thanks,
> -Michiel.

I'm not sure, but try rpy or rpy2 for calling these R libraries from
Python. If you know both languages it is very powerful.

Peter

From tiagoantao at gmail.com  Sun Feb 12 07:39:20 2012
From: tiagoantao at gmail.com (=?ISO-8859-1?Q?Tiago_Ant=E3o?=)
Date: Sun, 12 Feb 2012 12:39:20 +0000
Subject: [Biopython] Digital gene expression
In-Reply-To: <CAKVJ-_6SFFeMQCMhUhLLE=yu7=YxpY4AGC6=aUdGc+RrkGjoNw@mail.gmail.com>
References: <1329017744.74960.YahooMailClassic@web161203.mail.bf1.yahoo.com>
	<CAKVJ-_6SFFeMQCMhUhLLE=yu7=YxpY4AGC6=aUdGc+RrkGjoNw@mail.gmail.com>
Message-ID: <CAA9RGENXAg=GQ4po1XkE=M1odYnbw6P18-PS6_8Kepc_4f8K7A@mail.gmail.com>

Hi,

On Sun, Feb 12, 2012 at 12:27 PM, Peter Cock
> I'm not sure, but try rpy or rpy2 for calling these R

rpy2 is an extremely declarative library. One almost forgets it is
writing R inside Python. It seems to be brilliantly well done. I have
only used it a couple of times myself, but I can only offer praise for
it.

From dan.bolser at gmail.com  Mon Feb 13 20:32:39 2012
From: dan.bolser at gmail.com (Dan Bolser)
Date: Tue, 14 Feb 2012 01:32:39 +0000
Subject: [Biopython] Fwd: Interested in Variation?
In-Reply-To: <CAPBO=2=uR-aTe=qsjTnRwmvgMFzXzDuuJgfhfW87iAT4qoAyEg@mail.gmail.com>
References: <CAPBO=2=FfmY70b0_u6cVk9Bv5RH7Lt5Lg7huE1-1s_Keu_bNRQ@mail.gmail.com>
	<CAPBO=2m9=h6PJvmikVsZ785BChhgfTuQ6Kb1psvTeaHpD8PNJw@mail.gmail.com>
	<CAPBO=2=uR-aTe=qsjTnRwmvgMFzXzDuuJgfhfW87iAT4qoAyEg@mail.gmail.com>
Message-ID: <CAPBO=2mWurq5POijp+f+couMBGFkhFGuVXYhd4CXbT7YSyapiQ@mail.gmail.com>

Job at the EBI:

"... the primary responsibility of the post-holder will be the
development of pipelines and storage solutions for variation data
deriving from whole genome re-sequencing."

http://goo.gl/eQrRu or

http://ig14.i-grasp.com/fe/tpl_embl01.asp?s=LktVsYDaNlCOtQqCli&jobid=47627,4187528723&key=45520467&c=126152212583&pagestamp=dbnjwyufpgvrmyvkmt


Cheers,
Dan.

From chris.mit7 at gmail.com  Tue Feb 14 15:30:41 2012
From: chris.mit7 at gmail.com (Chris Mitchell)
Date: Tue, 14 Feb 2012 15:30:41 -0500
Subject: [Biopython] Proteomics tools in BioPython
Message-ID: <CAK_U6ODyxTb-AW3yv4iMDTuG3A1o+ejseSnix9BafgeRZfUXrQ@mail.gmail.com>

Hey David,

What sort of tools do you have in mind for proteomics?  I have quite a few
stashed away (3/6 frame translations, GFF files->proteins, X!Tandem
parsers/FDR calculators, GFF parsers, etc.)

Chris

From d.m.a.martin at dundee.ac.uk  Wed Feb 15 12:22:48 2012
From: d.m.a.martin at dundee.ac.uk (David Martin)
Date: Wed, 15 Feb 2012 17:22:48 +0000
Subject: [Biopython] Proteomics tools for biopython
Message-ID: <959CFF5060375249824CC633DDDF896F08710546@AMSPRD0402MB113.eurprd04.prod.outlook.com>



> Hey David,
>
> What sort of tools do you have in mind for proteomics?  I have quite a few stashed away (3/6 frame translations, GFF files->proteins, X!Tandem parsers/FDR calculators, GFF parsers, etc.)
>
> Chris

At present we are wrapping the OpenMS outputs (featureML etc) so that we can interrogate the detail of how the runs behave. It is insightful to see (for example) how many of the ms/ms are on overlapping peptides, and the distribution of ms/ms selections per feature (vs intensity). This is just the first stage. Having these data (which up till now have been difficult to access) allows for building of smarter tools (custom delta mass thresholds for each ms/ms, second peptide searching, seeing whether all the peptide ID for a feature agree, correlating ID from different search engines to the same spectra).

There are outstanding questions from our users for things like 'is it really necessary to do duplicate runs?' or in other words, can we get the machine to treat duplicate runs differently to optimise ID. (under the principle that madness is doing the same thing repeatedly but expecting different results.)

Parsers for XTandem! would be really useful as that is something we'd like to have in our tool chain. A Mascot one would be good - I am looking into that (it is on my list of things to do, just not near the top right now.)  I very much favour a modular approach where each class/object does one thing really well and can feed output to another class, and all can be represented using open formats. It might be a good idea to arrange a telecon or Skype group chat for people who are interested in contributing to this and building a comprehensive set of tools into Biopython. I can't promise too much from our end but we are making good progress and we have a strong commitment to open software and algorithms, with a heavy python development presence.

..d


The University of Dundee is a registered Scottish Charity, No: SC015096



From Achim.Treumann at NEPAF.com  Wed Feb 15 13:49:30 2012
From: Achim.Treumann at NEPAF.com (Achim Treumann)
Date: Wed, 15 Feb 2012 18:49:30 -0000
Subject: [Biopython] Proteomics tools for biopython
In-Reply-To: <959CFF5060375249824CC633DDDF896F08710546@AMSPRD0402MB113.eurprd04.prod.outlook.com>
References: <959CFF5060375249824CC633DDDF896F08710546@AMSPRD0402MB113.eurprd04.prod.outlook.com>
Message-ID: <01798D2396253A449511F31F1CDE835519D5ED@srv1.NEPAF.local>

Hi, 

I could possibly contribute a few snippets regarding an X!Tandem parser
and a few other little tools - at the moment I am very busy, but can
take part in the discussion more in March. 

Another interesting toolset that has been released today by Mike
Gorshkov's research group is pyteomics 1.0.0
http://pypi.python.org/pypi/pyteomics/1.0.0 

Best wishes, 
Achim

-----Original Message-----
From: biopython-bounces at lists.open-bio.org
[mailto:biopython-bounces at lists.open-bio.org] On Behalf Of David Martin
Sent: 15 February 2012 17:23
To: 'biopython at lists.open-bio.org'
Subject: [Biopython] Proteomics tools for biopython



> Hey David,
>
> What sort of tools do you have in mind for proteomics?  I have quite a
few stashed away (3/6 frame translations, GFF files->proteins, X!Tandem
parsers/FDR calculators, GFF parsers, etc.)
>
> Chris

At present we are wrapping the OpenMS outputs (featureML etc) so that we
can interrogate the detail of how the runs behave. It is insightful to
see (for example) how many of the ms/ms are on overlapping peptides, and
the distribution of ms/ms selections per feature (vs intensity). This is
just the first stage. Having these data (which up till now have been
difficult to access) allows for building of smarter tools (custom delta
mass thresholds for each ms/ms, second peptide searching, seeing whether
all the peptide ID for a feature agree, correlating ID from different
search engines to the same spectra).

There are outstanding questions from our users for things like 'is it
really necessary to do duplicate runs?' or in other words, can we get
the machine to treat duplicate runs differently to optimise ID. (under
the principle that madness is doing the same thing repeatedly but
expecting different results.)

Parsers for XTandem! would be really useful as that is something we'd
like to have in our tool chain. A Mascot one would be good - I am
looking into that (it is on my list of things to do, just not near the
top right now.)  I very much favour a modular approach where each
class/object does one thing really well and can feed output to another
class, and all can be represented using open formats. It might be a good
idea to arrange a telecon or Skype group chat for people who are
interested in contributing to this and building a comprehensive set of
tools into Biopython. I can't promise too much from our end but we are
making good progress and we have a strong commitment to open software
and algorithms, with a heavy python development presence.

..d


The University of Dundee is a registered Scottish Charity, No: SC015096


_______________________________________________
Biopython mailing list  -  Biopython at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biopython


From schnoes at gmail.com  Thu Feb 16 20:18:30 2012
From: schnoes at gmail.com (Alexandra Schnoes)
Date: Thu, 16 Feb 2012 17:18:30 -0800
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
Message-ID: <CABZpzJcZEF=Or-28VSxL55eK6Wx7Q8CXWuEw9KfE9KHpDN__aQ@mail.gmail.com>

Hi,

I have some python code (using BioPython 1.58) that uses Bio.Entrez to pull
out information on 50 papers from pubmed. I have had no problem with this
code until yesterday when I started getting HTTP Error 500 messages that
continue until today. For example...

Traceback (most recent call last):
  File "<stdin>", line 1, in <module>
  File "sp_tools.py", line 421, in top_papers_dict
    rettype="medline", retmode="text")
  File
"/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Bio/Entrez/__init__.py",
line 113, in efetch
    return _open(cgi, variables)
  File
"/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Bio/Entrez/__init__.py",
line 360, in _open
    raise exception
urllib2.HTTPError: HTTP Error 500: Internal server error

The parameters I'm using are
db = pubmed
rettype = medline
retmode = text

Anyone have an idea why this might be happening now?

Thanks!
Alexandra


-- 
Alexandra Schnoes, Ph.D.
Scientist, Babbitt Laboratory
Program Coordinator, Graduate Student Internships for Career Exploration
University of California San Francisco
Tel:  415-502-1248
Fax: 415-514-9656
Email: schnoes at gmail.com

From jgrant at smith.edu  Thu Feb 16 21:39:54 2012
From: jgrant at smith.edu (Jessica Grant)
Date: Thu, 16 Feb 2012 21:39:54 -0500
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <CABZpzJcZEF=Or-28VSxL55eK6Wx7Q8CXWuEw9KfE9KHpDN__aQ@mail.gmail.com>
References: <CABZpzJcZEF=Or-28VSxL55eK6Wx7Q8CXWuEw9KfE9KHpDN__aQ@mail.gmail.com>
Message-ID: <CAOuNqdnDC8N1=DGCuvZYBAW7EwK4D2jGQ87f2-tOZeGoBAYWrg@mail.gmail.com>

I have a script I have used successfully in the past that uses Entrez.
 Yesterday, a lab-mate was using it but about half way through the files
she was processing she got an error and it wouldn't work after that.  I
went over the script from top to bottom to see what went wrong and couldn't
find a problem.  Your question gives me hope that it is something happening
at ncbi.  Our error was not identical.  Our script seemed to work until it
tried to read the output of the Entrez.efetch and then found no record in
the handle (or something like that...I don't have it in front of me.)

I suggested my lab mate contact the ncbi help desk to see if anything was
wrong on their end, but I dont' know if she did or if she heard back.

Jessica





On Thu, Feb 16, 2012 at 8:18 PM, Alexandra Schnoes <schnoes at gmail.com>wrote:

> Hi,
>
> I have some python code (using BioPython 1.58) that uses Bio.Entrez to pull
> out information on 50 papers from pubmed. I have had no problem with this
> code until yesterday when I started getting HTTP Error 500 messages that
> continue until today. For example...
>
> Traceback (most recent call last):
>  File "<stdin>", line 1, in <module>
>  File "sp_tools.py", line 421, in top_papers_dict
>    rettype="medline", retmode="text")
>  File
>
> "/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Bio/Entrez/__init__.py",
> line 113, in efetch
>    return _open(cgi, variables)
>  File
>
> "/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Bio/Entrez/__init__.py",
> line 360, in _open
>    raise exception
> urllib2.HTTPError: HTTP Error 500: Internal server error
>
> The parameters I'm using are
> db = pubmed
> rettype = medline
> retmode = text
>
> Anyone have an idea why this might be happening now?
>
> Thanks!
> Alexandra
>
>
> --
> Alexandra Schnoes, Ph.D.
> Scientist, Babbitt Laboratory
> Program Coordinator, Graduate Student Internships for Career Exploration
> University of California San Francisco
> Tel:  415-502-1248
> Fax: 415-514-9656
> Email: schnoes at gmail.com
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>

From mictadlo at gmail.com  Fri Feb 17 01:39:27 2012
From: mictadlo at gmail.com (Mic)
Date: Fri, 17 Feb 2012 16:39:27 +1000
Subject: [Biopython] histogram plot of insert size
Message-ID: <CAOP6n=hBnPV0_u5Mmr=UCbZNUmF0y77KGTuR7y2wA_xN2-cZkA@mail.gmail.com>

Hi all,
How is it possible to create histogram plot of insert size with
pysam/Biopython?

Thank you in advance.

Cheers

From schnoes at gmail.com  Fri Feb 17 02:31:10 2012
From: schnoes at gmail.com (Alexandra Schnoes)
Date: Thu, 16 Feb 2012 23:31:10 -0800
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <CAOuNqdnDC8N1=DGCuvZYBAW7EwK4D2jGQ87f2-tOZeGoBAYWrg@mail.gmail.com>
References: <CABZpzJcZEF=Or-28VSxL55eK6Wx7Q8CXWuEw9KfE9KHpDN__aQ@mail.gmail.com>
	<CAOuNqdnDC8N1=DGCuvZYBAW7EwK4D2jGQ87f2-tOZeGoBAYWrg@mail.gmail.com>
Message-ID: <CABZpzJcfQ2AO=oXYrPV14EYRNVoZ1Sh=7K2A5p0Vus5pSXPtPg@mail.gmail.com>

Thanks, that is somewhat encouraging to hear. I have also emailed NCBI
(that's actually where the multi-repeat subject line came from. My computer
sometimes has weird lags and apparently I hit ctrl-v a couple of times when
copying over the email I sent to NCBI, and didn't notice it. My apologies).
Hopefully one of us will hear something soon!
Alex



On Thu, Feb 16, 2012 at 6:39 PM, Jessica Grant <jgrant at smith.edu> wrote:

> I have a script I have used successfully in the past that uses Entrez.
>  Yesterday, a lab-mate was using it but about half way through the files
> she was processing she got an error and it wouldn't work after that.  I
> went over the script from top to bottom to see what went wrong and couldn't
> find a problem.  Your question gives me hope that it is something happening
> at ncbi.  Our error was not identical.  Our script seemed to work until it
> tried to read the output of the Entrez.efetch and then found no record in
> the handle (or something like that...I don't have it in front of me.)
>
> I suggested my lab mate contact the ncbi help desk to see if anything was
> wrong on their end, but I dont' know if she did or if she heard back.
>
> Jessica
>
>
>
>
>
> On Thu, Feb 16, 2012 at 8:18 PM, Alexandra Schnoes <schnoes at gmail.com>wrote:
>
>> Hi,
>>
>> I have some python code (using BioPython 1.58) that uses Bio.Entrez to
>> pull
>> out information on 50 papers from pubmed. I have had no problem with this
>> code until yesterday when I started getting HTTP Error 500 messages that
>> continue until today. For example...
>>
>> Traceback (most recent call last):
>>  File "<stdin>", line 1, in <module>
>>  File "sp_tools.py", line 421, in top_papers_dict
>>    rettype="medline", retmode="text")
>>  File
>>
>> "/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Bio/Entrez/__init__.py",
>> line 113, in efetch
>>    return _open(cgi, variables)
>>  File
>>
>> "/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Bio/Entrez/__init__.py",
>> line 360, in _open
>>    raise exception
>> urllib2.HTTPError: HTTP Error 500: Internal server error
>>
>> The parameters I'm using are
>> db = pubmed
>> rettype = medline
>> retmode = text
>>
>> Anyone have an idea why this might be happening now?
>>
>> Thanks!
>> Alexandra
>>
>>
>>

From p.j.a.cock at googlemail.com  Fri Feb 17 04:56:05 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 17 Feb 2012 09:56:05 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <CABZpzJcfQ2AO=oXYrPV14EYRNVoZ1Sh=7K2A5p0Vus5pSXPtPg@mail.gmail.com>
References: <CABZpzJcZEF=Or-28VSxL55eK6Wx7Q8CXWuEw9KfE9KHpDN__aQ@mail.gmail.com>
	<CAOuNqdnDC8N1=DGCuvZYBAW7EwK4D2jGQ87f2-tOZeGoBAYWrg@mail.gmail.com>
	<CABZpzJcfQ2AO=oXYrPV14EYRNVoZ1Sh=7K2A5p0Vus5pSXPtPg@mail.gmail.com>
Message-ID: <CAKVJ-_6bk2ReYLP=FFwK_SZCg-fSMAx1c0n=+X=vc2V2Wv1NHw@mail.gmail.com>

On Fri, Feb 17, 2012 at 7:31 AM, Alexandra Schnoes <schnoes at gmail.com> wrote:
> Thanks, that is somewhat encouraging to hear. I have also emailed NCBI
> (that's actually where the multi-repeat subject line came from. My computer
> sometimes has weird lags and apparently I hit ctrl-v a couple of times when
> copying over the email I sent to NCBI, and didn't notice it. My apologies).
> Hopefully one of us will hear something soon!
> Alex

This is probably due to a recent NCBI change (on Wednesday 15 Feb 2012)
with the release of EFetch 2.0, see:

http://www.ncbi.nlm.nih.gov/mailman/pipermail/utilities-announce/2012-February/000085.html
http://www.ncbi.nlm.nih.gov/books/NBK25499/#chapter4.Release_Notes

They have changed things with the default retmode, although looking at
their Table 1 from the above link, using rettype="medline", retmode="text"
looks OK still with both db="pmc" and ab"pubmed" databases.

Peter

From mictadlo at gmail.com  Fri Feb 17 05:13:31 2012
From: mictadlo at gmail.com (Mic)
Date: Fri, 17 Feb 2012 20:13:31 +1000
Subject: [Biopython] histogram plot of insert size
In-Reply-To: <84771354-DF77-49FE-B1EC-F3EAA1FF21F6@hsr.it>
References: <CAOP6n=hBnPV0_u5Mmr=UCbZNUmF0y77KGTuR7y2wA_xN2-cZkA@mail.gmail.com>
	<84771354-DF77-49FE-B1EC-F3EAA1FF21F6@hsr.it>
Message-ID: <CAOP6n=hstzDJGj5QwmAPdFdD05sfFgMUdQFQ948jVAUiM0GgTw@mail.gmail.com>

Hi Cittaro,
Thank you for your solution. I run fixmate from samtools on a BAM file:
HWI-ST226_0154:4:1206:12773:170407#CTTGTA 73 A_01a 1046 30 100M * 0 0
AGTATAAAACTAAGCAAACTGTTAGAACTTTGATTACGTTTTGTTTATCAGTGATACGCAAAAGTTTAAGATCCTTGAGTACCTCTTTCGATGGCGGATT
fdfffdfffbddaec_dSc^ddd^dQc^`Udddad_`c^^ac`R_NV\\]T^c`T_Mc]aV[V\R`Xa^^EKIIVcccc`YNY]UV[U`BBBBBBBBBBB
NM:i:1 MD:Z:73T26

I just wonder which column I have to take to fill isize_array?

Thank you in advance.


On Fri, Feb 17, 2012 at 7:07 PM, Cittaro Davide <cittaro.davide at hsr.it>wrote:

>
> On Feb 17, 2012, at 7:39 AM, Mic wrote:
>
> > Hi all,
> > How is it possible to create histogram plot of insert size with
> pysam/Biopython?
>
> As far as you have some plotting library yes.
> Take a look to matplotlib and try this:
>
> import matplotlib.pyplot as plt
>
> f = plt.figure()
> h = f.add_subplot(111)
> h.hist(isize_array, bins=50, normed=True)
> f.savefig('myhist.pdf', format='pdf')
>
> assuming isize_array is your array/list of insert sizes
>
> d
> /*
> Davide Cittaro, PhD
>
> Head of Bioinformatics Core
> Center for Translational Genomics and Bioinformatics
> San Raffaele Scientific Institute
> Via Olgettina 58
> 20132 Milano
> Italy
>
> Office: +39 02 26439140
> Mail: cittaro.davide at hsr.it
> Skype: daweonline
> */
>
>
>
>
>
>
>
>
>
>
>

From Matej.Repic at ki.si  Fri Feb 17 08:20:13 2012
From: Matej.Repic at ki.si (=?utf-8?B?TWF0ZWogUmVwacSN?=)
Date: Fri, 17 Feb 2012 13:20:13 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
Message-ID: <47063F60-DC26-4901-9D12-8503F285F3C9@ki.si>

Fortunately, the fix is quite simple:

Substitute the id=idlist in you fetch line with id=",".join(idlist).


Explanation:

This has something to do with how Pubmed accepts a python list. If you enter PMIDs by hand it works ok, but if you feed it a python list you get an internal server error.

Instead of using the procedure from the Cookbook, where you feed the list:

>>> fetch_handle = Entrez.esearch(db="pubmed", term="orchid", retmax=463)
>>> record = Entrez.read(fetch_handle)
>>> idlist = record["IdList"]
>>> record_handle = Entrez.efetch(db="pubmed", id=idlist, rettype="medline", retmode="text")

Use this slightly modified line for record_handle. With the ",".join(idlist) you convert the idlist python list to a comma separated string, which works as expected. 

>>> fetch_handle = Entrez.esearch(db="pubmed", term="orchid", retmax=463)
>>> record = Entrez.read(fetch_handle)
>>> idlist = record["IdList"]
>>> record_handle = Entrez.efetch(db="pubmed", id=",".join(idlist), rettype="medline", retmode="text")


Kind regards,
Matej
----------------------------------------------------------
Matej Repi?
Junior Researcher

Laboratory for Biocomputing and Bioinformatics
National Institute of Chemistry
Hajdrihova 19
SI-1001 Ljubljana POB 660
Slovenia

tel: +386-1-4760457
e-mail: matej.repic at ki.si
----------------------------------------------------------



From Matej.Repic at ki.si  Fri Feb 17 08:14:10 2012
From: Matej.Repic at ki.si (=?utf-8?B?TWF0ZWogUmVwacSN?=)
Date: Fri, 17 Feb 2012 13:14:10 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
Message-ID: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>

Fortunately, the fix is quite simple:

Substitute the id=idlist in you fetch line with id=",".join(idlist).


Explanation:

This has something to do with how Pubmed accepts a python list. If you enter PMIDs by hand it works ok, but if you feed it a python list you get an internal server error.

Instead of using the procedure from the Cookbook, where you feed the list:

>>> fetch_handle = Entrez.esearch(db="pubmed", term="orchid", retmax=463)
>>> record = Entrez.read(fetch_handle)
>>> idlist = record["IdList"]
>>> record_handle = Entrez.efetch(db="pubmed", id=idlist, rettype="medline", retmode="text")

Use this slightly modified line for record_handle. With the ",".join(idlist) you convert the idlist python list to a comma separated string, which works as expected. 

>>> fetch_handle = Entrez.esearch(db="pubmed", term="orchid", retmax=463)
>>> record = Entrez.read(fetch_handle)
>>> idlist = record["IdList"]
>>> record_handle = Entrez.efetch(db="pubmed", id=",".join(idlist), rettype="medline", retmode="text")


Kind regards,
Matej



----------------------------------------------------------
Matej Repi?
Junior Researcher

Laboratory for Biocomputing and Bioinformatics
National Institute of Chemistry
Hajdrihova 19
SI-1001 Ljubljana POB 660
Slovenia

tel: +386-1-4760457
e-mail: matej.repic at ki.si
----------------------------------------------------------



From p.j.a.cock at googlemail.com  Fri Feb 17 08:36:13 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 17 Feb 2012 13:36:13 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
References: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
Message-ID: <CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>

On Fri, Feb 17, 2012 at 1:14 PM, Matej Repi? <Matej.Repic at ki.si> wrote:
> Fortunately, the fix is quite simple:
>
> Substitute the id=idlist in you fetch line with id=",".join(idlist).
>

Hi Matej,

Well spotted. The idea is that this call,

Entrez.efetch(db="pubmed", id=['22307645', '22303114', '22301129',
'22299544', '22298842'], rettype="medline", retmode="text")

accesses this URL (where I have removed the email entry) which used to work
but isn't following the letter of the specification:

http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?retmode=text&tool=biopython&db=pubmed&id=22307645&id=22303114&id=22301129&id=22299544&id=22298842&rettype=medline

Whereas this call:

h = Entrez.efetch(db="pubmed",
id="22307645,22303114,22301129,22299544,22298842", rettype="medline",
retmode="text")

actually uses a different URL (which the NCBI would approve of):

http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?retmode=text&tool=biopython&db=pubmed&id=22307645%2C22303114%2C22301129%2C22299544%2C22298842&rettype=medline

It is possible the NCBI may opt to "fix" this, but it looks like it was only
working in the past by accident. However, we can do the conversion inside
the Bio.Entrez.efetch function in future - we're due for another Biopython
release now anyway so you shouldn't have to wait too long.

I'm having general errors from the Entrez server right now - so I can't confirm
the problem or test the potential fix yet.

Peter


From p.j.a.cock at googlemail.com  Fri Feb 17 09:41:26 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 17 Feb 2012 14:41:26 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>
References: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
	<CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>
Message-ID: <CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>

On Fri, Feb 17, 2012 at 1:36 PM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
> On Fri, Feb 17, 2012 at 1:14 PM, Matej Repi? <Matej.Repic at ki.si> wrote:
>> Fortunately, the fix is quite simple:
>>
>> Substitute the id=idlist in you fetch line with id=",".join(idlist).
>>
>
> Hi Matej,
>
> Well spotted. ...
>
> It is possible the NCBI may opt to "fix" this, but it looks like it was only
> working in the past by accident. However, we can do the conversion inside
> the Bio.Entrez.efetch function in future - we're due for another Biopython
> release now anyway so you shouldn't have to wait too long.
>
> I'm having general errors from the Entrez server right now - so I can't confirm
> the problem or test the potential fix yet.

I guess they kicked the server or something - it is working again now, and
I could confirm Matej Repi?'s findings and test my fix based on them:
https://github.com/biopython/biopython/commit/01b091cd4679b58d7e478734324528dd9d52f3ed

If anyone needs the fix right now, you must install Biopython from source,
or at least update the Bio/Entrez/__init__.py file by hand. Some testing
would be appreciated - and then we'll try to expedite the release of
Biopython 1.59 by the end of the month.

Peter

P.S. If anyone wants a small challenge for contributing to Biopython, an
online unit test for this and other things in Bio.Entrez would be great.
Please ask for more information on the biopython-dev list if you're
interested in helping out.


From jgrant at smith.edu  Fri Feb 17 09:52:21 2012
From: jgrant at smith.edu (Jessica Grant)
Date: Fri, 17 Feb 2012 09:52:21 -0500
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
	Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch:
	Getting HTTP Error 500
In-Reply-To: <CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>
References: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
	<CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>
	<CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>
Message-ID: <937A6C1B-3C8D-4820-AD11-FA2BA730B047@smith.edu>

My problem was fixed by changing the db to "nuccore" and the rettype to "fasta".  Up until the other day, I was successfully using "nucleotide" and "gb".

Jessica







On Feb 17, 2012, at 9:41 AM, Peter Cock wrote:

> On Fri, Feb 17, 2012 at 1:36 PM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
>> On Fri, Feb 17, 2012 at 1:14 PM, Matej Repi? <Matej.Repic at ki.si> wrote:
>>> Fortunately, the fix is quite simple:
>>> 
>>> Substitute the id=idlist in you fetch line with id=",".join(idlist).
>>> 
>> 
>> Hi Matej,
>> 
>> Well spotted. ...
>> 
>> It is possible the NCBI may opt to "fix" this, but it looks like it was only
>> working in the past by accident. However, we can do the conversion inside
>> the Bio.Entrez.efetch function in future - we're due for another Biopython
>> release now anyway so you shouldn't have to wait too long.
>> 
>> I'm having general errors from the Entrez server right now - so I can't confirm
>> the problem or test the potential fix yet.
> 
> I guess they kicked the server or something - it is working again now, and
> I could confirm Matej Repi?'s findings and test my fix based on them:
> https://github.com/biopython/biopython/commit/01b091cd4679b58d7e478734324528dd9d52f3ed
> 
> If anyone needs the fix right now, you must install Biopython from source,
> or at least update the Bio/Entrez/__init__.py file by hand. Some testing
> would be appreciated - and then we'll try to expedite the release of
> Biopython 1.59 by the end of the month.
> 
> Peter
> 
> P.S. If anyone wants a small challenge for contributing to Biopython, an
> online unit test for this and other things in Bio.Entrez would be great.
> Please ask for more information on the biopython-dev list if you're
> interested in helping out.
> 
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython



From schnoes at gmail.com  Fri Feb 17 12:33:59 2012
From: schnoes at gmail.com (Alexandra Schnoes)
Date: Fri, 17 Feb 2012 09:33:59 -0800
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <937A6C1B-3C8D-4820-AD11-FA2BA730B047@smith.edu>
References: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
	<CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>
	<CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>
	<937A6C1B-3C8D-4820-AD11-FA2BA730B047@smith.edu>
Message-ID: <CABZpzJck8y4hcv7Ldez0455DubkH1sAkPMw0GHUG5=B3AYkSoA@mail.gmail.com>

Wow. That was quick! Thanks guys!
Alex

On Fri, Feb 17, 2012 at 6:52 AM, Jessica Grant <jgrant at smith.edu> wrote:

> My problem was fixed by changing the db to "nuccore" and the rettype to
> "fasta".  Up until the other day, I was successfully using "nucleotide" and
> "gb".
>
> Jessica
>
>
>
>
>
>
>
> On Feb 17, 2012, at 9:41 AM, Peter Cock wrote:
>
> > On Fri, Feb 17, 2012 at 1:36 PM, Peter Cock <p.j.a.cock at googlemail.com>
> wrote:
> >> On Fri, Feb 17, 2012 at 1:14 PM, Matej Repi? <Matej.Repic at ki.si> wrote:
> >>> Fortunately, the fix is quite simple:
> >>>
> >>> Substitute the id=idlist in you fetch line with id=",".join(idlist).
> >>>
> >>
> >> Hi Matej,
> >>
> >> Well spotted. ...
> >>
> >> It is possible the NCBI may opt to "fix" this, but it looks like it was
> only
> >> working in the past by accident. However, we can do the conversion
> inside
> >> the Bio.Entrez.efetch function in future - we're due for another
> Biopython
> >> release now anyway so you shouldn't have to wait too long.
> >>
> >> I'm having general errors from the Entrez server right now - so I can't
> confirm
> >> the problem or test the potential fix yet.
> >
> > I guess they kicked the server or something - it is working again now,
> and
> > I could confirm Matej Repi?'s findings and test my fix based on them:
> >
> https://github.com/biopython/biopython/commit/01b091cd4679b58d7e478734324528dd9d52f3ed
> >
> > If anyone needs the fix right now, you must install Biopython from
> source,
> > or at least update the Bio/Entrez/__init__.py file by hand. Some testing
> > would be appreciated - and then we'll try to expedite the release of
> > Biopython 1.59 by the end of the month.
> >
> > Peter
> >
> > P.S. If anyone wants a small challenge for contributing to Biopython, an
> > online unit test for this and other things in Bio.Entrez would be great.
> > Please ask for more information on the biopython-dev list if you're
> > interested in helping out.
> >
> > _______________________________________________
> > Biopython mailing list  -  Biopython at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/biopython
>
>
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From Matej.Repic at ki.si  Fri Feb 17 16:21:24 2012
From: Matej.Repic at ki.si (=?utf-8?B?TWF0ZWogUmVwacSN?=)
Date: Fri, 17 Feb 2012 21:21:24 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>
References: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
	<CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>
	<CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>
Message-ID: <7E558ACD-59B7-41B0-BE87-998704A3940C@ki.si>

The fix is working for me. I updated the __init__.py by hand and now both approaches work. By both i mean id=idlist or id=",".join(idlist).

Great and quick fix!

Regards,
Matej


On 17. feb. 2012, at 15:41, Peter Cock wrote:

> On Fri, Feb 17, 2012 at 1:36 PM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
>> On Fri, Feb 17, 2012 at 1:14 PM, Matej Repi? <Matej.Repic at ki.si> wrote:
>>> Fortunately, the fix is quite simple:
>>> 
>>> Substitute the id=idlist in you fetch line with id=",".join(idlist).
>>> 
>> 
>> Hi Matej,
>> 
>> Well spotted. ...
>> 
>> It is possible the NCBI may opt to "fix" this, but it looks like it was only
>> working in the past by accident. However, we can do the conversion inside
>> the Bio.Entrez.efetch function in future - we're due for another Biopython
>> release now anyway so you shouldn't have to wait too long.
>> 
>> I'm having general errors from the Entrez server right now - so I can't confirm
>> the problem or test the potential fix yet.
> 
> I guess they kicked the server or something - it is working again now, and
> I could confirm Matej Repi?'s findings and test my fix based on them:
> https://github.com/biopython/biopython/commit/01b091cd4679b58d7e478734324528dd9d52f3ed
> 
> If anyone needs the fix right now, you must install Biopython from source,
> or at least update the Bio/Entrez/__init__.py file by hand. Some testing
> would be appreciated - and then we'll try to expedite the release of
> Biopython 1.59 by the end of the month.
> 
> Peter
> 
> P.S. If anyone wants a small challenge for contributing to Biopython, an
> online unit test for this and other things in Bio.Entrez would be great.
> Please ask for more information on the biopython-dev list if you're
> interested in helping out.



From p.j.a.cock at googlemail.com  Fri Feb 17 17:33:23 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 17 Feb 2012 22:33:23 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <7E558ACD-59B7-41B0-BE87-998704A3940C@ki.si>
References: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
	<CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>
	<CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>
	<7E558ACD-59B7-41B0-BE87-998704A3940C@ki.si>
Message-ID: <CAKVJ-_4jh75=WfD75vHp40uC+KXgFwYOncEOOENgGwbgyC3G6g@mail.gmail.com>

On Fri, Feb 17, 2012 at 9:21 PM, Matej Repi? <Matej.Repic at ki.si> wrote:
> The fix is working for me. I updated the __init__.py by hand
> and now both approaches work. By both i mean id=idlist or
> id=",".join(idlist).
>
> Great and quick fix!
>
> Regards,
> Matej

Great - independent testing is always good, thanks.

The NCBI have now announced this change was a deliberate
tightening up of the Entrez API, so we do need this fix in
Biopython to avoid existing scripts breaking:
http://www.ncbi.nlm.nih.gov/mailman/pipermail/utilities-announce/2012-February/000086.html

Peter


From mictadlo at gmail.com  Sat Feb 18 02:53:32 2012
From: mictadlo at gmail.com (Mic)
Date: Sat, 18 Feb 2012 17:53:32 +1000
Subject: [Biopython] Google Summer of Code 2012
Message-ID: <CAOP6n=i4SSrWN-jOyyRyy2FVJMyF-ad4=g3FRm=UTifHKX2ZEw@mail.gmail.com>

Hi all,
would it be possible to put the following idea to Google Summer of Code
2012:
* http://www.biogems.info/ for Biopython with
http://pypi.python.org/pypi/pip . Could include pysam, GFF3, OBO/OWL (see
below) and so on.

