From eric.talevich at gmail.com  Fri Jul  1 11:27:42 2011
From: eric.talevich at gmail.com (Eric Talevich)
Date: Fri, 1 Jul 2011 11:27:42 -0400
Subject: [Biopython] Having a hard time getting a handle on handles
In-Reply-To: <4E0D441C.5020600@gmail.com>
References: <4E0D212B.4040206@gmail.com>
	<BANLkTinF=T-0OMHJNmbg9bM2E2ZP61xrCw@mail.gmail.com>
	<4E0D441C.5020600@gmail.com>
Message-ID: <BANLkTimammQ2KbKy2m=8wxfBEQXhpX07zw@mail.gmail.com>

OK, the "iteration" is where you're trying to construct a list. Where it
says:

blast_record = list(NCBIXML.read(result_handle))

Try:

blast_record = NCBIXML.read(result_handle)
print blast_record

And see what's in the blast_record object. That should make it more clear
how the rest of your code should navigate it.

-E

On Thu, Jun 30, 2011 at 11:50 PM, Dilara Ally <dilara.ally at gmail.com> wrote:

> Thanks, I tried that and now the error is
>
>
> Traceback (most recent call last):
>  File "<stdin>", line 12, in <module>
> TypeError: iteration over non-sequence
>
> Dilara
>
>
> On 6/30/11 8:24 PM, Eric Talevich wrote:
>
>> from Bio.Blast import NCBIXML
>>
>

From p.j.a.cock at googlemail.com  Sat Jul  2 05:18:45 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Sat, 2 Jul 2011 10:18:45 +0100
Subject: [Biopython] multiple sequence blast
In-Reply-To: <20110630104227.GA2883@sobchak>
References: <4E0BAD67.70305@gmail.com>
	<20110630104227.GA2883@sobchak>
Message-ID: <CAKVJ-_5B1i9j+zp9b67tStmTVnvODGV7Xu_s-o9BPHwQNifBGg@mail.gmail.com>

On Thu, Jun 30, 2011 at 11:42 AM, Brad Chapman <chapmanb at 50mail.com> wrote:
> Dilara;
> Thanks for the message. It would be helpful if you'd include the
> error message traceback that you got stuck on; this will help
> pinpoint the problem.
>
> From reading your code, my guess is that you are getting and IOError
> about files not existing. When you do os.listdir, it only includes
> the name of the files, not the full path to where they are located.

I would have suggested the same thing.

In addition, are you really trying to run 100,000 contigs though
the NCBI online BLAST service? If it works it will take a long time,
but they might not like that and block your access. Big BLAST
jobs like this are better done by installing BLAST+ (and in this case
the NR database) locally. Biopython has wrappers to help call
standalone BLAST too.

Peter

From dilara.ally at gmail.com  Sun Jul  3 14:27:12 2011
From: dilara.ally at gmail.com (Dilara Ally)
Date: Sun, 03 Jul 2011 11:27:12 -0700
Subject: [Biopython] multiple sequence blast
In-Reply-To: <CAKVJ-_5B1i9j+zp9b67tStmTVnvODGV7Xu_s-o9BPHwQNifBGg@mail.gmail.com>
References: <4E0BAD67.70305@gmail.com>	<20110630104227.GA2883@sobchak>
	<CAKVJ-_5B1i9j+zp9b67tStmTVnvODGV7Xu_s-o9BPHwQNifBGg@mail.gmail.com>
Message-ID: <4E10B480.1030600@gmail.com>

Thanks Peter.

On 7/2/11 2:18 AM, Peter Cock wrote:
> On Thu, Jun 30, 2011 at 11:42 AM, Brad Chapman<chapmanb at 50mail.com>  wrote:
>> Dilara;
>> Thanks for the message. It would be helpful if you'd include the
>> error message traceback that you got stuck on; this will help
>> pinpoint the problem.
>>
>>  From reading your code, my guess is that you are getting and IOError
>> about files not existing. When you do os.listdir, it only includes
>> the name of the files, not the full path to where they are located.
> I would have suggested the same thing.
>
> In addition, are you really trying to run 100,000 contigs though
> the NCBI online BLAST service? If it works it will take a long time,
> but they might not like that and block your access. Big BLAST
> jobs like this are better done by installing BLAST+ (and in this case
> the NR database) locally. Biopython has wrappers to help call
> standalone BLAST too.
>
> Peter
>

From dilara.ally at gmail.com  Sun Jul  3 15:27:53 2011
From: dilara.ally at gmail.com (Dilara Ally)
Date: Sun, 03 Jul 2011 12:27:53 -0700
Subject: [Biopython] multiple sequence blast
In-Reply-To: <CAKVJ-_5B1i9j+zp9b67tStmTVnvODGV7Xu_s-o9BPHwQNifBGg@mail.gmail.com>
References: <4E0BAD67.70305@gmail.com>	<20110630104227.GA2883@sobchak>
	<CAKVJ-_5B1i9j+zp9b67tStmTVnvODGV7Xu_s-o9BPHwQNifBGg@mail.gmail.com>
Message-ID: <4E10C2B9.2000909@gmail.com>

Hi Peter

How long will it take then to do a big BLAST job that has over 600,000 
contigs.  Wouldn't downloading the databasese and doing a standalone 
BLAST take a lot of cpu memory?  Should I be doing this on a cluster?

Dilara

On 7/2/11 2:18 AM, Peter Cock wrote:
> On Thu, Jun 30, 2011 at 11:42 AM, Brad Chapman<chapmanb at 50mail.com>  wrote:
>> Dilara;
>> Thanks for the message. It would be helpful if you'd include the
>> error message traceback that you got stuck on; this will help
>> pinpoint the problem.
>>
>>  From reading your code, my guess is that you are getting and IOError
>> about files not existing. When you do os.listdir, it only includes
>> the name of the files, not the full path to where they are located.
> I would have suggested the same thing.
>
> In addition, are you really trying to run 100,000 contigs though
> the NCBI online BLAST service? If it works it will take a long time,
> but they might not like that and block your access. Big BLAST
> jobs like this are better done by installing BLAST+ (and in this case
> the NR database) locally. Biopython has wrappers to help call
> standalone BLAST too.
>
> Peter
>

From p.j.a.cock at googlemail.com  Sun Jul  3 19:52:34 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 4 Jul 2011 00:52:34 +0100
Subject: [Biopython] multiple sequence blast
In-Reply-To: <4E10C2B9.2000909@gmail.com>
References: <4E0BAD67.70305@gmail.com> <20110630104227.GA2883@sobchak>
	<CAKVJ-_5B1i9j+zp9b67tStmTVnvODGV7Xu_s-o9BPHwQNifBGg@mail.gmail.com>
	<4E10C2B9.2000909@gmail.com>
Message-ID: <CAKVJ-_44-QXPUooJ6Zu4VkYcTJQvharchYLdobuxu-qUXcycBQ@mail.gmail.com>

On Sun, Jul 3, 2011 at 8:27 PM, Dilara Ally wrote:
> Hi Peter
>
> How long will it take then to do a big BLAST job that has over
> 600,000 contigs.

How long is a piece of string? ;)

What I mean is this is hard to say without looking at your data.
Do you know the total sequence length of the contigs?

Try doing 60 representative contigs on your machine for an
estimate (note their lengths are important - shorter contigs
should be faster to run as BLAST queries).

Remember that standalone BLAST+ can be run multi-threaded.
It will depend on the number of CPUs and how much RAM you
have.

> Wouldn't downloading the databasese and doing a standalone
> BLAST take a lot of cpu memory?

Yes, it will take a lot of CPU time, and a moderate amount of
RAM (if you are doing genome assembly to get the contigs,
that will probably have needed far more RAM than running
BLAST will).

>?Should I be doing this on a cluster?

It would probably be worth while. You *might* manage with a
powerful multicore desktop (like a recent MacPro or similar)
or powerful server.

Peter


From kokomutai at gmail.com  Mon Jul  4 04:25:35 2011
From: kokomutai at gmail.com (Koko Mutai)
Date: Mon, 4 Jul 2011 11:25:35 +0300
Subject: [Biopython] (no subject)
Message-ID: <CA++B1TiDWe+TbzG=06SpCc5g5eaeZ4CXDsakVZKtoyu-c39nRg@mail.gmail.com>

hallo l would like to ask how to import,sequence matrix
metalloproteinases and DNA annotation using biopython

From from.d.putto at gmail.com  Thu Jul  7 06:26:48 2011
From: from.d.putto at gmail.com (Sheila the angel)
Date: Thu, 7 Jul 2011 12:26:48 +0200
Subject: [Biopython] Passing sequence to local BLAST
Message-ID: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>

Hi All,

I want to download genbank file from NCBI and pass the protein sequence
directly to the local BLAST. But I am getting error in BLAST step
#-------------------------------------------------------------------------------------------
from Bio import SeqIO
from Bio import Entrez
from Bio.Blast.Applications import NcbiblastpCommandline
id='200203'
handle = Entrez.efetch(db="protein", id=id, rettype="gp")
seq_record = SeqIO.read(handle, "gb")
x=seq_record.seq                                            #getting the
sequence in a variable x
blastp_cline = NcbiblastpCommandline(query=x, db="protein_database",
evalue=0.001)    # My BLAST command
result_handle, stderr = blastp_cline()                    #Running BLAST and
getting error :(

#-------------------------------------------------------------------------------------------

At this last step I am getting error.....
I sort-of understand the problem.....it is taking value of x as a file name
while its a variable which contains the sequence.
Is there any way out to this problem without making temporary file.


Thanks in Advance

--
Cheers
Sheila

From p.j.a.cock at googlemail.com  Thu Jul  7 06:43:22 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 7 Jul 2011 11:43:22 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
Message-ID: <CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>

On Thu, Jul 7, 2011 at 11:26 AM, Sheila the angel
<from.d.putto at gmail.com> wrote:
> Hi All,
>
> I want to download genbank file from NCBI and pass the protein sequence
> directly to the local BLAST. But I am getting error in BLAST step
> #-------------------------------------------------------------------------------------------
> from Bio import SeqIO
> from Bio import Entrez
> from Bio.Blast.Applications import NcbiblastpCommandline
> id='200203'
> handle = Entrez.efetch(db="protein", id=id, rettype="gp")
> seq_record = SeqIO.read(handle, "gb")
> x=seq_record.seq ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?#getting the
> sequence in a variable x
> blastp_cline = NcbiblastpCommandline(query=x, db="protein_database",
> evalue=0.001) ? ?# My BLAST command
> result_handle, stderr = blastp_cline() ? ? ? ? ? ? ? ? ? ?#Running BLAST and
> getting error :(
>
> #-------------------------------------------------------------------------------------------
>
> At this last step I am getting error.....
> I sort-of understand the problem.....it is taking value of x as a file name
> while its a variable which contains the sequence.
> Is there any way out to this problem without making temporary file.

With the standalone blast tools you generally need to prepare an input
FASTA file with your query sequence(s).

However, in principle you can give the input filename as - (default),
and instead pipe the query FASTA record in as stdin (standard input).
Try something like this (untested):

...
blastp_cline = NcbiblastpCommandline(query="-", db="protein_database",
evalue=0.001)
stdout, stderr = blastp_cline(stdin=seq_record.format("fasta"))

Peter


From from.d.putto at gmail.com  Thu Jul  7 06:53:28 2011
From: from.d.putto at gmail.com (Sheila the angel)
Date: Thu, 7 Jul 2011 12:53:28 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
Message-ID: <CAFinXcQmm3FRC6hEsXR77_ddMvA-4wWGDhJ70KvyfKrz8NsM_w@mail.gmail.com>

Great !!!! It works
Thanks a lot :)

On Thu, Jul 7, 2011 at 12:43 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 7, 2011 at 11:26 AM, Sheila the angel
> <from.d.putto at gmail.com> wrote:
> > Hi All,
> >
> > I want to download genbank file from NCBI and pass the protein sequence
> > directly to the local BLAST. But I am getting error in BLAST step
> >
> #-------------------------------------------------------------------------------------------
> > from Bio import SeqIO
> > from Bio import Entrez
> > from Bio.Blast.Applications import NcbiblastpCommandline
> > id='200203'
> > handle = Entrez.efetch(db="protein", id=id, rettype="gp")
> > seq_record = SeqIO.read(handle, "gb")
> > x=seq_record.seq                                            #getting the
> > sequence in a variable x
> > blastp_cline = NcbiblastpCommandline(query=x, db="protein_database",
> > evalue=0.001)    # My BLAST command
> > result_handle, stderr = blastp_cline()                    #Running BLAST
> and
> > getting error :(
> >
> >
> #-------------------------------------------------------------------------------------------
> >
> > At this last step I am getting error.....
> > I sort-of understand the problem.....it is taking value of x as a file
> name
> > while its a variable which contains the sequence.
> > Is there any way out to this problem without making temporary file.
>
> With the standalone blast tools you generally need to prepare an input
> FASTA file with your query sequence(s).
>
> However, in principle you can give the input filename as - (default),
> and instead pipe the query FASTA record in as stdin (standard input).
> Try something like this (untested):
>
> ...
> blastp_cline = NcbiblastpCommandline(query="-", db="protein_database",
> evalue=0.001)
> stdout, stderr = blastp_cline(stdin=seq_record.format("fasta"))
>
> Peter
>

From p.j.a.cock at googlemail.com  Thu Jul  7 06:55:29 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 7 Jul 2011 11:55:29 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAFinXcQmm3FRC6hEsXR77_ddMvA-4wWGDhJ70KvyfKrz8NsM_w@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcQmm3FRC6hEsXR77_ddMvA-4wWGDhJ70KvyfKrz8NsM_w@mail.gmail.com>
Message-ID: <CAKVJ-_7U52gqY3fR80fk8f5TNpYQiTovoVeTjPPyM5D7T6jMWg@mail.gmail.com>

On Thu, Jul 7, 2011 at 11:53 AM, Sheila the angel
<from.d.putto at gmail.com> wrote:
> Great !!!!?It works
> Thanks a lot :)

Thanks for letting us know.