Cheers,

On Tue, Dec 27, 2011 at 3:55 AM, Martin Mokrejs <mmokrejs at fold.natur.cuni.cz
> wrote:

> Hi,
>  I would like to parse some OBO/OWL files in python. I searched
> for some existing code and found http://biopython.org/wiki/Gene_Ontology
> pointing to some OWL parser from Ed Cannon (follow a link on the page
> listed above). Unfortunately, the code is gone? :((
>
>  I also discovered an OBO parser at http://hal.elte.hu/~nepusz/development
> ,
> the sources can be fetched from
>
> http://bazaar.launchpad.net/~ntamas/+junk/go-parser/tarball/7?start_revid=7
>
>  It can open the .obo files for me although I do not see much methods
> available.
>
>  Finally, I found
> https://github.com/gotgenes/biopython/tree/a4824ceb71f3a687b3eb5e1fefd0ad3c278bf185/Bio/GO so
> my question is when will this be available in released biopython
> and what are your opinions/suggestions now. Does it offer more than the
> go-parser from ~ntamas?
>
>  I want to cluster some sequences based on anatomical terms, so
> I think what I want is to be able to lookup easily all parents
> (probably except the very root node or so) and compare whether
> they overlap with any parent of another sequence.
>
> Thank you for your comments,
> Martin
> P.S.: I want to parse OBO from http://www.evocontology.org/
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>

From eric.talevich at gmail.com  Sat Feb 18 11:34:18 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Sat, 18 Feb 2012 11:34:18 -0500
Subject: [Biopython] Bio.Phylo bugs & pain points
Message-ID: <CAMC681nQF3u-xFW9ekzfi6mBzqZmp10oEfShPQNDefr8LMAmjA@mail.gmail.com>

Folks,

Since we're coming up on another release of Biopython, I'd like to identify
any remaing bugs, pain points, aesthetic flaws, and minor missing features
in Bio.Phylo. (And hopefully, fix them before the release.)

In particular, the Phylo.draw() function, which plots a rooted phylogram
with matplotlib, appeared in the last Biopython release unannounced. There
are already many tree-drawing programs that produce beautiful
publication-quality graphics, and we're not trying to compete with those.
But we do want it to be useful for quickly visualizing a tree as you
develop a script or modify a tree interactively in IPython, for example. So
-- do the trees drawn by Phylo.draw() look right?

Thanks,
Eric

From mjldehoon at yahoo.com  Sat Feb 18 11:46:33 2012
From: mjldehoon at yahoo.com (Michiel de Hoon)
Date: Sat, 18 Feb 2012 08:46:33 -0800 (PST)
Subject: [Biopython] Bio.Phylo bugs & pain points
In-Reply-To: <CAMC681nQF3u-xFW9ekzfi6mBzqZmp10oEfShPQNDefr8LMAmjA@mail.gmail.com>
Message-ID: <1329583593.82866.YahooMailClassic@web161202.mail.bf1.yahoo.com>

Hi Eric,

> But we do want it to be useful for quickly visualizing a
> tree as you develop a script or modify a tree
> interactively in IPython, for example.

Do you need IPython or is regular Python sufficient?

-Michiel.

--- On Sat, 2/18/12, Eric Talevich <eric.talevich at gmail.com> wrote:

> From: Eric Talevich <eric.talevich at gmail.com>
> Subject: [Biopython] Bio.Phylo bugs & pain points
> To: "BioPython Mailing List" <biopython at lists.open-bio.org>, "BioPython-Dev Mailing List" <biopython-dev at biopython.org>
> Date: Saturday, February 18, 2012, 11:34 AM
> Folks,
> 
> Since we're coming up on another release of Biopython, I'd
> like to identify
> any remaing bugs, pain points, aesthetic flaws, and minor
> missing features
> in Bio.Phylo. (And hopefully, fix them before the release.)
> 
> In particular, the Phylo.draw() function, which plots a
> rooted phylogram
> with matplotlib, appeared in the last Biopython release
> unannounced. There
> are already many tree-drawing programs that produce
> beautiful
> publication-quality graphics, and we're not trying to
> compete with those.
> But we do want it to be useful for quickly visualizing a
> tree as you
> develop a script or modify a tree interactively in IPython,
> for example. So
> -- do the trees drawn by Phylo.draw() look right?
> 
> Thanks,
> Eric
> _______________________________________________
> Biopython mailing list? -? Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
> 


From eric.talevich at gmail.com  Sat Feb 18 11:52:16 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Sat, 18 Feb 2012 11:52:16 -0500
Subject: [Biopython] Have you used Bio.Phylo in a published study?
Message-ID: <CAMC681=Vgjhv20OvTq3R2Z2tfOB0FonRLwO57W5ojutV0j_0+A@mail.gmail.com>

Folks,

Now that Bio.Phylo has reached a somewhat stable point, we're preparing a
journal article on it. I'd like to mention and cite some published studies
in which Bio.Phylo was used for some part of the analysis. Has anyone here
published a study that relied on the Phylo module of Biopython?

I know of two so far:
http://www.biology-direct.com/content/6/1/34/
http://www.biomedcentral.com/1471-2148/11/321

Thanks,
Eric

From eric.talevich at gmail.com  Sat Feb 18 11:54:03 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Sat, 18 Feb 2012 11:54:03 -0500
Subject: [Biopython] Bio.Phylo bugs & pain points
In-Reply-To: <1329583593.82866.YahooMailClassic@web161202.mail.bf1.yahoo.com>
References: <CAMC681nQF3u-xFW9ekzfi6mBzqZmp10oEfShPQNDefr8LMAmjA@mail.gmail.com>
	<1329583593.82866.YahooMailClassic@web161202.mail.bf1.yahoo.com>
Message-ID: <CAMC681=oW-dphYqezoug_NTAr_eJJJWJQ1T5yKqWVmFfLJ35uQ@mail.gmail.com>

On Sat, Feb 18, 2012 at 11:46 AM, Michiel de Hoon <mjldehoon at yahoo.com>wrote:

> Hi Eric,
>
> > But we do want it to be useful for quickly visualizing a
> > tree as you develop a script or modify a tree
> > interactively in IPython, for example.
>
> Do you need IPython or is regular Python sufficient?
>
> -Michiel.
>

Regular Python plus matplotlib is sufficient. IPython has convenient
integration with pylab, that's all.
-E


>
> --- On Sat, 2/18/12, Eric Talevich <eric.talevich at gmail.com> wrote:
>
> > From: Eric Talevich <eric.talevich at gmail.com>
> > Subject: [Biopython] Bio.Phylo bugs & pain points
> > To: "BioPython Mailing List" <biopython at lists.open-bio.org>,
> "BioPython-Dev Mailing List" <biopython-dev at biopython.org>
> > Date: Saturday, February 18, 2012, 11:34 AM
> > Folks,
> >
> > Since we're coming up on another release of Biopython, I'd
> > like to identify
> > any remaing bugs, pain points, aesthetic flaws, and minor
> > missing features
> > in Bio.Phylo. (And hopefully, fix them before the release.)
> >
> > In particular, the Phylo.draw() function, which plots a
> > rooted phylogram
> > with matplotlib, appeared in the last Biopython release
> > unannounced. There
> > are already many tree-drawing programs that produce
> > beautiful
> > publication-quality graphics, and we're not trying to
> > compete with those.
> > But we do want it to be useful for quickly visualizing a
> > tree as you
> > develop a script or modify a tree interactively in IPython,
> > for example. So
> > -- do the trees drawn by Phylo.draw() look right?
> >
> > Thanks,
> > Eric
> > _______________________________________________
> > Biopython mailing list  -  Biopython at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/biopython
> >
>

From eric.talevich at gmail.com  Sat Feb 18 12:11:27 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Sat, 18 Feb 2012 12:11:27 -0500
Subject: [Biopython] Bio.Phylo bugs & pain points
In-Reply-To: <CAMC681nQF3u-xFW9ekzfi6mBzqZmp10oEfShPQNDefr8LMAmjA@mail.gmail.com>
References: <CAMC681nQF3u-xFW9ekzfi6mBzqZmp10oEfShPQNDefr8LMAmjA@mail.gmail.com>
Message-ID: <CAMC681kVjz7rWvxpzq6Op_AW9qdJJYr11sUj7=XJMLjXpWygiw@mail.gmail.com>

On Sat, Feb 18, 2012 at 11:34 AM, Eric Talevich <eric.talevich at gmail.com>wrote:

> So -- do the trees drawn by Phylo.draw() look right?
>
>
Here's how to get a quick tree, using a test file from the Biopython source
distribution:

>>> from Bio import Phylo
>>> tree = Phylo.read("Tests/PhyloXML/apaf.xml", "phyloxml")
>>> Phylo.draw(tree)


If you don't have the Tests/ directory, you can use any other Newick, Nexus
or PhyloXML tree; just change the file name and format name in the call to
Phylo.read().

Thanks,
Eric

From mictadlo at gmail.com  Mon Feb 20 01:37:59 2012
From: mictadlo at gmail.com (Mic)
Date: Mon, 20 Feb 2012 16:37:59 +1000
Subject: [Biopython] retrieving paired sequences from BAM
Message-ID: <CAOP6n=jbd5UKRjXsij9EFmeXCd7KBzS4uKzAHR5x8-utuv4PgA@mail.gmail.com>

Hello,
I am trying to retrieve paired end sequences from BAM file. However, I am
only able to retrieve the A sequence with the following code:
''''''''''''''''''''''''''''''''''''''''
import pysam
samfile = pysam.Samfile("b.sorted.bam", "rb")
for read in samfile.fetch():
        if read.is_paired:
                print read.qname
                print read.seq
samfile.close()

$ python a.py | head -n 2
HWI-ST226_0154:4:1206:12773:170407#CTTGTA
AGTATAAAACTAAGCAAACTGTTAGAACTTTGATTACGTTTTGTTTATCAGTGATACGCAAAAGTTTAAGATCCTTGAGTACCTCTTTCGATGGCGGATT
''''''''''''''''''''''''''''''''''''''''

How is it possible to retrieve also the B sequence?
What is the difference between is_proper_pair and is_paired?

-------------
$ grep -A 1 'HWI-ST226_0154:4:1206:12773:170407#CTTGTA' X_A.fastq
@HWI-ST226_0154:4:1206:12773:170407#CTTGTA/1
AGTATAAAACTAAGCAAACTGTTAGAACTTTGATTACGTTTTGTTTATCAGTGATACGCAAAAGTTTAAGATCCTTGAGTACCTCTTTCGATGGCGGATT

$ grep -A 1 'HWI-ST226_0154:4:1206:12773:170407#CTTGTA' X_B.fastq
@HWI-ST226_0154:4:1206:12773:170407#CTTGTA/2
GGCGCTGTGACTGAAGTCCTCAGATTTCGGTACGGTTTTGTCTATTTCTGGGTTCCTGCGGAAACACCTTCTCGATTATTTTCTAATCTCAATTAGGTTT
-------------

Thank you in advance.

Cheers

From MatatTHC at gmx.de  Wed Feb 22 10:06:02 2012
From: MatatTHC at gmx.de (Matthias Bernt)
Date: Wed, 22 Feb 2012 16:06:02 +0100
Subject: [Biopython] Degenerated Codons
Message-ID: <20120222150602.313750@gmx.net>

Hi, 

Is there a some functionality:
- to list X-fold degenerated codons? 
- to test if a codon is X-fold degenerated?
- to return X for a given codon 
in biopython? 
        
If not then we might forward this to the dev-list. I would try to implement this. 

Matthias
-- 
Empfehlen Sie GMX DSL Ihren Freunden und Bekannten und wir
belohnen Sie mit bis zu 50,- Euro! https://freundschaftswerbung.gmx.de

From p.j.a.cock at googlemail.com  Wed Feb 22 10:58:36 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 22 Feb 2012 15:58:36 +0000
Subject: [Biopython] Degenerated Codons
In-Reply-To: <20120222150602.313750@gmx.net>
References: <20120222150602.313750@gmx.net>
Message-ID: <CAKVJ-_4Fj08FRVPYomxcjMiK3EuCxWQ=iRxKJU0dxPichHPcAw@mail.gmail.com>

On Wed, Feb 22, 2012 at 3:06 PM, Matthias Bernt <MatatTHC at gmx.de> wrote:
> Hi,
>
> Is there a some functionality:
> - to list X-fold degenerated codons?
> - to test if a codon is X-fold degenerated?
> - to return X for a given codon
> in biopython?
>
> If not then we might forward this to the dev-list. I would try to implement this.
>
> Matthias

Hi Matthias,

You can probably do that with the codon dictionaries
provided in Bio.Data.CodonTable (used for translations).
If you could give some specific examples of input and
desired output I'm sure we can give you more hints.

Peter

From MatatTHC at gmx.de  Thu Feb 23 06:00:42 2012
From: MatatTHC at gmx.de (Matthias Bernt)
Date: Thu, 23 Feb 2012 12:00:42 +0100
Subject: [Biopython] Degenerated Codons
In-Reply-To: <CAKVJ-_4Fj08FRVPYomxcjMiK3EuCxWQ=iRxKJU0dxPichHPcAw@mail.gmail.com>
References: <20120222150602.313750@gmx.net>
	<CAKVJ-_4Fj08FRVPYomxcjMiK3EuCxWQ=iRxKJU0dxPichHPcAw@mail.gmail.com>
Message-ID: <CALNFT0hvM6V625MbTn6qVGNKXnmsTrFK_tr7fKcePb-Nz4kVqA@mail.gmail.com>

Hi,

You can probably do that with the codon dictionaries
> provided in Bio.Data.CodonTable (used for translations).
> If you could give some specific examples of input and
> desired output I'm sure we can give you more hints.
>

You mean the forward_table?

The most important function for me is:
- Input: Codon (sequence of length 3), code table
- Output: X, number of codons coding for the same
  amino acid as the given codon

Building on this it would be easy to implements:
- Input: Codon, code table, X
- Output: true iff there are X codons coding for the same amino acid

Also important (and maybe the core of the other two functions):
- Input: codon
- Output: list of codons coding for the same amino acid

I think this is it. I need to implement these functions anyway.
So maybe you can give me hints how I should implement it.
For my application it would be acceptable to iterate over the
forward_table for each call.
But maybe its possible to modify the backward_table such
that it stores all codons (as list) for a amino acid. For the other
functions building on it (back translation...) it would be possible
to take the first element of the list.

Matthias

From p.j.a.cock at googlemail.com  Thu Feb 23 06:29:04 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 23 Feb 2012 11:29:04 +0000
Subject: [Biopython] Degenerated Codons
In-Reply-To: <CALNFT0hvM6V625MbTn6qVGNKXnmsTrFK_tr7fKcePb-Nz4kVqA@mail.gmail.com>
References: <20120222150602.313750@gmx.net>
	<CAKVJ-_4Fj08FRVPYomxcjMiK3EuCxWQ=iRxKJU0dxPichHPcAw@mail.gmail.com>
	<CALNFT0hvM6V625MbTn6qVGNKXnmsTrFK_tr7fKcePb-Nz4kVqA@mail.gmail.com>
Message-ID: <CAKVJ-_5SCWbEWiK56iifzKSkVoiKmexPfTqSFd+dmqi18HOCrQ@mail.gmail.com>

On Thu, Feb 23, 2012 at 11:00 AM, Matthias Bernt <MatatTHC at gmx.de> wrote:
> Hi,
>
>> You can probably do that with the codon dictionaries
>> provided in Bio.Data.CodonTable (used for translations).
>> If you could give some specific examples of input and
>> desired output I'm sure we can give you more hints.
>
>
> You mean the forward_table?
>
> The most important function for me is:
> - Input: Codon (sequence of length 3), code table
> - Output: X, number of codons coding for the same
> ? amino acid as the given codon

Where table could be ambiguous or unambiguous,
DNA or RNA? Something like this works nicely for
unambiguous tables:

from Bio.Data.CodonTable import unambiguous_dna_by_id
for table in [unambiguous_dna_by_id[1], unambiguous_dna_by_id[2]]:
    print table.id
    for codon in  ["AAA", "ATT"]:
        amino = table.forward_table[codon]
        alt_codons = [k for (k,v) in table.forward_table.iteritems()
if v==amino]
        print "%s -> %s, %i codons for this amino acid" % (codon,
amino, len(alt_codons))

Giving:

1
AAA -> K, 2 codons for this amino acid
ATT -> I, 3 codons for this amino acid
2
AAA -> K, 2 codons for this amino acid
ATT -> I, 2 codons for this amino acid


> But maybe its possible to modify the backward_table such
> that it stores all codons (as list) for a amino acid. For the other
> functions building on it (back translation...) it would be possible
> to take the first element of the list.

We can't change that for backwards compatibility, but we
could add a alt_backward_table or something instead?

Peter


From marco.galardini at unifi.it  Thu Feb 23 11:05:53 2012
From: marco.galardini at unifi.it (Marco Galardini)
Date: Thu, 23 Feb 2012 17:05:53 +0100
Subject: [Biopython] SeqIO fasta "fakes" recognition
Message-ID: <4F4663E1.5010206@unifi.it>

Hi all,

i was wondering if you are aware of a method to distinguish between 
"real" fasta files and files that just happen to have a ">" character.
I would like to scan a directory and return only the "real" fasta files.
I tried to open a .png file and surprisingly it gave me the following 
results:

SeqIO.parse(open('Screenshot.png'),'fasta').next()
SeqRecord(seq=Seq('?;9r$????8?n??????7M?4???\?r???0????$It??I...q+', 
SingleLetterAlphabet()), 
id='>>DEE\xd1\xaaU+\x8e\x1f?Nxx8g\xce\x9c1\xb8]``', 
name='>>DEE\xd1\xaaU+\x8e\x1f?Nxx8g\xce\x9c1\xb8]``', 
description='>>DEE\xd1\xaaU+\x8e\x1f?Nxx8g\xce\x9c1\xb8]`` 
\x81\x81\x81\xec\xdb\xb7Ok\xf9\xd5\xabW\xf1\xf0\xf0`\xe2\xc4\x89\x8c\x181\x82\x9e={j\x95+\x14', 
dbxrefs=[])

I tried to use some Alphabets but i experienced the same results.
Thanks in advance,
Marco

-- 
-------------------------------------------------
Marco Galardini
DBE - Department of Evolutionary Biology
University of Florence - Italy

e-mail: marco.galardini at unifi.it
www: http://www.unifi.it/dblage/CMpro-v-p-51.html
phone:  +39 055 2288249
mobile: +39 340 2808041
-------------------------------------------------


From p.j.a.cock at googlemail.com  Thu Feb 23 11:21:36 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 23 Feb 2012 16:21:36 +0000
Subject: [Biopython] SeqIO fasta "fakes" recognition
In-Reply-To: <4F4663E1.5010206@unifi.it>
References: <4F4663E1.5010206@unifi.it>
Message-ID: <CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>

On Thu, Feb 23, 2012 at 4:05 PM, Marco Galardini
<marco.galardini at unifi.it> wrote:
> Hi all,
>
> i was wondering if you are aware of a method to distinguish between "real"
> fasta files and files that just happen to have a ">" character.
> I would like to scan a directory and return only the "real" fasta files.
> I tried to open a .png file and surprisingly it gave me the following
> results:

The FASTA parser doesn't attempt to restrict the sequence alphabet,
indeed some FASTA like files do use all sorts of weird characters
(e.g. RNA secondary structure). Also it allows for 'free text' before
the first record (useful in several situations including FASTA records
embedded at the end of a GFF file). As a side effect of this need for
tolerance, the code does its best to read any file you give it - but
this is clearly a case of garbage in, garbage out (GIGO).

Guessing bioinformatics file types is non-trivial, and not something
that Bio.SeqIO attempts to do (unlike BioPerl). We take the Python
approach that you the user need to be explicit, and if you say it is
a FASTA file we'll try to treat it as such.

Detecting image files (or indeed most binary file types) on the other
hand is much easier - so do that instead?

Peter

From eric.talevich at gmail.com  Thu Feb 23 11:35:29 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Thu, 23 Feb 2012 11:35:29 -0500
Subject: [Biopython] SeqIO fasta "fakes" recognition
In-Reply-To: <CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>
References: <4F4663E1.5010206@unifi.it>
	<CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>
Message-ID: <CAMC681m8BU4mdcvFt8D5x4FU+AHYqEN-m8DMmWcqFSpb7n1Nkg@mail.gmail.com>

On Thu, Feb 23, 2012 at 11:21 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Feb 23, 2012 at 4:05 PM, Marco Galardini
> <marco.galardini at unifi.it> wrote:
> > Hi all,
> >
> > i was wondering if you are aware of a method to distinguish between
> "real"
> > fasta files and files that just happen to have a ">" character.
> > I would like to scan a directory and return only the "real" fasta files.
> > I tried to open a .png file and surprisingly it gave me the following
> > results:
>
> The FASTA parser doesn't attempt to restrict the sequence alphabet,
> indeed some FASTA like files do use all sorts of weird characters
> (e.g. RNA secondary structure). Also it allows for 'free text' before
> the first record (useful in several situations including FASTA records
> embedded at the end of a GFF file). As a side effect of this need for
> tolerance, the code does its best to read any file you give it - but
> this is clearly a case of garbage in, garbage out (GIGO).
>
> Guessing bioinformatics file types is non-trivial, and not something
> that Bio.SeqIO attempts to do (unlike BioPerl). We take the Python
> approach that you the user need to be explicit, and if you say it is
> a FASTA file we'll try to treat it as such.
>
>
I suppose there's always:

try:
    record = SeqIO.read("gigo.png", "fasta")
    assert str(record.seq).isalpha()
except:
    # complain...


At some point, didn't we discuss adding optional alphabet validation, e.g.
a validate() method or something more automatic?

-Eric

From p.j.a.cock at googlemail.com  Thu Feb 23 11:38:59 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 23 Feb 2012 16:38:59 +0000
Subject: [Biopython] SeqIO fasta "fakes" recognition
In-Reply-To: <CAMC681m8BU4mdcvFt8D5x4FU+AHYqEN-m8DMmWcqFSpb7n1Nkg@mail.gmail.com>
References: <4F4663E1.5010206@unifi.it>
	<CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>
	<CAMC681m8BU4mdcvFt8D5x4FU+AHYqEN-m8DMmWcqFSpb7n1Nkg@mail.gmail.com>
Message-ID: <CAKVJ-_7d9h5d95Va5c61W7q7vGEu59hg203XP4gZjm3XqAYfNw@mail.gmail.com>

On Thu, Feb 23, 2012 at 4:35 PM, Eric Talevich <eric.talevich at gmail.com> wrote:
>
> At some point, didn't we discuss adding optional alphabet validation, e.g. a
> validate() method or something more automatic?
>

Yes, but with no clear best way forward agreed:
http://lists.open-bio.org/pipermail/biopython-dev/2011-December/009343.html
https://redmine.open-bio.org/issues/2597

Peter

From marco.galardini at unifi.it  Thu Feb 23 11:40:25 2012
From: marco.galardini at unifi.it (Marco Galardini)
Date: Thu, 23 Feb 2012 17:40:25 +0100
Subject: [Biopython] SeqIO fasta "fakes" recognition
In-Reply-To: <CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>
References: <4F4663E1.5010206@unifi.it>
	<CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>
Message-ID: <4F466BF9.6080805@unifi.it>

On 02/23/2012 05:21 PM, Peter Cock wrote:
> On Thu, Feb 23, 2012 at 4:05 PM, Marco Galardini
> <marco.galardini at unifi.it>  wrote:
>> Hi all,
>>
>> i was wondering if you are aware of a method to distinguish between "real"
>> fasta files and files that just happen to have a ">" character.
>> I would like to scan a directory and return only the "real" fasta files.
>> I tried to open a .png file and surprisingly it gave me the following
>> results:
> Guessing bioinformatics file types is non-trivial, and not something
> that Bio.SeqIO attempts to do (unlike BioPerl). We take the Python
> approach that you the user need to be explicit, and if you say it is
> a FASTA file we'll try to treat it as such.
You're right: probably the best thing to do will be to trust users and 
hope they won't push garbage as inputs.
> Detecting image files (or indeed most binary file types) on the other
> hand is much easier - so do that instead?
>
In principle this is true, but the fact is that i think it won't be easy 
or straightforward to account for all possible file formats that can be 
found in a given directory. I'll stick to good python principles and 
hope to have smart-enough users :)

Thanks for your instant reply.
Marco

-- 
-------------------------------------------------
Marco Galardini
DBE - Department of Evolutionary Biology
University of Florence - Italy

e-mail: marco.galardini at unifi.it
www: http://www.unifi.it/dblage/CMpro-v-p-51.html
phone:  +39 055 2288249
mobile: +39 340 2808041
-------------------------------------------------


From marco.galardini at unifi.it  Thu Feb 23 12:38:26 2012
From: marco.galardini at unifi.it (Marco Galardini)
Date: Thu, 23 Feb 2012 18:38:26 +0100
Subject: [Biopython] SeqIO fasta "fakes" recognition
In-Reply-To: <CAMC681m8BU4mdcvFt8D5x4FU+AHYqEN-m8DMmWcqFSpb7n1Nkg@mail.gmail.com>
References: <4F4663E1.5010206@unifi.it>
	<CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>
	<CAMC681m8BU4mdcvFt8D5x4FU+AHYqEN-m8DMmWcqFSpb7n1Nkg@mail.gmail.com>
Message-ID: <4F467992.9060205@unifi.it>

On 02/23/2012 05:35 PM, Eric Talevich wrote:
>
> I suppose there's always:
>
> try:
>      record = SeqIO.read("gigo.png", "fasta")
>      assert str(record.seq).isalpha()
> except:
>      # complain...
>
>
Thanks for the hint, I've implemented this (using the parse method) and 
i'll see how it will perform (i guess it will had some overhead).
Marco

-- 
-------------------------------------------------
Marco Galardini
DBE - Department of Evolutionary Biology
University of Florence - Italy

e-mail: marco.galardini at unifi.it
www: http://www.unifi.it/dblage/CMpro-v-p-51.html
phone:  +39 055 2288249
mobile: +39 340 2808041
-------------------------------------------------


From MatatTHC at gmx.de  Thu Feb 23 16:09:18 2012
From: MatatTHC at gmx.de (Matthias Bernt)
Date: Thu, 23 Feb 2012 22:09:18 +0100
Subject: [Biopython] Degenerated Codons
In-Reply-To: <CAKVJ-_5SCWbEWiK56iifzKSkVoiKmexPfTqSFd+dmqi18HOCrQ@mail.gmail.com>
References: <20120222150602.313750@gmx.net>
	<CAKVJ-_4Fj08FRVPYomxcjMiK3EuCxWQ=iRxKJU0dxPichHPcAw@mail.gmail.com>
	<CALNFT0hvM6V625MbTn6qVGNKXnmsTrFK_tr7fKcePb-Nz4kVqA@mail.gmail.com>
	<CAKVJ-_5SCWbEWiK56iifzKSkVoiKmexPfTqSFd+dmqi18HOCrQ@mail.gmail.com>
Message-ID: <CALNFT0gLSht47aWa3qpx_59G0O8_5cM5RN4ogTD3A0LA-oMn4A@mail.gmail.com>

hi peter,

Thank you for the suggestions. I will try to create the functions as
suggested.
Should I post them here?


> Where table could be ambiguous or unambiguous,
> DNA or RNA? Something like this works nicely for
> unambiguous tables:
>
> from Bio.Data.CodonTable import unambiguous_dna_by_id
> for table in [unambiguous_dna_by_id[1], unambiguous_dna_by_id[2]]:
>    print table.id
>    for codon in  ["AAA", "ATT"]:
>        amino = table.forward_table[codon]
>        alt_codons = [k for (k,v) in table.forward_table.iteritems()
> if v==amino]
>        print "%s -> %s, %i codons for this amino acid" % (codon,
> amino, len(alt_codons))
>
> Giving:
>
> 1
> AAA -> K, 2 codons for this amino acid
> ATT -> I, 3 codons for this amino acid
> 2
> AAA -> K, 2 codons for this amino acid
> ATT -> I, 2 codons for this amino acid
>
>
> > But maybe its possible to modify the backward_table such
> > that it stores all codons (as list) for a amino acid. For the other
> > functions building on it (back translation...) it would be possible
> > to take the first element of the list.
>
> We can't change that for backwards compatibility, but we
> could add a alt_backward_table or something instead
>

I think we keep it as it is at the moment. Performance is not so important
for me .. so far.
Optimisation can still be done later.

Matthias

From fenggao0907 at yahoo.com.cn  Thu Feb 23 16:35:23 2012
From: fenggao0907 at yahoo.com.cn (=?utf-8?B?6auY5YekKEZlbmcgR0FPKQ==?=)
Date: Fri, 24 Feb 2012 05:35:23 +0800 (CST)
Subject: [Biopython]  Entrez and SeqIO "no records found in handle"
Message-ID: <1330032923.65491.YahooMailNeo@web15106.mail.cnb.yahoo.com>

Hi all,
We have some python code using gi number to get record from Genbank.
Part of the code is:

handle = Entrez.efetch(db="protein", id=ID, rettype="gb")
record = SeqIO.read(handle,"genbank")

We have had no problem with this code
 until this week when we started getting "ValueError: No records found in handle".
Anyone have an idea how to fix it now? Thanks!
Feng
?
--------------------------------------Ms. Feng Gao
Department of Biological Sciences
Smith College
Northampton, MA 01063
USA
&
Laboratory of Protozoology
Institute of Evolution and Marine Biodiversity
Ocean University of China
266003 Qingdao
China
E-mail: fenggao0907 at yahoo.com.cn
--------------------------------------

From p.j.a.cock at googlemail.com  Thu Feb 23 18:00:17 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 23 Feb 2012 23:00:17 +0000
Subject: [Biopython] Degenerated Codons
In-Reply-To: <CALNFT0gLSht47aWa3qpx_59G0O8_5cM5RN4ogTD3A0LA-oMn4A@mail.gmail.com>
References: <20120222150602.313750@gmx.net>
	<CAKVJ-_4Fj08FRVPYomxcjMiK3EuCxWQ=iRxKJU0dxPichHPcAw@mail.gmail.com>
	<CALNFT0hvM6V625MbTn6qVGNKXnmsTrFK_tr7fKcePb-Nz4kVqA@mail.gmail.com>
	<CAKVJ-_5SCWbEWiK56iifzKSkVoiKmexPfTqSFd+dmqi18HOCrQ@mail.gmail.com>
	<CALNFT0gLSht47aWa3qpx_59G0O8_5cM5RN4ogTD3A0LA-oMn4A@mail.gmail.com>
Message-ID: <CAKVJ-_7MtFS-rrvk2+LEjh+mMbLXx=Ko+Jsqn0FfinWZToBh1Q@mail.gmail.com>

On Thu, Feb 23, 2012 at 9:09 PM, Matthias Bernt <MatatTHC at gmx.de> wrote:
> hi peter,
>
> Thank you for the suggestions. I will try to create the functions as
> suggested.
> Should I post them here?

Sure - or on the wiki under a new 'Cookbook' entry?
http://biopython.org/wiki/Category:Cookbook

> I think we keep it as it is at the moment. Performance is not so important
> for me .. so far.
> Optimisation can still be done later.

Of course :)

Do you know the quote "premature optimization is the root of all evil"?

Peter

From p.j.a.cock at googlemail.com  Thu Feb 23 18:03:01 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 23 Feb 2012 23:03:01 +0000
Subject: [Biopython] Entrez and SeqIO "no records found in handle"
In-Reply-To: <1330032923.65491.YahooMailNeo@web15106.mail.cnb.yahoo.com>
References: <1330032923.65491.YahooMailNeo@web15106.mail.cnb.yahoo.com>
Message-ID: <CAKVJ-_4sX-Qp8ObXuvXrmyhX=KjbJ2vzky0kB1HPU5PczQapgQ@mail.gmail.com>

2012/2/23 ????(Feng GAO) <fenggao0907 at yahoo.com.cn>:
> Hi all,
> We have some python code using gi number to get record from Genbank.
> Part of the code is:
>
> handle = Entrez.efetch(db="protein", id=ID, rettype="gb")
> record = SeqIO.read(handle,"genbank")
>
> We have had no problem with this code
>  until this week when we started getting "ValueError: No records found in handle".
> Anyone have an idea how to fix it now? Thanks!
> Feng

Try using an explicit retmode="text" in the efetch call.
The NCBI changed the defaults with EFetch 2.0, which
went live earlier this month. You're probably getting
XML back instead.

Note to self: I wonder if the Biopython tutorial examples
need to be updated as well...

Peter


From p.j.a.cock at googlemail.com  Fri Feb 24 11:56:11 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 24 Feb 2012 16:56:11 +0000
Subject: [Biopython] Biopython 1.59 released
Message-ID: <CAKVJ-_6zJRpv4A2P_fF1Hbpog12dahbTzQmmjZf7L3NWZobGpQ@mail.gmail.com>

Dear Biopythoneers,

Biopython 1.59 is out:
http://news.open-bio.org/news/2012/02/biopython-1-59-released/

Thank you to everyone who has contributed.

Peter

P.S. We're on Twitter as @Biopython

From idoerg at gmail.com  Fri Feb 24 12:02:19 2012
From: idoerg at gmail.com (Iddo Friedberg)
Date: Fri, 24 Feb 2012 12:02:19 -0500
Subject: [Biopython] Biopython 1.59 released
In-Reply-To: <CAKVJ-_6zJRpv4A2P_fF1Hbpog12dahbTzQmmjZf7L3NWZobGpQ@mail.gmail.com>
References: <CAKVJ-_6zJRpv4A2P_fF1Hbpog12dahbTzQmmjZf7L3NWZobGpQ@mail.gmail.com>
Message-ID: <CABm4-MSrAOVG3DqEK8AT_A4w+OZFC4vNGgoR=eQCqkH2=M5mvQ@mail.gmail.com>

As an ex- (and hopefully future?) contributer and a strong cheerleader and
user: thanks Peter and all developers for all the hard work!

On Fri, Feb 24, 2012 at 11:56 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> Dear Biopythoneers,
>
> Biopython 1.59 is out:
> http://news.open-bio.org/news/2012/02/biopython-1-59-released/
>
> Thank you to everyone who has contributed.
>
> Peter
>
> P.S. We're on Twitter as @Biopython
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



-- 
Iddo Friedberg
http://iddo-friedberg.net/contact.html
++++++++++[>+++>++++++>++++++++>++++++++++>+++++++++++<<<<<-]>>>>++++.>
++++++..----.<<<<++++++++++++++++++++++++++++.-----------..>>>+.-----.
.>-.<<<<--.>>>++.>+++.<+++.----.-.<++++++++++++++++++.>+.>.<++.<<<+.>>
>>----.<--.>++++++.<<<<------------------------------------.

From idoerg at gmail.com  Fri Feb 24 12:24:41 2012
From: idoerg at gmail.com (Iddo Friedberg)
Date: Fri, 24 Feb 2012 12:24:41 -0500
Subject: [Biopython] Biopython 1.59 released
In-Reply-To: <CABm4-MSrAOVG3DqEK8AT_A4w+OZFC4vNGgoR=eQCqkH2=M5mvQ@mail.gmail.com>
References: <CAKVJ-_6zJRpv4A2P_fF1Hbpog12dahbTzQmmjZf7L3NWZobGpQ@mail.gmail.com>
	<CABm4-MSrAOVG3DqEK8AT_A4w+OZFC4vNGgoR=eQCqkH2=M5mvQ@mail.gmail.com>
Message-ID: <CABm4-MRz+N=arSi=BAZp0fi1AGOivDQ9J2tUAVpFtUyUzSByQA@mail.gmail.com>

As an ex- (and hopefully future?) contributer and a strong cheerleader and
user: thanks Peter and all developers for all the hard work!



> On Fri, Feb 24, 2012 at 11:56 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:
>
>> Dear Biopythoneers,
>>
>> Biopython 1.59 is out:
>> http://news.open-bio.org/news/2012/02/biopython-1-59-released/
>>
>> Thank you to everyone who has contributed.
>>
>> Peter
>>
>> P.S. We're on Twitter as @Biopython
>> _______________________________________________
>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biopython
>>
>
>
>
> --
> Iddo Friedberg
> http://iddo-friedberg.net/contact.html
> ++++++++++[>+++>++++++>++++++++>++++++++++>+++++++++++<<<<<-]>>>>++++.>
> ++++++..----.<<<<++++++++++++++++++++++++++++.-----------..>>>+.-----.
> .>-.<<<<--.>>>++.>+++.<+++.----.-.<++++++++++++++++++.>+.>.<++.<<<+.>>
> >>----.<--.>++++++.<<<<------------------------------------.
>
>



-- 
Iddo Friedberg
http://iddo-friedberg.net/contact.html
++++++++++[>+++>++++++>++++++++>++++++++++>+++++++++++<<<<<-]>>>>++++.>
++++++..----.<<<<++++++++++++++++++++++++++++.-----------..>>>+.-----.
.>-.<<<<--.>>>++.>+++.<+++.----.-.<++++++++++++++++++.>+.>.<++.<<<+.>>
>>----.<--.>++++++.<<<<------------------------------------.

From rbuels at gmail.com  Mon Feb 27 11:24:03 2012
From: rbuels at gmail.com (Robert Buels)
Date: Mon, 27 Feb 2012 11:24:03 -0500
Subject: [Biopython] Update: call for Google Summer of Code project ideas
Message-ID: <4F4BAE23.7070402@gmail.com>

Hi all,

As kindly pointed out by Reece Hart, the previous email I sent out 
calling for Google Summer of Code project ideas, had the wrong due date 
for project ideas in it.

I actually want them to all be in place by Friday, March 2, which is 
this coming Friday.

== Instructions for Wiki Editing ==

For each of the OBF projects that wants to do GSoC again this year, please:

a.) Update the list of project ideas on your project's GSoC page 
(BioPython, BioPerl, BioRuby, etc).  Add new ones, remove ones that have 
already been done or no longer relevant, etc.

b.) Update the list of project ideas on the main OBF GSoC page 
(http://www.open-bio.org/wiki/Google_Summer_of_Code) to match.

c.) Let me know via email that you have done so and it's ready for 
Google to peruse.

== end instructions ==

Again, please have the updates done by this Friday (March 2). The number 
and quality of the project ideas are part of the evaluation process for 
whether OBF is accepted as a Summer of Code organization again this 
year, so let's come up with some good ones.  :-)

Rob

----
Robert Buels
(prospective) 2012 OBF GSoC Organization Admin

From fedyukina at gmail.com  Mon Feb 27 16:00:11 2012
From: fedyukina at gmail.com (Daria Fedyukina)
Date: Mon, 27 Feb 2012 15:00:11 -0600
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
Message-ID: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>

Hello,

I am trying to install BioPython 1.58. My BioPython and python are both in the Applications folder.
My configuration is:
OS: Mac OS 10.7.3
Python: 2.7.2
Apple Xcode is installed.
NumPy is not installed (could not install for 2.7, only available for 2.6; decided to skip)

When I try to install it, I go to X11 -> go inside biopython-1.58 older -> type "python setup.py build" -> choose to proceed without NumPy -> get an error.

Here how it looks:
bash-3.2$ cd biopython-1.58
bash-3.2$ ls
Bio             DEPRECATED      MANIFEST.in     README          build
BioSQL          Doc             NEWS            Scripts         do2to3.py
CONTRIB         LICENSE         PKG-INFO        Tests           setup.py
bash-3.2$ python setup.py build
running build
running build_py

Numerical Python (NumPy) is not installed.

This package is required for many Biopython features.  Please install
it before you install Biopython. You can install Biopython anyway, but
anything dependent on NumPy will not work. If you do this, and later
install NumPy, you should then re-install Biopython.

You can find NumPy at http://numpy.scipy.org

Do you want to continue this installation? (y/N):
y
running build_ext
building 'Bio.cpairwise2' extension
gcc-4.2 -fno-strict-aliasing -fno-common -dynamic -isysroot /Developer/SDKs/MaSX10.6.sdk -arch i386 -arch x86_64 -g -O2 -DNDEBUG -g -O3 -IBio -I/Library/Fraworks/Python.framework/Versions/2.7/include/python2.7 -c Bio/cpairwise2module.-o build/temp.macosx-10.6-intel-2.7/Bio/cpairwise2module.o
In file included from /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/unicodeobject.h:4,
                 from /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/Python.h:85,
                 from Bio/cpairwise2module.c:12:
/Developer/SDKs/MacOSX10.6.sdk/usr/include/stdarg.h:4:25: error: stdarg.h: No ch file or directory
In file included from /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/unicodeobject.h:4,
                 from /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/Python.h:85,
                 from Bio/cpairwise2module.c:12:
/Developer/SDKs/MacOSX10.6.sdk/usr/include/stdarg.h:4:25: error: stdarg.h: No ch file or directory
lipo: can't figure out the architecture type of: /var/folders/nt/1ppm7j953zv2qylmtwydqm0000gn/T//ccODIZmY.out
error: command 'gcc-4.2' failed with exit status 1
bash-3.2$ 

I googled this error, it turned out that gcc-4.2 needs to be installed. I did. Then, the situation is exactly the same when I repeat biopython installation.

Does anyone know what could've happened? My only suspicion now is that Lion is messing stuff up. Looks like Snow Leopard works better.

Thank you very much for any help or advice!
-Daria

From idoerg at gmail.com  Mon Feb 27 16:27:31 2012
From: idoerg at gmail.com (Iddo Friedberg)
Date: Mon, 27 Feb 2012 16:27:31 -0500
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
Message-ID: <CABm4-MT_m8y-_wi_qC+V69u42Wywsz_1ox8GaZb_6zUJ+3aqXg@mail.gmail.com>

Daria,

Seems like there is a NumPy for Python 2.7 on Mac:

http://sourceforge.net/projects/numpy/files/NumPy/1.6.1/

In any case, you should not skip the NumPy installation. Even if for teh
combination of your OS and Python version there is only NumPy for Python
2.6, you should install that. There is very little difference between
Python 2.6 and 2.7, and NumPy should not break (and, in any case, seems
like your desired version is in the link above).

HTH,

Iddo

On Mon, Feb 27, 2012 at 4:00 PM, Daria Fedyukina <fedyukina at gmail.com>wrote:

> Hello,
>
> I am trying to install BioPython 1.58. My BioPython and python are both in
> the Applications folder.
> My configuration is:
> OS: Mac OS 10.7.3
> Python: 2.7.2
> Apple Xcode is installed.
> NumPy is not installed (could not install for 2.7, only available for 2.6;
> decided to skip)
>
> When I try to install it, I go to X11 -> go inside biopython-1.58 older ->
> type "python setup.py build" -> choose to proceed without NumPy -> get an
> error.
>
> Here how it looks:
> bash-3.2$ cd biopython-1.58
> bash-3.2$ ls
> Bio             DEPRECATED      MANIFEST.in     README          build
> BioSQL          Doc             NEWS            Scripts         do2to3.py
> CONTRIB         LICENSE         PKG-INFO        Tests           setup.py
> bash-3.2$ python setup.py build
> running build
> running build_py
>
> Numerical Python (NumPy) is not installed.
>
> This package is required for many Biopython features.  Please install
> it before you install Biopython. You can install Biopython anyway, but
> anything dependent on NumPy will not work. If you do this, and later
> install NumPy, you should then re-install Biopython.
>
> You can find NumPy at http://numpy.scipy.org
>
> Do you want to continue this installation? (y/N):
> y
> running build_ext
> building 'Bio.cpairwise2' extension
> gcc-4.2 -fno-strict-aliasing -fno-common -dynamic -isysroot
> /Developer/SDKs/MaSX10.6.sdk -arch i386 -arch x86_64 -g -O2 -DNDEBUG -g -O3
> -IBio -I/Library/Fraworks/Python.framework/Versions/2.7/include/python2.7
> -c Bio/cpairwise2module.-o
> build/temp.macosx-10.6-intel-2.7/Bio/cpairwise2module.o
> In file included from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/unicodeobject.h:4,
>                 from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/Python.h:85,
>                 from Bio/cpairwise2module.c:12:
> /Developer/SDKs/MacOSX10.6.sdk/usr/include/stdarg.h:4:25: error: stdarg.h:
> No ch file or directory
> In file included from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/unicodeobject.h:4,
>                 from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/Python.h:85,
>                 from Bio/cpairwise2module.c:12:
> /Developer/SDKs/MacOSX10.6.sdk/usr/include/stdarg.h:4:25: error: stdarg.h:
> No ch file or directory
> lipo: can't figure out the architecture type of:
> /var/folders/nt/1ppm7j953zv2qylmtwydqm0000gn/T//ccODIZmY.out
> error: command 'gcc-4.2' failed with exit status 1
> bash-3.2$
>
> I googled this error, it turned out that gcc-4.2 needs to be installed. I
> did. Then, the situation is exactly the same when I repeat biopython
> installation.
>
> Does anyone know what could've happened? My only suspicion now is that
> Lion is messing stuff up. Looks like Snow Leopard works better.
>
> Thank you very much for any help or advice!
> -Daria
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



-- 
Iddo Friedberg
http://iddo-friedberg.net/contact.html
++++++++++[>+++>++++++>++++++++>++++++++++>+++++++++++<<<<<-]>>>>++++.>
++++++..----.<<<<++++++++++++++++++++++++++++.-----------..>>>+.-----.
.>-.<<<<--.>>>++.>+++.<+++.----.-.<++++++++++++++++++.>+.>.<++.<<<+.>>
>>----.<--.>++++++.<<<<------------------------------------.

From idoerg at gmail.com  Mon Feb 27 17:37:01 2012
From: idoerg at gmail.com (Iddo Friedberg)
Date: Mon, 27 Feb 2012 17:37:01 -0500
Subject: [Biopython] Fwd: question on installation of BioPython on Mac OS
	10.7
In-Reply-To: <FDAF036A-1D11-43C8-B98B-F069FEB49DC1@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CABm4-MT_m8y-_wi_qC+V69u42Wywsz_1ox8GaZb_6zUJ+3aqXg@mail.gmail.com>
	<FDAF036A-1D11-43C8-B98B-F069FEB49DC1@gmail.com>
Message-ID: <CABm4-MRXaSt1YggAvkoaOgnEqS=oGxtWEx4bTPkRsdewYTmHUg@mail.gmail.com>

---------- Forwarded message ----------
From: Daria Fedyukina <fedyukina at gmail.com>
Date: Mon, Feb 27, 2012 at 5:15 PM
Subject: Re: [Biopython] question on installation of BioPython on Mac OS
10.7
To: Iddo Friedberg <idoerg at gmail.com>


Hi Iddo,

I have installed NumPy. Thank you very much for finding the right version
for me. I cannot understand how I missed it.

I thought I installed NumPy correctly: I double clicked on it, I agreed on
terms and conditions, I saw "installation is successful"
After that I did not see any new folder or package in my Applications
folder except previous numpy-1.6.1-py2.7-python.org-macosx10.3.dmg file.
I drag and dropped numpy-1.6.1-py2.7.mpkg file in Applications just in case.

I do not know what to do with this .mpkg file because if I double click on
it, it gives me hte same installation wizard as before, all steps are the
same, nothing chages.

I went to my X11 -> went inside biopython-1.58 older -> typed "python
setup.py build" -> it again asked me if I want to proceed without NumPy. It
did not see that I installed NumPy. It means I did not install it right.

I looked online, the instructions talk about some kind of binary here
http://docs.scipy.org/doc/numpy/user/install.html for Mac OS X, but it does
not look any different from what I have already done.

Would you be so kind as to provide some insight on what they want?
THank you again.

-Daria


P.S. I got Mac 3 months ago, I always thought that it is more convenient
for programming in general. Well..... It was easier to install biopython on
windows. This is a very interesting case.



On Feb 27, 2012, at 3:27 PM, Iddo Friedberg wrote:

Daria,

Seems like there is a NumPy for Python 2.7 on Mac:

http://sourceforge.net/projects/numpy/files/NumPy/1.6.1/

In any case, you should not skip the NumPy installation. Even if for teh
combination of your OS and Python version there is only NumPy for Python
2.6, you should install that. There is very little difference between
Python 2.6 and 2.7, and NumPy should not break (and, in any case, seems
like your desired version is in the link above).

HTH,

Iddo

On Mon, Feb 27, 2012 at 4:00 PM, Daria Fedyukina <fedyukina at gmail.com>wrote:

> Hello,
>
> I am trying to install BioPython 1.58. My BioPython and python are both in
> the Applications folder.
> My configuration is:
> OS: Mac OS 10.7.3
> Python: 2.7.2
> Apple Xcode is installed.
> NumPy is not installed (could not install for 2.7, only available for 2.6;
> decided to skip)
>
> When I try to install it, I go to X11 -> go inside biopython-1.58 older ->
> type "python setup.py build" -> choose to proceed without NumPy -> get an
> error.
>
> Here how it looks:
> bash-3.2$ cd biopython-1.58
> bash-3.2$ ls
> Bio             DEPRECATED      MANIFEST.in     README          build
> BioSQL          Doc             NEWS            Scripts         do2to3.py
> CONTRIB         LICENSE         PKG-INFO        Tests           setup.py
> bash-3.2$ python setup.py build
> running build
> running build_py
>
> Numerical Python (NumPy) is not installed.
>
> This package is required for many Biopython features.  Please install
> it before you install Biopython. You can install Biopython anyway, but
> anything dependent on NumPy will not work. If you do this, and later
> install NumPy, you should then re-install Biopython.
>
> You can find NumPy at http://numpy.scipy.org
>
> Do you want to continue this installation? (y/N):
> y
> running build_ext
> building 'Bio.cpairwise2' extension
> gcc-4.2 -fno-strict-aliasing -fno-common -dynamic -isysroot
> /Developer/SDKs/MaSX10.6.sdk -arch i386 -arch x86_64 -g -O2 -DNDEBUG -g -O3
> -IBio -I/Library/Fraworks/Python.framework/Versions/2.7/include/python2.7
> -c Bio/cpairwise2module.-o
> build/temp.macosx-10.6-intel-2.7/Bio/cpairwise2module.o
> In file included from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/unicodeobject.h:4,
>                 from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/Python.h:85,
>                 from Bio/cpairwise2module.c:12:
> /Developer/SDKs/MacOSX10.6.sdk/usr/include/stdarg.h:4:25: error: stdarg.h:
> No ch file or directory
> In file included from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/unicodeobject.h:4,
>                 from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/Python.h:85,
>                 from Bio/cpairwise2module.c:12:
> /Developer/SDKs/MacOSX10.6.sdk/usr/include/stdarg.h:4:25: error: stdarg.h:
> No ch file or directory
> lipo: can't figure out the architecture type of:
> /var/folders/nt/1ppm7j953zv2qylmtwydqm0000gn/T//ccODIZmY.out
> error: command 'gcc-4.2' failed with exit status 1
> bash-3.2$
>
> I googled this error, it turned out that gcc-4.2 needs to be installed. I
> did. Then, the situation is exactly the same when I repeat biopython
> installation.
>
> Does anyone know what could've happened? My only suspicion now is that
> Lion is messing stuff up. Looks like Snow Leopard works better.
>
> Thank you very much for any help or advice!
> -Daria
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



-- 
Iddo Friedberg
http://iddo-friedberg.net/contact.html
++++++++++[>+++>++++++>++++++++>++++++++++>+++++++++++<<<<<-]>>>>++++.>
++++++..----.<<<<++++++++++++++++++++++++++++.-----------..>>>+.-----.
.>-.<<<<--.>>>++.>+++.<+++.----.-.<++++++++++++++++++.>+.>.<++.<<<+.>>
>>----.<--.>++++++.<<<<------------------------------------.





-- 
Iddo Friedberg
http://iddo-friedberg.net/contact.html
++++++++++[>+++>++++++>++++++++>++++++++++>+++++++++++<<<<<-]>>>>++++.>
++++++..----.<<<<++++++++++++++++++++++++++++.-----------..>>>+.-----.
.>-.<<<<--.>>>++.>+++.<+++.----.-.<++++++++++++++++++.>+.>.<++.<<<+.>>
>>----.<--.>++++++.<<<<------------------------------------.

From p.j.a.cock at googlemail.com  Mon Feb 27 17:37:08 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 27 Feb 2012 22:37:08 +0000
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
Message-ID: <CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>

On Monday, February 27, 2012, Daria Fedyukina wrote:

> Hello,
>
> I am trying to install BioPython 1.58. My BioPython and python are both in
> the Applications folder.
> My configuration is:
> OS: Mac OS 10.7.3
> Python: 2.7.2
> Apple Xcode is installed.
> NumPy is not installed (could not install for 2.7, only available for 2.6;
> decided to skip)
>
>
What version of Xcode do you have, and were there any options when you
installed about SDK installation and command line tool installation? It
worked for me on one of my machines which has Mac OS X 10.7 Lion, but I am
not in front of it right now to check the details.

Peter

From schnoes at gmail.com  Mon Feb 27 17:50:36 2012
From: schnoes at gmail.com (Alexandra Schnoes)
Date: Mon, 27 Feb 2012 14:50:36 -0800
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
Message-ID: <CABZpzJdX6Y-o=7KHw+h1hVXSoVTZvbtX0BToQVO=2vemfDSQWA@mail.gmail.com>

Hi Daria,

It sounds like you might be new to Mac/OS 10... an easy way to ease into
that is to use a package manager (or if you're like me and just like to
keep everything organized with a manager and don't always feel like self
compiling). I have used a couple of different ones. I am currently using
MacPorts (http://www.macports.org/) and they keep very up to date (just
upgraded my biopython to 1.59 today). Fink (http://www.finkproject.org/)
and Homebrew (http://mxcl.github.com/homebrew/) are two other commonly
used/ well known managers.

Best,
Alex


On Mon, Feb 27, 2012 at 2:37 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Monday, February 27, 2012, Daria Fedyukina wrote:
>
> > Hello,
> >
> > I am trying to install BioPython 1.58. My BioPython and python are both
> in
> > the Applications folder.
> > My configuration is:
> > OS: Mac OS 10.7.3
> > Python: 2.7.2
> > Apple Xcode is installed.
> > NumPy is not installed (could not install for 2.7, only available for
> 2.6;
> > decided to skip)
> >
> >
> What version of Xcode do you have, and were there any options when you
> installed about SDK installation and command line tool installation? It
> worked for me on one of my machines which has Mac OS X 10.7 Lion, but I am
> not in front of it right now to check the details.
>
> Peter
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



-- 
Alexandra Schnoes, Ph.D.
Scientist, Babbitt Laboratory
Program Coordinator, Graduate Student Internships for Career Exploration
University of California San Francisco
Tel:  415-502-1248
Fax: 415-514-9656
Email: schnoes at gmail.com

From anna.kostikova at gmail.com  Tue Feb 28 08:28:50 2012
From: anna.kostikova at gmail.com (Anna Kostikova)
Date: Tue, 28 Feb 2012 14:28:50 +0100
Subject: [Biopython] Entrez.efetch issue with the returning data type
Message-ID: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>

Dear list,

Since today I've started to have an issue with Entrez.efetch utility,
and in particular with the rettype parameter. Essentially, the format
of the data returned when I specify
Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') does not
correspond anymore to a genbank datatype. Few days ago all was fine.
What is going on?

the script is:
from Bio import Entrez
Entrez.email = 'my.email at domain.com'

local_file=open("test.gb", 'w')
try:
        handle =
Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') #download
record with Entrez.efetch
        local_file.write(handle.read()) #write to a file
        handle.close()
except:
        print "Accsession id is not found"
local_file.close()

Thanks a lot for your ideas,
Anna

From p.j.a.cock at googlemail.com  Tue Feb 28 09:16:39 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 28 Feb 2012 14:16:39 +0000
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
Message-ID: <CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>

On Tue, Feb 28, 2012 at 1:28 PM, Anna Kostikova
<anna.kostikova at gmail.com> wrote:
> Dear list,
>
> Since today I've started to have an issue with Entrez.efetch utility,
> and in particular with the rettype parameter. Essentially, the format
> of the data returned when I specify
> Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') does not
> correspond anymore to a genbank datatype. Few days ago all was fine.
> What is going on?

The NCBI changed the defaults in mid Feb 2012 with the release of
EFetch v2.0 - you must now add retmode="text" to the Entrez fetch
call otherwise you'll probably get XML back. We mentioned this on
the release notes for Biopython 1.59, but I should probably add this
link as well:

http://www.ncbi.nlm.nih.gov/mailman/pipermail/utilities-announce/2012-February/000085.html

Peter

From Matej.Repic at ki.si  Tue Feb 28 09:12:31 2012
From: Matej.Repic at ki.si (=?iso-8859-2?Q?Matej_Repi=E8?=)
Date: Tue, 28 Feb 2012 14:12:31 +0000
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
Message-ID: <CB729F3F.3B03%matej.repic@ki.si>

For me the script works without a problem (Biopython 1.58, Python 2.6). On
the other hand, some things were changed on the Pubmed side this month, so
maybe it would work for you if you edit your script according to this
table:

http://www.ncbi.nlm.nih.gov/books/NBK25499/table/chapter4.chapter4_table1/?
report=objectonly

The full documentation on Efetch 2.0 is available at:
http://www.ncbi.nlm.nih.gov/books/NBK25499/#chapter4.Efetch



Regards,



----------------------------------------------------------
Matej Repi?
Junior Researcher

Laboratory for Biocomputing and Bioinformatics
National Institute of Chemistry
Hajdrihova 19
SI-1001 Ljubljana POB 660
Slovenia

tel: +386-1-4760457 <tel:%2B386-1-4760457>

e-mail: matej.repic at ki.si
----------------------------------------------------------






On 28.2.12 14:28, "Anna Kostikova" <anna.kostikova at gmail.com> wrote:

>Dear list,
>
>Since today I've started to have an issue with Entrez.efetch utility,
>and in particular with the rettype parameter. Essentially, the format
>of the data returned when I specify
>Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') does not
>correspond anymore to a genbank datatype. Few days ago all was fine.
>What is going on?
>
>the script is:
>from Bio import Entrez
>Entrez.email = 'my.email at domain.com'
>
>local_file=open("test.gb", 'w')
>try:
>        handle =
>Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') #download
>record with Entrez.efetch
>        local_file.write(handle.read()) #write to a file
>        handle.close()
>except:
>        print "Accsession id is not found"
>local_file.close()
>
>Thanks a lot for your ideas,
>Anna
>_______________________________________________
>Biopython mailing list  -  Biopython at lists.open-bio.org
>http://lists.open-bio.org/mailman/listinfo/biopython



From p.j.a.cock at googlemail.com  Tue Feb 28 09:35:03 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 28 Feb 2012 14:35:03 +0000
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
Message-ID: <CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>

On Mon, Feb 27, 2012 at 11:14 PM, Daria Fedyukina <fedyukina at gmail.com> wrote:
> Hi Peter,
>
> I have version 4.2.1 of Xcode.

I think that is what my Mac OS X 10.7 Lion machine has - not checked yet.

> I went to Macintosh HD-> Developer and I see SDKs and Tools folders. But the
> content of both is daunting. I have no idea what I can do with it, probably
> nothing. When I click on Xcode in my Dock, there is no command line, it
> looks like a piece of GUI software with, it reminds me Eclipse.

Xcode covers a *lot* of stuff, including a GUI for editing source code,
system library files for compiling code, and compilers themselves
(for C, C++, etc).

> The command line that I used before is called X11 and I found it in
> /Applications/Utilities/X11.
>
> I tried to figure out what the difference between X11 and Xcode (if any) and
> whether X11 was in Utilities prior Xcode installation. But I do not know the
> answers to these questions.

Normally I would use the Mac OS  X command line via the "Terminal"
application, also under  /Applications/Utilities, but getting to a command
line prompt via X11 instead should work.

Peter

From anna.kostikova at gmail.com  Tue Feb 28 10:15:33 2012
From: anna.kostikova at gmail.com (Anna Kostikova)
Date: Tue, 28 Feb 2012 16:15:33 +0100
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
Message-ID: <CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>

Dear Peter,

Thanks a lot for the prompt response. Yes, exactly, it was retmode="text" thing.
Thanks a lot again!

Anna

2012/2/28 Peter Cock <p.j.a.cock at googlemail.com>:
> On Tue, Feb 28, 2012 at 1:28 PM, Anna Kostikova
> <anna.kostikova at gmail.com> wrote:
>> Dear list,
>>
>> Since today I've started to have an issue with Entrez.efetch utility,
>> and in particular with the rettype parameter. Essentially, the format
>> of the data returned when I specify
>> Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') does not
>> correspond anymore to a genbank datatype. Few days ago all was fine.
>> What is going on?
>
> The NCBI changed the defaults in mid Feb 2012 with the release of
> EFetch v2.0 - you must now add retmode="text" to the Entrez fetch
> call otherwise you'll probably get XML back. We mentioned this on
> the release notes for Biopython 1.59, but I should probably add this
> link as well:
>
> http://www.ncbi.nlm.nih.gov/mailman/pipermail/utilities-announce/2012-February/000085.html
>
> Peter

From p.j.a.cock at googlemail.com  Tue Feb 28 12:18:28 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 28 Feb 2012 17:18:28 +0000
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
Message-ID: <CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>

On Tue, Feb 28, 2012 at 5:00 PM, Daria Fedyukina <fedyukina at gmail.com> wrote:
>
> Hi Peter,
>
> Thank you. I tried Terminal, it is indeed exactly the same.
> NumPy is not installed somehow. Here is my screenshot. Do you have any
> suggestions on how to install NumPy in such a way that this installation is
> seen when I do "python setup.py build" in the terminal?
>
> -Daria

Hi Daria,

Personally I use Apple's provided Python, which from memory
comes with a (slightly out of date) copy of NumPy. A more detailed
reply will have to wait until I'm at my Mac OS X 10.7 "Lion" machine.

If anyone else online right now has Biopython installed and working
on Mac OS X 10.7 "Lion" and can help now, please speak up.

One important question could be was this a clean install of Lion,
or an update from Snow Leopard?

I'm a little confused now even with the screenshots. It looks
like you have download python-2.7.2-macosx10.6.dmg and
numpy-1.6.1-py2.7-python.org-macosx10.3.dmg which should
work fine together BUT you will have two copies of Python (the
Apple provided Python, and Python.org's Python) and it can be
confusing about which is in use and which has a given library
installed

Peter

From fedyukina at gmail.com  Tue Feb 28 12:22:50 2012
From: fedyukina at gmail.com (Daria Fedyukina)
Date: Tue, 28 Feb 2012 11:22:50 -0600
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
Message-ID: <6A4268ED-0E86-49B2-87C9-D5095EDE5654@gmail.com>

Hi all,

Answering Peter's question: I got a new laptop with Lion already installed.

-Daria


On Feb 28, 2012, at 11:18 AM, Peter Cock wrote:

> On Tue, Feb 28, 2012 at 5:00 PM, Daria Fedyukina <fedyukina at gmail.com> wrote:
>> 
>> Hi Peter,
>> 
>> Thank you. I tried Terminal, it is indeed exactly the same.
>> NumPy is not installed somehow. Here is my screenshot. Do you have any
>> suggestions on how to install NumPy in such a way that this installation is
>> seen when I do "python setup.py build" in the terminal?
>> 
>> -Daria
> 
> Hi Daria,
> 
> Personally I use Apple's provided Python, which from memory
> comes with a (slightly out of date) copy of NumPy. A more detailed
> reply will have to wait until I'm at my Mac OS X 10.7 "Lion" machine.
> 
> If anyone else online right now has Biopython installed and working
> on Mac OS X 10.7 "Lion" and can help now, please speak up.
> 
> One important question could be was this a clean install of Lion,
> or an update from Snow Leopard?
> 
> I'm a little confused now even with the screenshots. It looks
> like you have download python-2.7.2-macosx10.6.dmg and
> numpy-1.6.1-py2.7-python.org-macosx10.3.dmg which should
> work fine together BUT you will have two copies of Python (the
> Apple provided Python, and Python.org's Python) and it can be
> confusing about which is in use and which has a given library
> installed
> 
> Peter



From anaryin at gmail.com  Tue Feb 28 12:23:49 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 28 Feb 2012 18:23:49 +0100
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
Message-ID: <CAJ9sUYPXsxtEvToiuZKfjK-=umAqVJ_Vj=5nTt05MhMXAbUTRw@mail.gmail.com>

Hi Daria,

Which Python architecture did you install? 32 bits or 64?

This thread in SO solves a similar problem:
http://stackoverflow.com/questions/6839795/cant-figure-out-the-architecture-type-of-problem-when-compiling-python

Maybe it solves yours?

Cheers,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



No dia 28 de Fevereiro de 2012 18:18, Peter Cock
<p.j.a.cock at googlemail.com>escreveu:

> On Tue, Feb 28, 2012 at 5:00 PM, Daria Fedyukina <fedyukina at gmail.com>
> wrote:
> >
> > Hi Peter,
> >
> > Thank you. I tried Terminal, it is indeed exactly the same.
> > NumPy is not installed somehow. Here is my screenshot. Do you have any
> > suggestions on how to install NumPy in such a way that this installation
> is
> > seen when I do "python setup.py build" in the terminal?
> >
> > -Daria
>
> Hi Daria,
>
> Personally I use Apple's provided Python, which from memory
> comes with a (slightly out of date) copy of NumPy. A more detailed
> reply will have to wait until I'm at my Mac OS X 10.7 "Lion" machine.
>
> If anyone else online right now has Biopython installed and working
> on Mac OS X 10.7 "Lion" and can help now, please speak up.
>
> One important question could be was this a clean install of Lion,
> or an update from Snow Leopard?
>
> I'm a little confused now even with the screenshots. It looks
> like you have download python-2.7.2-macosx10.6.dmg and
> numpy-1.6.1-py2.7-python.org-macosx10.3.dmg which should
> work fine together BUT you will have two copies of Python (the
> Apple provided Python, and Python.org's Python) and it can be
> confusing about which is in use and which has a given library
> installed
>
> Peter
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From fedyukina at gmail.com  Tue Feb 28 12:28:29 2012
From: fedyukina at gmail.com (Daria Fedyukina)
Date: Tue, 28 Feb 2012 11:28:29 -0600
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <CAJ9sUYPXsxtEvToiuZKfjK-=umAqVJ_Vj=5nTt05MhMXAbUTRw@mail.gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
	<CAJ9sUYPXsxtEvToiuZKfjK-=umAqVJ_Vj=5nTt05MhMXAbUTRw@mail.gmail.com>
Message-ID: <8CC22492-718A-451D-A8B5-D216E0A37932@gmail.com>

I downloaded and installed this one:
Python 2.7.2 Mac OS X 64-bit/32-bit x86-64/i386 Installer
because on the web site it says that this version is for 10.6 and 10.7

But it did not help me to avoid the problem. 
Also my exit status is 1, and here it is 255. Do these numbers tell me anything useful?
I could not locate definite answer by googling.
 
On Feb 28, 2012, at 11:23 AM, Jo?o Rodrigues wrote:

> Hi Daria,
> 
> Which Python architecture did you install? 32 bits or 64?
> 
> This thread in SO solves a similar problem: http://stackoverflow.com/questions/6839795/cant-figure-out-the-architecture-type-of-problem-when-compiling-python
> 
> Maybe it solves yours?
> 
> Cheers,
> 
> Jo?o [...] Rodrigues
> http://nmr.chem.uu.nl/~joao
> 
> 
> 
> No dia 28 de Fevereiro de 2012 18:18, Peter Cock <p.j.a.cock at googlemail.com> escreveu:
> On Tue, Feb 28, 2012 at 5:00 PM, Daria Fedyukina <fedyukina at gmail.com> wrote:
> >
> > Hi Peter,
> >
> > Thank you. I tried Terminal, it is indeed exactly the same.
> > NumPy is not installed somehow. Here is my screenshot. Do you have any
> > suggestions on how to install NumPy in such a way that this installation is
> > seen when I do "python setup.py build" in the terminal?
> >
> > -Daria
> 
> Hi Daria,
> 
> Personally I use Apple's provided Python, which from memory
> comes with a (slightly out of date) copy of NumPy. A more detailed
> reply will have to wait until I'm at my Mac OS X 10.7 "Lion" machine.
> 
> If anyone else online right now has Biopython installed and working
> on Mac OS X 10.7 "Lion" and can help now, please speak up.
> 
> One important question could be was this a clean install of Lion,
> or an update from Snow Leopard?
> 
> I'm a little confused now even with the screenshots. It looks
> like you have download python-2.7.2-macosx10.6.dmg and
> numpy-1.6.1-py2.7-python.org-macosx10.3.dmg which should
> work fine together BUT you will have two copies of Python (the
> Apple provided Python, and Python.org's Python) and it can be
> confusing about which is in use and which has a given library
> installed
> 
> Peter
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
> 



From p.j.a.cock at googlemail.com  Tue Feb 28 13:46:15 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 28 Feb 2012 18:46:15 +0000
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <8CC22492-718A-451D-A8B5-D216E0A37932@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
	<CAJ9sUYPXsxtEvToiuZKfjK-=umAqVJ_Vj=5nTt05MhMXAbUTRw@mail.gmail.com>
	<8CC22492-718A-451D-A8B5-D216E0A37932@gmail.com>
Message-ID: <CAKVJ-_703r5A1Yari8FaRkK5LwOAf-EO=4sRxy+VavByaxzDxA@mail.gmail.com>

On my Lion laptop, Apple provides Python 2.6.7 and 2.7.1

$ which python2.6
/usr/bin/python2.6
$ which python2.7
/usr/bin/python2.7
$ which python
/usr/bin/python

The default on my machine is Python 2.7, and both this and
Python 2.6 have NumPy 1.5.1 installed - however I'm not 100%
if I installed this (and if so how), or if it came on the machine:

$ python
Python 2.7.1 (r271:86832, Jun 25 2011, 05:09:01)
[GCC 4.2.1 (Based on Apple Inc. build 5658) (LLVM build 2335.15.00)] on darwin
Type "help", "copyright", "credits" or "license" for more information.
>>> import numpy
>>> numpy.__version__
'1.5.1'
>>> quit()

$ python2.6
Python 2.6.7 (r267:88850, Jul 31 2011, 19:30:54)
[GCC 4.2.1 (Based on Apple Inc. build 5658) (LLVM build 2335.15.00)] on darwin
Type "help", "copyright", "credits" or "license" for more information.
>>> import numpy
>>> numpy.__version__
'1.5.1'
>>> quit()

That probably doesn't help much :(

Peter

From anaryin at gmail.com  Tue Feb 28 14:29:45 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 28 Feb 2012 20:29:45 +0100
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <CAKVJ-_703r5A1Yari8FaRkK5LwOAf-EO=4sRxy+VavByaxzDxA@mail.gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
	<CAJ9sUYPXsxtEvToiuZKfjK-=umAqVJ_Vj=5nTt05MhMXAbUTRw@mail.gmail.com>
	<8CC22492-718A-451D-A8B5-D216E0A37932@gmail.com>
	<CAKVJ-_703r5A1Yari8FaRkK5LwOAf-EO=4sRxy+VavByaxzDxA@mail.gmail.com>
Message-ID: <CAJ9sUYP86h+yEW6G4GWsmUmHcSM=QqcPowY53n=C49GF-6ApRQ@mail.gmail.com>

I googled a bit and likely you have architecture mismatches everywhere..
The numpy error is clearly from that as 1) I've seen it before and 2) so did
someone else<http://www.voidspace.org.uk/python/weblog/arch_d7_2011_09_03.shtml>
.