Another solution would be to just download the file from the NCBI
in FASTA format rather than GenBank format - but I expect you
had other reasons for doing that.

Peter


From jessecolangelolillis at googlemail.com  Thu Jul  7 07:30:58 2011
From: jessecolangelolillis at googlemail.com (Jesse Colangelo-Lillis)
Date: Thu, 7 Jul 2011 04:30:58 -0700
Subject: [Biopython] Bio.Blast; entrez_query= multiple organisms
Message-ID: <CALgkfoahGpswsEg0d3DwmcTsAFihzZmjTaTZ8JFgxzKJ7HB-Sg@mail.gmail.com>

Can someone tell me the format for specifying multiple organisms
within the blast parameters?

I have this:

result_handle = NCBIWWW.qblast("blastp", "nr", gene_seq, expect=100,
hitlist_size=1, entrez_query="unclassified Caudovirales[orgn]")

but I actually want to blast against both 'Caudovirales' and
'unclassified Caudovirales'.
Thanks for any help.

-- 
Jesse Colangelo-Lillis
--
Australian National University
Research School Earth Sciences
Bldg 61. Mills Road
Canberra, ACT 0200
Australia
cell: 0415 380 105
--

From p.j.a.cock at googlemail.com  Thu Jul  7 07:42:45 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 7 Jul 2011 12:42:45 +0100
Subject: [Biopython] Bio.Blast; entrez_query= multiple organisms
In-Reply-To: <CALgkfoahGpswsEg0d3DwmcTsAFihzZmjTaTZ8JFgxzKJ7HB-Sg@mail.gmail.com>
References: <CALgkfoahGpswsEg0d3DwmcTsAFihzZmjTaTZ8JFgxzKJ7HB-Sg@mail.gmail.com>
Message-ID: <CAKVJ-_5DjqSjT1NVJnBsaA_VcYJECMwZz66ti3JWFuUDMsNPNA@mail.gmail.com>

On Thu, Jul 7, 2011 at 12:30 PM, Jesse Colangelo-Lillis
<jessecolangelolillis at googlemail.com> wrote:
> Can someone tell me the format for specifying multiple organisms
> within the blast parameters?
>
> I have this:
>
> result_handle = NCBIWWW.qblast("blastp", "nr", gene_seq, expect=100,
> hitlist_size=1, entrez_query="unclassified Caudovirales[orgn]")
>
> but I actually want to blast against both 'Caudovirales' and
> 'unclassified Caudovirales'.
> Thanks for any help.

You probably would need explicit quotes round unclassified Caudovirales
on the Entrez query, otherwise it will do this I think:

unclassified AND Caudovirales[orgn]

I would use the taxid rather than the name to avoid the space problem.

Is a taxid that covers both your clades of interest?

Otherwise combine fields with OR (or AND as appropriate). Play with
the web interface to build the right query:

http://www.ncbi.nlm.nih.gov/protein/advanced

Peter

From mnemonico at posthocergopropterhoc.net  Fri Jul  8 00:19:20 2011
From: mnemonico at posthocergopropterhoc.net (A M Torres, Hugo)
Date: Fri, 8 Jul 2011 01:19:20 -0300
Subject: [Biopython] error writing fasta file using SeqIO
Message-ID: <CAAVOifQE_=djoORwxsMmYNdXkiQz1jHNHo28TMEm8kMpXah87w@mail.gmail.com>

Hi. Can someone spot why I can't create a fasta file here? I tried following
the cookbook tutorial but something goes wrong when I try to write  the
sequence from a SeqRecord object to a fasta file:

 Lodge It

   - New <http://paste.pound-python.org/>
   - All <http://paste.pound-python.org/all/>
   - About <http://paste.pound-python.org/about/>
   - ? <http://paste.pound-python.org/help/>

 Paste #9205
Paste Details

reply <http://paste.pound-python.org/?reply_to=9205> |
raw<http://paste.pound-python.org/raw/9205/>

posted on Jul 8, 2011 4:12:16 AM

   - reply to this paste <http://paste.pound-python.org/?reply_to=9205>
   - download paste <http://paste.pound-python.org/raw/9205/>
   - compare with paste
   - select different colorscheme  Autumn Borland Bw Colorful Default Emacs
   Friendly Fruity Manni Monokai Murphy Native Pastie Perldoc Tango Trac Vs
   - toggle line numbers<http://paste.pound-python.org/show/9205/?linenos=no>

   1
 2
 3
 4
 5
 6
 7
 8
 9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78

import abifpy
from Bio.Seq import Seq
from Bio.SeqRecord import SeqRecord
from Bio.Emboss.Applications import NeedleCommandline
import os #uso a funcao listdir
from Bio import SeqIO

def acessa_ab1(arquivo,trim=True): #generalizar depois
    """acessa um arquivo ab1 e retorna um objeto SeqRecord"""
    dado = abifpy.Trace(arquivo)
    if trim:
        cortado = dado.trim(dado.seq(ambig=True))
        return SeqRecord(cortado, id=arquivo, description='dado cortado')
    else:
        return dado.seqrecord()

def abre_ref(arquivo):
    """acessa um arquivo contendo uma sequencia de referencia
      retorna um objeto SeqRecord"""
    with open(arquivo, 'rUb') as dado:
        referencia = SeqIO.read(dado, 'genbank')
    return referencia

def salva_fasta(obj_SeqRecord):
    """Pega um objeto SeqRecord e cria um fasta com a sua sequencia"""

    SeqIO.write([obj_SeqRecord], obj_SeqRecord + '.fasta','fasta')

def processar_lote(diretorio, ref):
    """abre os arquivos ab1 de uma pasta, apara, salva em fasta, faz o
alinhamento com
    o fasta de referencia e salva o alinhamento em um arquivo para analise
    posterior.
    diretorio --> uma string representando o caminho da pasta contendo
os arquivos
    ref --> uma string representando o caminho absoluto + genbank com a
    sequencia de referencia.
    """

    referencia = abre_ref(ref)
    referencia.id = 'sequencia de referencia'
    salva_fasta(referencia)
    ab1files = [x for x in os.listdir(diretorio) if x.endswith('.ab1')]
    for file in ab1files:
        dado = acessa_ab1(diretorio + file)
        salva_fasta(dado)
        needle_cline = NeedleCommandline(asequence='referencia.fasta',
                                        bsequence= file + '.fasta',
gapopen=10, gapextend=0.5,
                                        outfile=file + "_aligned.txt")
    stdout, stderr = needle_cline()




#pasta = '/home/mercutio22/Dropbox/My scripts/Fabi/vs/Seq_placa273 analisada/'
#referencia = '/home/mercutio22/Dropbox/My
scripts/Fabi/vs/Seq_placa273 analisada/BRCA1 (total) - Frag 3450.gb'

#processar_lote(pasta, referencia)

dado = acessa_ab1('/home/mercutio22/Dropbox/My
scripts/Fabi/vs/Seq_placa273 analisada/1174411_3450F_A01.ab1')
print type(dado)
salva_fasta(dado)


===============================error msg==============
<class 'Bio.SeqRecord.SeqRecord'>
Traceback (most recent call last):
  File "louise.py", line 59, in <module>
    salva_fasta(dado)
  File "louise.py", line 26, in salva_fasta
    SeqIO.write([obj_SeqRecord], obj_SeqRecord + '.fasta','fasta')
  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/__init__.py", line 412, in write
    count = writer_class(handle).write_file(sequences)
  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/Interfaces.py", line
271, in write_file
    count = self.write_records(records)
  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/Interfaces.py", line
256, in write_records
    self.write_record(record)
  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/FastaIO.py", line 134,
in write_record
    self.handle.write(">%s\n" % title)
AttributeError: 'SeqRecord' object has no attribute 'write'

From w.arindrarto at gmail.com  Fri Jul  8 00:46:11 2011
From: w.arindrarto at gmail.com (Wibowo Arindrarto)
Date: Fri, 8 Jul 2011 06:46:11 +0200
Subject: [Biopython] error writing fasta file using SeqIO
In-Reply-To: <CAAVOifQE_=djoORwxsMmYNdXkiQz1jHNHo28TMEm8kMpXah87w@mail.gmail.com>
References: <CAAVOifQE_=djoORwxsMmYNdXkiQz1jHNHo28TMEm8kMpXah87w@mail.gmail.com>
Message-ID: <CADEGkF5-VhP+_TsSb6FxoL32uWzuFqG5CxTN6WFvCd7hUwkOhw@mail.gmail.com>

Hi Hugo,

I think the problem is you tried to concatenate a SeqRecord object and a
string object. Do this in 'salva_fasta' instead:

SeqIO.write([obj_SeqRecord], obj_SeqRecord.id + '.fasta', 'fasta')

And just as an additional input, in the 'processar_lote' method, you can use
this to generate a list of absolute file name paths (import the os and glob
module beforehand).

files = [os.path.abspath(x) for x in glob.glob('*.ab1')]

os.path.abspath() returns the absolute file path for a given file, and
glob.glob() returns a list of names that matches the given pattern.

Hope that helps!
---
Wibowo Arindrarto (bow)
http://bow.web.id



On Fri, Jul 8, 2011 at 06:19, A M Torres, Hugo <
mnemonico at posthocergopropterhoc.net> wrote:

> Hi. Can someone spot why I can't create a fasta file here? I tried
> following
> the cookbook tutorial but something goes wrong when I try to write  the
> sequence from a SeqRecord object to a fasta file:
>
>  Lodge It
>
>   - New <http://paste.pound-python.org/>
>   - All <http://paste.pound-python.org/all/>
>   - About <http://paste.pound-python.org/about/>
>   - ? <http://paste.pound-python.org/help/>
>
>  Paste #9205
> Paste Details
>
> reply <http://paste.pound-python.org/?reply_to=9205> |
> raw<http://paste.pound-python.org/raw/9205/>
>
> posted on Jul 8, 2011 4:12:16 AM
>
>   - reply to this paste <http://paste.pound-python.org/?reply_to=9205>
>   - download paste <http://paste.pound-python.org/raw/9205/>
>   - compare with paste
>   - select different colorscheme  Autumn Borland Bw Colorful Default Emacs
>   Friendly Fruity Manni Monokai Murphy Native Pastie Perldoc Tango Trac Vs
>   - toggle line numbers<
> http://paste.pound-python.org/show/9205/?linenos=no>
>
>   1
>  2
>  3
>  4
>  5
>  6
>  7
>  8
>  9
> 10
> 11
> 12
> 13
> 14
> 15
> 16
> 17
> 18
> 19
> 20
> 21
> 22
> 23
> 24
> 25
> 26
> 27
> 28
> 29
> 30
> 31
> 32
> 33
> 34
> 35
> 36
> 37
> 38
> 39
> 40
> 41
> 42
> 43
> 44
> 45
> 46
> 47
> 48
> 49
> 50
> 51
> 52
> 53
> 54
> 55
> 56
> 57
> 58
> 59
> 60
> 61
> 62
> 63
> 64
> 65
> 66
> 67
> 68
> 69
> 70
> 71
> 72
> 73
> 74
> 75
> 76
> 77
> 78
>
> import abifpy
> from Bio.Seq import Seq
> from Bio.SeqRecord import SeqRecord
> from Bio.Emboss.Applications import NeedleCommandline
> import os #uso a funcao listdir
> from Bio import SeqIO
>
> def acessa_ab1(arquivo,trim=True): #generalizar depois
>    """acessa um arquivo ab1 e retorna um objeto SeqRecord"""
>    dado = abifpy.Trace(arquivo)
>    if trim:
>        cortado = dado.trim(dado.seq(ambig=True))
>        return SeqRecord(cortado, id=arquivo, description='dado cortado')
>    else:
>        return dado.seqrecord()
>
> def abre_ref(arquivo):
>    """acessa um arquivo contendo uma sequencia de referencia
>      retorna um objeto SeqRecord"""
>    with open(arquivo, 'rUb') as dado:
>        referencia = SeqIO.read(dado, 'genbank')
>    return referencia
>
> def salva_fasta(obj_SeqRecord):
>    """Pega um objeto SeqRecord e cria um fasta com a sua sequencia"""
>
>    SeqIO.write([obj_SeqRecord], obj_SeqRecord + '.fasta','fasta')
>
> def processar_lote(diretorio, ref):
>    """abre os arquivos ab1 de uma pasta, apara, salva em fasta, faz o
> alinhamento com
>    o fasta de referencia e salva o alinhamento em um arquivo para analise
>    posterior.
>    diretorio --> uma string representando o caminho da pasta contendo
> os arquivos
>    ref --> uma string representando o caminho absoluto + genbank com a
>    sequencia de referencia.
>    """
>
>    referencia = abre_ref(ref)
>    referencia.id = 'sequencia de referencia'
>    salva_fasta(referencia)
>    ab1files = [x for x in os.listdir(diretorio) if x.endswith('.ab1')]
>    for file in ab1files:
>        dado = acessa_ab1(diretorio + file)
>        salva_fasta(dado)
>        needle_cline = NeedleCommandline(asequence='referencia.fasta',
>                                        bsequence= file + '.fasta',
> gapopen=10, gapextend=0.5,
>                                        outfile=file + "_aligned.txt")
>    stdout, stderr = needle_cline()
>
>
>
>
> #pasta = '/home/mercutio22/Dropbox/My scripts/Fabi/vs/Seq_placa273
> analisada/'
> #referencia = '/home/mercutio22/Dropbox/My
> scripts/Fabi/vs/Seq_placa273 analisada/BRCA1 (total) - Frag 3450.gb'
>
> #processar_lote(pasta, referencia)
>
> dado = acessa_ab1('/home/mercutio22/Dropbox/My
> scripts/Fabi/vs/Seq_placa273 analisada/1174411_3450F_A01.ab1')
> print type(dado)
> salva_fasta(dado)
>
>
> ===============================error msg==============
> <class 'Bio.SeqRecord.SeqRecord'>
> Traceback (most recent call last):
>  File "louise.py", line 59, in <module>
>    salva_fasta(dado)
>  File "louise.py", line 26, in salva_fasta
>    SeqIO.write([obj_SeqRecord], obj_SeqRecord + '.fasta','fasta')
>  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/__init__.py", line 412, in
> write
>    count = writer_class(handle).write_file(sequences)
>  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/Interfaces.py", line
> 271, in write_file
>    count = self.write_records(records)
>  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/Interfaces.py", line
> 256, in write_records
>    self.write_record(record)
>  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/FastaIO.py", line 134,
> in write_record
>    self.handle.write(">%s\n" % title)
> AttributeError: 'SeqRecord' object has no attribute 'write'
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>