Therefore, I would try to compile Numpy from source in your computer and
then install biopython. I'm guessing that these might help a bit.

Also, from your traceback, which XCode did you install? It says 10.6 in a
few places but Lion should be 10.7. Dunno if this might cause some
mismatches when compiling stuff..

From Jared.Sampson at nyumc.org  Tue Feb 28 16:05:10 2012
From: Jared.Sampson at nyumc.org (Sampson, Jared)
Date: Tue, 28 Feb 2012 16:05:10 -0500
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
Message-ID: <AD66BC02-B699-41B7-84F4-AA8ADC3C4144@nyumc.org>

Hi Daria et al. -

What about using pip<http://www.pip-installer.org/en/latest/index.html> or easy_install?

I'm running a Mac with Lion and I had no problem installing Biopython via:

    sudo pip install numpy
    sudo pip install biopython

I got a "you need numpy first" warning when I tried installing biopython alone, but running the commands above worked just fine to install numpy first, then Bio. It may be useful to note I've done this mainly within a virtualenv<http://www.virtualenv.org/en/latest/index.html>, but I think it should work using the system Python as well.

Jared


--
Jared Sampson
Xiangpeng Kong Lab
NYU Langone Medical Center
550 First Ave MSB 329/398
New York, NY 10016
212-263-7898
http://kong.med.nyu.edu/

On Feb 28, 2012, at 12:18 PM, Peter Cock wrote:

On Tue, Feb 28, 2012 at 5:00 PM, Daria Fedyukina <fedyukina at gmail.com<mailto:fedyukina at gmail.com>> wrote:

Hi Peter,

Thank you. I tried Terminal, it is indeed exactly the same.
NumPy is not installed somehow. Here is my screenshot. Do you have any
suggestions on how to install NumPy in such a way that this installation is
seen when I do "python setup.py build" in the terminal?

-Daria

Hi Daria,

Personally I use Apple's provided Python, which from memory
comes with a (slightly out of date) copy of NumPy. A more detailed
reply will have to wait until I'm at my Mac OS X 10.7 "Lion" machine.

If anyone else online right now has Biopython installed and working
on Mac OS X 10.7 "Lion" and can help now, please speak up.

One important question could be was this a clean install of Lion,
or an update from Snow Leopard?

I'm a little confused now even with the screenshots. It looks
like you have download python-2.7.2-macosx10.6.dmg and
numpy-1.6.1-py2.7-python.org-macosx10.3.dmg which should
work fine together BUT you will have two copies of Python (the
Apple provided Python, and Python.org<http://Python.org>'s Python) and it can be
confusing about which is in use and which has a given library
installed

Peter
_______________________________________________
Biopython mailing list  -  Biopython at lists.open-bio.org<mailto:Biopython at lists.open-bio.org>
http://lists.open-bio.org/mailman/listinfo/biopython


------------------------------------------------------------
This email message, including any attachments, is for the sole use of the intended recipient(s) and may contain information that is proprietary, confidential, and exempt from disclosure under applicable law. Any unauthorized review, use, disclosure, or distribution is prohibited. If you have received this email in error please notify the sender by return email and delete the original message. Please note, the recipient should check this email and any attachments for the presence of viruses. The organization accepts no liability for any damage caused by any virus transmitted by this email.
=================================


From karolisr at gmail.com  Tue Feb 28 23:01:30 2012
From: karolisr at gmail.com (Karolis Ramanauskas)
Date: Tue, 28 Feb 2012 22:01:30 -0600
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
	<CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
Message-ID: <CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>

Good day,

I think it would be a good idea to not rely on the NCBI defaults in
Biopython and hardcode retmode and other defaults directly into the
Biopython methods. Basically having defaults that Biopython
guarantees. That way the defaults will not change haphazardly when
NCBI decides to change things. Of course users will still be able to
set their own parameters if they do not use default behavior, but this
would reduce unexpected changes and the need to go over long stretches
of code and change things.

Karolis

On Tue, Feb 28, 2012 at 09:15, Anna Kostikova <anna.kostikova at gmail.com> wrote:
> Dear Peter,
>
> Thanks a lot for the prompt response. Yes, exactly, it was retmode="text" thing.
> Thanks a lot again!
>
> Anna
>
> 2012/2/28 Peter Cock <p.j.a.cock at googlemail.com>:
>> On Tue, Feb 28, 2012 at 1:28 PM, Anna Kostikova
>> <anna.kostikova at gmail.com> wrote:
>>> Dear list,
>>>
>>> Since today I've started to have an issue with Entrez.efetch utility,
>>> and in particular with the rettype parameter. Essentially, the format
>>> of the data returned when I specify
>>> Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') does not
>>> correspond anymore to a genbank datatype. Few days ago all was fine.
>>> What is going on?
>>
>> The NCBI changed the defaults in mid Feb 2012 with the release of
>> EFetch v2.0 - you must now add retmode="text" to the Entrez fetch
>> call otherwise you'll probably get XML back. We mentioned this on
>> the release notes for Biopython 1.59, but I should probably add this
>> link as well:
>>
>> http://www.ncbi.nlm.nih.gov/mailman/pipermail/utilities-announce/2012-February/000085.html
>>
>> Peter
> _______________________________________________
> Biopython mailing list ?- ?Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython


From p.j.a.cock at googlemail.com  Wed Feb 29 05:28:03 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 29 Feb 2012 10:28:03 +0000
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
	<CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
	<CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>
Message-ID: <CAKVJ-_6p5GOmEho5sPxNaCTZ+pu3=gCJaVFOcXEiKzRXsw3=0g@mail.gmail.com>

On Wed, Feb 29, 2012 at 4:01 AM, Karolis Ramanauskas <karolisr at gmail.com> wrote:
> Good day,
>
> I think it would be a good idea to not rely on the NCBI defaults in
> Biopython and hardcode retmode and other defaults directly into the
> Biopython methods. Basically having defaults that Biopython
> guarantees. That way the defaults will not change haphazardly when
> NCBI decides to change things. Of course users will still be able to
> set their own parameters if they do not use default behavior, but this
> would reduce unexpected changes and the need to go over long stretches
> of code and change things.
>
> Karolis

Hi Karolis,

That has downsides too - take the NCBI QBLAST API for calling an
online BLAST search at the NCBI. Biopython has default values
which (I presume) once matched the NCBI, but the NCBI has changed
things. As a result, the defaults have diverged and we often see user
queries about why their BLAST results via Biopython are different.

You could write to the NCBI Entrez team and urge them to consider
backwards compatibility more strongly.

Peter

P.S. I've added an FAQ entry about EFetch defaults to the tutorial:
https://github.com/biopython/biopython/commit/2a2ef7ab7b5a9c3ed3891922df7e2d47e2701faf

From karolisr at gmail.com  Wed Feb 29 08:57:22 2012
From: karolisr at gmail.com (Karolis Ramanauskas)
Date: Wed, 29 Feb 2012 07:57:22 -0600
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CAKVJ-_6p5GOmEho5sPxNaCTZ+pu3=gCJaVFOcXEiKzRXsw3=0g@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
	<CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
	<CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>
	<CAKVJ-_6p5GOmEho5sPxNaCTZ+pu3=gCJaVFOcXEiKzRXsw3=0g@mail.gmail.com>
Message-ID: <CACT_pJGW+0ngh7fvh9s9kSzEomda0ZiKEyb80hhb_vR2rArqsw@mail.gmail.com>

I see, you can never make everyone happy. Thanks.

On Wed, Feb 29, 2012 at 04:28, Peter Cock <p.j.a.cock at googlemail.com> wrote:
> On Wed, Feb 29, 2012 at 4:01 AM, Karolis Ramanauskas <karolisr at gmail.com> wrote:
>> Good day,
>>
>> I think it would be a good idea to not rely on the NCBI defaults in
>> Biopython and hardcode retmode and other defaults directly into the
>> Biopython methods. Basically having defaults that Biopython
>> guarantees. That way the defaults will not change haphazardly when
>> NCBI decides to change things. Of course users will still be able to
>> set their own parameters if they do not use default behavior, but this
>> would reduce unexpected changes and the need to go over long stretches
>> of code and change things.
>>
>> Karolis
>
> Hi Karolis,
>
> That has downsides too - take the NCBI QBLAST API for calling an
> online BLAST search at the NCBI. Biopython has default values
> which (I presume) once matched the NCBI, but the NCBI has changed
> things. As a result, the defaults have diverged and we often see user
> queries about why their BLAST results via Biopython are different.
>
> You could write to the NCBI Entrez team and urge them to consider
> backwards compatibility more strongly.
>
> Peter
>
> P.S. I've added an FAQ entry about EFetch defaults to the tutorial:
> https://github.com/biopython/biopython/commit/2a2ef7ab7b5a9c3ed3891922df7e2d47e2701faf

From p.j.a.cock at googlemail.com  Wed Feb 29 12:34:56 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 29 Feb 2012 17:34:56 +0000
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CACT_pJGW+0ngh7fvh9s9kSzEomda0ZiKEyb80hhb_vR2rArqsw@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
	<CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
	<CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>
	<CAKVJ-_6p5GOmEho5sPxNaCTZ+pu3=gCJaVFOcXEiKzRXsw3=0g@mail.gmail.com>
	<CACT_pJGW+0ngh7fvh9s9kSzEomda0ZiKEyb80hhb_vR2rArqsw@mail.gmail.com>
Message-ID: <CAKVJ-_52bJ9CjcnQKVLPdi3P7eJwPP91p49GQH9KH9Wm9zCzRw@mail.gmail.com>

On Wed, Feb 29, 2012 at 1:57 PM, Karolis Ramanauskas <karolisr at gmail.com> wrote:
> I see, you can never make everyone happy. Thanks.

Sadly true of many things in life.

However, in this particular case, encouraging people to be
explicit and provide their desired EFetch retmode/rettype is
not only a practical solution, but also very Pythonic:

Zen Of Python: Explicit is better than implicit.
http://www.python.org/dev/peps/pep-0020/

Peter

From karolisr at gmail.com  Wed Feb 29 12:40:39 2012
From: karolisr at gmail.com (Karolis Ramanauskas)
Date: Wed, 29 Feb 2012 11:40:39 -0600
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CAKVJ-_52bJ9CjcnQKVLPdi3P7eJwPP91p49GQH9KH9Wm9zCzRw@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
	<CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
	<CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>
	<CAKVJ-_6p5GOmEho5sPxNaCTZ+pu3=gCJaVFOcXEiKzRXsw3=0g@mail.gmail.com>
	<CACT_pJGW+0ngh7fvh9s9kSzEomda0ZiKEyb80hhb_vR2rArqsw@mail.gmail.com>
	<CAKVJ-_52bJ9CjcnQKVLPdi3P7eJwPP91p49GQH9KH9Wm9zCzRw@mail.gmail.com>
Message-ID: <CACT_pJF=05TXVqLo5eQFQ10HO-+0r1kMNNZxv3TBgvrO7d_8Gg@mail.gmail.com>

I agree, reading their code after a few weeks of writing it, most people
would not remember what implicit settings they relied on.

On Feb 29, 2012 11:34 AM, "Peter Cock" <p.j.a.cock at googlemail.com> wrote:
>
> On Wed, Feb 29, 2012 at 1:57 PM, Karolis Ramanauskas <karolisr at gmail.com>
wrote:
> > I see, you can never make everyone happy. Thanks.
>
> Sadly true of many things in life.
>
> However, in this particular case, encouraging people to be
> explicit and provide their desired EFetch retmode/rettype is
> not only a practical solution, but also very Pythonic:
>
> Zen Of Python: Explicit is better than implicit.
> http://www.python.org/dev/peps/pep-0020/
>
> Peter

From p.j.a.cock at googlemail.com  Wed Feb 29 12:45:14 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 29 Feb 2012 17:45:14 +0000
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CACT_pJF=05TXVqLo5eQFQ10HO-+0r1kMNNZxv3TBgvrO7d_8Gg@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
	<CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
	<CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>
	<CAKVJ-_6p5GOmEho5sPxNaCTZ+pu3=gCJaVFOcXEiKzRXsw3=0g@mail.gmail.com>
	<CACT_pJGW+0ngh7fvh9s9kSzEomda0ZiKEyb80hhb_vR2rArqsw@mail.gmail.com>
	<CAKVJ-_52bJ9CjcnQKVLPdi3P7eJwPP91p49GQH9KH9Wm9zCzRw@mail.gmail.com>
	<CACT_pJF=05TXVqLo5eQFQ10HO-+0r1kMNNZxv3TBgvrO7d_8Gg@mail.gmail.com>
Message-ID: <CAKVJ-_4Or_jQrzmLLWK-Q-xnkg5G2eNxCnHFEFg9ye0a9AjHeQ@mail.gmail.com>

On Wed, Feb 29, 2012 at 5:40 PM, Karolis wrote:
> On Feb 29, 2012 11:34 AM, Peter wrote:
>> On Wed, Feb 29, 2012 at 1:57 PM, Karolis wrote
>> > I see, you can never make everyone happy. Thanks.
>>
>> Sadly true of many things in life.
>>
>> However, in this particular case, encouraging people to be
>> explicit and provide their desired EFetch retmode/rettype is
>> not only a practical solution, but also very Pythonic:
>>
>> Zen Of Python: Explicit is better than implicit.
>> http://www.python.org/dev/peps/pep-0020/
>>
>> Peter
>
> I agree, reading their code after a few weeks of writing it, most people
> would not remember what implicit settings they relied on.

I suppose we could add a warning if the retmode or rettype is not
set explicitly. Maybe we should have done it for Biopython 1.59?
It would have got people's attention and given them a big clue
about how their EFetch script might have been broken by the
recent NCBI change.

Peter

From Jared.Sampson at nyumc.org  Wed Feb 29 15:56:53 2012
From: Jared.Sampson at nyumc.org (Sampson, Jared)
Date: Wed, 29 Feb 2012 15:56:53 -0500
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <B909698A-91D1-4269-B81B-6BE4A0C2D61D@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
	<AD66BC02-B699-41B7-84F4-AA8ADC3C4144@nyumc.org>
	<B909698A-91D1-4269-B81B-6BE4A0C2D61D@gmail.com>
Message-ID: <78E520BD-F3A5-49D4-B83C-60170FC4AE16@nyumc.org>

Hi Daria -

If the output of typing:

    which easy_install

in a terminal window gives a path, then you have easy_install on your machine already. So you could just type:

    sudo easy_install pip

When that finishes, run the commands from before to install numpy and biopython.

Pip and easy_install are both Python package managers, and the choice of one over the other is largely a matter of preference.  So if you'd rather not install pip, you could replace "pip install" with "easy_install" in those previous commands.

If that doesn't work (i.e. you don't have easy_install either), you can install pip or setuptools (which includes easy_install) by following the instructions on this website<http://www.pip-installer.org/en/latest/index.html> I gave the link to before, under 'installation instructions.'

Hope that helps,

Jared

--
Jared Sampson
Xiangpeng Kong Lab
NYU Langone Medical Center
550 First Ave MSB 329/398
New York, NY 10016
212-263-7898
http://kong.med.nyu.edu/

On Feb 29, 2012, at 12:30 PM, Daria Fedyukina wrote:

Thank you Jared,

I tried to use these commands but it does not know what "pip" is.
I used with no "pip", but it did not help.

I will keep searching for the cure :)

-Daria


On Feb 28, 2012, at 3:05 PM, Sampson, Jared wrote:

Hi Daria et al. -

What about using pip<http://www.pip-installer.org/en/latest/index.html> or easy_install?

I'm running a Mac with Lion and I had no problem installing Biopython via:

    sudo pip install numpy
    sudo pip install biopython

I got a "you need numpy first" warning when I tried installing biopython alone, but running the commands above worked just fine to install numpy first, then Bio. It may be useful to note I've done this mainly within a virtualenv<http://www.virtualenv.org/en/latest/index.html>, but I think it should work using the system Python as well.

Jared


--
Jared Sampson
Xiangpeng Kong Lab
NYU Langone Medical Center
550 First Ave MSB 329/398
New York, NY 10016
212-263-7898
http://kong.med.nyu.edu/

On Feb 28, 2012, at 12:18 PM, Peter Cock wrote:

On Tue, Feb 28, 2012 at 5:00 PM, Daria Fedyukina <fedyukina at gmail.com<mailto:fedyukina at gmail.com>> wrote:

Hi Peter,

Thank you. I tried Terminal, it is indeed exactly the same.
NumPy is not installed somehow. Here is my screenshot. Do you have any
suggestions on how to install NumPy in such a way that this installation is
seen when I do "python setup.py build" in the terminal?

-Daria

Hi Daria,

Personally I use Apple's provided Python, which from memory
comes with a (slightly out of date) copy of NumPy. A more detailed
reply will have to wait until I'm at my Mac OS X 10.7 "Lion" machine.

If anyone else online right now has Biopython installed and working
on Mac OS X 10.7 "Lion" and can help now, please speak up.

One important question could be was this a clean install of Lion,
or an update from Snow Leopard?

I'm a little confused now even with the screenshots. It looks
like you have download python-2.7.2-macosx10.6.dmg and
numpy-1.6.1-py2.7-python.org-macosx10.3.dmg which should
work fine together BUT you will have two copies of Python (the
Apple provided Python, and Python.org<http://Python.org/>'s Python) and it can be
confusing about which is in use and which has a given library
installed

Peter
_______________________________________________
Biopython mailing list  -  Biopython at lists.open-bio.org<mailto:Biopython at lists.open-bio.org>
http://lists.open-bio.org/mailman/listinfo/biopython


------------------------------------------------------------
This email message, including any attachments, is for the sole use of the intended recipient(s) and may contain information that is proprietary, confidential, and exempt from disclosure under applicable law. Any unauthorized review, use, disclosure, or distribution is prohibited. If you have received this email in error please notify the sender by return email and delete the original message. Please note, the recipient should check this email and any attachments for the presence of viruses. The organization accepts no liability for any damage caused by any virus transmitted by this email.
=================================



------------------------------------------------------------
This email message, including any attachments, is for the sole use of the intended recipient(s) and may contain information that is proprietary, confidential, and exempt from disclosure under applicable law. Any unauthorized review, use, disclosure, or distribution is prohibited. If you have received this email in error please notify the sender by return email and delete the original message. Please note, the recipient should check this email and any attachments for the presence of viruses. The organization accepts no liability for any damage caused by any virus transmitted by this email.
=================================


From mictadlo at gmail.com  Wed Feb 29 20:40:02 2012
From: mictadlo at gmail.com (Mic)
Date: Thu, 1 Mar 2012 11:40:02 +1000
Subject: [Biopython] samtools does not return correct exit code
Message-ID: <CAOP6n=iGRh5=vrxot_5RoBHDQbffDJiQo9jj_G-tC8P6PAuETg@mail.gmail.com>

Hallo,
Samtools does not return correct the exit code:

import subprocess
import logging
import sys

def run_cmd(args):
        if subprocess.call(args,shell=True) != 0:
                print 'hello'
                logging.error("Error copying sequence file args='%s'" %
str(args))
                return 1
        print 'e', sys.stderr
        print 'o', sys.stdout
        return 0


def runSamtools( cmd ):
    '''run a samtools command'''

    try:
        retcode = subprocess.call(cmd, shell=True)
        print retcode
        if retcode < 0:
            print >>sys.stderr, "Child was terminated by signal", -retcode
    except OSError, e:
        print >>sys.stderr, "Execution failed:", e

print run_cmd("samtools faidx ex1.fa")
print runSamtools("samtools faidx ex1.fa")

print 'Hello still alive'


and as output I got:

$ python p3.py
open: No such file or directory
[_razf_open] fail to open ex1.fa
[fai_build] fail to open the FASTA file ex1.fa
e <open file '<stderr>', mode 'w' at 0x7ffa4658d270>
o <open file '<stdout>', mode 'w' at 0x7ffa4658d1e0>
0
open: No such file or directory
[_razf_open] fail to open ex1.fa
[fai_build] fail to open the FASTA file ex1.fa
0
None
Hello still alive

How can I get sure that all samtools commands were executed successfully?

Thank you in advance.

From p.j.a.cock at googlemail.com  Wed Feb  1 17:22:18 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 1 Feb 2012 17:22:18 +0000
Subject: [Biopython] regarding retrieving antigen information of
 specific gene using Biopython
In-Reply-To: <CAMGxMGtwDkZfHzVVn2_RPotJ8XTrwe5UEiTyypd3uQ16DxE88w@mail.gmail.com>
References: <CAMGxMGtwDkZfHzVVn2_RPotJ8XTrwe5UEiTyypd3uQ16DxE88w@mail.gmail.com>
Message-ID: <CAKVJ-_5cE-GBb4BFEY=dxkOS3eQ3+L_Omn4nT+CGrKtrNSAzYA@mail.gmail.com>

On Tue, Jan 31, 2012 at 7:00 AM, shweta dubey <sweta.dubey31 at gmail.com> wrote:
> hello everyone,
>
> I am new to Biopython.I have a set of genes and i want information of
> antigens specific to these genes from a database(suppose, Antigen
> Database).
>
> How can i do the same using Biopython??
>
> Thanks in advance
>
> Shweta Dubey

Hi,

Which antigen database are you trying to use? If it is one of the
NCBI ones you can probably use their Entrez API via Biopython.

Peter


From bpkth2012 at gmail.com  Thu Feb  2 15:45:17 2012
From: bpkth2012 at gmail.com (Sarttu Bourvir)
Date: Thu, 2 Feb 2012 16:45:17 +0100
Subject: [Biopython] parsing Blast results (xml)
Message-ID: <CACvaKy1oK8upTa096h3PHE1ovqZgAfFD_7YHRV2fVWj9NbaUjA@mail.gmail.com>

Hi,
I am new to biopython and having problems parsing a blast reulst file (xml
format).
I can get out alignments, alignment length, title etc.
But I would additionally need to print the query title , percent
similarity, e-value.

How does one do that?  Is there anywhere else than Biopython cookbook and
help(Bio.Blast.NCBIXML.Record) to
look for information. I feel like I don't really understand the
Blast.Record and where in there things can be found.
Is the sequence query title in the header?

Example code would be greatly appreciated!
Thank you,


From p.j.a.cock at googlemail.com  Thu Feb  2 16:09:54 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 2 Feb 2012 16:09:54 +0000
Subject: [Biopython] parsing Blast results (xml)
In-Reply-To: <CACvaKy1oK8upTa096h3PHE1ovqZgAfFD_7YHRV2fVWj9NbaUjA@mail.gmail.com>
References: <CACvaKy1oK8upTa096h3PHE1ovqZgAfFD_7YHRV2fVWj9NbaUjA@mail.gmail.com>
Message-ID: <CAKVJ-_5VmVHHD6yGJurUf9mHrF4Q_ADZC1SB9oGx0h2GE91pzQ@mail.gmail.com>

On Thu, Feb 2, 2012 at 3:45 PM, Sarttu Bourvir <bpkth2012 at gmail.com> wrote:
> Hi,
> I am new to biopython and having problems parsing a blast reulst file (xml
> format).
> I can get out alignments, alignment length, title etc.
> But I would additionally need to print the query title , percent
> similarity, e-value.

Well e-value is easy, and covered in the tutorial - e.g.

for alignment in blast_record.alignments:
    for hsp in alignment.hsps:
            print '****Alignment****'
            print 'sequence:', alignment.title
            print 'length:', alignment.length
            print 'e value:', hsp.expect
            print hsp.query[0:75] + '...'
            print hsp.match[0:75] + '...'
            print hsp.sbjct[0:75] + '...'

For percentage similarity I think you must use hsp.positives
and the alignment length. Likewise hsp.identities can be used
to get the percentage identity.

> How does one do that? ?Is there anywhere else than Biopython
> cookbook and help(Bio.Blast.NCBIXML.Record) to look for information.

I assume you also know about dir(...) as well? e.g. try dir(hsp)
after the above example or dir(alignment) to see what attributes
these objects have.

> I feel like I don't really understand the
> Blast.Record and where in there things can be found.
> Is the sequence query title in the header?

Yes, the query details should be captured. Try dir(blast_record)
where blast_record is a Bio.Blast.Record from the parser.

Peter



From drobukow at UTMB.EDU  Tue Feb  7 14:41:50 2012
From: drobukow at UTMB.EDU (Obukowicz, Dennis R.)
Date: Tue, 7 Feb 2012 14:41:50 +0000
Subject: [Biopython] Problems Installing: Can't find modules Seq and
 Alphabet plus many others
Message-ID: <43C6C371D341DE44A81477FD432BA65854CB0B1F@GRMBX4.utmb.edu>

I am new to Biopython and have tried installing Biopython according to instructions. When I run the test after installing I get  many errors, 96 errors (see below some examples) in all out of 154 test runs. Two errors that keep popping up are  not being able to find module Seq and module Alphabet.

ImportError: No module named Seq

ImportError: No module named Alphabet

NameError: name 'Seq' is not defined

NameError: name 'record' is not defined

NameError: name 'protein_rec' is not defined

NameError: name 'protein_rec' is not defined


Dennis




From drobukow at UTMB.EDU  Tue Feb  7 16:01:21 2012
From: drobukow at UTMB.EDU (Obukowicz, Dennis R.)
Date: Tue, 7 Feb 2012 16:01:21 +0000
Subject: [Biopython] Problems Installing: Can't find modules Seq and
 Alphabet plus many others
In-Reply-To: <43C6C371D341DE44A81477FD432BA65854CB0B1F@GRMBX4.utmb.edu>
References: <43C6C371D341DE44A81477FD432BA65854CB0B1F@GRMBX4.utmb.edu>
Message-ID: <43C6C371D341DE44A81477FD432BA65854CB0B94@GRMBX4.utmb.edu>

I solved some of my earlier problems with adjusting the path with the sys.path.append, adding directories where packages are located. However, now I keep getting this error below. I've searched for this error but can't find any mention of it. Can anyone help?

ERROR: Bio.Wise
----------------------------------------------------------------------
Traceback (most recent call last):
  File "run_tests.py", line 327, in runTest
    module = __import__(name, None, None, name.split("."))
  File "/usr/local/biopython/biopython-1.58/build/lib.linux-x86_64-2.7/Bio/Wise/__init__.py", line 20, in <module>
    from Bio import SeqIO
  File "/usr/local/biopython/biopython-1.58/build/lib.linux-x86_64-2.7/Bio/SeqIO/__init__.py", line 308, in <module>
    import Seq
  File "/usr/local/biopython/biopython-1.58/Bio/Seq.py", line 31, in <module>
    import ambiguous_dna_complement, ambiguous_rna_complement
ImportError: No module named ambiguous_dna_complement

From: Obukowicz, Dennis R.
Sent: Tuesday, February 07, 2012 8:42 AM
To: 'biopython at lists.open-bio.org'
Subject: Problems Installing: Can't find modules Seq and Alphabet plus many others

I am new to Biopython and have tried installing Biopython according to instructions. When I run the test after installing I get  many errors, 96 errors (see below some examples) in all out of 154 test runs. Two errors that keep popping up are  not being able to find module Seq and module Alphabet.

ImportError: No module named Seq

ImportError: No module named Alphabet

NameError: name 'Seq' is not defined

NameError: name 'record' is not defined

NameError: name 'protein_rec' is not defined

NameError: name 'protein_rec' is not defined


Dennis




From devaniranjan at gmail.com  Wed Feb  8 01:01:31 2012
From: devaniranjan at gmail.com (George Devaniranjan)
Date: Tue, 7 Feb 2012 20:01:31 -0500
Subject: [Biopython] comparing sequences.qustion
Message-ID: <CAFU65Pc-CvB=68Dbznrgbs2OxZgcyz8GhSpwPrdrCZPJCeB5Mw@mail.gmail.com>

Hi,

I have a list of > 200, 000   UNIQUE short EQUAL length sequences.
I do the following

I am comparing ALL sequences against ALL sequences so there will be (200000
* 199999 )/2 comparisons
Once a sequence is compared, if they differ from one another by ONE letter
only . then I do another more detailed alignment using a BLOSUM matrix.

Currently I use the pairwise sequence comparison code found in BIOPYTHON
for both comparison, simple comparison where I set
match = 0
mismatch = -1
If the total alignment score is equal to -1 (meaning only one mismatch)
then I go a further step and do a BLOSUM alignment.

This works but its taking a long long time, I suspect its because I am
using TWO alignments but I think there could be a way to do the first
simple alignment WITHOUT using the pairwise alignment code for the first
part will speed up this calculation.
Unfortunately I don't have much more than a desktop to do this, so if
someone can suggest a quicker way to do this, I would appreciate it.

Thank you,
George


From eric.talevich at gmail.com  Wed Feb  8 01:50:28 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Tue, 7 Feb 2012 20:50:28 -0500
Subject: [Biopython] comparing sequences.qustion
In-Reply-To: <CAFU65Pc-CvB=68Dbznrgbs2OxZgcyz8GhSpwPrdrCZPJCeB5Mw@mail.gmail.com>
References: <CAFU65Pc-CvB=68Dbznrgbs2OxZgcyz8GhSpwPrdrCZPJCeB5Mw@mail.gmail.com>
Message-ID: <CAMC681=_4tnmyvEWopC=_W+MyLR5TiRRvZNE5_uaFqPPJ7k2XQ@mail.gmail.com>

On Tue, Feb 7, 2012 at 8:01 PM, George Devaniranjan
<devaniranjan at gmail.com>wrote:

> Hi,
>
> I have a list of > 200, 000   UNIQUE short EQUAL length sequences.
> I do the following
>
> I am comparing ALL sequences against ALL sequences so there will be (200000
> * 199999 )/2 comparisons
> Once a sequence is compared, if they differ from one another by ONE letter
> only . then I do another more detailed alignment using a BLOSUM matrix.
>
> Currently I use the pairwise sequence comparison code found in BIOPYTHON
> for both comparison, simple comparison where I set
> match = 0
> mismatch = -1
> If the total alignment score is equal to -1 (meaning only one mismatch)
> then I go a further step and do a BLOSUM alignment.
>
> This works but its taking a long long time, I suspect its because I am
> using TWO alignments but I think there could be a way to do the first
> simple alignment WITHOUT using the pairwise alignment code for the first
> part will speed up this calculation.
> Unfortunately I don't have much more than a desktop to do this, so if
> someone can suggest a quicker way to do this, I would appreciate it.
>
> Thank you,
> George
>
>
Hi George,

If your sequences are all equal length, and you're interested in the ones
that differ by 1 character, then the difference between any two of those
sequences of interest will be a single mismatched character. You don't need
to do an alignment at all.

Without Python: try clustering at whatever identify threshold corresponds
to edit distance 1 in your sequences. UCLUST/USEARCH and other programs can
do this quickly.

With Python: try an expression like:

seq_pairs_of_interest = []
for i, aseq in input_seq_list[:-1]:
    for j, bseq in input_seq_list[i+1:]:
        if sum(a != b for a, b in zip(aseq, bseq)) == 1:
            seq_pairs_of_interest.append((aseq, bseq))


Hope that helps,
Eric


From nje5 at georgetown.edu  Wed Feb  8 15:50:15 2012
From: nje5 at georgetown.edu (Nathan Edwards)
Date: Wed, 08 Feb 2012 10:50:15 -0500
Subject: [Biopython] comparing sequences.qustion
In-Reply-To: <CAMC681=_4tnmyvEWopC=_W+MyLR5TiRRvZNE5_uaFqPPJ7k2XQ@mail.gmail.com>
References: <CAFU65Pc-CvB=68Dbznrgbs2OxZgcyz8GhSpwPrdrCZPJCeB5Mw@mail.gmail.com>
	<CAMC681=_4tnmyvEWopC=_W+MyLR5TiRRvZNE5_uaFqPPJ7k2XQ@mail.gmail.com>
Message-ID: <4F3299B7.4090305@georgetown.edu>


Classical method (essentially BYP, obligatory reference to Goldberg):

* for each sequence, divide in two, get s1 and s2.
* place the sequences (or an reference/index) in a dictionary with list 
values at key s1 and s2.

This is linear time.

Any pair of sequences that differ in only one position _must_ have at 
least one of their halves in common, so do detailed alignment on all 
pairs of sequences with a common key. You specified unique, so each pair 
must be considered at most once. If you had duplicates, these would be 
aligned for each of their halves (and you'd have to normalize these out, 
somehow). This will be a small fraction of all pairs, assuming these are 
not pathological sequences.

This works well as long as the halves have enough specificity - for DNA 
length 10 halves should work. Note that this doesn't distinguish between 
left-halves and right-halves, which might have the same key values, but 
obviously won't differ by one. Fixing this is an easy modification. BTW, 
this works even for edit-distance. Only concern is the use of the 
in-memory dictionary data-structure, which can get big.

Untested pseudocode:

from collections import defaultdict
from itertools import combinations

n = 20
halves = defaultdict(list)
for s in sequences:
     s1 = s[:n/2]
     s2 = s[n/2:]
     halves[s1].append(s)
     halves[s2].append(s)

for k in halves.iterkeys():
     for seq1,seq2 in combinations(halves[k],2):
	# check for one-change before expensive alignment?
	align(seq1,seq2)

- n

On 2/7/2012 8:50 PM, Eric Talevich wrote:
> On Tue, Feb 7, 2012 at 8:01 PM, George Devaniranjan
> <devaniranjan at gmail.com>wrote:
>
>> Hi,
>>
>> I have a list of>  200, 000   UNIQUE short EQUAL length sequences.
>> I do the following
>>
>> I am comparing ALL sequences against ALL sequences so there will be (200000
>> * 199999 )/2 comparisons
>> Once a sequence is compared, if they differ from one another by ONE letter
>> only . then I do another more detailed alignment using a BLOSUM matrix.
>>
>> Currently I use the pairwise sequence comparison code found in BIOPYTHON
>> for both comparison, simple comparison where I set
>> match = 0
>> mismatch = -1
>> If the total alignment score is equal to -1 (meaning only one mismatch)
>> then I go a further step and do a BLOSUM alignment.
>>
>> This works but its taking a long long time, I suspect its because I am
>> using TWO alignments but I think there could be a way to do the first
>> simple alignment WITHOUT using the pairwise alignment code for the first
>> part will speed up this calculation.
>> Unfortunately I don't have much more than a desktop to do this, so if
>> someone can suggest a quicker way to do this, I would appreciate it.
>>
>> Thank you,
>> George
>>
>>
> Hi George,
>
> If your sequences are all equal length, and you're interested in the ones
> that differ by 1 character, then the difference between any two of those
> sequences of interest will be a single mismatched character. You don't need
> to do an alignment at all.
>
> Without Python: try clustering at whatever identify threshold corresponds
> to edit distance 1 in your sequences. UCLUST/USEARCH and other programs can
> do this quickly.
>
> With Python: try an expression like:
>
> seq_pairs_of_interest = []
> for i, aseq in input_seq_list[:-1]:
>      for j, bseq in input_seq_list[i+1:]:
>          if sum(a != b for a, b in zip(aseq, bseq)) == 1:
>              seq_pairs_of_interest.append((aseq, bseq))
>
>
> Hope that helps,
> Eric
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython


-- 
Dr. Nathan Edwards                      nje5 at georgetown.edu
Department of Biochemistry and Molecular & Cellular Biology
            Georgetown University Medical Center
Room 1215, Harris Building          Room 347, Basic Science
3300 Whitehaven St, NW              3900 Reservoir Road, NW
Washington DC 20007                     Washington DC 20007
Phone: 202-687-7042                     Phone: 202-687-1618
Fax: 202-687-0057                         Fax: 202-687-7186


From nje5 at georgetown.edu  Wed Feb  8 16:08:30 2012
From: nje5 at georgetown.edu (Nathan Edwards)
Date: Wed, 08 Feb 2012 11:08:30 -0500
Subject: [Biopython] comparing sequences.qustion
In-Reply-To: <4F3299B7.4090305@georgetown.edu>
References: <CAFU65Pc-CvB=68Dbznrgbs2OxZgcyz8GhSpwPrdrCZPJCeB5Mw@mail.gmail.com>
	<CAMC681=_4tnmyvEWopC=_W+MyLR5TiRRvZNE5_uaFqPPJ7k2XQ@mail.gmail.com>
	<4F3299B7.4090305@georgetown.edu>
Message-ID: <4F329DFE.6010607@georgetown.edu>


Argh, Gusfield "Algorithms on Strings, Trees, and Sequences" is the 
obligatory string matching reference...

- n

On 2/8/2012 10:50 AM, Nathan Edwards wrote:
>
> Classical method (essentially BYP, obligatory reference to Goldberg):
>
> * for each sequence, divide in two, get s1 and s2.
> * place the sequences (or an reference/index) in a dictionary with list
> values at key s1 and s2.
>
> This is linear time.
>
> Any pair of sequences that differ in only one position _must_ have at
> least one of their halves in common, so do detailed alignment on all
> pairs of sequences with a common key. You specified unique, so each pair
> must be considered at most once. If you had duplicates, these would be
> aligned for each of their halves (and you'd have to normalize these out,
> somehow). This will be a small fraction of all pairs, assuming these are
> not pathological sequences.
>
> This works well as long as the halves have enough specificity - for DNA
> length 10 halves should work. Note that this doesn't distinguish between
> left-halves and right-halves, which might have the same key values, but
> obviously won't differ by one. Fixing this is an easy modification. BTW,
> this works even for edit-distance. Only concern is the use of the
> in-memory dictionary data-structure, which can get big.
>
> Untested pseudocode:
>
> from collections import defaultdict
> from itertools import combinations
>
> n = 20
> halves = defaultdict(list)
> for s in sequences:
> s1 = s[:n/2]
> s2 = s[n/2:]
> halves[s1].append(s)
> halves[s2].append(s)
>
> for k in halves.iterkeys():
> for seq1,seq2 in combinations(halves[k],2):
> # check for one-change before expensive alignment?
> align(seq1,seq2)
>
> - n
>
> On 2/7/2012 8:50 PM, Eric Talevich wrote:
>> On Tue, Feb 7, 2012 at 8:01 PM, George Devaniranjan
>> <devaniranjan at gmail.com>wrote:
>>
>>> Hi,
>>>
>>> I have a list of> 200, 000 UNIQUE short EQUAL length sequences.
>>> I do the following
>>>
>>> I am comparing ALL sequences against ALL sequences so there will be
>>> (200000
>>> * 199999 )/2 comparisons
>>> Once a sequence is compared, if they differ from one another by ONE
>>> letter
>>> only . then I do another more detailed alignment using a BLOSUM matrix.
>>>
>>> Currently I use the pairwise sequence comparison code found in BIOPYTHON
>>> for both comparison, simple comparison where I set
>>> match = 0
>>> mismatch = -1
>>> If the total alignment score is equal to -1 (meaning only one mismatch)
>>> then I go a further step and do a BLOSUM alignment.
>>>
>>> This works but its taking a long long time, I suspect its because I am
>>> using TWO alignments but I think there could be a way to do the first
>>> simple alignment WITHOUT using the pairwise alignment code for the first
>>> part will speed up this calculation.
>>> Unfortunately I don't have much more than a desktop to do this, so if
>>> someone can suggest a quicker way to do this, I would appreciate it.
>>>
>>> Thank you,
>>> George
>>>
>>>
>> Hi George,
>>
>> If your sequences are all equal length, and you're interested in the ones
>> that differ by 1 character, then the difference between any two of those
>> sequences of interest will be a single mismatched character. You don't
>> need
>> to do an alignment at all.
>>
>> Without Python: try clustering at whatever identify threshold corresponds
>> to edit distance 1 in your sequences. UCLUST/USEARCH and other
>> programs can
>> do this quickly.
>>
>> With Python: try an expression like:
>>
>> seq_pairs_of_interest = []
>> for i, aseq in input_seq_list[:-1]:
>> for j, bseq in input_seq_list[i+1:]:
>> if sum(a != b for a, b in zip(aseq, bseq)) == 1:
>> seq_pairs_of_interest.append((aseq, bseq))
>>
>>
>> Hope that helps,
>> Eric
>> _______________________________________________
>> Biopython mailing list - Biopython at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biopython
>
>


-- 
Dr. Nathan Edwards                      nje5 at georgetown.edu
Department of Biochemistry and Molecular & Cellular Biology
            Georgetown University Medical Center
Room 1215, Harris Building          Room 347, Basic Science
3300 Whitehaven St, NW              3900 Reservoir Road, NW
Washington DC 20007                     Washington DC 20007
Phone: 202-687-7042                     Phone: 202-687-1618
Fax: 202-687-0057                         Fax: 202-687-7186


From d.m.a.martin at dundee.ac.uk  Thu Feb  9 14:36:42 2012
From: d.m.a.martin at dundee.ac.uk (David Martin)
Date: Thu, 9 Feb 2012 14:36:42 +0000
Subject: [Biopython] Proteomics tools in BioPython
Message-ID: <959CFF5060375249824CC633DDDF896F086CB9AD@AMSPRD0402MB109.eurprd04.prod.outlook.com>

We are planning to develop some proteomics tools in python and have a view to submit them as part of Biopython.
Primarily we will be writing wrappers/parsers for the OpenMS tools/output formats and analytic tools on top of that. If anyone else is working on python wrappers for openms then I'd be happy to share expertise.

..d

Dr David Martin
College of Life Sciences
University of Dundee


The University of Dundee is a registered Scottish Charity, No: SC015096




From p.j.a.cock at googlemail.com  Thu Feb  9 18:10:39 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 9 Feb 2012 18:10:39 +0000
Subject: [Biopython] Proteomics tools in BioPython
In-Reply-To: <959CFF5060375249824CC633DDDF896F086CB9AD@AMSPRD0402MB109.eurprd04.prod.outlook.com>
References: <959CFF5060375249824CC633DDDF896F086CB9AD@AMSPRD0402MB109.eurprd04.prod.outlook.com>
Message-ID: <CAKVJ-_6NTZLe4jp+Ww-GUa3kDNwG4t7sbuV2dqwpvV7GnXLS4w@mail.gmail.com>

On Thu, Feb 9, 2012 at 2:36 PM, David Martin <d.m.a.martin at dundee.ac.uk> wrote:
> We are planning to develop some proteomics tools in python and
> have a view to submit them as part of Biopython.
> Primarily we will be writing wrappers/parsers for the OpenMS
> tools/output formats and analytic tools on top of that. If anyone
> else is working on python wrappers for openms then I'd be happy
> to share expertise.
>
> ..d

Thanks David - that was quick, you must have sent this almost
straight after our chat this afternoon at the Dundee NextGenBUG
meeting :)

Peter


From eric.talevich at gmail.com  Thu Feb  9 20:41:02 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Thu, 9 Feb 2012 15:41:02 -0500
Subject: [Biopython] Proteomics tools in BioPython
In-Reply-To: <959CFF5060375249824CC633DDDF896F086CB9AD@AMSPRD0402MB109.eurprd04.prod.outlook.com>
References: <959CFF5060375249824CC633DDDF896F086CB9AD@AMSPRD0402MB109.eurprd04.prod.outlook.com>
Message-ID: <CAMC681mKVgAe0V0xjUZ8C524w3dSeCte91NEQCa5NVkkOnBYAA@mail.gmail.com>

On Thu, Feb 9, 2012 at 9:36 AM, David Martin <d.m.a.martin at dundee.ac.uk>wrote:

> We are planning to develop some proteomics tools in python and have a view
> to submit them as part of Biopython.
> Primarily we will be writing wrappers/parsers for the OpenMS tools/output
> formats and analytic tools on top of that. If anyone else is working on
> python wrappers for openms then I'd be happy to share expertise.
>
> ..d
>
>
Sounds great to me! Since Google Summer of Code is coming up soon, do you
see an opportunity to take on a student to help out with this work or build
something on top of it?

-Eric


From d.m.a.martin at dundee.ac.uk  Fri Feb 10 17:03:04 2012
From: d.m.a.martin at dundee.ac.uk (David Martin)
Date: Fri, 10 Feb 2012 17:03:04 +0000
Subject: [Biopython] Proteomics tools in biopython
Message-ID: <959CFF5060375249824CC633DDDF896F08709A95@AMSPRD0402MB113.eurprd04.prod.outlook.com>

There may be potential but I don't have the time to get organized for this year. We shall see how things progress.

..d

On Thu, Feb 9, 2012 at 9:36 AM, David Martin <d.m.a.martin at dundee.ac.uk>wrote:

> We are planning to develop some proteomics tools in python and have a
> view to submit them as part of Biopython.
> Primarily we will be writing wrappers/parsers for the OpenMS
> tools/output formats and analytic tools on top of that. If anyone else
> is working on python wrappers for openms then I'd be happy to share expertise.
>
> ..d
>
>
Sounds great to me! Since Google Summer of Code is coming up soon, do you see an opportunity to take on a student to help out with this work or build something on top of it?

-Eric


------------------------------

_______________________________________________
Biopython mailing list  -  Biopython at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/biopython


End of Biopython Digest, Vol 110, Issue 5
*****************************************


The University of Dundee is a registered Scottish Charity, No: SC015096




From rbuels at gmail.com  Fri Feb 10 17:51:12 2012
From: rbuels at gmail.com (Robert Buels)
Date: Fri, 10 Feb 2012 12:51:12 -0500
Subject: [Biopython] Google Summer of Code project ideas
Message-ID: <4F355910.4060203@gmail.com>

Hi all,

I'm going to be OBF project admin again this year for Google Summer of 
code.  OBF's application is due in a couple of weeks, and we need to 
update our project ideas on the OBF wiki page and on each project's 
individual wiki pages.

So, for each of the OBF projects that wants to do GSoC again this year, 
please:

a.) Update the list of project ideas on your project's GSoC page 
(BioPython, BioPerl, BioRuby, etc).  Add new ones, remove ones that have 
already been done or no longer relevant, etc.

b.) Update the list of project ideas on the main OBF GSoC page 
(http://www.open-bio.org/wiki/Google_Summer_of_Code) to match.

c.) Let me know via email that you have done so and it's ready for 
Google to peruse.

Please have the updates done, if possible, by this Friday (March 11). 
The number and quality of the project ideas are part of the evaluation 
process for whether OBF is accepted as a Summer of Code organization 
again this year, so let's come up with some good ones.  :-)

Rob

----
Robert Buels
(prospective) 2012 OBF GSoC Organization Admin


From mjldehoon at yahoo.com  Sun Feb 12 03:35:44 2012
From: mjldehoon at yahoo.com (Michiel de Hoon)
Date: Sat, 11 Feb 2012 19:35:44 -0800 (PST)
Subject: [Biopython] Digital gene expression
Message-ID: <1329017744.74960.YahooMailClassic@web161203.mail.bf1.yahoo.com>

Hi everybody,

EdgeR and DESeq are popular R packages to analyze differential expression in digital gene expression methodologies such as RNAseq and CAGE. Is something similar to these R packages available in Python (or is anybody working on such a module for Biopython)? Not that I don't like EdgeR / DESeq, but I'd prefer something in Python so that I can understand what I am doing.

Thanks,
-Michiel.


From p.j.a.cock at googlemail.com  Sun Feb 12 12:27:12 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Sun, 12 Feb 2012 12:27:12 +0000
Subject: [Biopython] Digital gene expression
In-Reply-To: <1329017744.74960.YahooMailClassic@web161203.mail.bf1.yahoo.com>
References: <1329017744.74960.YahooMailClassic@web161203.mail.bf1.yahoo.com>
Message-ID: <CAKVJ-_6SFFeMQCMhUhLLE=yu7=YxpY4AGC6=aUdGc+RrkGjoNw@mail.gmail.com>

On Sunday, February 12, 2012, Michiel de Hoon <mjldehoon at yahoo.com> wrote:
> Hi everybody,
>
> EdgeR and DESeq are popular R packages to analyze differential
> expression in digital gene expression methodologies such as
> RNAseq and CAGE. Is something similar to these R packages
> available in Python (or is anybody working on such a module
> for Biopython)? Not that I don't like EdgeR / DESeq, but I'd
> prefer something in Python so that I can understand what I
> am doing.
>
> Thanks,
> -Michiel.

I'm not sure, but try rpy or rpy2 for calling these R libraries from
Python. If you know both languages it is very powerful.

Peter


From tiagoantao at gmail.com  Sun Feb 12 12:39:20 2012
From: tiagoantao at gmail.com (=?ISO-8859-1?Q?Tiago_Ant=E3o?=)
Date: Sun, 12 Feb 2012 12:39:20 +0000
Subject: [Biopython] Digital gene expression
In-Reply-To: <CAKVJ-_6SFFeMQCMhUhLLE=yu7=YxpY4AGC6=aUdGc+RrkGjoNw@mail.gmail.com>
References: <1329017744.74960.YahooMailClassic@web161203.mail.bf1.yahoo.com>
	<CAKVJ-_6SFFeMQCMhUhLLE=yu7=YxpY4AGC6=aUdGc+RrkGjoNw@mail.gmail.com>
Message-ID: <CAA9RGENXAg=GQ4po1XkE=M1odYnbw6P18-PS6_8Kepc_4f8K7A@mail.gmail.com>

Hi,

On Sun, Feb 12, 2012 at 12:27 PM, Peter Cock
> I'm not sure, but try rpy or rpy2 for calling these R

rpy2 is an extremely declarative library. One almost forgets it is
writing R inside Python. It seems to be brilliantly well done. I have
only used it a couple of times myself, but I can only offer praise for
it.


From dan.bolser at gmail.com  Tue Feb 14 01:32:39 2012
From: dan.bolser at gmail.com (Dan Bolser)
Date: Tue, 14 Feb 2012 01:32:39 +0000
Subject: [Biopython] Fwd: Interested in Variation?
In-Reply-To: <CAPBO=2=uR-aTe=qsjTnRwmvgMFzXzDuuJgfhfW87iAT4qoAyEg@mail.gmail.com>
References: <CAPBO=2=FfmY70b0_u6cVk9Bv5RH7Lt5Lg7huE1-1s_Keu_bNRQ@mail.gmail.com>
	<CAPBO=2m9=h6PJvmikVsZ785BChhgfTuQ6Kb1psvTeaHpD8PNJw@mail.gmail.com>
	<CAPBO=2=uR-aTe=qsjTnRwmvgMFzXzDuuJgfhfW87iAT4qoAyEg@mail.gmail.com>
Message-ID: <CAPBO=2mWurq5POijp+f+couMBGFkhFGuVXYhd4CXbT7YSyapiQ@mail.gmail.com>

Job at the EBI:

"... the primary responsibility of the post-holder will be the
development of pipelines and storage solutions for variation data
deriving from whole genome re-sequencing."

http://goo.gl/eQrRu or

http://ig14.i-grasp.com/fe/tpl_embl01.asp?s=LktVsYDaNlCOtQqCli&jobid=47627,4187528723&key=45520467&c=126152212583&pagestamp=dbnjwyufpgvrmyvkmt


Cheers,
Dan.


From chris.mit7 at gmail.com  Tue Feb 14 20:30:41 2012
From: chris.mit7 at gmail.com (Chris Mitchell)
Date: Tue, 14 Feb 2012 15:30:41 -0500
Subject: [Biopython] Proteomics tools in BioPython
Message-ID: <CAK_U6ODyxTb-AW3yv4iMDTuG3A1o+ejseSnix9BafgeRZfUXrQ@mail.gmail.com>

Hey David,

What sort of tools do you have in mind for proteomics?  I have quite a few
stashed away (3/6 frame translations, GFF files->proteins, X!Tandem
parsers/FDR calculators, GFF parsers, etc.)

Chris


From d.m.a.martin at dundee.ac.uk  Wed Feb 15 17:22:48 2012
From: d.m.a.martin at dundee.ac.uk (David Martin)
Date: Wed, 15 Feb 2012 17:22:48 +0000
Subject: [Biopython] Proteomics tools for biopython
Message-ID: <959CFF5060375249824CC633DDDF896F08710546@AMSPRD0402MB113.eurprd04.prod.outlook.com>



> Hey David,
>
> What sort of tools do you have in mind for proteomics?  I have quite a few stashed away (3/6 frame translations, GFF files->proteins, X!Tandem parsers/FDR calculators, GFF parsers, etc.)
>
> Chris

At present we are wrapping the OpenMS outputs (featureML etc) so that we can interrogate the detail of how the runs behave. It is insightful to see (for example) how many of the ms/ms are on overlapping peptides, and the distribution of ms/ms selections per feature (vs intensity). This is just the first stage. Having these data (which up till now have been difficult to access) allows for building of smarter tools (custom delta mass thresholds for each ms/ms, second peptide searching, seeing whether all the peptide ID for a feature agree, correlating ID from different search engines to the same spectra).

There are outstanding questions from our users for things like 'is it really necessary to do duplicate runs?' or in other words, can we get the machine to treat duplicate runs differently to optimise ID. (under the principle that madness is doing the same thing repeatedly but expecting different results.)

Parsers for XTandem! would be really useful as that is something we'd like to have in our tool chain. A Mascot one would be good - I am looking into that (it is on my list of things to do, just not near the top right now.)  I very much favour a modular approach where each class/object does one thing really well and can feed output to another class, and all can be represented using open formats. It might be a good idea to arrange a telecon or Skype group chat for people who are interested in contributing to this and building a comprehensive set of tools into Biopython. I can't promise too much from our end but we are making good progress and we have a strong commitment to open software and algorithms, with a heavy python development presence.

..d


The University of Dundee is a registered Scottish Charity, No: SC015096




From Achim.Treumann at NEPAF.com  Wed Feb 15 18:49:30 2012
From: Achim.Treumann at NEPAF.com (Achim Treumann)
Date: Wed, 15 Feb 2012 18:49:30 -0000
Subject: [Biopython] Proteomics tools for biopython
In-Reply-To: <959CFF5060375249824CC633DDDF896F08710546@AMSPRD0402MB113.eurprd04.prod.outlook.com>
References: <959CFF5060375249824CC633DDDF896F08710546@AMSPRD0402MB113.eurprd04.prod.outlook.com>
Message-ID: <01798D2396253A449511F31F1CDE835519D5ED@srv1.NEPAF.local>

Hi, 

I could possibly contribute a few snippets regarding an X!Tandem parser
and a few other little tools - at the moment I am very busy, but can
take part in the discussion more in March. 

Another interesting toolset that has been released today by Mike
Gorshkov's research group is pyteomics 1.0.0
http://pypi.python.org/pypi/pyteomics/1.0.0 

Best wishes, 
Achim

-----Original Message-----
From: biopython-bounces at lists.open-bio.org
[mailto:biopython-bounces at lists.open-bio.org] On Behalf Of David Martin
Sent: 15 February 2012 17:23
To: 'biopython at lists.open-bio.org'
Subject: [Biopython] Proteomics tools for biopython



> Hey David,
>
> What sort of tools do you have in mind for proteomics?  I have quite a
few stashed away (3/6 frame translations, GFF files->proteins, X!Tandem
parsers/FDR calculators, GFF parsers, etc.)
>
> Chris

At present we are wrapping the OpenMS outputs (featureML etc) so that we
can interrogate the detail of how the runs behave. It is insightful to
see (for example) how many of the ms/ms are on overlapping peptides, and
the distribution of ms/ms selections per feature (vs intensity). This is
just the first stage. Having these data (which up till now have been
difficult to access) allows for building of smarter tools (custom delta
mass thresholds for each ms/ms, second peptide searching, seeing whether
all the peptide ID for a feature agree, correlating ID from different
search engines to the same spectra).

There are outstanding questions from our users for things like 'is it
really necessary to do duplicate runs?' or in other words, can we get
the machine to treat duplicate runs differently to optimise ID. (under
the principle that madness is doing the same thing repeatedly but
expecting different results.)

Parsers for XTandem! would be really useful as that is something we'd
like to have in our tool chain. A Mascot one would be good - I am
looking into that (it is on my list of things to do, just not near the
top right now.)  I very much favour a modular approach where each
class/object does one thing really well and can feed output to another
class, and all can be represented using open formats. It might be a good
idea to arrange a telecon or Skype group chat for people who are
interested in contributing to this and building a comprehensive set of
tools into Biopython. I can't promise too much from our end but we are
making good progress and we have a strong commitment to open software
and algorithms, with a heavy python development presence.

..d


The University of Dundee is a registered Scottish Charity, No: SC015096


_______________________________________________
Biopython mailing list  -  Biopython at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biopython



From schnoes at gmail.com  Fri Feb 17 01:18:30 2012
From: schnoes at gmail.com (Alexandra Schnoes)
Date: Thu, 16 Feb 2012 17:18:30 -0800
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
Message-ID: <CABZpzJcZEF=Or-28VSxL55eK6Wx7Q8CXWuEw9KfE9KHpDN__aQ@mail.gmail.com>

Hi,

I have some python code (using BioPython 1.58) that uses Bio.Entrez to pull
out information on 50 papers from pubmed. I have had no problem with this
code until yesterday when I started getting HTTP Error 500 messages that
continue until today. For example...

Traceback (most recent call last):
  File "<stdin>", line 1, in <module>
  File "sp_tools.py", line 421, in top_papers_dict
    rettype="medline", retmode="text")
  File
"/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Bio/Entrez/__init__.py",
line 113, in efetch
    return _open(cgi, variables)
  File
"/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Bio/Entrez/__init__.py",
line 360, in _open
    raise exception
urllib2.HTTPError: HTTP Error 500: Internal server error

The parameters I'm using are
db = pubmed
rettype = medline
retmode = text

Anyone have an idea why this might be happening now?

Thanks!
Alexandra


-- 
Alexandra Schnoes, Ph.D.
Scientist, Babbitt Laboratory
Program Coordinator, Graduate Student Internships for Career Exploration
University of California San Francisco
Tel:  415-502-1248
Fax: 415-514-9656
Email: schnoes at gmail.com


From jgrant at smith.edu  Fri Feb 17 02:39:54 2012
From: jgrant at smith.edu (Jessica Grant)
Date: Thu, 16 Feb 2012 21:39:54 -0500
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <CABZpzJcZEF=Or-28VSxL55eK6Wx7Q8CXWuEw9KfE9KHpDN__aQ@mail.gmail.com>
References: <CABZpzJcZEF=Or-28VSxL55eK6Wx7Q8CXWuEw9KfE9KHpDN__aQ@mail.gmail.com>
Message-ID: <CAOuNqdnDC8N1=DGCuvZYBAW7EwK4D2jGQ87f2-tOZeGoBAYWrg@mail.gmail.com>

I have a script I have used successfully in the past that uses Entrez.
 Yesterday, a lab-mate was using it but about half way through the files
she was processing she got an error and it wouldn't work after that.  I
went over the script from top to bottom to see what went wrong and couldn't
find a problem.  Your question gives me hope that it is something happening
at ncbi.  Our error was not identical.  Our script seemed to work until it
tried to read the output of the Entrez.efetch and then found no record in
the handle (or something like that...I don't have it in front of me.)

I suggested my lab mate contact the ncbi help desk to see if anything was
wrong on their end, but I dont' know if she did or if she heard back.

Jessica





On Thu, Feb 16, 2012 at 8:18 PM, Alexandra Schnoes <schnoes at gmail.com>wrote:

> Hi,
>
> I have some python code (using BioPython 1.58) that uses Bio.Entrez to pull
> out information on 50 papers from pubmed. I have had no problem with this
> code until yesterday when I started getting HTTP Error 500 messages that
> continue until today. For example...
>
> Traceback (most recent call last):
>  File "<stdin>", line 1, in <module>
>  File "sp_tools.py", line 421, in top_papers_dict
>    rettype="medline", retmode="text")
>  File
>
> "/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Bio/Entrez/__init__.py",
> line 113, in efetch
>    return _open(cgi, variables)
>  File
>
> "/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Bio/Entrez/__init__.py",
> line 360, in _open
>    raise exception
> urllib2.HTTPError: HTTP Error 500: Internal server error
>
> The parameters I'm using are
> db = pubmed
> rettype = medline
> retmode = text
>
> Anyone have an idea why this might be happening now?
>
> Thanks!
> Alexandra
>
>
> --
> Alexandra Schnoes, Ph.D.
> Scientist, Babbitt Laboratory
> Program Coordinator, Graduate Student Internships for Career Exploration
> University of California San Francisco
> Tel:  415-502-1248
> Fax: 415-514-9656
> Email: schnoes at gmail.com
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From mictadlo at gmail.com  Fri Feb 17 06:39:27 2012
From: mictadlo at gmail.com (Mic)
Date: Fri, 17 Feb 2012 16:39:27 +1000
Subject: [Biopython] histogram plot of insert size
Message-ID: <CAOP6n=hBnPV0_u5Mmr=UCbZNUmF0y77KGTuR7y2wA_xN2-cZkA@mail.gmail.com>

Hi all,
How is it possible to create histogram plot of insert size with
pysam/Biopython?

Thank you in advance.

Cheers


From schnoes at gmail.com  Fri Feb 17 07:31:10 2012
From: schnoes at gmail.com (Alexandra Schnoes)
Date: Thu, 16 Feb 2012 23:31:10 -0800
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <CAOuNqdnDC8N1=DGCuvZYBAW7EwK4D2jGQ87f2-tOZeGoBAYWrg@mail.gmail.com>
References: <CABZpzJcZEF=Or-28VSxL55eK6Wx7Q8CXWuEw9KfE9KHpDN__aQ@mail.gmail.com>
	<CAOuNqdnDC8N1=DGCuvZYBAW7EwK4D2jGQ87f2-tOZeGoBAYWrg@mail.gmail.com>
Message-ID: <CABZpzJcfQ2AO=oXYrPV14EYRNVoZ1Sh=7K2A5p0Vus5pSXPtPg@mail.gmail.com>

Thanks, that is somewhat encouraging to hear. I have also emailed NCBI
(that's actually where the multi-repeat subject line came from. My computer
sometimes has weird lags and apparently I hit ctrl-v a couple of times when
copying over the email I sent to NCBI, and didn't notice it. My apologies).
Hopefully one of us will hear something soon!
Alex



On Thu, Feb 16, 2012 at 6:39 PM, Jessica Grant <jgrant at smith.edu> wrote:

> I have a script I have used successfully in the past that uses Entrez.
>  Yesterday, a lab-mate was using it but about half way through the files
> she was processing she got an error and it wouldn't work after that.  I
> went over the script from top to bottom to see what went wrong and couldn't
> find a problem.  Your question gives me hope that it is something happening
> at ncbi.  Our error was not identical.  Our script seemed to work until it
> tried to read the output of the Entrez.efetch and then found no record in
> the handle (or something like that...I don't have it in front of me.)
>
> I suggested my lab mate contact the ncbi help desk to see if anything was
> wrong on their end, but I dont' know if she did or if she heard back.
>
> Jessica
>
>
>
>
>
> On Thu, Feb 16, 2012 at 8:18 PM, Alexandra Schnoes <schnoes at gmail.com>wrote:
>
>> Hi,
>>
>> I have some python code (using BioPython 1.58) that uses Bio.Entrez to
>> pull
>> out information on 50 papers from pubmed. I have had no problem with this
>> code until yesterday when I started getting HTTP Error 500 messages that
>> continue until today. For example...
>>
>> Traceback (most recent call last):
>>  File "<stdin>", line 1, in <module>
>>  File "sp_tools.py", line 421, in top_papers_dict
>>    rettype="medline", retmode="text")
>>  File
>>
>> "/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Bio/Entrez/__init__.py",
>> line 113, in efetch
>>    return _open(cgi, variables)
>>  File
>>
>> "/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Bio/Entrez/__init__.py",
>> line 360, in _open
>>    raise exception
>> urllib2.HTTPError: HTTP Error 500: Internal server error
>>
>> The parameters I'm using are
>> db = pubmed
>> rettype = medline
>> retmode = text
>>
>> Anyone have an idea why this might be happening now?
>>
>> Thanks!
>> Alexandra
>>
>>
>>


From p.j.a.cock at googlemail.com  Fri Feb 17 09:56:05 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 17 Feb 2012 09:56:05 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <CABZpzJcfQ2AO=oXYrPV14EYRNVoZ1Sh=7K2A5p0Vus5pSXPtPg@mail.gmail.com>
References: <CABZpzJcZEF=Or-28VSxL55eK6Wx7Q8CXWuEw9KfE9KHpDN__aQ@mail.gmail.com>
	<CAOuNqdnDC8N1=DGCuvZYBAW7EwK4D2jGQ87f2-tOZeGoBAYWrg@mail.gmail.com>
	<CABZpzJcfQ2AO=oXYrPV14EYRNVoZ1Sh=7K2A5p0Vus5pSXPtPg@mail.gmail.com>
Message-ID: <CAKVJ-_6bk2ReYLP=FFwK_SZCg-fSMAx1c0n=+X=vc2V2Wv1NHw@mail.gmail.com>

On Fri, Feb 17, 2012 at 7:31 AM, Alexandra Schnoes <schnoes at gmail.com> wrote:
> Thanks, that is somewhat encouraging to hear. I have also emailed NCBI
> (that's actually where the multi-repeat subject line came from. My computer
> sometimes has weird lags and apparently I hit ctrl-v a couple of times when
> copying over the email I sent to NCBI, and didn't notice it. My apologies).
> Hopefully one of us will hear something soon!
> Alex

This is probably due to a recent NCBI change (on Wednesday 15 Feb 2012)
with the release of EFetch 2.0, see:

http://www.ncbi.nlm.nih.gov/mailman/pipermail/utilities-announce/2012-February/000085.html
http://www.ncbi.nlm.nih.gov/books/NBK25499/#chapter4.Release_Notes

They have changed things with the default retmode, although looking at
their Table 1 from the above link, using rettype="medline", retmode="text"
looks OK still with both db="pmc" and ab"pubmed" databases.

Peter


From mictadlo at gmail.com  Fri Feb 17 10:13:31 2012
From: mictadlo at gmail.com (Mic)
Date: Fri, 17 Feb 2012 20:13:31 +1000
Subject: [Biopython] histogram plot of insert size
In-Reply-To: <84771354-DF77-49FE-B1EC-F3EAA1FF21F6@hsr.it>
References: <CAOP6n=hBnPV0_u5Mmr=UCbZNUmF0y77KGTuR7y2wA_xN2-cZkA@mail.gmail.com>
	<84771354-DF77-49FE-B1EC-F3EAA1FF21F6@hsr.it>
Message-ID: <CAOP6n=hstzDJGj5QwmAPdFdD05sfFgMUdQFQ948jVAUiM0GgTw@mail.gmail.com>

Hi Cittaro,
Thank you for your solution. I run fixmate from samtools on a BAM file:
HWI-ST226_0154:4:1206:12773:170407#CTTGTA 73 A_01a 1046 30 100M * 0 0
AGTATAAAACTAAGCAAACTGTTAGAACTTTGATTACGTTTTGTTTATCAGTGATACGCAAAAGTTTAAGATCCTTGAGTACCTCTTTCGATGGCGGATT
fdfffdfffbddaec_dSc^ddd^dQc^`Udddad_`c^^ac`R_NV\\]T^c`T_Mc]aV[V\R`Xa^^EKIIVcccc`YNY]UV[U`BBBBBBBBBBB
NM:i:1 MD:Z:73T26

I just wonder which column I have to take to fill isize_array?

Thank you in advance.


On Fri, Feb 17, 2012 at 7:07 PM, Cittaro Davide <cittaro.davide at hsr.it>wrote:

>
> On Feb 17, 2012, at 7:39 AM, Mic wrote:
>
> > Hi all,
> > How is it possible to create histogram plot of insert size with
> pysam/Biopython?
>
> As far as you have some plotting library yes.
> Take a look to matplotlib and try this:
>
> import matplotlib.pyplot as plt
>
> f = plt.figure()
> h = f.add_subplot(111)
> h.hist(isize_array, bins=50, normed=True)
> f.savefig('myhist.pdf', format='pdf')
>
> assuming isize_array is your array/list of insert sizes
>
> d
> /*
> Davide Cittaro, PhD
>
> Head of Bioinformatics Core
> Center for Translational Genomics and Bioinformatics
> San Raffaele Scientific Institute
> Via Olgettina 58
> 20132 Milano
> Italy
>
> Office: +39 02 26439140
> Mail: cittaro.davide at hsr.it
> Skype: daweonline
> */
>
>
>
>
>
>
>
>
>
>
>


From Matej.Repic at ki.si  Fri Feb 17 13:20:13 2012
From: Matej.Repic at ki.si (=?utf-8?B?TWF0ZWogUmVwacSN?=)
Date: Fri, 17 Feb 2012 13:20:13 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
Message-ID: <47063F60-DC26-4901-9D12-8503F285F3C9@ki.si>

Fortunately, the fix is quite simple:

Substitute the id=idlist in you fetch line with id=",".join(idlist).


Explanation:

This has something to do with how Pubmed accepts a python list. If you enter PMIDs by hand it works ok, but if you feed it a python list you get an internal server error.

Instead of using the procedure from the Cookbook, where you feed the list:

>>> fetch_handle = Entrez.esearch(db="pubmed", term="orchid", retmax=463)
>>> record = Entrez.read(fetch_handle)
>>> idlist = record["IdList"]
>>> record_handle = Entrez.efetch(db="pubmed", id=idlist, rettype="medline", retmode="text")

Use this slightly modified line for record_handle. With the ",".join(idlist) you convert the idlist python list to a comma separated string, which works as expected. 