From cmccoy at fhcrc.org  Fri Jul  8 18:33:35 2011
From: cmccoy at fhcrc.org (Connor McCoy)
Date: Fri, 8 Jul 2011 15:33:35 -0700
Subject: [Biopython] seqmagick
Message-ID: <CAChfGK1_-1+FABnHS+oT_3Unja-i+uXSLv3wABpfLfMwW-5bxQ@mail.gmail.com>

Hi all,

We wrote (and use) seqmagick, a little tool to conveniently access
BioPython's Sequence I/O and manipulation capabilities from the command
line.

Seqmagick allows one to extract summary information on sequence files,
convert between formats based on file extension, modify sequences, and
much more. For example:

# Convert from fasta to stockholm
> seqmagick convert seqfile.fasta seqfile.sto

# Reverse complement the first 5 sequences in file
> seqmagick convert --reverse-complement --head 5 seqfile.fasta seqfile.rev=
comp.fasta

# Remove all columns containing > 5% gaps, in place
> seqmagick mogrify --squeeze-threshold 0.95 seqfile.fasta

For more info, see: http://fhcrc.github.com/seqmagick/

Or to install:

     pip install seqmagick

Comments / contributions welcome.

Cheers,
Connor

From mnemonico at posthocergopropterhoc.net  Mon Jul 11 02:22:10 2011
From: mnemonico at posthocergopropterhoc.net (A M Torres, Hugo)
Date: Mon, 11 Jul 2011 03:22:10 -0300
Subject: [Biopython] error writing fasta file using SeqIO
In-Reply-To: <CADEGkF5-VhP+_TsSb6FxoL32uWzuFqG5CxTN6WFvCd7hUwkOhw@mail.gmail.com>
References: <CAAVOifQE_=djoORwxsMmYNdXkiQz1jHNHo28TMEm8kMpXah87w@mail.gmail.com>
	<CADEGkF5-VhP+_TsSb6FxoL32uWzuFqG5CxTN6WFvCd7hUwkOhw@mail.gmail.com>
Message-ID: <CAAVOifQFo9m=vcfn2vva8Rp+GyY+j9i15bTiDO4xxm_YeYnVxQ@mail.gmail.com>

Hi folks.

Thanks once again for helping me out. That problem is solved. I took a look
at the glob module. It is really just neat!

A new problem has arised when I try to call the process that should run the
sequence alignment. I try to use the 'needle' subprocess but it fails with
this error: http://paste.pound-python.org/show/9395/.

Here is how the code looks now: http://paste.pound-python.org/show/9394/.

The weird thing is needle executes ok when I use needle_cline as it is in a
bash shell. I took care to write full paths when pointing to individual
files and the needle binary but that hasn't solved the error.

Any clues?

On Fri, Jul 8, 2011 at 1:46 AM, Wibowo Arindrarto <w.arindrarto at gmail.com>wrote:

> Hi Hugo,
>
> I think the problem is you tried to concatenate a SeqRecord object and a
> string object. Do this in 'salva_fasta' instead:
>
> SeqIO.write([obj_SeqRecord], obj_SeqRecord.id + '.fasta', 'fasta')
>
> And just as an additional input, in the 'processar_lote' method, you can
> use this to generate a list of absolute file name paths (import the os and
> glob module beforehand).
>
> files = [os.path.abspath(x) for x in glob.glob('*.ab1')]
>
> os.path.abspath() returns the absolute file path for a given file, and
> glob.glob() returns a list of names that matches the given pattern.
>
> Hope that helps!
> ---
> Wibowo Arindrarto (bow)
> http://bow.web.id
>
>
>
>

From gori at cs.ru.nl  Mon Jul 11 12:07:59 2011
From: gori at cs.ru.nl (Fabio Gori)
Date: Mon, 11 Jul 2011 18:07:59 +0200
Subject: [Biopython] Parsing FASTA records based on headers
Message-ID: <201107111808.00013.gori@cs.ru.nl>

Hi all,

I tried to parse a FASTA file to select the sequences whose headers satisfy a 
condition. The condition is that the first word of the header belongs to a list 
named SelectedSequencesId.
In the page http://biopython.org/wiki/SeqIO, I found this example, where the 
condition is that sequence length <300:

1 from Bio import SeqIO
2 
3 input_seq_iterator = SeqIO.parse(open("cor6_6.gb", "rU"), "genbank")
4 short_seq_iterator = (record for record in input_seq_iterator \
5                      if len(record.seq) < 300)
6 
7 output_handle = open("short_seqs.fasta", "w")
8 SeqIO.write(short_seq_iterator, output_handle, "fasta")
9 output_handle.close()

so I tried to substitute line 5 with
5 record.id.split()[0] in SelectedSequencesId)

But it did not work.
I was able to get what I wanted generating a list with all the records and 
then parsing it, but I'd like to find a solution that uses a generating 
expression.

Thanks in advance,

Fabio

-- 

F. Gori, PhD student
Intelligent Systems
ICIS (Institute for Computing and Information Sciences)
Radboud University Nijmegen

Home Page: http://www.cs.ru.nl/~gori/

From surykartka at gmail.com  Mon Jul 11 13:02:51 2011
From: surykartka at gmail.com (Dorota Matelska)
Date: Mon, 11 Jul 2011 19:02:51 +0200
Subject: [Biopython]  Parsing FASTA records based on headers
In-Reply-To: <201107111808.00013.gori@cs.ru.nl>
References: <201107111808.00013.gori@cs.ru.nl>
Message-ID: <5EECA7AF-1767-4BFB-9ECC-D8EACFCEED54@gmail.com>

Hi Fabio,

You forgot to change also the format name of your input file while using SeqIO.parse(). Your input is of fasta format, so instead of "genbank" put there "fasta", and it should work.

Hope this will help you :-)

Dorota

On Jul 11, 2011, at 6:07 PM, Fabio Gori wrote:

> Hi all,
> 
> I tried to parse a FASTA file to select the sequences whose headers satisfy a 
> condition. The condition is that the first word of the header belongs to a list 
> named SelectedSequencesId.
> In the page http://biopython.org/wiki/SeqIO, I found this example, where the 
> condition is that sequence length <300:
> 
> 1 from Bio import SeqIO
> 2 
> 3 input_seq_iterator = SeqIO.parse(open("cor6_6.gb", "rU"), "genbank")
> 4 short_seq_iterator = (record for record in input_seq_iterator \
> 5                      if len(record.seq) < 300)
> 6 
> 7 output_handle = open("short_seqs.fasta", "w")
> 8 SeqIO.write(short_seq_iterator, output_handle, "fasta")
> 9 output_handle.close()
> 
> so I tried to substitute line 5 with
> 5 record.id.split()[0] in SelectedSequencesId)
> 
> But it did not work.
> I was able to get what I wanted generating a list with all the records and 
> then parsing it, but I'd like to find a solution that uses a generating 
> expression.
> 
> Thanks in advance,
> 
> Fabio
> 
> -- 
> 
> F. Gori, PhD student
> Intelligent Systems
> ICIS (Institute for Computing and Information Sciences)
> Radboud University Nijmegen
> 
> Home Page: http://www.cs.ru.nl/~gori/
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython



From w.arindrarto at gmail.com  Mon Jul 11 13:02:36 2011
From: w.arindrarto at gmail.com (Wibowo Arindrarto)
Date: Mon, 11 Jul 2011 19:02:36 +0200
Subject: [Biopython] error writing fasta file using SeqIO
In-Reply-To: <CAAVOifQFo9m=vcfn2vva8Rp+GyY+j9i15bTiDO4xxm_YeYnVxQ@mail.gmail.com>
References: <CAAVOifQE_=djoORwxsMmYNdXkiQz1jHNHo28TMEm8kMpXah87w@mail.gmail.com>
	<CADEGkF5-VhP+_TsSb6FxoL32uWzuFqG5CxTN6WFvCd7hUwkOhw@mail.gmail.com>
	<CAAVOifQFo9m=vcfn2vva8Rp+GyY+j9i15bTiDO4xxm_YeYnVxQ@mail.gmail.com>
Message-ID: <CADEGkF5OkZB+YXLF35t03KLDH-viSScOQ3CWdahVnCyrwdwZjQ@mail.gmail.com>

Hi Hugo,

I think you should pass 'alinhar' as the argument for subprocess.call()
instead of 'needle_cline'. You can use the 'needle_cline' for the argument,
but you should also set shell to true, so the command
is subprocess.call(needle_cline, shell=True).

Hope that helps.
---
Wibowo Arindrarto (bow)
http://bow.web.id



On Mon, Jul 11, 2011 at 08:22, A M Torres, Hugo <
mnemonico at posthocergopropterhoc.net> wrote:

> Hi folks.
>
> Thanks once again for helping me out. That problem is solved. I took a look
> at the glob module. It is really just neat!
>
> A new problem has arised when I try to call the process that should run the
> sequence alignment. I try to use the 'needle' subprocess but it fails with
> this error: http://paste.pound-python.org/show/9395/.
>
> Here is how the code looks now: http://paste.pound-python.org/show/9394/.
>
> The weird thing is needle executes ok when I use needle_cline as it is in a
> bash shell. I took care to write full paths when pointing to individual
> files and the needle binary but that hasn't solved the error.
>
> Any clues?
>
>
> On Fri, Jul 8, 2011 at 1:46 AM, Wibowo Arindrarto <w.arindrarto at gmail.com>wrote:
>
>> Hi Hugo,
>>
>> I think the problem is you tried to concatenate a SeqRecord object and a
>> string object. Do this in 'salva_fasta' instead:
>>
>> SeqIO.write([obj_SeqRecord], obj_SeqRecord.id + '.fasta', 'fasta')
>>
>> And just as an additional input, in the 'processar_lote' method, you can
>> use this to generate a list of absolute file name paths (import the os and
>> glob module beforehand).
>>
>> files = [os.path.abspath(x) for x in glob.glob('*.ab1')]
>>
>> os.path.abspath() returns the absolute file path for a given file, and
>> glob.glob() returns a list of names that matches the given pattern.
>>
>> Hope that helps!
>> ---
>> Wibowo Arindrarto (bow)
>> http://bow.web.id
>>
>>
>>
>>
>

From devaniranjan at gmail.com  Mon Jul 11 15:43:56 2011
From: devaniranjan at gmail.com (George Devaniranjan)
Date: Mon, 11 Jul 2011 15:43:56 -0400
Subject: [Biopython] comparision of alignment scores
Message-ID: <CAFU65Pc-6uaZLwMZ-1LN-0ZK0vAtRt-P7B2yzfN=kDn00n5=4Q@mail.gmail.com>

I have several statistical comparison of alignment scores for a list of
proteins--generated using biopython with the use of BLOSUM and other matrix
generated by me.

All matrix methods (inc BLOSUM) correctly identies it's own sequence in a
collection of seq (high score set apart from the other scores) but I want to
see if my own matrix is better performing than the BLOSUM.
i.e --is my matrix more sensitive than BLOSUM.

Is there a way using statistics to find this out?
I know that this might not be the most appropriate forum to ask this
question but since many of you work in this area  I thought I will try.

Thank you,
George

From p.j.a.cock at googlemail.com  Mon Jul 11 15:51:09 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 11 Jul 2011 20:51:09 +0100
Subject: [Biopython] Parsing FASTA records based on headers
In-Reply-To: <201107111808.00013.gori@cs.ru.nl>
References: <201107111808.00013.gori@cs.ru.nl>
Message-ID: <CAKVJ-_4nUR+QdLc3h=2fhUppTk8s8XVgCrw9mqEGHmHSC7eDGw@mail.gmail.com>

On Mon, Jul 11, 2011 at 5:07 PM, Fabio Gori <gori at cs.ru.nl> wrote:
> Hi all,
>
> I tried to parse a FASTA file to select the sequences whose headers
> satisfy a condition.
>
> The condition is that the first word of the header belongs to a list
> named SelectedSequencesId.
>
> In the page http://biopython.org/wiki/SeqIO, I found this example, where the
> condition is that sequence length <300:
>
> ...
>
> so I tried to substitute line 5 with
> 5 record.id.split()[0] in SelectedSequencesId)

The SeqIO parse uses the first word of the ">" line as the id,
so all you need is this: record.id in SelectedSequencesId
rather than: len(record.seq) < 300

> But it did not work.