>>> fetch_handle = Entrez.esearch(db="pubmed", term="orchid", retmax=463)
>>> record = Entrez.read(fetch_handle)
>>> idlist = record["IdList"]
>>> record_handle = Entrez.efetch(db="pubmed", id=",".join(idlist), rettype="medline", retmode="text")


Kind regards,
Matej
----------------------------------------------------------
Matej Repi?
Junior Researcher

Laboratory for Biocomputing and Bioinformatics
National Institute of Chemistry
Hajdrihova 19
SI-1001 Ljubljana POB 660
Slovenia

tel: +386-1-4760457
e-mail: matej.repic at ki.si
----------------------------------------------------------




From Matej.Repic at ki.si  Fri Feb 17 13:14:10 2012
From: Matej.Repic at ki.si (=?utf-8?B?TWF0ZWogUmVwacSN?=)
Date: Fri, 17 Feb 2012 13:14:10 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
Message-ID: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>

Fortunately, the fix is quite simple:

Substitute the id=idlist in you fetch line with id=",".join(idlist).


Explanation:

This has something to do with how Pubmed accepts a python list. If you enter PMIDs by hand it works ok, but if you feed it a python list you get an internal server error.

Instead of using the procedure from the Cookbook, where you feed the list:

>>> fetch_handle = Entrez.esearch(db="pubmed", term="orchid", retmax=463)
>>> record = Entrez.read(fetch_handle)
>>> idlist = record["IdList"]
>>> record_handle = Entrez.efetch(db="pubmed", id=idlist, rettype="medline", retmode="text")

Use this slightly modified line for record_handle. With the ",".join(idlist) you convert the idlist python list to a comma separated string, which works as expected. 

>>> fetch_handle = Entrez.esearch(db="pubmed", term="orchid", retmax=463)
>>> record = Entrez.read(fetch_handle)
>>> idlist = record["IdList"]
>>> record_handle = Entrez.efetch(db="pubmed", id=",".join(idlist), rettype="medline", retmode="text")


Kind regards,
Matej



----------------------------------------------------------
Matej Repi?
Junior Researcher

Laboratory for Biocomputing and Bioinformatics
National Institute of Chemistry
Hajdrihova 19
SI-1001 Ljubljana POB 660
Slovenia

tel: +386-1-4760457
e-mail: matej.repic at ki.si
----------------------------------------------------------




From p.j.a.cock at googlemail.com  Fri Feb 17 13:36:13 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 17 Feb 2012 13:36:13 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
References: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
Message-ID: <CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>

On Fri, Feb 17, 2012 at 1:14 PM, Matej Repi? <Matej.Repic at ki.si> wrote:
> Fortunately, the fix is quite simple:
>
> Substitute the id=idlist in you fetch line with id=",".join(idlist).
>

Hi Matej,

Well spotted. The idea is that this call,

Entrez.efetch(db="pubmed", id=['22307645', '22303114', '22301129',
'22299544', '22298842'], rettype="medline", retmode="text")

accesses this URL (where I have removed the email entry) which used to work
but isn't following the letter of the specification:

http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?retmode=text&tool=biopython&db=pubmed&id=22307645&id=22303114&id=22301129&id=22299544&id=22298842&rettype=medline

Whereas this call:

h = Entrez.efetch(db="pubmed",
id="22307645,22303114,22301129,22299544,22298842", rettype="medline",
retmode="text")

actually uses a different URL (which the NCBI would approve of):

http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?retmode=text&tool=biopython&db=pubmed&id=22307645%2C22303114%2C22301129%2C22299544%2C22298842&rettype=medline

It is possible the NCBI may opt to "fix" this, but it looks like it was only
working in the past by accident. However, we can do the conversion inside
the Bio.Entrez.efetch function in future - we're due for another Biopython
release now anyway so you shouldn't have to wait too long.

I'm having general errors from the Entrez server right now - so I can't confirm
the problem or test the potential fix yet.

Peter



From p.j.a.cock at googlemail.com  Fri Feb 17 14:41:26 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 17 Feb 2012 14:41:26 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>
References: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
	<CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>
Message-ID: <CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>

On Fri, Feb 17, 2012 at 1:36 PM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
> On Fri, Feb 17, 2012 at 1:14 PM, Matej Repi? <Matej.Repic at ki.si> wrote:
>> Fortunately, the fix is quite simple:
>>
>> Substitute the id=idlist in you fetch line with id=",".join(idlist).
>>
>
> Hi Matej,
>
> Well spotted. ...
>
> It is possible the NCBI may opt to "fix" this, but it looks like it was only
> working in the past by accident. However, we can do the conversion inside
> the Bio.Entrez.efetch function in future - we're due for another Biopython
> release now anyway so you shouldn't have to wait too long.
>
> I'm having general errors from the Entrez server right now - so I can't confirm
> the problem or test the potential fix yet.

I guess they kicked the server or something - it is working again now, and
I could confirm Matej Repi?'s findings and test my fix based on them:
https://github.com/biopython/biopython/commit/01b091cd4679b58d7e478734324528dd9d52f3ed

If anyone needs the fix right now, you must install Biopython from source,
or at least update the Bio/Entrez/__init__.py file by hand. Some testing
would be appreciated - and then we'll try to expedite the release of
Biopython 1.59 by the end of the month.

Peter

P.S. If anyone wants a small challenge for contributing to Biopython, an
online unit test for this and other things in Bio.Entrez would be great.
Please ask for more information on the biopython-dev list if you're
interested in helping out.



From jgrant at smith.edu  Fri Feb 17 14:52:21 2012
From: jgrant at smith.edu (Jessica Grant)
Date: Fri, 17 Feb 2012 09:52:21 -0500
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
	Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch:
	Getting HTTP Error 500
In-Reply-To: <CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>
References: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
	<CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>
	<CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>
Message-ID: <937A6C1B-3C8D-4820-AD11-FA2BA730B047@smith.edu>

My problem was fixed by changing the db to "nuccore" and the rettype to "fasta".  Up until the other day, I was successfully using "nucleotide" and "gb".

Jessica







On Feb 17, 2012, at 9:41 AM, Peter Cock wrote:

> On Fri, Feb 17, 2012 at 1:36 PM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
>> On Fri, Feb 17, 2012 at 1:14 PM, Matej Repi? <Matej.Repic at ki.si> wrote:
>>> Fortunately, the fix is quite simple:
>>> 
>>> Substitute the id=idlist in you fetch line with id=",".join(idlist).
>>> 
>> 
>> Hi Matej,
>> 
>> Well spotted. ...
>> 
>> It is possible the NCBI may opt to "fix" this, but it looks like it was only
>> working in the past by accident. However, we can do the conversion inside
>> the Bio.Entrez.efetch function in future - we're due for another Biopython
>> release now anyway so you shouldn't have to wait too long.
>> 
>> I'm having general errors from the Entrez server right now - so I can't confirm
>> the problem or test the potential fix yet.
> 
> I guess they kicked the server or something - it is working again now, and
> I could confirm Matej Repi?'s findings and test my fix based on them:
> https://github.com/biopython/biopython/commit/01b091cd4679b58d7e478734324528dd9d52f3ed
> 
> If anyone needs the fix right now, you must install Biopython from source,
> or at least update the Bio/Entrez/__init__.py file by hand. Some testing
> would be appreciated - and then we'll try to expedite the release of
> Biopython 1.59 by the end of the month.
> 
> Peter
> 
> P.S. If anyone wants a small challenge for contributing to Biopython, an
> online unit test for this and other things in Bio.Entrez would be great.
> Please ask for more information on the biopython-dev list if you're
> interested in helping out.
> 
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython




From schnoes at gmail.com  Fri Feb 17 17:33:59 2012
From: schnoes at gmail.com (Alexandra Schnoes)
Date: Fri, 17 Feb 2012 09:33:59 -0800
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <937A6C1B-3C8D-4820-AD11-FA2BA730B047@smith.edu>
References: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
	<CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>
	<CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>
	<937A6C1B-3C8D-4820-AD11-FA2BA730B047@smith.edu>
Message-ID: <CABZpzJck8y4hcv7Ldez0455DubkH1sAkPMw0GHUG5=B3AYkSoA@mail.gmail.com>

Wow. That was quick! Thanks guys!
Alex

On Fri, Feb 17, 2012 at 6:52 AM, Jessica Grant <jgrant at smith.edu> wrote:

> My problem was fixed by changing the db to "nuccore" and the rettype to
> "fasta".  Up until the other day, I was successfully using "nucleotide" and
> "gb".
>
> Jessica
>
>
>
>
>
>
>
> On Feb 17, 2012, at 9:41 AM, Peter Cock wrote:
>
> > On Fri, Feb 17, 2012 at 1:36 PM, Peter Cock <p.j.a.cock at googlemail.com>
> wrote:
> >> On Fri, Feb 17, 2012 at 1:14 PM, Matej Repi? <Matej.Repic at ki.si> wrote:
> >>> Fortunately, the fix is quite simple:
> >>>
> >>> Substitute the id=idlist in you fetch line with id=",".join(idlist).
> >>>
> >>
> >> Hi Matej,
> >>
> >> Well spotted. ...
> >>
> >> It is possible the NCBI may opt to "fix" this, but it looks like it was
> only
> >> working in the past by accident. However, we can do the conversion
> inside
> >> the Bio.Entrez.efetch function in future - we're due for another
> Biopython
> >> release now anyway so you shouldn't have to wait too long.
> >>
> >> I'm having general errors from the Entrez server right now - so I can't
> confirm
> >> the problem or test the potential fix yet.
> >
> > I guess they kicked the server or something - it is working again now,
> and
> > I could confirm Matej Repi?'s findings and test my fix based on them:
> >
> https://github.com/biopython/biopython/commit/01b091cd4679b58d7e478734324528dd9d52f3ed
> >
> > If anyone needs the fix right now, you must install Biopython from
> source,
> > or at least update the Bio/Entrez/__init__.py file by hand. Some testing
> > would be appreciated - and then we'll try to expedite the release of
> > Biopython 1.59 by the end of the month.
> >
> > Peter
> >
> > P.S. If anyone wants a small challenge for contributing to Biopython, an
> > online unit test for this and other things in Bio.Entrez would be great.
> > Please ask for more information on the biopython-dev list if you're
> > interested in helping out.
> >
> > _______________________________________________
> > Biopython mailing list  -  Biopython at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/biopython
>
>
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



From Matej.Repic at ki.si  Fri Feb 17 21:21:24 2012
From: Matej.Repic at ki.si (=?utf-8?B?TWF0ZWogUmVwacSN?=)
Date: Fri, 17 Feb 2012 21:21:24 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>
References: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
	<CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>
	<CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>
Message-ID: <7E558ACD-59B7-41B0-BE87-998704A3940C@ki.si>

The fix is working for me. I updated the __init__.py by hand and now both approaches work. By both i mean id=idlist or id=",".join(idlist).

Great and quick fix!

Regards,
Matej


On 17. feb. 2012, at 15:41, Peter Cock wrote:

> On Fri, Feb 17, 2012 at 1:36 PM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
>> On Fri, Feb 17, 2012 at 1:14 PM, Matej Repi? <Matej.Repic at ki.si> wrote:
>>> Fortunately, the fix is quite simple:
>>> 
>>> Substitute the id=idlist in you fetch line with id=",".join(idlist).
>>> 
>> 
>> Hi Matej,
>> 
>> Well spotted. ...
>> 
>> It is possible the NCBI may opt to "fix" this, but it looks like it was only
>> working in the past by accident. However, we can do the conversion inside
>> the Bio.Entrez.efetch function in future - we're due for another Biopython
>> release now anyway so you shouldn't have to wait too long.
>> 
>> I'm having general errors from the Entrez server right now - so I can't confirm
>> the problem or test the potential fix yet.
> 
> I guess they kicked the server or something - it is working again now, and
> I could confirm Matej Repi?'s findings and test my fix based on them:
> https://github.com/biopython/biopython/commit/01b091cd4679b58d7e478734324528dd9d52f3ed
> 
> If anyone needs the fix right now, you must install Biopython from source,
> or at least update the Bio/Entrez/__init__.py file by hand. Some testing
> would be appreciated - and then we'll try to expedite the release of
> Biopython 1.59 by the end of the month.
> 
> Peter
> 
> P.S. If anyone wants a small challenge for contributing to Biopython, an
> online unit test for this and other things in Bio.Entrez would be great.
> Please ask for more information on the biopython-dev list if you're
> interested in helping out.




From p.j.a.cock at googlemail.com  Fri Feb 17 22:33:23 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 17 Feb 2012 22:33:23 +0000
Subject: [Biopython] Bio/Entrez/efetch: Getting HTTP Error 500
 Bio/Entrez/efetch: Getting HTTP Error 500 Bio/Entrez/efetch: Getting HTTP
 Error 500
In-Reply-To: <7E558ACD-59B7-41B0-BE87-998704A3940C@ki.si>
References: <985E73BE-35D3-422D-8CC4-470FF9040C78@ki.si>
	<CAKVJ-_6DaZcb94TqkeKfjXL7jn8a=1Q9+EL7L3WhR79_fvueSg@mail.gmail.com>
	<CAKVJ-_7KgGP4BifXFAEnjBQ1uxDg9DnVEWsSn6SJC+6urTtYRw@mail.gmail.com>
	<7E558ACD-59B7-41B0-BE87-998704A3940C@ki.si>
Message-ID: <CAKVJ-_4jh75=WfD75vHp40uC+KXgFwYOncEOOENgGwbgyC3G6g@mail.gmail.com>

On Fri, Feb 17, 2012 at 9:21 PM, Matej Repi? <Matej.Repic at ki.si> wrote:
> The fix is working for me. I updated the __init__.py by hand
> and now both approaches work. By both i mean id=idlist or
> id=",".join(idlist).
>
> Great and quick fix!
>
> Regards,
> Matej

Great - independent testing is always good, thanks.

The NCBI have now announced this change was a deliberate
tightening up of the Entrez API, so we do need this fix in
Biopython to avoid existing scripts breaking:
http://www.ncbi.nlm.nih.gov/mailman/pipermail/utilities-announce/2012-February/000086.html

Peter



From mictadlo at gmail.com  Sat Feb 18 07:53:32 2012
From: mictadlo at gmail.com (Mic)
Date: Sat, 18 Feb 2012 17:53:32 +1000
Subject: [Biopython] Google Summer of Code 2012
Message-ID: <CAOP6n=i4SSrWN-jOyyRyy2FVJMyF-ad4=g3FRm=UTifHKX2ZEw@mail.gmail.com>

Hi all,
would it be possible to put the following idea to Google Summer of Code
2012:
* http://www.biogems.info/ for Biopython with
http://pypi.python.org/pypi/pip . Could include pysam, GFF3, OBO/OWL (see
below) and so on.

Cheers,

On Tue, Dec 27, 2011 at 3:55 AM, Martin Mokrejs <mmokrejs at fold.natur.cuni.cz
> wrote:

> Hi,
>  I would like to parse some OBO/OWL files in python. I searched
> for some existing code and found http://biopython.org/wiki/Gene_Ontology
> pointing to some OWL parser from Ed Cannon (follow a link on the page
> listed above). Unfortunately, the code is gone? :((
>
>  I also discovered an OBO parser at http://hal.elte.hu/~nepusz/development
> ,
> the sources can be fetched from
>
> http://bazaar.launchpad.net/~ntamas/+junk/go-parser/tarball/7?start_revid=7
>
>  It can open the .obo files for me although I do not see much methods
> available.
>
>  Finally, I found
> https://github.com/gotgenes/biopython/tree/a4824ceb71f3a687b3eb5e1fefd0ad3c278bf185/Bio/GO so
> my question is when will this be available in released biopython
> and what are your opinions/suggestions now. Does it offer more than the
> go-parser from ~ntamas?
>
>  I want to cluster some sequences based on anatomical terms, so
> I think what I want is to be able to lookup easily all parents
> (probably except the very root node or so) and compare whether
> they overlap with any parent of another sequence.
>
> Thank you for your comments,
> Martin
> P.S.: I want to parse OBO from http://www.evocontology.org/
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From eric.talevich at gmail.com  Sat Feb 18 16:34:18 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Sat, 18 Feb 2012 11:34:18 -0500
Subject: [Biopython] Bio.Phylo bugs & pain points
Message-ID: <CAMC681nQF3u-xFW9ekzfi6mBzqZmp10oEfShPQNDefr8LMAmjA@mail.gmail.com>

Folks,

Since we're coming up on another release of Biopython, I'd like to identify
any remaing bugs, pain points, aesthetic flaws, and minor missing features
in Bio.Phylo. (And hopefully, fix them before the release.)

In particular, the Phylo.draw() function, which plots a rooted phylogram
with matplotlib, appeared in the last Biopython release unannounced. There
are already many tree-drawing programs that produce beautiful
publication-quality graphics, and we're not trying to compete with those.
But we do want it to be useful for quickly visualizing a tree as you
develop a script or modify a tree interactively in IPython, for example. So
-- do the trees drawn by Phylo.draw() look right?

Thanks,
Eric


From mjldehoon at yahoo.com  Sat Feb 18 16:46:33 2012
From: mjldehoon at yahoo.com (Michiel de Hoon)
Date: Sat, 18 Feb 2012 08:46:33 -0800 (PST)
Subject: [Biopython] Bio.Phylo bugs & pain points
In-Reply-To: <CAMC681nQF3u-xFW9ekzfi6mBzqZmp10oEfShPQNDefr8LMAmjA@mail.gmail.com>
Message-ID: <1329583593.82866.YahooMailClassic@web161202.mail.bf1.yahoo.com>

Hi Eric,

> But we do want it to be useful for quickly visualizing a
> tree as you develop a script or modify a tree
> interactively in IPython, for example.

Do you need IPython or is regular Python sufficient?

-Michiel.

--- On Sat, 2/18/12, Eric Talevich <eric.talevich at gmail.com> wrote:

> From: Eric Talevich <eric.talevich at gmail.com>
> Subject: [Biopython] Bio.Phylo bugs & pain points
> To: "BioPython Mailing List" <biopython at lists.open-bio.org>, "BioPython-Dev Mailing List" <biopython-dev at biopython.org>
> Date: Saturday, February 18, 2012, 11:34 AM
> Folks,
> 
> Since we're coming up on another release of Biopython, I'd
> like to identify
> any remaing bugs, pain points, aesthetic flaws, and minor
> missing features
> in Bio.Phylo. (And hopefully, fix them before the release.)
> 
> In particular, the Phylo.draw() function, which plots a
> rooted phylogram
> with matplotlib, appeared in the last Biopython release
> unannounced. There
> are already many tree-drawing programs that produce
> beautiful
> publication-quality graphics, and we're not trying to
> compete with those.
> But we do want it to be useful for quickly visualizing a
> tree as you
> develop a script or modify a tree interactively in IPython,
> for example. So
> -- do the trees drawn by Phylo.draw() look right?
> 
> Thanks,
> Eric
> _______________________________________________
> Biopython mailing list? -? Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
> 



From eric.talevich at gmail.com  Sat Feb 18 16:52:16 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Sat, 18 Feb 2012 11:52:16 -0500
Subject: [Biopython] Have you used Bio.Phylo in a published study?
Message-ID: <CAMC681=Vgjhv20OvTq3R2Z2tfOB0FonRLwO57W5ojutV0j_0+A@mail.gmail.com>

Folks,

Now that Bio.Phylo has reached a somewhat stable point, we're preparing a
journal article on it. I'd like to mention and cite some published studies
in which Bio.Phylo was used for some part of the analysis. Has anyone here
published a study that relied on the Phylo module of Biopython?

I know of two so far:
http://www.biology-direct.com/content/6/1/34/
http://www.biomedcentral.com/1471-2148/11/321

Thanks,
Eric


From eric.talevich at gmail.com  Sat Feb 18 16:54:03 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Sat, 18 Feb 2012 11:54:03 -0500
Subject: [Biopython] Bio.Phylo bugs & pain points
In-Reply-To: <1329583593.82866.YahooMailClassic@web161202.mail.bf1.yahoo.com>
References: <CAMC681nQF3u-xFW9ekzfi6mBzqZmp10oEfShPQNDefr8LMAmjA@mail.gmail.com>
	<1329583593.82866.YahooMailClassic@web161202.mail.bf1.yahoo.com>
Message-ID: <CAMC681=oW-dphYqezoug_NTAr_eJJJWJQ1T5yKqWVmFfLJ35uQ@mail.gmail.com>

On Sat, Feb 18, 2012 at 11:46 AM, Michiel de Hoon <mjldehoon at yahoo.com>wrote:

> Hi Eric,
>
> > But we do want it to be useful for quickly visualizing a
> > tree as you develop a script or modify a tree
> > interactively in IPython, for example.
>
> Do you need IPython or is regular Python sufficient?
>
> -Michiel.
>

Regular Python plus matplotlib is sufficient. IPython has convenient
integration with pylab, that's all.
-E


>
> --- On Sat, 2/18/12, Eric Talevich <eric.talevich at gmail.com> wrote:
>
> > From: Eric Talevich <eric.talevich at gmail.com>
> > Subject: [Biopython] Bio.Phylo bugs & pain points
> > To: "BioPython Mailing List" <biopython at lists.open-bio.org>,
> "BioPython-Dev Mailing List" <biopython-dev at biopython.org>
> > Date: Saturday, February 18, 2012, 11:34 AM
> > Folks,
> >
> > Since we're coming up on another release of Biopython, I'd
> > like to identify
> > any remaing bugs, pain points, aesthetic flaws, and minor
> > missing features
> > in Bio.Phylo. (And hopefully, fix them before the release.)
> >
> > In particular, the Phylo.draw() function, which plots a
> > rooted phylogram
> > with matplotlib, appeared in the last Biopython release
> > unannounced. There
> > are already many tree-drawing programs that produce
> > beautiful
> > publication-quality graphics, and we're not trying to
> > compete with those.
> > But we do want it to be useful for quickly visualizing a
> > tree as you
> > develop a script or modify a tree interactively in IPython,
> > for example. So
> > -- do the trees drawn by Phylo.draw() look right?
> >
> > Thanks,
> > Eric
> > _______________________________________________
> > Biopython mailing list  -  Biopython at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/biopython
> >
>


From eric.talevich at gmail.com  Sat Feb 18 17:11:27 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Sat, 18 Feb 2012 12:11:27 -0500
Subject: [Biopython] Bio.Phylo bugs & pain points
In-Reply-To: <CAMC681nQF3u-xFW9ekzfi6mBzqZmp10oEfShPQNDefr8LMAmjA@mail.gmail.com>
References: <CAMC681nQF3u-xFW9ekzfi6mBzqZmp10oEfShPQNDefr8LMAmjA@mail.gmail.com>
Message-ID: <CAMC681kVjz7rWvxpzq6Op_AW9qdJJYr11sUj7=XJMLjXpWygiw@mail.gmail.com>

On Sat, Feb 18, 2012 at 11:34 AM, Eric Talevich <eric.talevich at gmail.com>wrote:

> So -- do the trees drawn by Phylo.draw() look right?
>
>
Here's how to get a quick tree, using a test file from the Biopython source
distribution:

>>> from Bio import Phylo
>>> tree = Phylo.read("Tests/PhyloXML/apaf.xml", "phyloxml")
>>> Phylo.draw(tree)


If you don't have the Tests/ directory, you can use any other Newick, Nexus
or PhyloXML tree; just change the file name and format name in the call to
Phylo.read().

Thanks,
Eric


From mictadlo at gmail.com  Mon Feb 20 06:37:59 2012
From: mictadlo at gmail.com (Mic)
Date: Mon, 20 Feb 2012 16:37:59 +1000
Subject: [Biopython] retrieving paired sequences from BAM
Message-ID: <CAOP6n=jbd5UKRjXsij9EFmeXCd7KBzS4uKzAHR5x8-utuv4PgA@mail.gmail.com>

Hello,
I am trying to retrieve paired end sequences from BAM file. However, I am
only able to retrieve the A sequence with the following code:
''''''''''''''''''''''''''''''''''''''''
import pysam
samfile = pysam.Samfile("b.sorted.bam", "rb")
for read in samfile.fetch():
        if read.is_paired:
                print read.qname
                print read.seq
samfile.close()

$ python a.py | head -n 2
HWI-ST226_0154:4:1206:12773:170407#CTTGTA
AGTATAAAACTAAGCAAACTGTTAGAACTTTGATTACGTTTTGTTTATCAGTGATACGCAAAAGTTTAAGATCCTTGAGTACCTCTTTCGATGGCGGATT
''''''''''''''''''''''''''''''''''''''''

How is it possible to retrieve also the B sequence?
What is the difference between is_proper_pair and is_paired?

-------------
$ grep -A 1 'HWI-ST226_0154:4:1206:12773:170407#CTTGTA' X_A.fastq
@HWI-ST226_0154:4:1206:12773:170407#CTTGTA/1
AGTATAAAACTAAGCAAACTGTTAGAACTTTGATTACGTTTTGTTTATCAGTGATACGCAAAAGTTTAAGATCCTTGAGTACCTCTTTCGATGGCGGATT

$ grep -A 1 'HWI-ST226_0154:4:1206:12773:170407#CTTGTA' X_B.fastq
@HWI-ST226_0154:4:1206:12773:170407#CTTGTA/2
GGCGCTGTGACTGAAGTCCTCAGATTTCGGTACGGTTTTGTCTATTTCTGGGTTCCTGCGGAAACACCTTCTCGATTATTTTCTAATCTCAATTAGGTTT
-------------

Thank you in advance.

Cheers


From MatatTHC at gmx.de  Wed Feb 22 15:06:02 2012
From: MatatTHC at gmx.de (Matthias Bernt)
Date: Wed, 22 Feb 2012 16:06:02 +0100
Subject: [Biopython] Degenerated Codons
Message-ID: <20120222150602.313750@gmx.net>

Hi, 

Is there a some functionality:
- to list X-fold degenerated codons? 
- to test if a codon is X-fold degenerated?
- to return X for a given codon 
in biopython? 
        
If not then we might forward this to the dev-list. I would try to implement this. 

Matthias
-- 
Empfehlen Sie GMX DSL Ihren Freunden und Bekannten und wir
belohnen Sie mit bis zu 50,- Euro! https://freundschaftswerbung.gmx.de


From p.j.a.cock at googlemail.com  Wed Feb 22 15:58:36 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 22 Feb 2012 15:58:36 +0000
Subject: [Biopython] Degenerated Codons
In-Reply-To: <20120222150602.313750@gmx.net>
References: <20120222150602.313750@gmx.net>
Message-ID: <CAKVJ-_4Fj08FRVPYomxcjMiK3EuCxWQ=iRxKJU0dxPichHPcAw@mail.gmail.com>

On Wed, Feb 22, 2012 at 3:06 PM, Matthias Bernt <MatatTHC at gmx.de> wrote:
> Hi,
>
> Is there a some functionality:
> - to list X-fold degenerated codons?
> - to test if a codon is X-fold degenerated?
> - to return X for a given codon
> in biopython?
>
> If not then we might forward this to the dev-list. I would try to implement this.
>
> Matthias

Hi Matthias,

You can probably do that with the codon dictionaries
provided in Bio.Data.CodonTable (used for translations).
If you could give some specific examples of input and
desired output I'm sure we can give you more hints.

Peter


From MatatTHC at gmx.de  Thu Feb 23 11:00:42 2012
From: MatatTHC at gmx.de (Matthias Bernt)
Date: Thu, 23 Feb 2012 12:00:42 +0100
Subject: [Biopython] Degenerated Codons
In-Reply-To: <CAKVJ-_4Fj08FRVPYomxcjMiK3EuCxWQ=iRxKJU0dxPichHPcAw@mail.gmail.com>
References: <20120222150602.313750@gmx.net>
	<CAKVJ-_4Fj08FRVPYomxcjMiK3EuCxWQ=iRxKJU0dxPichHPcAw@mail.gmail.com>
Message-ID: <CALNFT0hvM6V625MbTn6qVGNKXnmsTrFK_tr7fKcePb-Nz4kVqA@mail.gmail.com>

Hi,

You can probably do that with the codon dictionaries
> provided in Bio.Data.CodonTable (used for translations).
> If you could give some specific examples of input and
> desired output I'm sure we can give you more hints.
>

You mean the forward_table?

The most important function for me is:
- Input: Codon (sequence of length 3), code table
- Output: X, number of codons coding for the same
  amino acid as the given codon

Building on this it would be easy to implements:
- Input: Codon, code table, X
- Output: true iff there are X codons coding for the same amino acid

Also important (and maybe the core of the other two functions):
- Input: codon
- Output: list of codons coding for the same amino acid

I think this is it. I need to implement these functions anyway.
So maybe you can give me hints how I should implement it.
For my application it would be acceptable to iterate over the
forward_table for each call.
But maybe its possible to modify the backward_table such
that it stores all codons (as list) for a amino acid. For the other
functions building on it (back translation...) it would be possible
to take the first element of the list.

Matthias


From p.j.a.cock at googlemail.com  Thu Feb 23 11:29:04 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 23 Feb 2012 11:29:04 +0000
Subject: [Biopython] Degenerated Codons
In-Reply-To: <CALNFT0hvM6V625MbTn6qVGNKXnmsTrFK_tr7fKcePb-Nz4kVqA@mail.gmail.com>
References: <20120222150602.313750@gmx.net>
	<CAKVJ-_4Fj08FRVPYomxcjMiK3EuCxWQ=iRxKJU0dxPichHPcAw@mail.gmail.com>
	<CALNFT0hvM6V625MbTn6qVGNKXnmsTrFK_tr7fKcePb-Nz4kVqA@mail.gmail.com>
Message-ID: <CAKVJ-_5SCWbEWiK56iifzKSkVoiKmexPfTqSFd+dmqi18HOCrQ@mail.gmail.com>

On Thu, Feb 23, 2012 at 11:00 AM, Matthias Bernt <MatatTHC at gmx.de> wrote:
> Hi,
>
>> You can probably do that with the codon dictionaries
>> provided in Bio.Data.CodonTable (used for translations).
>> If you could give some specific examples of input and
>> desired output I'm sure we can give you more hints.
>
>
> You mean the forward_table?
>
> The most important function for me is:
> - Input: Codon (sequence of length 3), code table
> - Output: X, number of codons coding for the same
> ? amino acid as the given codon

Where table could be ambiguous or unambiguous,
DNA or RNA? Something like this works nicely for
unambiguous tables:

from Bio.Data.CodonTable import unambiguous_dna_by_id
for table in [unambiguous_dna_by_id[1], unambiguous_dna_by_id[2]]:
    print table.id
    for codon in  ["AAA", "ATT"]:
        amino = table.forward_table[codon]
        alt_codons = [k for (k,v) in table.forward_table.iteritems()
if v==amino]
        print "%s -> %s, %i codons for this amino acid" % (codon,
amino, len(alt_codons))

Giving:

1
AAA -> K, 2 codons for this amino acid
ATT -> I, 3 codons for this amino acid
2
AAA -> K, 2 codons for this amino acid
ATT -> I, 2 codons for this amino acid


> But maybe its possible to modify the backward_table such
> that it stores all codons (as list) for a amino acid. For the other
> functions building on it (back translation...) it would be possible
> to take the first element of the list.

We can't change that for backwards compatibility, but we
could add a alt_backward_table or something instead?

Peter



From marco.galardini at unifi.it  Thu Feb 23 16:05:53 2012
From: marco.galardini at unifi.it (Marco Galardini)
Date: Thu, 23 Feb 2012 17:05:53 +0100
Subject: [Biopython] SeqIO fasta "fakes" recognition
Message-ID: <4F4663E1.5010206@unifi.it>

Hi all,

i was wondering if you are aware of a method to distinguish between 
"real" fasta files and files that just happen to have a ">" character.
I would like to scan a directory and return only the "real" fasta files.
I tried to open a .png file and surprisingly it gave me the following 
results:

SeqIO.parse(open('Screenshot.png'),'fasta').next()
SeqRecord(seq=Seq('?;9r$????8?n??????7M?4???\?r???0????$It??I...q+', 
SingleLetterAlphabet()), 
id='>>DEE\xd1\xaaU+\x8e\x1f?Nxx8g\xce\x9c1\xb8]``', 
name='>>DEE\xd1\xaaU+\x8e\x1f?Nxx8g\xce\x9c1\xb8]``', 
description='>>DEE\xd1\xaaU+\x8e\x1f?Nxx8g\xce\x9c1\xb8]`` 
\x81\x81\x81\xec\xdb\xb7Ok\xf9\xd5\xabW\xf1\xf0\xf0`\xe2\xc4\x89\x8c\x181\x82\x9e={j\x95+\x14', 
dbxrefs=[])

I tried to use some Alphabets but i experienced the same results.
Thanks in advance,
Marco

-- 
-------------------------------------------------
Marco Galardini
DBE - Department of Evolutionary Biology
University of Florence - Italy

e-mail: marco.galardini at unifi.it
www: http://www.unifi.it/dblage/CMpro-v-p-51.html
phone:  +39 055 2288249
mobile: +39 340 2808041
-------------------------------------------------



From p.j.a.cock at googlemail.com  Thu Feb 23 16:21:36 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 23 Feb 2012 16:21:36 +0000
Subject: [Biopython] SeqIO fasta "fakes" recognition
In-Reply-To: <4F4663E1.5010206@unifi.it>
References: <4F4663E1.5010206@unifi.it>
Message-ID: <CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>

On Thu, Feb 23, 2012 at 4:05 PM, Marco Galardini
<marco.galardini at unifi.it> wrote:
> Hi all,
>
> i was wondering if you are aware of a method to distinguish between "real"
> fasta files and files that just happen to have a ">" character.
> I would like to scan a directory and return only the "real" fasta files.
> I tried to open a .png file and surprisingly it gave me the following
> results:

The FASTA parser doesn't attempt to restrict the sequence alphabet,
indeed some FASTA like files do use all sorts of weird characters
(e.g. RNA secondary structure). Also it allows for 'free text' before
the first record (useful in several situations including FASTA records
embedded at the end of a GFF file). As a side effect of this need for
tolerance, the code does its best to read any file you give it - but
this is clearly a case of garbage in, garbage out (GIGO).

Guessing bioinformatics file types is non-trivial, and not something
that Bio.SeqIO attempts to do (unlike BioPerl). We take the Python
approach that you the user need to be explicit, and if you say it is
a FASTA file we'll try to treat it as such.

Detecting image files (or indeed most binary file types) on the other
hand is much easier - so do that instead?

Peter


From eric.talevich at gmail.com  Thu Feb 23 16:35:29 2012
From: eric.talevich at gmail.com (Eric Talevich)
Date: Thu, 23 Feb 2012 11:35:29 -0500
Subject: [Biopython] SeqIO fasta "fakes" recognition
In-Reply-To: <CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>
References: <4F4663E1.5010206@unifi.it>
	<CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>
Message-ID: <CAMC681m8BU4mdcvFt8D5x4FU+AHYqEN-m8DMmWcqFSpb7n1Nkg@mail.gmail.com>

On Thu, Feb 23, 2012 at 11:21 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Feb 23, 2012 at 4:05 PM, Marco Galardini
> <marco.galardini at unifi.it> wrote:
> > Hi all,
> >
> > i was wondering if you are aware of a method to distinguish between
> "real"
> > fasta files and files that just happen to have a ">" character.
> > I would like to scan a directory and return only the "real" fasta files.
> > I tried to open a .png file and surprisingly it gave me the following
> > results:
>
> The FASTA parser doesn't attempt to restrict the sequence alphabet,
> indeed some FASTA like files do use all sorts of weird characters
> (e.g. RNA secondary structure). Also it allows for 'free text' before
> the first record (useful in several situations including FASTA records
> embedded at the end of a GFF file). As a side effect of this need for
> tolerance, the code does its best to read any file you give it - but
> this is clearly a case of garbage in, garbage out (GIGO).
>
> Guessing bioinformatics file types is non-trivial, and not something
> that Bio.SeqIO attempts to do (unlike BioPerl). We take the Python
> approach that you the user need to be explicit, and if you say it is
> a FASTA file we'll try to treat it as such.
>
>
I suppose there's always:

try:
    record = SeqIO.read("gigo.png", "fasta")
    assert str(record.seq).isalpha()
except:
    # complain...


At some point, didn't we discuss adding optional alphabet validation, e.g.
a validate() method or something more automatic?

-Eric


From p.j.a.cock at googlemail.com  Thu Feb 23 16:38:59 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 23 Feb 2012 16:38:59 +0000
Subject: [Biopython] SeqIO fasta "fakes" recognition
In-Reply-To: <CAMC681m8BU4mdcvFt8D5x4FU+AHYqEN-m8DMmWcqFSpb7n1Nkg@mail.gmail.com>
References: <4F4663E1.5010206@unifi.it>
	<CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>
	<CAMC681m8BU4mdcvFt8D5x4FU+AHYqEN-m8DMmWcqFSpb7n1Nkg@mail.gmail.com>
Message-ID: <CAKVJ-_7d9h5d95Va5c61W7q7vGEu59hg203XP4gZjm3XqAYfNw@mail.gmail.com>

On Thu, Feb 23, 2012 at 4:35 PM, Eric Talevich <eric.talevich at gmail.com> wrote:
>
> At some point, didn't we discuss adding optional alphabet validation, e.g. a
> validate() method or something more automatic?
>

Yes, but with no clear best way forward agreed:
http://lists.open-bio.org/pipermail/biopython-dev/2011-December/009343.html
https://redmine.open-bio.org/issues/2597

Peter


From marco.galardini at unifi.it  Thu Feb 23 16:40:25 2012
From: marco.galardini at unifi.it (Marco Galardini)
Date: Thu, 23 Feb 2012 17:40:25 +0100
Subject: [Biopython] SeqIO fasta "fakes" recognition
In-Reply-To: <CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>
References: <4F4663E1.5010206@unifi.it>
	<CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>
Message-ID: <4F466BF9.6080805@unifi.it>

On 02/23/2012 05:21 PM, Peter Cock wrote:
> On Thu, Feb 23, 2012 at 4:05 PM, Marco Galardini
> <marco.galardini at unifi.it>  wrote:
>> Hi all,
>>
>> i was wondering if you are aware of a method to distinguish between "real"
>> fasta files and files that just happen to have a ">" character.
>> I would like to scan a directory and return only the "real" fasta files.
>> I tried to open a .png file and surprisingly it gave me the following
>> results:
> Guessing bioinformatics file types is non-trivial, and not something
> that Bio.SeqIO attempts to do (unlike BioPerl). We take the Python
> approach that you the user need to be explicit, and if you say it is
> a FASTA file we'll try to treat it as such.
You're right: probably the best thing to do will be to trust users and 
hope they won't push garbage as inputs.
> Detecting image files (or indeed most binary file types) on the other
> hand is much easier - so do that instead?
>
In principle this is true, but the fact is that i think it won't be easy 
or straightforward to account for all possible file formats that can be 
found in a given directory. I'll stick to good python principles and 
hope to have smart-enough users :)

Thanks for your instant reply.
Marco

-- 
-------------------------------------------------
Marco Galardini
DBE - Department of Evolutionary Biology
University of Florence - Italy

e-mail: marco.galardini at unifi.it
www: http://www.unifi.it/dblage/CMpro-v-p-51.html
phone:  +39 055 2288249
mobile: +39 340 2808041
-------------------------------------------------



From marco.galardini at unifi.it  Thu Feb 23 17:38:26 2012
From: marco.galardini at unifi.it (Marco Galardini)
Date: Thu, 23 Feb 2012 18:38:26 +0100
Subject: [Biopython] SeqIO fasta "fakes" recognition
In-Reply-To: <CAMC681m8BU4mdcvFt8D5x4FU+AHYqEN-m8DMmWcqFSpb7n1Nkg@mail.gmail.com>
References: <4F4663E1.5010206@unifi.it>
	<CAKVJ-_5x6q2+m1WAA61hiod8hS25Qb_DCCm8-MiPzGQibORpGw@mail.gmail.com>
	<CAMC681m8BU4mdcvFt8D5x4FU+AHYqEN-m8DMmWcqFSpb7n1Nkg@mail.gmail.com>
Message-ID: <4F467992.9060205@unifi.it>

On 02/23/2012 05:35 PM, Eric Talevich wrote:
>
> I suppose there's always:
>
> try:
>      record = SeqIO.read("gigo.png", "fasta")
>      assert str(record.seq).isalpha()
> except:
>      # complain...
>
>
Thanks for the hint, I've implemented this (using the parse method) and 
i'll see how it will perform (i guess it will had some overhead).
Marco

-- 
-------------------------------------------------
Marco Galardini
DBE - Department of Evolutionary Biology
University of Florence - Italy

e-mail: marco.galardini at unifi.it
www: http://www.unifi.it/dblage/CMpro-v-p-51.html
phone:  +39 055 2288249
mobile: +39 340 2808041
-------------------------------------------------



From MatatTHC at gmx.de  Thu Feb 23 21:09:18 2012
From: MatatTHC at gmx.de (Matthias Bernt)
Date: Thu, 23 Feb 2012 22:09:18 +0100
Subject: [Biopython] Degenerated Codons
In-Reply-To: <CAKVJ-_5SCWbEWiK56iifzKSkVoiKmexPfTqSFd+dmqi18HOCrQ@mail.gmail.com>
References: <20120222150602.313750@gmx.net>
	<CAKVJ-_4Fj08FRVPYomxcjMiK3EuCxWQ=iRxKJU0dxPichHPcAw@mail.gmail.com>
	<CALNFT0hvM6V625MbTn6qVGNKXnmsTrFK_tr7fKcePb-Nz4kVqA@mail.gmail.com>
	<CAKVJ-_5SCWbEWiK56iifzKSkVoiKmexPfTqSFd+dmqi18HOCrQ@mail.gmail.com>
Message-ID: <CALNFT0gLSht47aWa3qpx_59G0O8_5cM5RN4ogTD3A0LA-oMn4A@mail.gmail.com>

hi peter,

Thank you for the suggestions. I will try to create the functions as
suggested.
Should I post them here?


> Where table could be ambiguous or unambiguous,
> DNA or RNA? Something like this works nicely for
> unambiguous tables:
>
> from Bio.Data.CodonTable import unambiguous_dna_by_id
> for table in [unambiguous_dna_by_id[1], unambiguous_dna_by_id[2]]:
>    print table.id
>    for codon in  ["AAA", "ATT"]:
>        amino = table.forward_table[codon]
>        alt_codons = [k for (k,v) in table.forward_table.iteritems()
> if v==amino]
>        print "%s -> %s, %i codons for this amino acid" % (codon,
> amino, len(alt_codons))
>
> Giving:
>
> 1
> AAA -> K, 2 codons for this amino acid
> ATT -> I, 3 codons for this amino acid
> 2
> AAA -> K, 2 codons for this amino acid
> ATT -> I, 2 codons for this amino acid
>
>
> > But maybe its possible to modify the backward_table such
> > that it stores all codons (as list) for a amino acid. For the other
> > functions building on it (back translation...) it would be possible
> > to take the first element of the list.
>
> We can't change that for backwards compatibility, but we
> could add a alt_backward_table or something instead
>

I think we keep it as it is at the moment. Performance is not so important
for me .. so far.
Optimisation can still be done later.

Matthias


From fenggao0907 at yahoo.com.cn  Thu Feb 23 21:35:23 2012
From: fenggao0907 at yahoo.com.cn (=?utf-8?B?6auY5YekKEZlbmcgR0FPKQ==?=)
Date: Fri, 24 Feb 2012 05:35:23 +0800 (CST)
Subject: [Biopython]  Entrez and SeqIO "no records found in handle"
Message-ID: <1330032923.65491.YahooMailNeo@web15106.mail.cnb.yahoo.com>

Hi all,
We have some python code using gi number to get record from Genbank.
Part of the code is:

handle = Entrez.efetch(db="protein", id=ID, rettype="gb")
record = SeqIO.read(handle,"genbank")

We have had no problem with this code
 until this week when we started getting "ValueError: No records found in handle".
Anyone have an idea how to fix it now? Thanks!
Feng
?
--------------------------------------Ms. Feng Gao
Department of Biological Sciences
Smith College
Northampton, MA 01063
USA
&
Laboratory of Protozoology
Institute of Evolution and Marine Biodiversity
Ocean University of China
266003 Qingdao
China
E-mail: fenggao0907 at yahoo.com.cn
--------------------------------------


From p.j.a.cock at googlemail.com  Thu Feb 23 23:00:17 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 23 Feb 2012 23:00:17 +0000
Subject: [Biopython] Degenerated Codons
In-Reply-To: <CALNFT0gLSht47aWa3qpx_59G0O8_5cM5RN4ogTD3A0LA-oMn4A@mail.gmail.com>
References: <20120222150602.313750@gmx.net>
	<CAKVJ-_4Fj08FRVPYomxcjMiK3EuCxWQ=iRxKJU0dxPichHPcAw@mail.gmail.com>
	<CALNFT0hvM6V625MbTn6qVGNKXnmsTrFK_tr7fKcePb-Nz4kVqA@mail.gmail.com>
	<CAKVJ-_5SCWbEWiK56iifzKSkVoiKmexPfTqSFd+dmqi18HOCrQ@mail.gmail.com>
	<CALNFT0gLSht47aWa3qpx_59G0O8_5cM5RN4ogTD3A0LA-oMn4A@mail.gmail.com>
Message-ID: <CAKVJ-_7MtFS-rrvk2+LEjh+mMbLXx=Ko+Jsqn0FfinWZToBh1Q@mail.gmail.com>

On Thu, Feb 23, 2012 at 9:09 PM, Matthias Bernt <MatatTHC at gmx.de> wrote:
> hi peter,
>
> Thank you for the suggestions. I will try to create the functions as
> suggested.
> Should I post them here?

Sure - or on the wiki under a new 'Cookbook' entry?
http://biopython.org/wiki/Category:Cookbook

> I think we keep it as it is at the moment. Performance is not so important
> for me .. so far.
> Optimisation can still be done later.

Of course :)

Do you know the quote "premature optimization is the root of all evil"?

Peter


From p.j.a.cock at googlemail.com  Thu Feb 23 23:03:01 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 23 Feb 2012 23:03:01 +0000
Subject: [Biopython] Entrez and SeqIO "no records found in handle"
In-Reply-To: <1330032923.65491.YahooMailNeo@web15106.mail.cnb.yahoo.com>
References: <1330032923.65491.YahooMailNeo@web15106.mail.cnb.yahoo.com>
Message-ID: <CAKVJ-_4sX-Qp8ObXuvXrmyhX=KjbJ2vzky0kB1HPU5PczQapgQ@mail.gmail.com>

2012/2/23 ??(Feng GAO) <fenggao0907 at yahoo.com.cn>:
> Hi all,
> We have some python code using gi number to get record from Genbank.
> Part of the code is:
>
> handle = Entrez.efetch(db="protein", id=ID, rettype="gb")
> record = SeqIO.read(handle,"genbank")
>
> We have had no problem with this code
>  until this week when we started getting "ValueError: No records found in handle".
> Anyone have an idea how to fix it now? Thanks!
> Feng

Try using an explicit retmode="text" in the efetch call.
The NCBI changed the defaults with EFetch 2.0, which
went live earlier this month. You're probably getting
XML back instead.

Note to self: I wonder if the Biopython tutorial examples
need to be updated as well...

Peter



From p.j.a.cock at googlemail.com  Fri Feb 24 16:56:11 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 24 Feb 2012 16:56:11 +0000
Subject: [Biopython] Biopython 1.59 released
Message-ID: <CAKVJ-_6zJRpv4A2P_fF1Hbpog12dahbTzQmmjZf7L3NWZobGpQ@mail.gmail.com>

Dear Biopythoneers,

Biopython 1.59 is out:
http://news.open-bio.org/news/2012/02/biopython-1-59-released/

Thank you to everyone who has contributed.

Peter

P.S. We're on Twitter as @Biopython


From idoerg at gmail.com  Fri Feb 24 17:02:19 2012
From: idoerg at gmail.com (Iddo Friedberg)
Date: Fri, 24 Feb 2012 12:02:19 -0500
Subject: [Biopython] Biopython 1.59 released
In-Reply-To: <CAKVJ-_6zJRpv4A2P_fF1Hbpog12dahbTzQmmjZf7L3NWZobGpQ@mail.gmail.com>
References: <CAKVJ-_6zJRpv4A2P_fF1Hbpog12dahbTzQmmjZf7L3NWZobGpQ@mail.gmail.com>
Message-ID: <CABm4-MSrAOVG3DqEK8AT_A4w+OZFC4vNGgoR=eQCqkH2=M5mvQ@mail.gmail.com>

As an ex- (and hopefully future?) contributer and a strong cheerleader and
user: thanks Peter and all developers for all the hard work!

On Fri, Feb 24, 2012 at 11:56 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> Dear Biopythoneers,
>
> Biopython 1.59 is out:
> http://news.open-bio.org/news/2012/02/biopython-1-59-released/
>
> Thank you to everyone who has contributed.
>
> Peter
>
> P.S. We're on Twitter as @Biopython
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



-- 
Iddo Friedberg
http://iddo-friedberg.net/contact.html
++++++++++[>+++>++++++>++++++++>++++++++++>+++++++++++<<<<<-]>>>>++++.>
++++++..----.<<<<++++++++++++++++++++++++++++.-----------..>>>+.-----.
.>-.<<<<--.>>>++.>+++.<+++.----.-.<++++++++++++++++++.>+.>.<++.<<<+.>>
>>----.<--.>++++++.<<<<------------------------------------.


From idoerg at gmail.com  Fri Feb 24 17:24:41 2012
From: idoerg at gmail.com (Iddo Friedberg)
Date: Fri, 24 Feb 2012 12:24:41 -0500
Subject: [Biopython] Biopython 1.59 released
In-Reply-To: <CABm4-MSrAOVG3DqEK8AT_A4w+OZFC4vNGgoR=eQCqkH2=M5mvQ@mail.gmail.com>
References: <CAKVJ-_6zJRpv4A2P_fF1Hbpog12dahbTzQmmjZf7L3NWZobGpQ@mail.gmail.com>
	<CABm4-MSrAOVG3DqEK8AT_A4w+OZFC4vNGgoR=eQCqkH2=M5mvQ@mail.gmail.com>
Message-ID: <CABm4-MRz+N=arSi=BAZp0fi1AGOivDQ9J2tUAVpFtUyUzSByQA@mail.gmail.com>

As an ex- (and hopefully future?) contributer and a strong cheerleader and
user: thanks Peter and all developers for all the hard work!



> On Fri, Feb 24, 2012 at 11:56 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:
>
>> Dear Biopythoneers,
>>
>> Biopython 1.59 is out:
>> http://news.open-bio.org/news/2012/02/biopython-1-59-released/
>>
>> Thank you to everyone who has contributed.
>>
>> Peter
>>
>> P.S. We're on Twitter as @Biopython
>> _______________________________________________
>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biopython
>>
>
>
>
> --
> Iddo Friedberg
> http://iddo-friedberg.net/contact.html
> ++++++++++[>+++>++++++>++++++++>++++++++++>+++++++++++<<<<<-]>>>>++++.>
> ++++++..----.<<<<++++++++++++++++++++++++++++.-----------..>>>+.-----.
> .>-.<<<<--.>>>++.>+++.<+++.----.-.<++++++++++++++++++.>+.>.<++.<<<+.>>
> >>----.<--.>++++++.<<<<------------------------------------.
>
>



-- 
Iddo Friedberg
http://iddo-friedberg.net/contact.html
++++++++++[>+++>++++++>++++++++>++++++++++>+++++++++++<<<<<-]>>>>++++.>
++++++..----.<<<<++++++++++++++++++++++++++++.-----------..>>>+.-----.
.>-.<<<<--.>>>++.>+++.<+++.----.-.<++++++++++++++++++.>+.>.<++.<<<+.>>
>>----.<--.>++++++.<<<<------------------------------------.


From rbuels at gmail.com  Mon Feb 27 16:24:03 2012
From: rbuels at gmail.com (Robert Buels)
Date: Mon, 27 Feb 2012 11:24:03 -0500
Subject: [Biopython] Update: call for Google Summer of Code project ideas
Message-ID: <4F4BAE23.7070402@gmail.com>

Hi all,

As kindly pointed out by Reece Hart, the previous email I sent out 
calling for Google Summer of Code project ideas, had the wrong due date 
for project ideas in it.

I actually want them to all be in place by Friday, March 2, which is 
this coming Friday.

== Instructions for Wiki Editing ==

For each of the OBF projects that wants to do GSoC again this year, please:

a.) Update the list of project ideas on your project's GSoC page 
(BioPython, BioPerl, BioRuby, etc).  Add new ones, remove ones that have 
already been done or no longer relevant, etc.

b.) Update the list of project ideas on the main OBF GSoC page 
(http://www.open-bio.org/wiki/Google_Summer_of_Code) to match.

c.) Let me know via email that you have done so and it's ready for 
Google to peruse.

== end instructions ==

Again, please have the updates done by this Friday (March 2). The number 
and quality of the project ideas are part of the evaluation process for 
whether OBF is accepted as a Summer of Code organization again this 
year, so let's come up with some good ones.  :-)

Rob

----
Robert Buels
(prospective) 2012 OBF GSoC Organization Admin


From fedyukina at gmail.com  Mon Feb 27 21:00:11 2012
From: fedyukina at gmail.com (Daria Fedyukina)
Date: Mon, 27 Feb 2012 15:00:11 -0600
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
Message-ID: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>

Hello,

I am trying to install BioPython 1.58. My BioPython and python are both in the Applications folder.
My configuration is:
OS: Mac OS 10.7.3
Python: 2.7.2
Apple Xcode is installed.
NumPy is not installed (could not install for 2.7, only available for 2.6; decided to skip)

When I try to install it, I go to X11 -> go inside biopython-1.58 older -> type "python setup.py build" -> choose to proceed without NumPy -> get an error.

Here how it looks:
bash-3.2$ cd biopython-1.58
bash-3.2$ ls
Bio             DEPRECATED      MANIFEST.in     README          build
BioSQL          Doc             NEWS            Scripts         do2to3.py
CONTRIB         LICENSE         PKG-INFO        Tests           setup.py
bash-3.2$ python setup.py build
running build
running build_py

Numerical Python (NumPy) is not installed.

This package is required for many Biopython features.  Please install
it before you install Biopython. You can install Biopython anyway, but
anything dependent on NumPy will not work. If you do this, and later
install NumPy, you should then re-install Biopython.

You can find NumPy at http://numpy.scipy.org

Do you want to continue this installation? (y/N):
y
running build_ext
building 'Bio.cpairwise2' extension
gcc-4.2 -fno-strict-aliasing -fno-common -dynamic -isysroot /Developer/SDKs/MaSX10.6.sdk -arch i386 -arch x86_64 -g -O2 -DNDEBUG -g -O3 -IBio -I/Library/Fraworks/Python.framework/Versions/2.7/include/python2.7 -c Bio/cpairwise2module.-o build/temp.macosx-10.6-intel-2.7/Bio/cpairwise2module.o
In file included from /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/unicodeobject.h:4,
                 from /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/Python.h:85,
                 from Bio/cpairwise2module.c:12:
/Developer/SDKs/MacOSX10.6.sdk/usr/include/stdarg.h:4:25: error: stdarg.h: No ch file or directory
In file included from /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/unicodeobject.h:4,
                 from /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/Python.h:85,
                 from Bio/cpairwise2module.c:12:
/Developer/SDKs/MacOSX10.6.sdk/usr/include/stdarg.h:4:25: error: stdarg.h: No ch file or directory
lipo: can't figure out the architecture type of: /var/folders/nt/1ppm7j953zv2qylmtwydqm0000gn/T//ccODIZmY.out
error: command 'gcc-4.2' failed with exit status 1
bash-3.2$ 

I googled this error, it turned out that gcc-4.2 needs to be installed. I did. Then, the situation is exactly the same when I repeat biopython installation.

Does anyone know what could've happened? My only suspicion now is that Lion is messing stuff up. Looks like Snow Leopard works better.

Thank you very much for any help or advice!
-Daria


From idoerg at gmail.com  Mon Feb 27 21:27:31 2012
From: idoerg at gmail.com (Iddo Friedberg)
Date: Mon, 27 Feb 2012 16:27:31 -0500
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
Message-ID: <CABm4-MT_m8y-_wi_qC+V69u42Wywsz_1ox8GaZb_6zUJ+3aqXg@mail.gmail.com>

Daria,

Seems like there is a NumPy for Python 2.7 on Mac:

http://sourceforge.net/projects/numpy/files/NumPy/1.6.1/

In any case, you should not skip the NumPy installation. Even if for teh
combination of your OS and Python version there is only NumPy for Python
2.6, you should install that. There is very little difference between
Python 2.6 and 2.7, and NumPy should not break (and, in any case, seems
like your desired version is in the link above).

HTH,

Iddo

On Mon, Feb 27, 2012 at 4:00 PM, Daria Fedyukina <fedyukina at gmail.com>wrote:

> Hello,
>
> I am trying to install BioPython 1.58. My BioPython and python are both in
> the Applications folder.
> My configuration is:
> OS: Mac OS 10.7.3
> Python: 2.7.2
> Apple Xcode is installed.
> NumPy is not installed (could not install for 2.7, only available for 2.6;
> decided to skip)
>
> When I try to install it, I go to X11 -> go inside biopython-1.58 older ->
> type "python setup.py build" -> choose to proceed without NumPy -> get an
> error.
>
> Here how it looks:
> bash-3.2$ cd biopython-1.58
> bash-3.2$ ls
> Bio             DEPRECATED      MANIFEST.in     README          build
> BioSQL          Doc             NEWS            Scripts         do2to3.py
> CONTRIB         LICENSE         PKG-INFO        Tests           setup.py
> bash-3.2$ python setup.py build
> running build
> running build_py
>
> Numerical Python (NumPy) is not installed.
>
> This package is required for many Biopython features.  Please install
> it before you install Biopython. You can install Biopython anyway, but
> anything dependent on NumPy will not work. If you do this, and later
> install NumPy, you should then re-install Biopython.
>
> You can find NumPy at http://numpy.scipy.org
>
> Do you want to continue this installation? (y/N):
> y
> running build_ext
> building 'Bio.cpairwise2' extension
> gcc-4.2 -fno-strict-aliasing -fno-common -dynamic -isysroot
> /Developer/SDKs/MaSX10.6.sdk -arch i386 -arch x86_64 -g -O2 -DNDEBUG -g -O3
> -IBio -I/Library/Fraworks/Python.framework/Versions/2.7/include/python2.7
> -c Bio/cpairwise2module.-o
> build/temp.macosx-10.6-intel-2.7/Bio/cpairwise2module.o
> In file included from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/unicodeobject.h:4,
>                 from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/Python.h:85,
>                 from Bio/cpairwise2module.c:12:
> /Developer/SDKs/MacOSX10.6.sdk/usr/include/stdarg.h:4:25: error: stdarg.h:
> No ch file or directory
> In file included from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/unicodeobject.h:4,
>                 from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/Python.h:85,
>                 from Bio/cpairwise2module.c:12:
> /Developer/SDKs/MacOSX10.6.sdk/usr/include/stdarg.h:4:25: error: stdarg.h:
> No ch file or directory
> lipo: can't figure out the architecture type of:
> /var/folders/nt/1ppm7j953zv2qylmtwydqm0000gn/T//ccODIZmY.out
> error: command 'gcc-4.2' failed with exit status 1
> bash-3.2$
>
> I googled this error, it turned out that gcc-4.2 needs to be installed. I
> did. Then, the situation is exactly the same when I repeat biopython
> installation.
>
> Does anyone know what could've happened? My only suspicion now is that
> Lion is messing stuff up. Looks like Snow Leopard works better.
>
> Thank you very much for any help or advice!
> -Daria
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



-- 
Iddo Friedberg
http://iddo-friedberg.net/contact.html
++++++++++[>+++>++++++>++++++++>++++++++++>+++++++++++<<<<<-]>>>>++++.>
++++++..----.<<<<++++++++++++++++++++++++++++.-----------..>>>+.-----.
.>-.<<<<--.>>>++.>+++.<+++.----.-.<++++++++++++++++++.>+.>.<++.<<<+.>>
>>----.<--.>++++++.<<<<------------------------------------.


From idoerg at gmail.com  Mon Feb 27 22:37:01 2012
From: idoerg at gmail.com (Iddo Friedberg)
Date: Mon, 27 Feb 2012 17:37:01 -0500
Subject: [Biopython] Fwd: question on installation of BioPython on Mac OS
	10.7
In-Reply-To: <FDAF036A-1D11-43C8-B98B-F069FEB49DC1@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CABm4-MT_m8y-_wi_qC+V69u42Wywsz_1ox8GaZb_6zUJ+3aqXg@mail.gmail.com>
	<FDAF036A-1D11-43C8-B98B-F069FEB49DC1@gmail.com>
Message-ID: <CABm4-MRXaSt1YggAvkoaOgnEqS=oGxtWEx4bTPkRsdewYTmHUg@mail.gmail.com>

---------- Forwarded message ----------
From: Daria Fedyukina <fedyukina at gmail.com>
Date: Mon, Feb 27, 2012 at 5:15 PM
Subject: Re: [Biopython] question on installation of BioPython on Mac OS
10.7
To: Iddo Friedberg <idoerg at gmail.com>


Hi Iddo,

I have installed NumPy. Thank you very much for finding the right version
for me. I cannot understand how I missed it.

I thought I installed NumPy correctly: I double clicked on it, I agreed on
terms and conditions, I saw "installation is successful"
After that I did not see any new folder or package in my Applications
folder except previous numpy-1.6.1-py2.7-python.org-macosx10.3.dmg file.
I drag and dropped numpy-1.6.1-py2.7.mpkg file in Applications just in case.

I do not know what to do with this .mpkg file because if I double click on
it, it gives me hte same installation wizard as before, all steps are the
same, nothing chages.

I went to my X11 -> went inside biopython-1.58 older -> typed "python
setup.py build" -> it again asked me if I want to proceed without NumPy. It
did not see that I installed NumPy. It means I did not install it right.

I looked online, the instructions talk about some kind of binary here
http://docs.scipy.org/doc/numpy/user/install.html for Mac OS X, but it does
not look any different from what I have already done.

Would you be so kind as to provide some insight on what they want?
THank you again.

-Daria


P.S. I got Mac 3 months ago, I always thought that it is more convenient
for programming in general. Well..... It was easier to install biopython on
windows. This is a very interesting case.



On Feb 27, 2012, at 3:27 PM, Iddo Friedberg wrote:

Daria,

Seems like there is a NumPy for Python 2.7 on Mac:

http://sourceforge.net/projects/numpy/files/NumPy/1.6.1/

In any case, you should not skip the NumPy installation. Even if for teh
combination of your OS and Python version there is only NumPy for Python
2.6, you should install that. There is very little difference between
Python 2.6 and 2.7, and NumPy should not break (and, in any case, seems
like your desired version is in the link above).

HTH,

Iddo

On Mon, Feb 27, 2012 at 4:00 PM, Daria Fedyukina <fedyukina at gmail.com>wrote:

> Hello,
>
> I am trying to install BioPython 1.58. My BioPython and python are both in
> the Applications folder.
> My configuration is:
> OS: Mac OS 10.7.3
> Python: 2.7.2
> Apple Xcode is installed.
> NumPy is not installed (could not install for 2.7, only available for 2.6;
> decided to skip)
>
> When I try to install it, I go to X11 -> go inside biopython-1.58 older ->
> type "python setup.py build" -> choose to proceed without NumPy -> get an
> error.
>
> Here how it looks:
> bash-3.2$ cd biopython-1.58
> bash-3.2$ ls
> Bio             DEPRECATED      MANIFEST.in     README          build
> BioSQL          Doc             NEWS            Scripts         do2to3.py
> CONTRIB         LICENSE         PKG-INFO        Tests           setup.py
> bash-3.2$ python setup.py build
> running build
> running build_py
>
> Numerical Python (NumPy) is not installed.
>
> This package is required for many Biopython features.  Please install
> it before you install Biopython. You can install Biopython anyway, but
> anything dependent on NumPy will not work. If you do this, and later
> install NumPy, you should then re-install Biopython.
>
> You can find NumPy at http://numpy.scipy.org
>
> Do you want to continue this installation? (y/N):
> y
> running build_ext
> building 'Bio.cpairwise2' extension
> gcc-4.2 -fno-strict-aliasing -fno-common -dynamic -isysroot
> /Developer/SDKs/MaSX10.6.sdk -arch i386 -arch x86_64 -g -O2 -DNDEBUG -g -O3
> -IBio -I/Library/Fraworks/Python.framework/Versions/2.7/include/python2.7
> -c Bio/cpairwise2module.-o
> build/temp.macosx-10.6-intel-2.7/Bio/cpairwise2module.o
> In file included from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/unicodeobject.h:4,
>                 from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/Python.h:85,
>                 from Bio/cpairwise2module.c:12:
> /Developer/SDKs/MacOSX10.6.sdk/usr/include/stdarg.h:4:25: error: stdarg.h:
> No ch file or directory
> In file included from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/unicodeobject.h:4,
>                 from
> /Library/Frameworks/Python.framework/Versions/2.7/includpython2.7/Python.h:85,
>                 from Bio/cpairwise2module.c:12:
> /Developer/SDKs/MacOSX10.6.sdk/usr/include/stdarg.h:4:25: error: stdarg.h:
> No ch file or directory
> lipo: can't figure out the architecture type of:
> /var/folders/nt/1ppm7j953zv2qylmtwydqm0000gn/T//ccODIZmY.out
> error: command 'gcc-4.2' failed with exit status 1
> bash-3.2$
>
> I googled this error, it turned out that gcc-4.2 needs to be installed. I
> did. Then, the situation is exactly the same when I repeat biopython
> installation.
>
> Does anyone know what could've happened? My only suspicion now is that
> Lion is messing stuff up. Looks like Snow Leopard works better.
>
> Thank you very much for any help or advice!
> -Daria
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



-- 
Iddo Friedberg
http://iddo-friedberg.net/contact.html
++++++++++[>+++>++++++>++++++++>++++++++++>+++++++++++<<<<<-]>>>>++++.>
++++++..----.<<<<++++++++++++++++++++++++++++.-----------..>>>+.-----.
.>-.<<<<--.>>>++.>+++.<+++.----.-.<++++++++++++++++++.>+.>.<++.<<<+.>>
>>----.<--.>++++++.<<<<------------------------------------.





-- 
Iddo Friedberg
http://iddo-friedberg.net/contact.html
++++++++++[>+++>++++++>++++++++>++++++++++>+++++++++++<<<<<-]>>>>++++.>
++++++..----.<<<<++++++++++++++++++++++++++++.-----------..>>>+.-----.
.>-.<<<<--.>>>++.>+++.<+++.----.-.<++++++++++++++++++.>+.>.<++.<<<+.>>
>>----.<--.>++++++.<<<<------------------------------------.


From p.j.a.cock at googlemail.com  Mon Feb 27 22:37:08 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 27 Feb 2012 22:37:08 +0000
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
Message-ID: <CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>

On Monday, February 27, 2012, Daria Fedyukina wrote:

> Hello,
>
> I am trying to install BioPython 1.58. My BioPython and python are both in
> the Applications folder.
> My configuration is:
> OS: Mac OS 10.7.3
> Python: 2.7.2
> Apple Xcode is installed.
> NumPy is not installed (could not install for 2.7, only available for 2.6;
> decided to skip)
>
>
What version of Xcode do you have, and were there any options when you
installed about SDK installation and command line tool installation? It
worked for me on one of my machines which has Mac OS X 10.7 Lion, but I am
not in front of it right now to check the details.

Peter


From schnoes at gmail.com  Mon Feb 27 22:50:36 2012
From: schnoes at gmail.com (Alexandra Schnoes)
Date: Mon, 27 Feb 2012 14:50:36 -0800
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
Message-ID: <CABZpzJdX6Y-o=7KHw+h1hVXSoVTZvbtX0BToQVO=2vemfDSQWA@mail.gmail.com>

Hi Daria,

It sounds like you might be new to Mac/OS 10... an easy way to ease into
that is to use a package manager (or if you're like me and just like to
keep everything organized with a manager and don't always feel like self
compiling). I have used a couple of different ones. I am currently using
MacPorts (http://www.macports.org/) and they keep very up to date (just
upgraded my biopython to 1.59 today). Fink (http://www.finkproject.org/)
and Homebrew (http://mxcl.github.com/homebrew/) are two other commonly
used/ well known managers.

Best,
Alex


On Mon, Feb 27, 2012 at 2:37 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Monday, February 27, 2012, Daria Fedyukina wrote:
>
> > Hello,
> >
> > I am trying to install BioPython 1.58. My BioPython and python are both
> in
> > the Applications folder.
> > My configuration is:
> > OS: Mac OS 10.7.3
> > Python: 2.7.2
> > Apple Xcode is installed.
> > NumPy is not installed (could not install for 2.7, only available for
> 2.6;
> > decided to skip)
> >
> >
> What version of Xcode do you have, and were there any options when you
> installed about SDK installation and command line tool installation? It
> worked for me on one of my machines which has Mac OS X 10.7 Lion, but I am
> not in front of it right now to check the details.
>
> Peter
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



-- 
Alexandra Schnoes, Ph.D.
Scientist, Babbitt Laboratory
Program Coordinator, Graduate Student Internships for Career Exploration
University of California San Francisco
Tel:  415-502-1248
Fax: 415-514-9656
Email: schnoes at gmail.com


From anna.kostikova at gmail.com  Tue Feb 28 13:28:50 2012
From: anna.kostikova at gmail.com (Anna Kostikova)
Date: Tue, 28 Feb 2012 14:28:50 +0100
Subject: [Biopython] Entrez.efetch issue with the returning data type
Message-ID: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>

Dear list,

Since today I've started to have an issue with Entrez.efetch utility,
and in particular with the rettype parameter. Essentially, the format
of the data returned when I specify
Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') does not
correspond anymore to a genbank datatype. Few days ago all was fine.
What is going on?

the script is:
from Bio import Entrez
Entrez.email = 'my.email at domain.com'

local_file=open("test.gb", 'w')
try:
        handle =
Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') #download
record with Entrez.efetch
        local_file.write(handle.read()) #write to a file
        handle.close()
except:
        print "Accsession id is not found"
local_file.close()

Thanks a lot for your ideas,
Anna


From p.j.a.cock at googlemail.com  Tue Feb 28 14:16:39 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 28 Feb 2012 14:16:39 +0000
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
Message-ID: <CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>

On Tue, Feb 28, 2012 at 1:28 PM, Anna Kostikova
<anna.kostikova at gmail.com> wrote:
> Dear list,
>
> Since today I've started to have an issue with Entrez.efetch utility,
> and in particular with the rettype parameter. Essentially, the format
> of the data returned when I specify
> Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') does not
> correspond anymore to a genbank datatype. Few days ago all was fine.
> What is going on?