In what way? Did you also change the format to "fasta"
as Dorota pointed out?

Peter

From mnemonico at posthocergopropterhoc.net  Tue Jul 12 03:59:54 2011
From: mnemonico at posthocergopropterhoc.net (A M Torres, Hugo)
Date: Tue, 12 Jul 2011 04:59:54 -0300
Subject: [Biopython] error writing fasta file using SeqIO
In-Reply-To: <CADEGkF5OkZB+YXLF35t03KLDH-viSScOQ3CWdahVnCyrwdwZjQ@mail.gmail.com>
References: <CAAVOifQE_=djoORwxsMmYNdXkiQz1jHNHo28TMEm8kMpXah87w@mail.gmail.com>
	<CADEGkF5-VhP+_TsSb6FxoL32uWzuFqG5CxTN6WFvCd7hUwkOhw@mail.gmail.com>
	<CAAVOifQFo9m=vcfn2vva8Rp+GyY+j9i15bTiDO4xxm_YeYnVxQ@mail.gmail.com>
	<CADEGkF5OkZB+YXLF35t03KLDH-viSScOQ3CWdahVnCyrwdwZjQ@mail.gmail.com>
Message-ID: <CAAVOifQQUmkT46XK5EurQ6ZYnWAUatOCaVHu-Uq8GxKW3=Rh6g@mail.gmail.com>

Yes of course! I should've known. Thanks a bunch, this one was killing me.

On Mon, Jul 11, 2011 at 2:02 PM, Wibowo Arindrarto
<w.arindrarto at gmail.com>wrote:

> Hi Hugo,
>
> I think you should pass 'alinhar' as the argument for subprocess.call()
> instead of 'needle_cline'. You can use the 'needle_cline' for the argument,
> but you should also set shell to true, so the command
> is subprocess.call(needle_cline, shell=True).
>
> Hope that helps.
> ---
> Wibowo Arindrarto (bow)
> http://bow.web.id
>
>
>
> On Mon, Jul 11, 2011 at 08:22, A M Torres, Hugo <
> mnemonico at posthocergopropterhoc.net> wrote:
>
>> Hi folks.
>>
>> Thanks once again for helping me out. That problem is solved. I took a
>> look at the glob module. It is really just neat!
>>
>> A new problem has arised when I try to call the process that should run
>> the sequence alignment. I try to use the 'needle' subprocess but it fails
>> with this error: http://paste.pound-python.org/show/9395/.
>>
>> Here is how the code looks now: http://paste.pound-python.org/show/9394/.
>>
>> The weird thing is needle executes ok when I use needle_cline as it is in
>> a bash shell. I took care to write full paths when pointing to individual
>> files and the needle binary but that hasn't solved the error.
>>
>> Any clues?
>>
>>
>> On Fri, Jul 8, 2011 at 1:46 AM, Wibowo Arindrarto <w.arindrarto at gmail.com
>> > wrote:
>>
>>> Hi Hugo,
>>>
>>> I think the problem is you tried to concatenate a SeqRecord object and a
>>> string object. Do this in 'salva_fasta' instead:
>>>
>>> SeqIO.write([obj_SeqRecord], obj_SeqRecord.id + '.fasta', 'fasta')
>>>
>>> And just as an additional input, in the 'processar_lote' method, you can
>>> use this to generate a list of absolute file name paths (import the os and
>>> glob module beforehand).
>>>
>>> files = [os.path.abspath(x) for x in glob.glob('*.ab1')]
>>>
>>> os.path.abspath() returns the absolute file path for a given file, and
>>> glob.glob() returns a list of names that matches the given pattern.
>>>
>>> Hope that helps!
>>> ---
>>> Wibowo Arindrarto (bow)
>>> http://bow.web.id
>>>
>>>
>>>
>>>
>>
>

From lawson.jones at gmail.com  Wed Jul 13 14:40:18 2011
From: lawson.jones at gmail.com (Daniel Jones)
Date: Wed, 13 Jul 2011 14:40:18 -0400
Subject: [Biopython] clustalw align multiple sequences to reference.
Message-ID: <CAK0-BZ26e8=QKNjkxjcepsZcst0Bg7oMe-efu1bff_Y-Zg_Y+g@mail.gmail.com>

Hi Biopython users,
I have a file with many (~50,000) 200 bp sequences, each of which I would
like to align to a fixed reference sequence. I *don't* care about aligning
all 50,000 sequences with each other; I only care about aligning each one
with the reference sequence. I can't figure out a way to do this without
generating 50,000 files, which seems like ridiculous unnecessary overhead.
It seems like ClustalW's interface is quite inflexible in demanding separate
input and output files for each alignment, but I don't have much experience
using it so maybe I'm completely missing something.

Incidentally, I'm not wedded to the idea of using ClustalW, so if there's an
alternate alignment program that would make this easier, I'd certainly be
open to trying it.

Thanks,
Daniel Jones

From eric.talevich at gmail.com  Wed Jul 13 16:38:42 2011
From: eric.talevich at gmail.com (Eric Talevich)
Date: Wed, 13 Jul 2011 16:38:42 -0400
Subject: [Biopython] clustalw align multiple sequences to reference.
In-Reply-To: <CAK0-BZ26e8=QKNjkxjcepsZcst0Bg7oMe-efu1bff_Y-Zg_Y+g@mail.gmail.com>
References: <CAK0-BZ26e8=QKNjkxjcepsZcst0Bg7oMe-efu1bff_Y-Zg_Y+g@mail.gmail.com>
Message-ID: <CAMC681k=wjNkpZJMSsoR7to+HN1ooH+9x4R4Mco+HjpSX6JJ2Q@mail.gmail.com>

On Wed, Jul 13, 2011 at 2:40 PM, Daniel Jones <lawson.jones at gmail.com>wrote:

> Hi Biopython users,
> I have a file with many (~50,000) 200 bp sequences, each of which I would
> like to align to a fixed reference sequence. I *don't* care about aligning
> all 50,000 sequences with each other; I only care about aligning each one
> with the reference sequence. I can't figure out a way to do this without
> generating 50,000 files, which seems like ridiculous unnecessary overhead.
> It seems like ClustalW's interface is quite inflexible in demanding
> separate
> input and output files for each alignment, but I don't have much experience
> using it so maybe I'm completely missing something.
>
> Incidentally, I'm not wedded to the idea of using ClustalW, so if there's
> an
> alternate alignment program that would make this easier, I'd certainly be
> open to trying it.
>
>
Are these reads from sequencing? If so, then BWA or Bowtie might be what you
want:

http://bio-bwa.sourceforge.net/
http://bowtie-bio.sourceforge.net/index.shtml

If not, then you could try BLAST with your reference sequence as the query
and the short sequences as your database.

Cheers,
Eric

From p.j.a.cock at googlemail.com  Wed Jul 13 17:44:55 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 13 Jul 2011 22:44:55 +0100
Subject: [Biopython]  clustalw align multiple sequences to reference.
In-Reply-To: <CAMC681k=wjNkpZJMSsoR7to+HN1ooH+9x4R4Mco+HjpSX6JJ2Q@mail.gmail.com>
References: <CAK0-BZ26e8=QKNjkxjcepsZcst0Bg7oMe-efu1bff_Y-Zg_Y+g@mail.gmail.com>
	<CAMC681k=wjNkpZJMSsoR7to+HN1ooH+9x4R4Mco+HjpSX6JJ2Q@mail.gmail.com>
Message-ID: <CAKVJ-_4uBUNmYLt1xFoEE3saX-B7mD-mW3_3YzQKaCp7ezODaA@mail.gmail.com>

On Wednesday, July 13, 2011, Daniel Jones <lawson.jones at gmail.com> wrote:
> Hi Biopython users,
> I have a file with many (~50,000) 200 bp sequences, each of which I would
> like to align to a fixed reference sequence. I *don't* care about aligning
> all 50,000 sequences with each other; I only care about aligning each one
> with the reference sequence. I can't figure out a way to do this without
> generating 50,000 files, which seems like ridiculous unnecessary overhead.
> It seems like ClustalW's interface is quite inflexible in demanding separate
> input and output files for each alignment, but I don't have much experience
> using it so maybe I'm completely missing something.
>
> Incidentally, I'm not wedded to the idea of using ClustalW, so if there's an
> alternate alignment program that would make this easier, I'd certainly be
> open to trying it.
>
> Thanks,
> Daniel Jones

You need a pairwise alignment tool. Perhaps needle or water from the
EMBOSS suite, or Biopython's pairwise2 module would be suitable (not
in the tutorial, read the API docs).

However, as Eric suggested, an NGS alignment tool might be more appropriate.

Peter

From mnemonico at posthocergopropterhoc.net  Thu Jul 14 00:19:22 2011
From: mnemonico at posthocergopropterhoc.net (A M Torres, Hugo)
Date: Thu, 14 Jul 2011 01:19:22 -0300
Subject: [Biopython] clustalw align multiple sequences to reference.
In-Reply-To: <CAKVJ-_4uBUNmYLt1xFoEE3saX-B7mD-mW3_3YzQKaCp7ezODaA@mail.gmail.com>
References: <CAK0-BZ26e8=QKNjkxjcepsZcst0Bg7oMe-efu1bff_Y-Zg_Y+g@mail.gmail.com>
	<CAMC681k=wjNkpZJMSsoR7to+HN1ooH+9x4R4Mco+HjpSX6JJ2Q@mail.gmail.com>
	<CAKVJ-_4uBUNmYLt1xFoEE3saX-B7mD-mW3_3YzQKaCp7ezODaA@mail.gmail.com>
Message-ID: <CAAVOifQbad-PbsZ+caSxKPKdkwJNFM3ZOHAr02ubA+qb5n06kw@mail.gmail.com>

I am having the same problem. First I was running "needle" on each
sequencing data and its reference then I thought of generating a big fasta
containing all sequences and then running MUSCLE. Like Daniel Jones I don't
mind that sequences are aligned against each other but they should be
aligned properly against the reference sequence.

On a side note: I have sequenced DNA data which I need to align to a
reference sequence and look for mutations. I am confused. Should I use a
global alignment algorithm or a local alignment algorithm? I have data for
forward and reverse strands, so it could be useful if I had both aligned
with the reference in a single file.

I don't mean to hijack the thread, but this seems exactly like my problem.
Excuse me for any inconvenience.

Hugo Torres

On Wed, Jul 13, 2011 at 6:44 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Wednesday, July 13, 2011, Daniel Jones <lawson.jones at gmail.com> wrote:
> > Hi Biopython users,
> > I have a file with many (~50,000) 200 bp sequences, each of which I would
> > like to align to a fixed reference sequence. I *don't* care about
> aligning
> > all 50,000 sequences with each other; I only care about aligning each one
> > with the reference sequence. I can't figure out a way to do this without
> > generating 50,000 files, which seems like ridiculous unnecessary
> overhead.
> > It seems like ClustalW's interface is quite inflexible in demanding
> separate
> > input and output files for each alignment, but I don't have much
> experience
> > using it so maybe I'm completely missing something.
> >
> > Incidentally, I'm not wedded to the idea of using ClustalW, so if there's
> an
> > alternate alignment program that would make this easier, I'd certainly be
> > open to trying it.
> >
> > Thanks,
> > Daniel Jones
>
> You need a pairwise alignment tool. Perhaps needle or water from the
> EMBOSS suite, or Biopython's pairwise2 module would be suitable (not
> in the tutorial, read the API docs).
>
> However, as Eric suggested, an NGS alignment tool might be more
> appropriate.
>
> Peter
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>

From gori at cs.ru.nl  Thu Jul 14 07:21:31 2011
From: gori at cs.ru.nl (Fabio Gori)
Date: Thu, 14 Jul 2011 13:21:31 +0200
Subject: [Biopython] Parsing FASTA records based on headers
In-Reply-To: <CAKVJ-_4nUR+QdLc3h=2fhUppTk8s8XVgCrw9mqEGHmHSC7eDGw@mail.gmail.com>
References: <201107111808.00013.gori@cs.ru.nl>
	<CAKVJ-_4nUR+QdLc3h=2fhUppTk8s8XVgCrw9mqEGHmHSC7eDGw@mail.gmail.com>
Message-ID: <201107141321.31160.gori@cs.ru.nl>

The condition "if record.id in SelectedSequencesId " works fine now, thank you.