The NCBI changed the defaults in mid Feb 2012 with the release of
EFetch v2.0 - you must now add retmode="text" to the Entrez fetch
call otherwise you'll probably get XML back. We mentioned this on
the release notes for Biopython 1.59, but I should probably add this
link as well:

http://www.ncbi.nlm.nih.gov/mailman/pipermail/utilities-announce/2012-February/000085.html

Peter


From Matej.Repic at ki.si  Tue Feb 28 14:12:31 2012
From: Matej.Repic at ki.si (=?iso-8859-2?Q?Matej_Repi=E8?=)
Date: Tue, 28 Feb 2012 14:12:31 +0000
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
Message-ID: <CB729F3F.3B03%matej.repic@ki.si>

For me the script works without a problem (Biopython 1.58, Python 2.6). On
the other hand, some things were changed on the Pubmed side this month, so
maybe it would work for you if you edit your script according to this
table:

http://www.ncbi.nlm.nih.gov/books/NBK25499/table/chapter4.chapter4_table1/?
report=objectonly

The full documentation on Efetch 2.0 is available at:
http://www.ncbi.nlm.nih.gov/books/NBK25499/#chapter4.Efetch



Regards,



----------------------------------------------------------
Matej Repi?
Junior Researcher

Laboratory for Biocomputing and Bioinformatics
National Institute of Chemistry
Hajdrihova 19
SI-1001 Ljubljana POB 660
Slovenia

tel: +386-1-4760457 <tel:%2B386-1-4760457>

e-mail: matej.repic at ki.si
----------------------------------------------------------






On 28.2.12 14:28, "Anna Kostikova" <anna.kostikova at gmail.com> wrote:

>Dear list,
>
>Since today I've started to have an issue with Entrez.efetch utility,
>and in particular with the rettype parameter. Essentially, the format
>of the data returned when I specify
>Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') does not
>correspond anymore to a genbank datatype. Few days ago all was fine.
>What is going on?
>
>the script is:
>from Bio import Entrez
>Entrez.email = 'my.email at domain.com'
>
>local_file=open("test.gb", 'w')
>try:
>        handle =
>Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') #download
>record with Entrez.efetch
>        local_file.write(handle.read()) #write to a file
>        handle.close()
>except:
>        print "Accsession id is not found"
>local_file.close()
>
>Thanks a lot for your ideas,
>Anna
>_______________________________________________
>Biopython mailing list  -  Biopython at lists.open-bio.org
>http://lists.open-bio.org/mailman/listinfo/biopython




From p.j.a.cock at googlemail.com  Tue Feb 28 14:35:03 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 28 Feb 2012 14:35:03 +0000
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
Message-ID: <CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>

On Mon, Feb 27, 2012 at 11:14 PM, Daria Fedyukina <fedyukina at gmail.com> wrote:
> Hi Peter,
>
> I have version 4.2.1 of Xcode.

I think that is what my Mac OS X 10.7 Lion machine has - not checked yet.

> I went to Macintosh HD-> Developer and I see SDKs and Tools folders. But the
> content of both is daunting. I have no idea what I can do with it, probably
> nothing. When I click on Xcode in my Dock, there is no command line, it
> looks like a piece of GUI software with, it reminds me Eclipse.

Xcode covers a *lot* of stuff, including a GUI for editing source code,
system library files for compiling code, and compilers themselves
(for C, C++, etc).

> The command line that I used before is called X11 and I found it in
> /Applications/Utilities/X11.
>
> I tried to figure out what the difference between X11 and Xcode (if any) and
> whether X11 was in Utilities prior Xcode installation. But I do not know the
> answers to these questions.

Normally I would use the Mac OS  X command line via the "Terminal"
application, also under  /Applications/Utilities, but getting to a command
line prompt via X11 instead should work.

Peter


From anna.kostikova at gmail.com  Tue Feb 28 15:15:33 2012
From: anna.kostikova at gmail.com (Anna Kostikova)
Date: Tue, 28 Feb 2012 16:15:33 +0100
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
Message-ID: <CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>

Dear Peter,

Thanks a lot for the prompt response. Yes, exactly, it was retmode="text" thing.
Thanks a lot again!

Anna

2012/2/28 Peter Cock <p.j.a.cock at googlemail.com>:
> On Tue, Feb 28, 2012 at 1:28 PM, Anna Kostikova
> <anna.kostikova at gmail.com> wrote:
>> Dear list,
>>
>> Since today I've started to have an issue with Entrez.efetch utility,
>> and in particular with the rettype parameter. Essentially, the format
>> of the data returned when I specify
>> Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') does not
>> correspond anymore to a genbank datatype. Few days ago all was fine.
>> What is going on?
>
> The NCBI changed the defaults in mid Feb 2012 with the release of
> EFetch v2.0 - you must now add retmode="text" to the Entrez fetch
> call otherwise you'll probably get XML back. We mentioned this on
> the release notes for Biopython 1.59, but I should probably add this
> link as well:
>
> http://www.ncbi.nlm.nih.gov/mailman/pipermail/utilities-announce/2012-February/000085.html
>
> Peter


From p.j.a.cock at googlemail.com  Tue Feb 28 17:18:28 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 28 Feb 2012 17:18:28 +0000
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
Message-ID: <CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>

On Tue, Feb 28, 2012 at 5:00 PM, Daria Fedyukina <fedyukina at gmail.com> wrote:
>
> Hi Peter,
>
> Thank you. I tried Terminal, it is indeed exactly the same.
> NumPy is not installed somehow. Here is my screenshot. Do you have any
> suggestions on how to install NumPy in such a way that this installation is
> seen when I do "python setup.py build" in the terminal?
>
> -Daria

Hi Daria,

Personally I use Apple's provided Python, which from memory
comes with a (slightly out of date) copy of NumPy. A more detailed
reply will have to wait until I'm at my Mac OS X 10.7 "Lion" machine.

If anyone else online right now has Biopython installed and working
on Mac OS X 10.7 "Lion" and can help now, please speak up.

One important question could be was this a clean install of Lion,
or an update from Snow Leopard?

I'm a little confused now even with the screenshots. It looks
like you have download python-2.7.2-macosx10.6.dmg and
numpy-1.6.1-py2.7-python.org-macosx10.3.dmg which should
work fine together BUT you will have two copies of Python (the
Apple provided Python, and Python.org's Python) and it can be
confusing about which is in use and which has a given library
installed

Peter


From fedyukina at gmail.com  Tue Feb 28 17:22:50 2012
From: fedyukina at gmail.com (Daria Fedyukina)
Date: Tue, 28 Feb 2012 11:22:50 -0600
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
Message-ID: <6A4268ED-0E86-49B2-87C9-D5095EDE5654@gmail.com>

Hi all,

Answering Peter's question: I got a new laptop with Lion already installed.

-Daria


On Feb 28, 2012, at 11:18 AM, Peter Cock wrote:

> On Tue, Feb 28, 2012 at 5:00 PM, Daria Fedyukina <fedyukina at gmail.com> wrote:
>> 
>> Hi Peter,
>> 
>> Thank you. I tried Terminal, it is indeed exactly the same.
>> NumPy is not installed somehow. Here is my screenshot. Do you have any
>> suggestions on how to install NumPy in such a way that this installation is
>> seen when I do "python setup.py build" in the terminal?
>> 
>> -Daria
> 
> Hi Daria,
> 
> Personally I use Apple's provided Python, which from memory
> comes with a (slightly out of date) copy of NumPy. A more detailed
> reply will have to wait until I'm at my Mac OS X 10.7 "Lion" machine.
> 
> If anyone else online right now has Biopython installed and working
> on Mac OS X 10.7 "Lion" and can help now, please speak up.
> 
> One important question could be was this a clean install of Lion,
> or an update from Snow Leopard?
> 
> I'm a little confused now even with the screenshots. It looks
> like you have download python-2.7.2-macosx10.6.dmg and
> numpy-1.6.1-py2.7-python.org-macosx10.3.dmg which should
> work fine together BUT you will have two copies of Python (the
> Apple provided Python, and Python.org's Python) and it can be
> confusing about which is in use and which has a given library
> installed
> 
> Peter




From anaryin at gmail.com  Tue Feb 28 17:23:49 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 28 Feb 2012 18:23:49 +0100
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
Message-ID: <CAJ9sUYPXsxtEvToiuZKfjK-=umAqVJ_Vj=5nTt05MhMXAbUTRw@mail.gmail.com>

Hi Daria,

Which Python architecture did you install? 32 bits or 64?

This thread in SO solves a similar problem:
http://stackoverflow.com/questions/6839795/cant-figure-out-the-architecture-type-of-problem-when-compiling-python

Maybe it solves yours?

Cheers,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



No dia 28 de Fevereiro de 2012 18:18, Peter Cock
<p.j.a.cock at googlemail.com>escreveu:

> On Tue, Feb 28, 2012 at 5:00 PM, Daria Fedyukina <fedyukina at gmail.com>
> wrote:
> >
> > Hi Peter,
> >
> > Thank you. I tried Terminal, it is indeed exactly the same.
> > NumPy is not installed somehow. Here is my screenshot. Do you have any
> > suggestions on how to install NumPy in such a way that this installation
> is
> > seen when I do "python setup.py build" in the terminal?
> >
> > -Daria
>
> Hi Daria,
>
> Personally I use Apple's provided Python, which from memory
> comes with a (slightly out of date) copy of NumPy. A more detailed
> reply will have to wait until I'm at my Mac OS X 10.7 "Lion" machine.
>
> If anyone else online right now has Biopython installed and working
> on Mac OS X 10.7 "Lion" and can help now, please speak up.
>
> One important question could be was this a clean install of Lion,
> or an update from Snow Leopard?
>
> I'm a little confused now even with the screenshots. It looks
> like you have download python-2.7.2-macosx10.6.dmg and
> numpy-1.6.1-py2.7-python.org-macosx10.3.dmg which should
> work fine together BUT you will have two copies of Python (the
> Apple provided Python, and Python.org's Python) and it can be
> confusing about which is in use and which has a given library
> installed
>
> Peter
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



From fedyukina at gmail.com  Tue Feb 28 17:28:29 2012
From: fedyukina at gmail.com (Daria Fedyukina)
Date: Tue, 28 Feb 2012 11:28:29 -0600
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <CAJ9sUYPXsxtEvToiuZKfjK-=umAqVJ_Vj=5nTt05MhMXAbUTRw@mail.gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
	<CAJ9sUYPXsxtEvToiuZKfjK-=umAqVJ_Vj=5nTt05MhMXAbUTRw@mail.gmail.com>
Message-ID: <8CC22492-718A-451D-A8B5-D216E0A37932@gmail.com>

I downloaded and installed this one:
Python 2.7.2 Mac OS X 64-bit/32-bit x86-64/i386 Installer
because on the web site it says that this version is for 10.6 and 10.7

But it did not help me to avoid the problem. 
Also my exit status is 1, and here it is 255. Do these numbers tell me anything useful?
I could not locate definite answer by googling.
 
On Feb 28, 2012, at 11:23 AM, Jo?o Rodrigues wrote:

> Hi Daria,
> 
> Which Python architecture did you install? 32 bits or 64?
> 
> This thread in SO solves a similar problem: http://stackoverflow.com/questions/6839795/cant-figure-out-the-architecture-type-of-problem-when-compiling-python
> 
> Maybe it solves yours?
> 
> Cheers,
> 
> Jo?o [...] Rodrigues
> http://nmr.chem.uu.nl/~joao
> 
> 
> 
> No dia 28 de Fevereiro de 2012 18:18, Peter Cock <p.j.a.cock at googlemail.com> escreveu:
> On Tue, Feb 28, 2012 at 5:00 PM, Daria Fedyukina <fedyukina at gmail.com> wrote:
> >
> > Hi Peter,
> >
> > Thank you. I tried Terminal, it is indeed exactly the same.
> > NumPy is not installed somehow. Here is my screenshot. Do you have any
> > suggestions on how to install NumPy in such a way that this installation is
> > seen when I do "python setup.py build" in the terminal?
> >
> > -Daria
> 
> Hi Daria,
> 
> Personally I use Apple's provided Python, which from memory
> comes with a (slightly out of date) copy of NumPy. A more detailed
> reply will have to wait until I'm at my Mac OS X 10.7 "Lion" machine.
> 
> If anyone else online right now has Biopython installed and working
> on Mac OS X 10.7 "Lion" and can help now, please speak up.
> 
> One important question could be was this a clean install of Lion,
> or an update from Snow Leopard?
> 
> I'm a little confused now even with the screenshots. It looks
> like you have download python-2.7.2-macosx10.6.dmg and
> numpy-1.6.1-py2.7-python.org-macosx10.3.dmg which should
> work fine together BUT you will have two copies of Python (the
> Apple provided Python, and Python.org's Python) and it can be
> confusing about which is in use and which has a given library
> installed
> 
> Peter
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
> 




From p.j.a.cock at googlemail.com  Tue Feb 28 18:46:15 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 28 Feb 2012 18:46:15 +0000
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <8CC22492-718A-451D-A8B5-D216E0A37932@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
	<CAJ9sUYPXsxtEvToiuZKfjK-=umAqVJ_Vj=5nTt05MhMXAbUTRw@mail.gmail.com>
	<8CC22492-718A-451D-A8B5-D216E0A37932@gmail.com>
Message-ID: <CAKVJ-_703r5A1Yari8FaRkK5LwOAf-EO=4sRxy+VavByaxzDxA@mail.gmail.com>

On my Lion laptop, Apple provides Python 2.6.7 and 2.7.1

$ which python2.6
/usr/bin/python2.6
$ which python2.7
/usr/bin/python2.7
$ which python
/usr/bin/python

The default on my machine is Python 2.7, and both this and
Python 2.6 have NumPy 1.5.1 installed - however I'm not 100%
if I installed this (and if so how), or if it came on the machine:

$ python
Python 2.7.1 (r271:86832, Jun 25 2011, 05:09:01)
[GCC 4.2.1 (Based on Apple Inc. build 5658) (LLVM build 2335.15.00)] on darwin
Type "help", "copyright", "credits" or "license" for more information.
>>> import numpy
>>> numpy.__version__
'1.5.1'
>>> quit()

$ python2.6
Python 2.6.7 (r267:88850, Jul 31 2011, 19:30:54)
[GCC 4.2.1 (Based on Apple Inc. build 5658) (LLVM build 2335.15.00)] on darwin
Type "help", "copyright", "credits" or "license" for more information.
>>> import numpy
>>> numpy.__version__
'1.5.1'
>>> quit()

That probably doesn't help much :(

Peter


From anaryin at gmail.com  Tue Feb 28 19:29:45 2012
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 28 Feb 2012 20:29:45 +0100
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <CAKVJ-_703r5A1Yari8FaRkK5LwOAf-EO=4sRxy+VavByaxzDxA@mail.gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
	<CAJ9sUYPXsxtEvToiuZKfjK-=umAqVJ_Vj=5nTt05MhMXAbUTRw@mail.gmail.com>
	<8CC22492-718A-451D-A8B5-D216E0A37932@gmail.com>
	<CAKVJ-_703r5A1Yari8FaRkK5LwOAf-EO=4sRxy+VavByaxzDxA@mail.gmail.com>
Message-ID: <CAJ9sUYP86h+yEW6G4GWsmUmHcSM=QqcPowY53n=C49GF-6ApRQ@mail.gmail.com>

I googled a bit and likely you have architecture mismatches everywhere..
The numpy error is clearly from that as 1) I've seen it before and 2) so did
someone else<http://www.voidspace.org.uk/python/weblog/arch_d7_2011_09_03.shtml>
.

Therefore, I would try to compile Numpy from source in your computer and
then install biopython. I'm guessing that these might help a bit.

Also, from your traceback, which XCode did you install? It says 10.6 in a
few places but Lion should be 10.7. Dunno if this might cause some
mismatches when compiling stuff..


From Jared.Sampson at nyumc.org  Tue Feb 28 21:05:10 2012
From: Jared.Sampson at nyumc.org (Sampson, Jared)
Date: Tue, 28 Feb 2012 16:05:10 -0500
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
Message-ID: <AD66BC02-B699-41B7-84F4-AA8ADC3C4144@nyumc.org>

Hi Daria et al. -

What about using pip<http://www.pip-installer.org/en/latest/index.html> or easy_install?

I'm running a Mac with Lion and I had no problem installing Biopython via:

    sudo pip install numpy
    sudo pip install biopython

I got a "you need numpy first" warning when I tried installing biopython alone, but running the commands above worked just fine to install numpy first, then Bio. It may be useful to note I've done this mainly within a virtualenv<http://www.virtualenv.org/en/latest/index.html>, but I think it should work using the system Python as well.

Jared


--
Jared Sampson
Xiangpeng Kong Lab
NYU Langone Medical Center
550 First Ave MSB 329/398
New York, NY 10016
212-263-7898
http://kong.med.nyu.edu/

On Feb 28, 2012, at 12:18 PM, Peter Cock wrote:

On Tue, Feb 28, 2012 at 5:00 PM, Daria Fedyukina <fedyukina at gmail.com<mailto:fedyukina at gmail.com>> wrote:

Hi Peter,

Thank you. I tried Terminal, it is indeed exactly the same.
NumPy is not installed somehow. Here is my screenshot. Do you have any
suggestions on how to install NumPy in such a way that this installation is
seen when I do "python setup.py build" in the terminal?

-Daria

Hi Daria,

Personally I use Apple's provided Python, which from memory
comes with a (slightly out of date) copy of NumPy. A more detailed
reply will have to wait until I'm at my Mac OS X 10.7 "Lion" machine.

If anyone else online right now has Biopython installed and working
on Mac OS X 10.7 "Lion" and can help now, please speak up.

One important question could be was this a clean install of Lion,
or an update from Snow Leopard?

I'm a little confused now even with the screenshots. It looks
like you have download python-2.7.2-macosx10.6.dmg and
numpy-1.6.1-py2.7-python.org-macosx10.3.dmg which should
work fine together BUT you will have two copies of Python (the
Apple provided Python, and Python.org<http://Python.org>'s Python) and it can be
confusing about which is in use and which has a given library
installed

Peter
_______________________________________________
Biopython mailing list  -  Biopython at lists.open-bio.org<mailto:Biopython at lists.open-bio.org>
http://lists.open-bio.org/mailman/listinfo/biopython


------------------------------------------------------------
This email message, including any attachments, is for the sole use of the intended recipient(s) and may contain information that is proprietary, confidential, and exempt from disclosure under applicable law. Any unauthorized review, use, disclosure, or distribution is prohibited. If you have received this email in error please notify the sender by return email and delete the original message. Please note, the recipient should check this email and any attachments for the presence of viruses. The organization accepts no liability for any damage caused by any virus transmitted by this email.
=================================



From karolisr at gmail.com  Wed Feb 29 04:01:30 2012
From: karolisr at gmail.com (Karolis Ramanauskas)
Date: Tue, 28 Feb 2012 22:01:30 -0600
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
	<CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
Message-ID: <CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>

Good day,

I think it would be a good idea to not rely on the NCBI defaults in
Biopython and hardcode retmode and other defaults directly into the
Biopython methods. Basically having defaults that Biopython
guarantees. That way the defaults will not change haphazardly when
NCBI decides to change things. Of course users will still be able to
set their own parameters if they do not use default behavior, but this
would reduce unexpected changes and the need to go over long stretches
of code and change things.

Karolis

On Tue, Feb 28, 2012 at 09:15, Anna Kostikova <anna.kostikova at gmail.com> wrote:
> Dear Peter,
>
> Thanks a lot for the prompt response. Yes, exactly, it was retmode="text" thing.
> Thanks a lot again!
>
> Anna
>
> 2012/2/28 Peter Cock <p.j.a.cock at googlemail.com>:
>> On Tue, Feb 28, 2012 at 1:28 PM, Anna Kostikova
>> <anna.kostikova at gmail.com> wrote:
>>> Dear list,
>>>
>>> Since today I've started to have an issue with Entrez.efetch utility,
>>> and in particular with the rettype parameter. Essentially, the format
>>> of the data returned when I specify
>>> Entrez.efetch(db='nucleotide',id='JQ042818.1',rettype='gb') does not
>>> correspond anymore to a genbank datatype. Few days ago all was fine.
>>> What is going on?
>>
>> The NCBI changed the defaults in mid Feb 2012 with the release of
>> EFetch v2.0 - you must now add retmode="text" to the Entrez fetch
>> call otherwise you'll probably get XML back. We mentioned this on
>> the release notes for Biopython 1.59, but I should probably add this
>> link as well:
>>
>> http://www.ncbi.nlm.nih.gov/mailman/pipermail/utilities-announce/2012-February/000085.html
>>
>> Peter
> _______________________________________________
> Biopython mailing list ?- ?Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython



From p.j.a.cock at googlemail.com  Wed Feb 29 10:28:03 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 29 Feb 2012 10:28:03 +0000
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
	<CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
	<CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>
Message-ID: <CAKVJ-_6p5GOmEho5sPxNaCTZ+pu3=gCJaVFOcXEiKzRXsw3=0g@mail.gmail.com>

On Wed, Feb 29, 2012 at 4:01 AM, Karolis Ramanauskas <karolisr at gmail.com> wrote:
> Good day,
>
> I think it would be a good idea to not rely on the NCBI defaults in
> Biopython and hardcode retmode and other defaults directly into the
> Biopython methods. Basically having defaults that Biopython
> guarantees. That way the defaults will not change haphazardly when
> NCBI decides to change things. Of course users will still be able to
> set their own parameters if they do not use default behavior, but this
> would reduce unexpected changes and the need to go over long stretches
> of code and change things.
>
> Karolis

Hi Karolis,

That has downsides too - take the NCBI QBLAST API for calling an
online BLAST search at the NCBI. Biopython has default values
which (I presume) once matched the NCBI, but the NCBI has changed
things. As a result, the defaults have diverged and we often see user
queries about why their BLAST results via Biopython are different.

You could write to the NCBI Entrez team and urge them to consider
backwards compatibility more strongly.

Peter

P.S. I've added an FAQ entry about EFetch defaults to the tutorial:
https://github.com/biopython/biopython/commit/2a2ef7ab7b5a9c3ed3891922df7e2d47e2701faf


From karolisr at gmail.com  Wed Feb 29 13:57:22 2012
From: karolisr at gmail.com (Karolis Ramanauskas)
Date: Wed, 29 Feb 2012 07:57:22 -0600
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CAKVJ-_6p5GOmEho5sPxNaCTZ+pu3=gCJaVFOcXEiKzRXsw3=0g@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
	<CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
	<CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>
	<CAKVJ-_6p5GOmEho5sPxNaCTZ+pu3=gCJaVFOcXEiKzRXsw3=0g@mail.gmail.com>
Message-ID: <CACT_pJGW+0ngh7fvh9s9kSzEomda0ZiKEyb80hhb_vR2rArqsw@mail.gmail.com>

I see, you can never make everyone happy. Thanks.

On Wed, Feb 29, 2012 at 04:28, Peter Cock <p.j.a.cock at googlemail.com> wrote:
> On Wed, Feb 29, 2012 at 4:01 AM, Karolis Ramanauskas <karolisr at gmail.com> wrote:
>> Good day,
>>
>> I think it would be a good idea to not rely on the NCBI defaults in
>> Biopython and hardcode retmode and other defaults directly into the
>> Biopython methods. Basically having defaults that Biopython
>> guarantees. That way the defaults will not change haphazardly when
>> NCBI decides to change things. Of course users will still be able to
>> set their own parameters if they do not use default behavior, but this
>> would reduce unexpected changes and the need to go over long stretches
>> of code and change things.
>>
>> Karolis
>
> Hi Karolis,
>
> That has downsides too - take the NCBI QBLAST API for calling an
> online BLAST search at the NCBI. Biopython has default values
> which (I presume) once matched the NCBI, but the NCBI has changed
> things. As a result, the defaults have diverged and we often see user
> queries about why their BLAST results via Biopython are different.
>
> You could write to the NCBI Entrez team and urge them to consider
> backwards compatibility more strongly.
>
> Peter
>
> P.S. I've added an FAQ entry about EFetch defaults to the tutorial:
> https://github.com/biopython/biopython/commit/2a2ef7ab7b5a9c3ed3891922df7e2d47e2701faf


From p.j.a.cock at googlemail.com  Wed Feb 29 17:34:56 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 29 Feb 2012 17:34:56 +0000
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CACT_pJGW+0ngh7fvh9s9kSzEomda0ZiKEyb80hhb_vR2rArqsw@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
	<CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
	<CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>
	<CAKVJ-_6p5GOmEho5sPxNaCTZ+pu3=gCJaVFOcXEiKzRXsw3=0g@mail.gmail.com>
	<CACT_pJGW+0ngh7fvh9s9kSzEomda0ZiKEyb80hhb_vR2rArqsw@mail.gmail.com>
Message-ID: <CAKVJ-_52bJ9CjcnQKVLPdi3P7eJwPP91p49GQH9KH9Wm9zCzRw@mail.gmail.com>

On Wed, Feb 29, 2012 at 1:57 PM, Karolis Ramanauskas <karolisr at gmail.com> wrote:
> I see, you can never make everyone happy. Thanks.

Sadly true of many things in life.

However, in this particular case, encouraging people to be
explicit and provide their desired EFetch retmode/rettype is
not only a practical solution, but also very Pythonic:

Zen Of Python: Explicit is better than implicit.
http://www.python.org/dev/peps/pep-0020/

Peter


From karolisr at gmail.com  Wed Feb 29 17:40:39 2012
From: karolisr at gmail.com (Karolis Ramanauskas)
Date: Wed, 29 Feb 2012 11:40:39 -0600
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CAKVJ-_52bJ9CjcnQKVLPdi3P7eJwPP91p49GQH9KH9Wm9zCzRw@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
	<CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
	<CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>
	<CAKVJ-_6p5GOmEho5sPxNaCTZ+pu3=gCJaVFOcXEiKzRXsw3=0g@mail.gmail.com>
	<CACT_pJGW+0ngh7fvh9s9kSzEomda0ZiKEyb80hhb_vR2rArqsw@mail.gmail.com>
	<CAKVJ-_52bJ9CjcnQKVLPdi3P7eJwPP91p49GQH9KH9Wm9zCzRw@mail.gmail.com>
Message-ID: <CACT_pJF=05TXVqLo5eQFQ10HO-+0r1kMNNZxv3TBgvrO7d_8Gg@mail.gmail.com>

I agree, reading their code after a few weeks of writing it, most people
would not remember what implicit settings they relied on.

On Feb 29, 2012 11:34 AM, "Peter Cock" <p.j.a.cock at googlemail.com> wrote:
>
> On Wed, Feb 29, 2012 at 1:57 PM, Karolis Ramanauskas <karolisr at gmail.com>
wrote:
> > I see, you can never make everyone happy. Thanks.
>
> Sadly true of many things in life.
>
> However, in this particular case, encouraging people to be
> explicit and provide their desired EFetch retmode/rettype is
> not only a practical solution, but also very Pythonic:
>
> Zen Of Python: Explicit is better than implicit.
> http://www.python.org/dev/peps/pep-0020/
>
> Peter


From p.j.a.cock at googlemail.com  Wed Feb 29 17:45:14 2012
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 29 Feb 2012 17:45:14 +0000
Subject: [Biopython] Entrez.efetch issue with the returning data type
In-Reply-To: <CACT_pJF=05TXVqLo5eQFQ10HO-+0r1kMNNZxv3TBgvrO7d_8Gg@mail.gmail.com>
References: <CAMzsESG1Zg8+6KcbASt7HuQT_Tt6QQYiKFy5FOunvFDusQcWQQ@mail.gmail.com>
	<CAKVJ-_4UWprGc8G_Q84zwX0uB2qyN+hunoUuD1US9HCtVee2Eg@mail.gmail.com>
	<CAMzsESFugqy4Tzsj6w9Zc8fL6q-X83BMB+0ciHJ4PB+w26kAqA@mail.gmail.com>
	<CACT_pJEENg5jGCdryQv_2BnwbOC4Co7Ch-fwqnTG_ZQ0ehWYcg@mail.gmail.com>
	<CAKVJ-_6p5GOmEho5sPxNaCTZ+pu3=gCJaVFOcXEiKzRXsw3=0g@mail.gmail.com>
	<CACT_pJGW+0ngh7fvh9s9kSzEomda0ZiKEyb80hhb_vR2rArqsw@mail.gmail.com>
	<CAKVJ-_52bJ9CjcnQKVLPdi3P7eJwPP91p49GQH9KH9Wm9zCzRw@mail.gmail.com>
	<CACT_pJF=05TXVqLo5eQFQ10HO-+0r1kMNNZxv3TBgvrO7d_8Gg@mail.gmail.com>
Message-ID: <CAKVJ-_4Or_jQrzmLLWK-Q-xnkg5G2eNxCnHFEFg9ye0a9AjHeQ@mail.gmail.com>

On Wed, Feb 29, 2012 at 5:40 PM, Karolis wrote:
> On Feb 29, 2012 11:34 AM, Peter wrote:
>> On Wed, Feb 29, 2012 at 1:57 PM, Karolis wrote
>> > I see, you can never make everyone happy. Thanks.
>>
>> Sadly true of many things in life.
>>
>> However, in this particular case, encouraging people to be
>> explicit and provide their desired EFetch retmode/rettype is
>> not only a practical solution, but also very Pythonic:
>>
>> Zen Of Python: Explicit is better than implicit.
>> http://www.python.org/dev/peps/pep-0020/
>>
>> Peter
>
> I agree, reading their code after a few weeks of writing it, most people
> would not remember what implicit settings they relied on.

I suppose we could add a warning if the retmode or rettype is not
set explicitly. Maybe we should have done it for Biopython 1.59?
It would have got people's attention and given them a big clue
about how their EFetch script might have been broken by the
recent NCBI change.

Peter


From Jared.Sampson at nyumc.org  Wed Feb 29 20:56:53 2012
From: Jared.Sampson at nyumc.org (Sampson, Jared)
Date: Wed, 29 Feb 2012 15:56:53 -0500
Subject: [Biopython] question on installation of BioPython on Mac OS 10.7
In-Reply-To: <B909698A-91D1-4269-B81B-6BE4A0C2D61D@gmail.com>
References: <55428E6B-EC5B-42EA-B91C-2C45499D6091@gmail.com>
	<CAKVJ-_6Qnz_NnR8dkrNjsFJO1kzSM+SE6EcgmbJZhz5_ztu-aA@mail.gmail.com>
	<1D2B139E-E1A7-4682-B2B8-B24186DEEA2D@gmail.com>
	<CAKVJ-_55qddwgBH45X8aCR5ZTLy5=PgiX5jkLgCw=AQgHjVMUg@mail.gmail.com>
	<76AE15B7-EA83-4DDF-83D3-BAC426E74CE2@gmail.com>
	<CAKVJ-_6qCMrjRgFjin-rP8955LK-O92EGCFzBATyrnMhxSo6fg@mail.gmail.com>
	<AD66BC02-B699-41B7-84F4-AA8ADC3C4144@nyumc.org>
	<B909698A-91D1-4269-B81B-6BE4A0C2D61D@gmail.com>
Message-ID: <78E520BD-F3A5-49D4-B83C-60170FC4AE16@nyumc.org>

Hi Daria -

If the output of typing:

    which easy_install

in a terminal window gives a path, then you have easy_install on your machine already. So you could just type:

    sudo easy_install pip

When that finishes, run the commands from before to install numpy and biopython.

Pip and easy_install are both Python package managers, and the choice of one over the other is largely a matter of preference.  So if you'd rather not install pip, you could replace "pip install" with "easy_install" in those previous commands.

If that doesn't work (i.e. you don't have easy_install either), you can install pip or setuptools (which includes easy_install) by following the instructions on this website<http://www.pip-installer.org/en/latest/index.html> I gave the link to before, under 'installation instructions.'

Hope that helps,

Jared

--
Jared Sampson
Xiangpeng Kong Lab
NYU Langone Medical Center
550 First Ave MSB 329/398
New York, NY 10016
212-263-7898
http://kong.med.nyu.edu/

On Feb 29, 2012, at 12:30 PM, Daria Fedyukina wrote:

Thank you Jared,

I tried to use these commands but it does not know what "pip" is.
I used with no "pip", but it did not help.

I will keep searching for the cure :)

-Daria


On Feb 28, 2012, at 3:05 PM, Sampson, Jared wrote:

Hi Daria et al. -

What about using pip<http://www.pip-installer.org/en/latest/index.html> or easy_install?

I'm running a Mac with Lion and I had no problem installing Biopython via:

    sudo pip install numpy
    sudo pip install biopython

I got a "you need numpy first" warning when I tried installing biopython alone, but running the commands above worked just fine to install numpy first, then Bio. It may be useful to note I've done this mainly within a virtualenv<http://www.virtualenv.org/en/latest/index.html>, but I think it should work using the system Python as well.

Jared


--
Jared Sampson
Xiangpeng Kong Lab
NYU Langone Medical Center
550 First Ave MSB 329/398
New York, NY 10016
212-263-7898
http://kong.med.nyu.edu/

On Feb 28, 2012, at 12:18 PM, Peter Cock wrote:

On Tue, Feb 28, 2012 at 5:00 PM, Daria Fedyukina <fedyukina at gmail.com<mailto:fedyukina at gmail.com>> wrote:

Hi Peter,

Thank you. I tried Terminal, it is indeed exactly the same.
NumPy is not installed somehow. Here is my screenshot. Do you have any
suggestions on how to install NumPy in such a way that this installation is
seen when I do "python setup.py build" in the terminal?

-Daria

Hi Daria,

Personally I use Apple's provided Python, which from memory
comes with a (slightly out of date) copy of NumPy. A more detailed
reply will have to wait until I'm at my Mac OS X 10.7 "Lion" machine.

If anyone else online right now has Biopython installed and working
on Mac OS X 10.7 "Lion" and can help now, please speak up.

One important question could be was this a clean install of Lion,
or an update from Snow Leopard?

I'm a little confused now even with the screenshots. It looks
like you have download python-2.7.2-macosx10.6.dmg and
numpy-1.6.1-py2.7-python.org-macosx10.3.dmg which should
work fine together BUT you will have two copies of Python (the
Apple provided Python, and Python.org<http://Python.org/>'s Python) and it can be
confusing about which is in use and which has a given library
installed

Peter
_______________________________________________
Biopython mailing list  -  Biopython at lists.open-bio.org<mailto:Biopython at lists.open-bio.org>
http://lists.open-bio.org/mailman/listinfo/biopython


------------------------------------------------------------
This email message, including any attachments, is for the sole use of the intended recipient(s) and may contain information that is proprietary, confidential, and exempt from disclosure under applicable law. Any unauthorized review, use, disclosure, or distribution is prohibited. If you have received this email in error please notify the sender by return email and delete the original message. Please note, the recipient should check this email and any attachments for the presence of viruses. The organization accepts no liability for any damage caused by any virus transmitted by this email.
=================================



------------------------------------------------------------
This email message, including any attachments, is for the sole use of the intended recipient(s) and may contain information that is proprietary, confidential, and exempt from disclosure under applicable law. Any unauthorized review, use, disclosure, or distribution is prohibited. If you have received this email in error please notify the sender by return email and delete the original message. Please note, the recipient should check this email and any attachments for the presence of viruses. The organization accepts no liability for any damage caused by any virus transmitted by this email.
=================================