Fabio

On Monday, July 11, 2011 09:51:09 pm Peter Cock wrote:
> On Mon, Jul 11, 2011 at 5:07 PM, Fabio Gori <gori at cs.ru.nl> wrote:
> > Hi all,
> > 
> > I tried to parse a FASTA file to select the sequences whose headers
> > satisfy a condition.
> > 
> > The condition is that the first word of the header belongs to a list
> > named SelectedSequencesId.
> > 
> > In the page http://biopython.org/wiki/SeqIO, I found this example, where
> > the condition is that sequence length <300:
> > 
> > ...
> > 
> > so I tried to substitute line 5 with
> > 5 record.id.split()[0] in SelectedSequencesId)
> 
> The SeqIO parse uses the first word of the ">" line as the id,
> so all you need is this: record.id in SelectedSequencesId
> rather than: len(record.seq) < 300
> 
> > But it did not work.
> 
> In what way? Did you also change the format to "fasta"
> as Dorota pointed out?
> 
> Peter

-- 

F. Gori, PhD student
Intelligent Systems
ICIS (Institute for Computing and Information Sciences)
Radboud University Nijmegen

Post Address:
    Intelligent Systems
    Postbus 9010 
    6500 GL  Nijmegen 
    The Netherlands 
Visiting Address:
    Room HG02.517 
    Faculty of Science 
    Heyendaalseweg 135
    6525 AJ  Nijmegen 
Tel.:   +31 (0)24 36 52703
E-mail: gori at cs.ru.nl
Home Page: http://www.cs.ru.nl/~gori/

From srivastavaisha.06 at gmail.com  Fri Jul 15 03:29:42 2011
From: srivastavaisha.06 at gmail.com (isha srivastava)
Date: Fri, 15 Jul 2011 12:59:42 +0530
Subject: [Biopython] Query
Message-ID: <CAEN7hu0aWy68-VZKrmPYWomO7sB5ab7bzOunBV1AyWPYi+oiwQ@mail.gmail.com>

    Hello,

    I am new user of BioPython.
    I have Downloaded the latest version of BioPython  i.e. BioPython 1.57.
    fallowed all the instructions according to tutorial.
    but wen i am running the program :

     >>> from Bio import SeqIO
     >>> for seq_record in SeqIO.parse("ls_orchid.fasta", "fasta"):
     ...         print seq_record.id
     ...         print repr(seq_record.seq)
     ...         print len(seq_record)
     ...


    it is showing error as fallows :-

    Traceback (most recent call last):
     File "<stdin>", line 1, in <module>
     File "/usr/lib/pymodules/python2.6/Bio/SeqIO/__init__.py", line 424, in
parse
     raise TypeError("Need a file handle, not a string (i.e. not a
filename)")
    TypeError: Need a file handle, not a string (i.e. not a filename)

Sir, how to solve this error?
Kindly make a soon reply.


With due regards,
Isha

From anaryin at gmail.com  Fri Jul 15 03:44:02 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Fri, 15 Jul 2011 09:44:02 +0200
Subject: [Biopython] Query
In-Reply-To: <CAEN7hu0aWy68-VZKrmPYWomO7sB5ab7bzOunBV1AyWPYi+oiwQ@mail.gmail.com>
References: <CAEN7hu0aWy68-VZKrmPYWomO7sB5ab7bzOunBV1AyWPYi+oiwQ@mail.gmail.com>
Message-ID: <CAJ9sUYON6j=fMcQkzr-ueA_osdKmBRx84EhcH2KMQfK5mO1sbA@mail.gmail.com>

Hello Isha,

As the error message says, you should not provide the filename to the
function, but instead a file handle. In other words, you need to open the
file first and then provide this to the function.

handle = open("ls_orchid.fasta")
> for seq_record in SeqIO.parse(handle, "fasta"):
>   blablabla


Regards,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



On Fri, Jul 15, 2011 at 9:29 AM, isha srivastava <
srivastavaisha.06 at gmail.com> wrote:

>    Hello,
>
>    I am new user of BioPython.
>    I have Downloaded the latest version of BioPython  i.e. BioPython 1.57.
>    fallowed all the instructions according to tutorial.
>    but wen i am running the program :
>
>     >>> from Bio import SeqIO
>     >>> for seq_record in SeqIO.parse("ls_orchid.fasta", "fasta"):
>     ...         print seq_record.id
>     ...         print repr(seq_record.seq)
>     ...         print len(seq_record)
>     ...
>
>
>    it is showing error as fallows :-
>
>    Traceback (most recent call last):
>     File "<stdin>", line 1, in <module>
>     File "/usr/lib/pymodules/python2.6/Bio/SeqIO/__init__.py", line 424, in
> parse
>     raise TypeError("Need a file handle, not a string (i.e. not a
> filename)")
>    TypeError: Need a file handle, not a string (i.e. not a filename)
>
> Sir, how to solve this error?
> Kindly make a soon reply.
>
>
> With due regards,
> Isha
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From p.j.a.cock at googlemail.com  Fri Jul 15 05:37:03 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 15 Jul 2011 10:37:03 +0100
Subject: [Biopython] Query
In-Reply-To: <CAEN7hu0aWy68-VZKrmPYWomO7sB5ab7bzOunBV1AyWPYi+oiwQ@mail.gmail.com>
References: <CAEN7hu0aWy68-VZKrmPYWomO7sB5ab7bzOunBV1AyWPYi+oiwQ@mail.gmail.com>
Message-ID: <CAKVJ-_72r0TWPKEH+RW1V1Nu88ymPXV5+v029Z8E6Yzc1gCQag@mail.gmail.com>

On Fri, Jul 15, 2011 at 8:29 AM, isha srivastava
<srivastavaisha.06 at gmail.com> wrote:
> ? ?Hello,
>
> ? ?I am new user of BioPython.
> ? ?I have Downloaded the latest version of BioPython ?i.e. BioPython 1.57.
> ? ?fallowed all the instructions according to tutorial.
> ? ?but wen i am running the program :
>
> ? ? >>> from Bio import SeqIO
> ? ? >>> for seq_record in SeqIO.parse("ls_orchid.fasta", "fasta"):
> ? ? ... ? ? ? ? print seq_record.id
> ? ? ... ? ? ? ? print repr(seq_record.seq)
> ? ? ... ? ? ? ? print len(seq_record)
> ? ? ...
>
>
> ? ?it is showing error as fallows :-
>
> ? ?Traceback (most recent call last):
> ? ? File "<stdin>", line 1, in <module>
> ? ? File "/usr/lib/pymodules/python2.6/Bio/SeqIO/__init__.py", line 424, in
> parse
> ? ? raise TypeError("Need a file handle, not a string (i.e. not a
> filename)")
> ? ?TypeError: Need a file handle, not a string (i.e. not a filename)
>
> Sir, how to solve this error?

That happens on older versions of Biopython - you can check
what is being used within python with:

import Bio
print Bio.__version__

My guess is your install of Biopython 1.57 hasn't worked properly,
and an older version is still being used.

Peter


From p.j.a.cock at googlemail.com  Fri Jul 15 08:48:36 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 15 Jul 2011 13:48:36 +0100
Subject: [Biopython] Query
In-Reply-To: <CAKVJ-_72r0TWPKEH+RW1V1Nu88ymPXV5+v029Z8E6Yzc1gCQag@mail.gmail.com>
References: <CAEN7hu0aWy68-VZKrmPYWomO7sB5ab7bzOunBV1AyWPYi+oiwQ@mail.gmail.com>
	<CAKVJ-_72r0TWPKEH+RW1V1Nu88ymPXV5+v029Z8E6Yzc1gCQag@mail.gmail.com>
Message-ID: <CAKVJ-_5mUzyMLNa0UiucMQaBSbnm7d5mSLra6wdLH-Ze4+eUAQ@mail.gmail.com>

On Fri, Jul 15, 2011 at 10:37 AM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
>>
>> That happens on older versions of Biopython - you can check
>> what is being used within python with:
>>
>> import Bio
>> print Bio.__version__
>>
>> My guess is your install of Biopython 1.57 hasn't worked properly,
>> and an older version is still being used.
>>
>> Peter
>>


On Fri, Jul 15, 2011 at 12:56 PM, isha srivastava
<srivastavaisha.06 at gmail.com> wrote:
> Hi Peter,
>
> you were right. i checked the version of biopython and it is showing version
> 1.53.
> how to get rid of this problem?
>
> hope for your soon reply.
>
> Thanx so much
> isha
>

Hi again,

Please CC the mailing list rather than emailing me directly with
things like this.

How was Biopython installed? What OS are you using?

Peter

From srivastavaisha.06 at gmail.com  Fri Jul 15 14:03:18 2011
From: srivastavaisha.06 at gmail.com (isha srivastava)
Date: Fri, 15 Jul 2011 23:33:18 +0530
Subject: [Biopython] Hi
Message-ID: <CAEN7hu22+jpbZG=0X1K_sd6BRCq1jVgqq7uLqrkxJQUT8Si7iw@mail.gmail.com>

Hello Peter,

I am sorry . Further i will not mail on your email directly.
I am using UBUNTU. ya I ll reinstall BioPython 1.57 again.



Regards,
Isha

From p.j.a.cock at googlemail.com  Sun Jul 17 16:19:02 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Sun, 17 Jul 2011 21:19:02 +0100
Subject: [Biopython] Hi
In-Reply-To: <CAEN7hu22+jpbZG=0X1K_sd6BRCq1jVgqq7uLqrkxJQUT8Si7iw@mail.gmail.com>
References: <CAEN7hu22+jpbZG=0X1K_sd6BRCq1jVgqq7uLqrkxJQUT8Si7iw@mail.gmail.com>
Message-ID: <CAKVJ-_6S77YAH8S3gNkgaucQ-ga=qeiFHD43zE_XS72KYyARSA@mail.gmail.com>

On Fri, Jul 15, 2011 at 7:03 PM, isha srivastava
<srivastavaisha.06 at gmail.com> wrote:
> Hello Peter,
>
> I am sorry . Further i will not mail on your email directly.

One reason I asked was I am at a conference at the moment,
so it was possible someone else might have been able to try
to help first.

The main reason is the mailing list is public, and people can
search it for solutions to this kind of problem in future.

>
> I am using UBUNTU. ya I ll reinstall BioPython 1.57 again.
>

Was Biopython 1.53 installed using the Ubuntu package system?
If so, please use the package manager to uninstall this old version
before trying to reinstall Biopython 1.57.

Peter

From malvikasharan at gmail.com  Sun Jul 17 17:53:03 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Sun, 17 Jul 2011 23:53:03 +0200
Subject: [Biopython] PSI-BLAST
Message-ID: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>

Hi All,

I am trying to code WWW version of PSI-BLAST. My intention is to integrate
PSI-Blast in my tool in order to find distant homologs.

i some how can not run the commandline version of psi blast (from
Bio.Blast.Applications import *NcbipsiblastCommandline*) as it states the
error
*" **Python* error: ImportError: *cannot* import *name
**NcbipsiblastCommandline
"*
*
*
*There are not much information available about it. Can somebody figure out
why?*
*
*
*Malvika*
*
*

From senthil.debian at gmail.com  Sun Jul 17 18:23:50 2011
From: senthil.debian at gmail.com (Senthil Kumar M)
Date: Sun, 17 Jul 2011 15:23:50 -0700
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
Message-ID: <CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>

On Sun, Jul 17, 2011 at 2:53 PM, malvika sharan <malvikasharan at gmail.com> wrote:
> Hi All,
>
> I am trying to code WWW version of PSI-BLAST. My intention is to integrate
> PSI-Blast in my tool in order to find distant homologs.
>
> i some how can not run the commandline version of psi blast (from
> Bio.Blast.Applications import *NcbipsiblastCommandline*) as it states the
> error
> *" **Python* error: ImportError: *cannot* import *name
> **NcbipsiblastCommandline
> "*
> *
> *
> *There are not much information available about it. Can somebody figure out
> why?*
> *
> *
> *Malvika*
> *
> *

Hi,

According to the Biopython tutorial
http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc93 (2 April
2011 version):

"You can run the standalone verion of PSI-BLAST (the legacy NCBI
command line tool blastpgp, or its replacement psiblast) using the
wrappers in Bio.Blast.Applications module.
At the time of writing, the NCBI do not appear to support tools
running a PSI-BLAST search via the internet."

HTH,

Senthil

-/
"You know, it's at times like this when I'm trapped in a Vogon
airlock with a man from Betelgeuse and about to die of asphyxiation in
deep space that I really wish I'd listened to what my mother told me
when I was young!"
	"Why, what did she tell you?"
	"I don't know, I didn't listen."
		-- Douglas Adams, "The Hitchhiker's Guide to the Galaxy"

From malvikasharan at gmail.com  Sun Jul 17 18:58:57 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Mon, 18 Jul 2011 00:58:57 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
Message-ID: <CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>

Thanks Senthil, but that is what i mentioned that i am trying to use
wrappers in Bio.Blast.Applications module. It just does not seem to work. I
have the whole Biopython installed and i am using Python 2.7.

the problem occurs while importing itself, i mentioned the error as well.
here is the whole error description:
Traceback (most recent call last):
    File "psiBlast.py", line 6, in <module>
        from Bio.Blast.Applications import NcbipsiblastCommandline
ImportError: cannot importname NcbipsiblastCommandline

i just cant figure out why.


On Mon, Jul 18, 2011 at 12:23 AM, Senthil Kumar M
<senthil.debian at gmail.com>wrote:

> On Sun, Jul 17, 2011 at 2:53 PM, malvika sharan <malvikasharan at gmail.com>
> wrote:
> > Hi All,
> >
> > I am trying to code WWW version of PSI-BLAST. My intention is to
> integrate
> > PSI-Blast in my tool in order to find distant homologs.
> >
> > i some how can not run the commandline version of psi blast (from
> > Bio.Blast.Applications import *NcbipsiblastCommandline*) as it states the
> > error
> > *" **Python* error: ImportError: *cannot* import *name
> > **NcbipsiblastCommandline
> > "*
> > *
> > *
> > *There are not much information available about it. Can somebody figure
> out
> > why?*
> > *
> > *
> > *Malvika*
> > *
> > *
>
> Hi,
>
> According to the Biopython tutorial
> http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc93 (2 April
> 2011 version):
>
> "You can run the standalone verion of PSI-BLAST (the legacy NCBI
> command line tool blastpgp, or its replacement psiblast) using the
> wrappers in Bio.Blast.Applications module.
> At the time of writing, the NCBI do not appear to support tools
> running a PSI-BLAST search via the internet."
>
> HTH,
>
> Senthil
>
> -/
> "You know, it's at times like this when I'm trapped in a Vogon
> airlock with a man from Betelgeuse and about to die of asphyxiation in
> deep space that I really wish I'd listened to what my mother told me
> when I was young!"
>        "Why, what did she tell you?"
>        "I don't know, I didn't listen."
>                -- Douglas Adams, "The Hitchhiker's Guide to the Galaxy"
>

From senthil.debian at gmail.com  Sun Jul 17 19:20:17 2011
From: senthil.debian at gmail.com (Senthil Kumar M)
Date: Sun, 17 Jul 2011 16:20:17 -0700
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
Message-ID: <CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>

On Sun, Jul 17, 2011 at 3:58 PM, malvika sharan <malvikasharan at gmail.com> wrote:
> Thanks Senthil, but that is what i mentioned that i am trying to use
> wrappers in Bio.Blast.Applications module. It just does not seem to work. I
> have the whole Biopython installed and i am using Python 2.7.
>
> the problem occurs while importing itself, i mentioned the error as well.
> here is the whole error description:
> Traceback (most recent call last):
> ??? File "psiBlast.py", line 6, in <module>
> ??????? from Bio.Blast.Applications import NcbipsiblastCommandline
> ImportError: cannot importname NcbipsiblastCommandline
>
> i just cant figure out why.

Hi,

Could you please provide more details such as your operating system,
python/biopython versions and a minimal example of your script?

On my system for example, 'from Bio.Blast.Applications import
NcbipsiblastCommandline' does not raise an error.

senthil at deepthought ~ $ python
Python 2.6.6 (r266:84292, Sep 15 2010, 16:22:56)
[GCC 4.4.5] on linux2
Type "help", "copyright", "credits" or "license" for more information.
>>> import Bio
>>> print Bio.__version__
1.57
>>> from Bio.Blast.Applications import NcbipsiblastCommandline
>>>

senthil at deepthought ~ $ uname -srm
Linux 2.6.35-22-generic x86_64

HTH

Senthil

-/
Time is an illusion, lunchtime doubly so.
		-- The Hitchhiker's Guide to the Galaxy


From malvikasharan at gmail.com  Sun Jul 17 19:27:33 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Mon, 18 Jul 2011 01:27:33 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
Message-ID: <CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>

My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.

And well as i said that the the error shows at the import.
import os, sys
from Bio import SeqIO
from Bio import Entrez
from Bio.Blast import NCBIWWW*
*from Bio.Blast.NCBIStandalone import PSIBlastParser
*from Bio.Blast.Applications import NcbipsiblastCommandline*
from Bio.Blast import NCBIXML

its irrelevant with my programming cos the program dies at line 6.

On Mon, Jul 18, 2011 at 1:20 AM, Senthil Kumar M
<senthil.debian at gmail.com>wrote:

> On Sun, Jul 17, 2011 at 3:58 PM, malvika sharan <malvikasharan at gmail.com>
> wrote:
> > Thanks Senthil, but that is what i mentioned that i am trying to use
> > wrappers in Bio.Blast.Applications module. It just does not seem to work.
> I
> > have the whole Biopython installed and i am using Python 2.7.
> >
> > the problem occurs while importing itself, i mentioned the error as well.
> > here is the whole error description:
> > Traceback (most recent call last):
> >     File "psiBlast.py", line 6, in <module>
> >         from Bio.Blast.Applications import NcbipsiblastCommandline
> > ImportError: cannot importname NcbipsiblastCommandline
> >
> > i just cant figure out why.
>
> Hi,
>
> Could you please provide more details such as your operating system,
> python/biopython versions and a minimal example of your script?
>
> On my system for example, 'from Bio.Blast.Applications import
> NcbipsiblastCommandline' does not raise an error.
>
> senthil at deepthought ~ $ python
> Python 2.6.6 (r266:84292, Sep 15 2010, 16:22:56)
> [GCC 4.4.5] on linux2
> Type "help", "copyright", "credits" or "license" for more information.
> >>> import Bio
> >>> print Bio.__version__
> 1.57
> >>> from Bio.Blast.Applications import NcbipsiblastCommandline
> >>>
>
> senthil at deepthought ~ $ uname -srm
> Linux 2.6.35-22-generic x86_64
>
> HTH
>
> Senthil
>
> -/
> Time is an illusion, lunchtime doubly so.
>                -- The Hitchhiker's Guide to the Galaxy
>

From malvikasharan at gmail.com  Sun Jul 17 19:48:20 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Mon, 18 Jul 2011 01:48:20 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
Message-ID: <CACCz97K_6QcbUwxXixXrcnUwz9i6s2uZ31pi63UF5MEec=dc2Q@mail.gmail.com>

please ignore the asterisk * , it appeared due to ctrl b.

On Mon, Jul 18, 2011 at 1:27 AM, malvika sharan <malvikasharan at gmail.com>wrote:

> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>
> And well as i said that the the error shows at the import.
> import os, sys
> from Bio import SeqIO
> from Bio import Entrez
> from Bio.Blast import NCBIWWW*
> *from Bio.Blast.NCBIStandalone import PSIBlastParser
>
> *from Bio.Blast.Applications import NcbipsiblastCommandline*
> from Bio.Blast import NCBIXML
>
> its irrelevant with my programming cos the program dies at line 6.
>
>
> On Mon, Jul 18, 2011 at 1:20 AM, Senthil Kumar M <senthil.debian at gmail.com
> > wrote:
>
>> On Sun, Jul 17, 2011 at 3:58 PM, malvika sharan <malvikasharan at gmail.com>
>> wrote:
>> > Thanks Senthil, but that is what i mentioned that i am trying to use
>> > wrappers in Bio.Blast.Applications module. It just does not seem to
>> work. I
>> > have the whole Biopython installed and i am using Python 2.7.
>> >
>> > the problem occurs while importing itself, i mentioned the error as
>> well.
>> > here is the whole error description:
>> > Traceback (most recent call last):
>> >     File "psiBlast.py", line 6, in <module>
>> >         from Bio.Blast.Applications import NcbipsiblastCommandline
>> > ImportError: cannot importname NcbipsiblastCommandline
>> >
>> > i just cant figure out why.
>>
>> Hi,
>>
>> Could you please provide more details such as your operating system,
>> python/biopython versions and a minimal example of your script?
>>
>> On my system for example, 'from Bio.Blast.Applications import
>> NcbipsiblastCommandline' does not raise an error.
>>
>> senthil at deepthought ~ $ python
>> Python 2.6.6 (r266:84292, Sep 15 2010, 16:22:56)
>> [GCC 4.4.5] on linux2
>> Type "help", "copyright", "credits" or "license" for more information.
>> >>> import Bio
>> >>> print Bio.__version__
>> 1.57
>> >>> from Bio.Blast.Applications import NcbipsiblastCommandline
>> >>>
>>
>> senthil at deepthought ~ $ uname -srm
>> Linux 2.6.35-22-generic x86_64
>>
>> HTH
>>
>> Senthil
>>
>> -/
>> Time is an illusion, lunchtime doubly so.
>>                -- The Hitchhiker's Guide to the Galaxy
>>
>
>

From alrakib at hotmail.com  Mon Jul 18 03:54:23 2011
From: alrakib at hotmail.com (L. Zarel)
Date: Mon, 18 Jul 2011 09:54:23 +0200
Subject: [Biopython] translating a FASTA file of CDS entries
Message-ID: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>


Good morning,

I'm Luis Zarel, from Spain. I'm a new user.

My question is: How I can make a translation into FASTA from CCDS entries? Any examples?

Thank you very much.


	   		 	   		  

From p.j.a.cock at googlemail.com  Mon Jul 18 05:14:30 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 18 Jul 2011 10:14:30 +0100
Subject: [Biopython] translating a FASTA file of CDS entries
In-Reply-To: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>
References: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>
Message-ID: <CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>

On Monday, July 18, 2011, L. Zarel <alrakib at hotmail.com> wrote:
>
> Good morning,
>
> I'm Luis Zarel, from Spain. I'm a new user.
>
> My question is: How I can make a translation into FASTA from CCDS entries? Any examples?
>
> Thank you very much.
>


Hi Luis,

Could you clarify your question? Did you mean CDS (coding sequences),
for example from GenBank files?

Peter

From alrakib at hotmail.com  Mon Jul 18 06:54:41 2011
From: alrakib at hotmail.com (L. Zarel)
Date: Mon, 18 Jul 2011 12:54:41 +0200
Subject: [Biopython] translating a FASTA file of CDS entries
In-Reply-To: <CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
References: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>,
	<CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
Message-ID: <BAY152-w18DF41D3EF4C7B930DCF5B14A0@phx.gbl>



Yes, I mean CDS

> Hi Luis,
> 
> Could you clarify your question? Did you mean CDS (coding sequences),
> for example from GenBank files?
> 
> Peter
 		 	   		  

From p.j.a.cock at googlemail.com  Mon Jul 18 08:07:37 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 18 Jul 2011 13:07:37 +0100
Subject: [Biopython] translating a FASTA file of CDS entries
In-Reply-To: <BAY152-w18DF41D3EF4C7B930DCF5B14A0@phx.gbl>
References: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>
	<CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
	<BAY152-w18DF41D3EF4C7B930DCF5B14A0@phx.gbl>
Message-ID: <CAKVJ-_7c7ZUYHLA7SPO96v5ZA1k67Eqk44RZdasemN1MNW7e6A@mail.gmail.com>

On Monday, July 18, 2011, L. Zarel <alrakib at hotmail.com> wrote:
>
> Yes, I mean CDS
>

Hi Luis,

So you have a FASTA file containing CDS nucleotide sequences,
and you want to turn this into a FASTA file containing translated
protein sequences? Have you looked at the documentation?

http://biopython.org/DIST/docs/tutorial/Tutorial.html
http://biopython.org/DIST/docs/tutorial/Tutorial.pdf

In particular, in the Cookbook chapter there is a section
"Translating a FASTA file of CDS entries".

If not, what form do you have your CDS data in? For example,
do you have an annotated GenBank file, or a tabular file of
co-ordinates and strands, or a GFF3 file, or something else?

Peter

From srivastavaisha.06 at gmail.com  Mon Jul 18 08:48:24 2011
From: srivastavaisha.06 at gmail.com (isha srivastava)
Date: Mon, 18 Jul 2011 18:18:24 +0530
Subject: [Biopython] Biopyhton 1.57 version problem
Message-ID: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>

Hello Sir / Mam

Sir , last days i asked problem about biopython 1.57 version that i have
downloaded the latest version that is 1.57 of biopython.
when i am giving the print Bio.__version__ command within the BioPython
directory this is showing correct version 1.57. But
when i am giving this command outside the biopyton directory then this is
showing biopython version 1.53.

I searched about the problem and found that my python 2.6.5 has already some
files of biopython such as ---

1)  python-biopython
1.53-1                                          Python library for
bioinformatics
2)  python-biopython-doc
1.53-1                                          Documentation for the
Biopython library
3)  python-biopython-sql
1.53-1                                          Biopython support for the
BioSQL database sc


I think the problem is because of these already existing biopython 1.53
files. Am i right?
If yes then how to get rid off this proble,?
If no then can anyone suggest me whats the problem and solution?

Kindly reply me soon.

Thanku very much.

regards
isha

From anaryin at gmail.com  Mon Jul 18 09:00:53 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Mon, 18 Jul 2011 15:00:53 +0200
Subject: [Biopython] Biopyhton 1.57 version problem
In-Reply-To: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>
References: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>
Message-ID: <CAJ9sUYOCEo6PdnCDWti2tvKoyEwzRxz4NBBCkLrTOM50k6PY_Q@mail.gmail.com>

Dear Isha,

The problem most likely is that you didn't completely remove 1.53, and your
PYTHONPATH variable is likely still pointing to it. When you start python
from the Biopython directory and import Bio, it will not load system-wide
packages but instead the one it has at hand.

I'd suggest you:

1) Do sudo aptitude remove/purge python-biopython

At this point, if you do:

cd $HOME
python
>> import Bio

It should give an ImportError. If not, there is still some version somewhere
that you need to remove.

2) Install Biopython 1.57 from the directory you downloaded, using sudo make
install and not giving any --home option during setup. This will ensure it
is installed system-wide and accessible from any python call.

Best,

Jo?o


From eric.talevich at gmail.com  Mon Jul 18 11:13:54 2011
From: eric.talevich at gmail.com (Eric Talevich)
Date: Mon, 18 Jul 2011 11:13:54 -0400
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
Message-ID: <CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>

On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <malvikasharan at gmail.com>wrote:

> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>

That's a very old version of Biopython. Are you able to install a more
recent version?


And well as i said that the the error shows at the import.
> import os, sys
> from Bio import SeqIO
> from Bio import Entrez
> from Bio.Blast import NCBIWWW*
> *from Bio.Blast.NCBIStandalone import PSIBlastParser
> *from Bio.Blast.Applications import NcbipsiblastCommandline*
> from Bio.Blast import NCBIXML
>

If the earlier imports of SeqIO and Entrez work, then
NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I would
guess.



On Mon, Jul 18, 2011 at 1:20 AM, Senthil Kumar M
> <senthil.debian at gmail.com>wrote:
>
> > On Sun, Jul 17, 2011 at 3:58 PM, malvika sharan <malvikasharan at gmail.com
> >
> > wrote:
> > > Thanks Senthil, but that is what i mentioned that i am trying to use
> > > wrappers in Bio.Blast.Applications module. It just does not seem to
> work.
> > I
> > > have the whole Biopython installed and i am using Python 2.7.
> > >
> > > the problem occurs while importing itself, i mentioned the error as
> well.
> > > here is the whole error description:
> > > Traceback (most recent call last):
> > >     File "psiBlast.py", line 6, in <module>
> > >         from Bio.Blast.Applications import NcbipsiblastCommandline
> > > ImportError: cannot importname NcbipsiblastCommandline
> > >
> > > i just cant figure out why.
> >
> > Hi,
> >
> > Could you please provide more details such as your operating system,
> > python/biopython versions and a minimal example of your script?
> >
> > On my system for example, 'from Bio.Blast.Applications import
> > NcbipsiblastCommandline' does not raise an error.
> >
> > senthil at deepthought ~ $ python
> > Python 2.6.6 (r266:84292, Sep 15 2010, 16:22:56)
> > [GCC 4.4.5] on linux2
> > Type "help", "copyright", "credits" or "license" for more information.
> > >>> import Bio
> > >>> print Bio.__version__
> > 1.57
> > >>> from Bio.Blast.Applications import NcbipsiblastCommandline
> > >>>
> >
> > senthil at deepthought ~ $ uname -srm
> > Linux 2.6.35-22-generic x86_64
> >
> > HTH
> >
> > Senthil
> >
> > -/
> > Time is an illusion, lunchtime doubly so.
> >                -- The Hitchhiker's Guide to the Galaxy
> >
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>

From akooser at unm.edu  Mon Jul 18 11:15:39 2011
From: akooser at unm.edu (Ara Kooser)
Date: Mon, 18 Jul 2011 09:15:39 -0600
Subject: [Biopython] NCBIWWW genbank files
In-Reply-To: <CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
References: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>
	<CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
Message-ID: <E205E214-5EEC-4FA9-A9D9-D8A864CA5484@unm.edu>

Good morning all,


   I am in the process of writing some code for pulling down files from NCBI. I wrote this based on the Biopython manual:

from Bio.Blast import NCBIWWW

def query():
    file_query = raw_input("Please enter the name of your sequence file: ")
    fasta_seq = open(file_query).read()
    result_handle = NCBIWWW.qblast("blastn","nr", fasta_seq, expect=1e-30, hitlist_size=20000)
    save_file = open("blast_results.xml","w")
    save_file.write(result_handle.read())
    save_file.close()
    result_handle.close()


query()

Everything works fine. But I was wondering is there a way to pull down the Genbank files using this method. I used the help(NCBIWWW.qblast) to look at all the options but didn't see the Genbank file format. Downstream in the program I use information extracted from both the .xml and genbank files since they contain different information to we need. I was hoping to combine everything into one program. Currently we use the web interface to pull down the xml and genbank files.

Thanks!
Ara





From srivastavaisha.06 at gmail.com  Tue Jul 19 01:34:43 2011
From: srivastavaisha.06 at gmail.com (isha srivastava)
Date: Tue, 19 Jul 2011 11:04:43 +0530
Subject: [Biopython] Biopyhton 1.57 version problem
In-Reply-To: <CAJ9sUYOCEo6PdnCDWti2tvKoyEwzRxz4NBBCkLrTOM50k6PY_Q@mail.gmail.com>
References: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>
	<CAJ9sUYOCEo6PdnCDWti2tvKoyEwzRxz4NBBCkLrTOM50k6PY_Q@mail.gmail.com>
Message-ID: <CAEN7hu01U61ORK+mkDBLBeqQkhx4kye8dmLSE8mFd1gq9KHe4A@mail.gmail.com>

Hi

Thanx for ur answer sir.
ya have already tried sudo apt-get remove python-biopython.it was worked
properly. even i removes python-biopython-doc and sql too.
Now when i m giving the command -->

>>>import Bio
>>>print Bio.__version__

this is showing error . which is good. but import Bio is still working .
which is not gd and it means biopython is not completely removed ..
thats y i m giving the fallowing command to findout all biopython named
files in my PC --

$ dpkg --list | grep 'biopython'

this command is showing no any result means there is no any biopyhton
file.If there is no any biopython directory then why ( import Bio )
is still working.

Hope for ur soon reply.

Thanx
isha

From p.j.a.cock at googlemail.com  Tue Jul 19 01:54:12 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 19 Jul 2011 06:54:12 +0100
Subject: [Biopython] NCBIWWW genbank files
In-Reply-To: <E205E214-5EEC-4FA9-A9D9-D8A864CA5484@unm.edu>
References: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>
	<CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
	<E205E214-5EEC-4FA9-A9D9-D8A864CA5484@unm.edu>
Message-ID: <CAKVJ-_7ZLJab9OXkC6NPg5sTNdt2SrkSdLaAy-oQ3UmyruQ95w@mail.gmail.com>

On Monday, July 18, 2011, Ara Kooser <akooser at unm.edu> wrote:
> Good morning all,
>
>
>  ? I am in the process of writing some code for pulling down files from NCBI. I wrote this based on the Biopython manual:
>
> from Bio.Blast import NCBIWWW
>
> def query():
>  ? ?file_query = raw_input("Please enter the name of your sequence file: ")
>  ? ?fasta_seq = open(file_query).read()
>  ? ?result_handle = NCBIWWW.qblast("blastn","nr", fasta_seq, expect=1e-30, hitlist_size=20000)
>  ? ?save_file = open("blast_results.xml","w")
>  ? ?save_file.write(result_handle.read())
>  ? ?save_file.close()
>  ? ?result_handle.close()
>
>
> query()
>
> Everything works fine. But I was wondering is there a way to pull down the Genbank files using this method. I used the help(NCBIWWW.qblast) to look at all the options but didn't see the Genbank file format. Downstream in the program I use information extracted from both the .xml and genbank files since they contain different information to we need. I was hoping to combine everything into one program. Currently we use the web interface to pull down the xml and genbank files.
>
> Thanks!
> Ara
>

Hi Ara,

BLAST does not offer GenBank as an output format.

Assuming I have understood your aim, this can be done as a multi step
process: Run BLAST, extract a list of matching record accessions,
download these records in GenBank format from the NCBI.

You may find it useful to request tabular output from BLAST and
extract the match names (column two). This should be faster as the XML
version of the data is much larger.

Also to avoid trying to download the same GenBank record more than
once, I would use a Python set rather than a Python list object when
recording this information from the BLAST file.

You can use the NCBI Entrez utilities API to download GenBank files,
see Bio.Entrez in the Biopython tutorial, function efetch.

Peter


From p.j.a.cock at googlemail.com  Tue Jul 19 02:03:44 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 19 Jul 2011 07:03:44 +0100
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
Message-ID: <CAKVJ-_4Za3PNgMHz35fUWLhw-HG6moRqhXrKNgP0_r5_bXmYaA@mail.gmail.com>

Senthil wrote:
>
> Hi,
>
> According to the Biopython tutorial
> http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc93 (2 April
> 2011 version):
>
> "You can run the standalone verion of PSI-BLAST (the legacy NCBI
> command line tool blastpgp, or its replacement psiblast) using the
> wrappers in Bio.Blast.Applications module.
> At the time of writing, the NCBI do not appear to support tools
> running a PSI-BLAST search via the internet."
>
> HTH,
>
> Senthil
>

That might be possibly after all, see this information reported
recently by F?bio Madeira:

https://github.com/biopython/biopython/pull/12

It should be possible with any recent Biopython, Fabio's
change was to the documentation for the blast function
only. We'd want to update the tutorial too ideally.

Peter


From p.j.a.cock at googlemail.com  Tue Jul 19 02:08:59 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 19 Jul 2011 07:08:59 +0100
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
Message-ID: <CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>

On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com> wrote:
> On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <malvikasharan at gmail.com>wrote:
>
>> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>>
>
> That's a very old version of Biopython. Are you able to install a more
> recent version?
>
>
> And well as i said that the the error shows at the import.
>> import os, sys
>> from Bio import SeqIO
>> from Bio import Entrez
>> from Bio.Blast import NCBIWWW*
>> *from Bio.Blast.NCBIStandalone import PSIBlastParser
>> *from Bio.Blast.Applications import NcbipsiblastCommandline*
>> from Bio.Blast import NCBIXML
>>
>
> If the earlier imports of SeqIO and Entrez work, then
> NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I would
> guess.
>

Correct. The BLAST+ wrappers were added in Biopython 1.53.
You will need to update it, ideally to the current release, 1.57

In general if some imports work and others fail, your library
Is either too old (and what you want didn't exist in the old
version), or too new (the code you want to use was obsolete
and removed).

Peter

From anaryin at gmail.com  Tue Jul 19 02:48:29 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 19 Jul 2011 08:48:29 +0200
Subject: [Biopython] Biopyhton 1.57 version problem
In-Reply-To: <CAEN7hu01U61ORK+mkDBLBeqQkhx4kye8dmLSE8mFd1gq9KHe4A@mail.gmail.com>
References: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>
	<CAJ9sUYOCEo6PdnCDWti2tvKoyEwzRxz4NBBCkLrTOM50k6PY_Q@mail.gmail.com>
	<CAEN7hu01U61ORK+mkDBLBeqQkhx4kye8dmLSE8mFd1gq9KHe4A@mail.gmail.com>
Message-ID: <CAJ9sUYO1JcXUEENJyA5K=mNgyj80hV092EdA+0Q_8+sDOChcCw@mail.gmail.com>

What error does print Bio.__version__ give?

In which directory are you executing those python commands?

From anaryin at gmail.com  Tue Jul 19 05:28:25 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 19 Jul 2011 11:28:25 +0200
Subject: [Biopython] Biopyhton 1.57 version problem
In-Reply-To: <CAEN7hu0w4Piv5XRxYGfWDd9OWgAj1_1=yPhFGEDbbDo0w-KxOg@mail.gmail.com>
References: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>
	<CAJ9sUYOCEo6PdnCDWti2tvKoyEwzRxz4NBBCkLrTOM50k6PY_Q@mail.gmail.com>
	<CAEN7hu01U61ORK+mkDBLBeqQkhx4kye8dmLSE8mFd1gq9KHe4A@mail.gmail.com>
	<CAJ9sUYO1JcXUEENJyA5K=mNgyj80hV092EdA+0Q_8+sDOChcCw@mail.gmail.com>
	<CAEN7hu0w4Piv5XRxYGfWDd9OWgAj1_1=yPhFGEDbbDo0w-KxOg@mail.gmail.com>
Message-ID: <CAJ9sUYOzNb=fC75XFqy3HRpKHcumgVNv1xN_1ONNGTRJbHEFjA@mail.gmail.com>

Hello Isha,

Where did you run the Python interpreter (i.e. in which directory were you
when you typed "python" and then "import Bio")?

Did you install the new version of Biopython correctly? Go to that
~/Downloads/python/biopython-1.57/ directory and run sudo python setup.py
install (assuming you have super user privileges).

Regards,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



On Tue, Jul 19, 2011 at 11:24 AM, isha srivastava <
srivastavaisha.06 at gmail.com> wrote:

> error is -->
>
>
> Traceback (most recent call last):
>   File "<stdin>", line 1, in <module>
> AttributeError: 'module' object has no attribute '__version__'
>
> in python directory i made a biopython directory .
>
> isha at desktop:~/Downloads/python$ ls
>
> biopython-1.57            numpy-1.6.1rc3  python.mk         Tutorial_files
> debian_defaults          ori_fasta             pyversions.py
> Tutorial.html
> egenix-mx-base-3.2.0  prog                reportlab-2.5
> fetch.py                      pyProgram.py      runtime.d
>
> isha at -desktop:~/Downloads/python$ cd biopython-1.57/
> isha at -desktop:~/Downloads/python/biopython-1.57$ ls
>
> Bio    build     DEPRECATED  LICENSE      NEWS        README   setup.py
> BioSQL    CONTRIB  Doc         MANIFEST.in  PKG-INFO  Scripts  Tests
>
>


From malvikasharan at gmail.com  Tue Jul 19 05:49:53 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Tue, 19 Jul 2011 11:49:53 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
Message-ID: <CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>

Thank you Peter and Eric.

you are right and i think i should have known this :(
I updated Biopython. and revising my codes. it should work now.

Malvika

On Tue, Jul 19, 2011 at 8:08 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com> wrote:
> > On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <malvikasharan at gmail.com
> >wrote:
> >
> >> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
> >>
> >
> > That's a very old version of Biopython. Are you able to install a more
> > recent version?
> >
> >
> > And well as i said that the the error shows at the import.
> >> import os, sys
> >> from Bio import SeqIO
> >> from Bio import Entrez
> >> from Bio.Blast import NCBIWWW*
> >> *from Bio.Blast.NCBIStandalone import PSIBlastParser
> >> *from Bio.Blast.Applications import NcbipsiblastCommandline*
> >> from Bio.Blast import NCBIXML
> >>
> >
> > If the earlier imports of SeqIO and Entrez work, then
> > NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I
> would
> > guess.
> >
>
> Correct. The BLAST+ wrappers were added in Biopython 1.53.
> You will need to update it, ideally to the current release, 1.57
>
> In general if some imports work and others fail, your library
> Is either too old (and what you want didn't exist in the old
> version), or too new (the code you want to use was obsolete
> and removed).
>
> Peter
>

From anaryin at gmail.com  Tue Jul 19 05:54:29 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 19 Jul 2011 11:54:29 +0200
Subject: [Biopython] Biopyhton 1.57 version problem
In-Reply-To: <CAEN7hu1toRxGGZPycNQpkskmSZCQi33_fKbDtCXt=pY6v3_zbw@mail.gmail.com>
References: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>
	<CAJ9sUYOCEo6PdnCDWti2tvKoyEwzRxz4NBBCkLrTOM50k6PY_Q@mail.gmail.com>
	<CAEN7hu01U61ORK+mkDBLBeqQkhx4kye8dmLSE8mFd1gq9KHe4A@mail.gmail.com>
	<CAJ9sUYO1JcXUEENJyA5K=mNgyj80hV092EdA+0Q_8+sDOChcCw@mail.gmail.com>
	<CAEN7hu0w4Piv5XRxYGfWDd9OWgAj1_1=yPhFGEDbbDo0w-KxOg@mail.gmail.com>
	<CAJ9sUYOzNb=fC75XFqy3HRpKHcumgVNv1xN_1ONNGTRJbHEFjA@mail.gmail.com>
	<CAEN7hu1toRxGGZPycNQpkskmSZCQi33_fKbDtCXt=pY6v3_zbw@mail.gmail.com>
Message-ID: <CAJ9sUYPvPaCTHyDzzyU1UmMRM_WX6LsgZj1qSjneXvDmpi4smg@mail.gmail.com>

Dear Isha,

If you run the interpreter in biopython-1.57 directory it will load the
modules from that folder, even if it is not installed in the system. You
have to do "sudo python setup.py install" in the biopython-1.57 directory,
wait for completion of the installation, and then move to another directory,
say for example your home directory or the Desktop, and there type "python"
and try "import Bio".

You don't have to remove anything..

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



On Tue, Jul 19, 2011 at 11:40 AM, isha srivastava <
srivastavaisha.06 at gmail.com> wrote:

>  Hello Sir
>
>  I run in the terminal.
>  I typed that in Python directory.
>  Now i m removing the Biopyhton -1.57 and ll again download and install
> that.
>
> Regards
> isha
>


From akooser at unm.edu  Tue Jul 19 11:07:23 2011
From: akooser at unm.edu (Ara Kooser)
Date: Tue, 19 Jul 2011 09:07:23 -0600
Subject: [Biopython] NCBIWWW genbank files
In-Reply-To: <CAKVJ-_7ZLJab9OXkC6NPg5sTNdt2SrkSdLaAy-oQ3UmyruQ95w@mail.gmail.com>
References: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>
	<CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
	<E205E214-5EEC-4FA9-A9D9-D8A864CA5484@unm.edu>
	<CAKVJ-_7ZLJab9OXkC6NPg5sTNdt2SrkSdLaAy-oQ3UmyruQ95w@mail.gmail.com>
Message-ID: <D5751A91-2F17-4AA7-9AC8-4920142CE78C@unm.edu>

Peter,

  Thanks for the clarification there. I was a little confused. I'll give this a try.

Regards,
Ara

On Jul 18, 2011, at 11:54 PM, Peter Cock wrote:

> On Monday, July 18, 2011, Ara Kooser <akooser at unm.edu> wrote:
>> Good morning all,
>> 
>> 
>>   I am in the process of writing some code for pulling down files from NCBI. I wrote this based on the Biopython manual:
>> 
>> from Bio.Blast import NCBIWWW
>> 
>> def query():
>>    file_query = raw_input("Please enter the name of your sequence file: ")
>>    fasta_seq = open(file_query).read()
>>    result_handle = NCBIWWW.qblast("blastn","nr", fasta_seq, expect=1e-30, hitlist_size=20000)
>>    save_file = open("blast_results.xml","w")
>>    save_file.write(result_handle.read())
>>    save_file.close()
>>    result_handle.close()
>> 
>> 
>> query()
>> 
>> Everything works fine. But I was wondering is there a way to pull down the Genbank files using this method. I used the help(NCBIWWW.qblast) to look at all the options but didn't see the Genbank file format. Downstream in the program I use information extracted from both the .xml and genbank files since they contain different information to we need. I was hoping to combine everything into one program. Currently we use the web interface to pull down the xml and genbank files.
>> 
>> Thanks!
>> Ara
>> 
> 
> Hi Ara,
> 
> BLAST does not offer GenBank as an output format.
> 
> Assuming I have understood your aim, this can be done as a multi step
> process: Run BLAST, extract a list of matching record accessions,
> download these records in GenBank format from the NCBI.
> 
> You may find it useful to request tabular output from BLAST and
> extract the match names (column two). This should be faster as the XML
> version of the data is much larger.
> 
> Also to avoid trying to download the same GenBank record more than
> once, I would use a Python set rather than a Python list object when
> recording this information from the BLAST file.
> 
> You can use the NCBI Entrez utilities API to download GenBank files,
> see Bio.Entrez in the Biopython tutorial, function efetch.
> 
> Peter



From mollymutant at googlemail.com  Wed Jul 20 09:26:33 2011
From: mollymutant at googlemail.com (molly mutant)
Date: Wed, 20 Jul 2011 15:26:33 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
Message-ID: <CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>

hello all,

I was also trying to run my program using the same wrapper from
Bio.Blast.Application for psiblast commandline.

i use the following code but this is not generating XML file.
        psi_cline = NcbipsiblastCommandline('psiblast', db =
'refseq_protein', query = queryID+".fasta", evalue =  10 , out =
queryID+"_psi.xml", outfmt = 7, out_pssm = queryID+"_pssm")
        p =
subprocess.Popen(str(psi_cline),stdout=subprocess.PIPE,stderr=subprocess.PIPE,shell=(sys.platform!="win32"))
        blastParser(p.stdout)

i have defined blastParser for parsing XML files which works perfectly with
other xml files.

i get the following error :

Traceback (most recent call last):
  File "psiBlast.py", line 110, in <module>
    blastParser(p.stdout)

  File
"/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Blast/NCBIXML.py",
line 617, in parse
    raise ValueError("Your XML file was empty")
ValueError: Your XML file was empty


you can see that i am using python 2.6 and Biopython 1.57. Do you know where
am i going incorrect?

Molly

On Wed, Jul 20, 2011 at 3:07 PM, malvika sharan <malvikasharan at gmail.com>wrote:

>
>
> ---------- Forwarded message ----------
>
>
> Thank you Peter and Eric.
>
> you are right and i think i should have known this :(
> I updated Biopython. and revising my codes. it should work now.
>
> Malvika
>
>
> On Tue, Jul 19, 2011 at 8:08 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:
>
>> On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com> wrote:
>> > On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <
>> malvikasharan at gmail.com>wrote:
>> >
>> >> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>> >>
>> >
>> > That's a very old version of Biopython. Are you able to install a more
>> > recent version?
>> >
>> >
>> > And well as i said that the the error shows at the import.
>> >> import os, sys
>> >> from Bio import SeqIO
>> >> from Bio import Entrez
>> >> from Bio.Blast import NCBIWWW*
>> >> *from Bio.Blast.NCBIStandalone import PSIBlastParser
>> >> *from Bio.Blast.Applications import NcbipsiblastCommandline*
>> >> from Bio.Blast import NCBIXML
>> >>
>> >
>> > If the earlier imports of SeqIO and Entrez work, then
>> > NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I
>> would
>> > guess.
>> >
>>
>> Correct. The BLAST+ wrappers were added in Biopython 1.53.
>> You will need to update it, ideally to the current release, 1.57
>>
>> In general if some imports work and others fail, your library
>> Is either too old (and what you want didn't exist in the old
>> version), or too new (the code you want to use was obsolete
>> and removed).
>>
>> Peter
>>
>
>
>

From mollymutant at googlemail.com  Wed Jul 20 09:33:04 2011
From: mollymutant at googlemail.com (molly mutant)
Date: Wed, 20 Jul 2011 15:33:04 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
	<CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
Message-ID: <CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>

Oh, i forgot to mention :

queryID here is a protein ID for example NP_010247.1
 ' query = queryID+".fasta" ' is a fasta file for this protein.
i want to get the XML output from the psi blast.

Regards
Molly

On Wed, Jul 20, 2011 at 3:26 PM, molly mutant <mollymutant at googlemail.com>wrote:

> hello all,
>
> I was also trying to run my program using the same wrapper from
> Bio.Blast.Application for psiblast commandline.
>
> i use the following code but this is not generating XML file.
>         psi_cline = NcbipsiblastCommandline('psiblast', db =
> 'refseq_protein', query = queryID+".fasta", evalue =  10 , out =
> queryID+"_psi.xml", outfmt = 7, out_pssm = queryID+"_pssm")
>         p =
> subprocess.Popen(str(psi_cline),stdout=subprocess.PIPE,stderr=subprocess.PIPE,shell=(sys.platform!="win32"))
>         blastParser(p.stdout)
>
> i have defined blastParser for parsing XML files which works perfectly with
> other xml files.
>
> i get the following error :
>
> Traceback (most recent call last):
>   File "psiBlast.py", line 110, in <module>
>     blastParser(p.stdout)
>
>   File
> "/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Blast/NCBIXML.py",
> line 617, in parse
>     raise ValueError("Your XML file was empty")
> ValueError: Your XML file was empty
>
>
> you can see that i am using python 2.6 and Biopython 1.57. Do you know
> where am i going incorrect?
>
> Molly
>
> On Wed, Jul 20, 2011 at 3:07 PM, malvika sharan <malvikasharan at gmail.com>wrote:
>
>
>>
>> ---------- Forwarded message ----------
>>
>>
>> Thank you Peter and Eric.
>>
>> you are right and i think i should have known this :(
>> I updated Biopython. and revising my codes. it should work now.
>>
>> Malvika
>>
>>
>> On Tue, Jul 19, 2011 at 8:08 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:
>>
>>> On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com> wrote:
>>> > On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <
>>> malvikasharan at gmail.com>wrote:
>>> >
>>> >> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>>> >>
>>> >
>>> > That's a very old version of Biopython. Are you able to install a more
>>> > recent version?
>>> >
>>> >
>>> > And well as i said that the the error shows at the import.
>>> >> import os, sys
>>> >> from Bio import SeqIO
>>> >> from Bio import Entrez
>>> >> from Bio.Blast import NCBIWWW*
>>> >> *from Bio.Blast.NCBIStandalone import PSIBlastParser
>>> >> *from Bio.Blast.Applications import NcbipsiblastCommandline*
>>> >> from Bio.Blast import NCBIXML
>>> >>
>>> >
>>> > If the earlier imports of SeqIO and Entrez work, then
>>> > NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I
>>> would
>>> > guess.
>>> >
>>>
>>> Correct. The BLAST+ wrappers were added in Biopython 1.53.
>>> You will need to update it, ideally to the current release, 1.57
>>>
>>> In general if some imports work and others fail, your library
>>> Is either too old (and what you want didn't exist in the old
>>> version), or too new (the code you want to use was obsolete
>>> and removed).
>>>
>>> Peter
>>>
>>
>>
>>
>

From mollymutant at googlemail.com  Wed Jul 20 11:30:13 2011
From: mollymutant at googlemail.com (molly mutant)
Date: Wed, 20 Jul 2011 17:30:13 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAL6BeoJbXvJy9YGXJVDE2-oNFFANR9oJY_YThNGYHO7di8mT5Q@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
	<CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
	<CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>
	<CAL6BeoJbXvJy9YGXJVDE2-oNFFANR9oJY_YThNGYHO7di8mT5Q@mail.gmail.com>
Message-ID: <CAL6BeoJnvhazEDR1-oG-FWK5fkf_woDr9OzTNfovt4_h2=F5Fg@mail.gmail.com>

Can anyone please share the functioning codes for PSI-BLAST using NCBI
commandline or suggest me the source from where i can get it?? i am in an
urgent need of it :( and i can not find the problem with my command/code.

Regards,
Molly

On Wed, Jul 20, 2011 at 4:19 PM, molly mutant <mollymutant at googlemail.com>wrote:

> if it use cline() command:
>
>         psi_cline = NcbipsiblastCommandline('psiblast', db =
> 'refseq_protein',\
>                                             query = queryID+".fasta",
> evalue =  10 , \
>                                             out = queryID+"_psi.xml",
> outfmt = 7, \
>                                             out_pssm = queryID+"_pssm")
>         str(psi_cline)
>         psi_cline()
>
> the following error occurs :
> Traceback (most recent call last):
>   File "psiBlast.py", line 113, in <module>
>     psi_cline()
>   File
> "/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Application/__init__.py",
> line 432, in __call__
>     stdout_str, stderr_str)
> Bio.Application.ApplicationError: Command 'psiblast -out NP_012649_psi.xml
> -outfmt 7 -query NP_012649.fasta -db refseq_protein -evalue 10 -out_pssm
> NP_012649_pssm' returned non-zero exit status 127, '/bin/sh: psiblast: not
> found'
>
> I think this error stands for that the command is not found, which means
> that my command is incorrect, am i right??
>
>
>
> On Wed, Jul 20, 2011 at 3:33 PM, molly mutant <mollymutant at googlemail.com>wrote:
>
>> Oh, i forgot to mention :
>>
>> queryID here is a protein ID for example NP_010247.1
>>  ' query = queryID+".fasta" ' is a fasta file for this protein.
>> i want to get the XML output from the psi blast.
>>
>> Regards
>> Molly
>>
>>
>> On Wed, Jul 20, 2011 at 3:26 PM, molly mutant <mollymutant at googlemail.com
>> > wrote:
>>
>>> hello all,
>>>
>>> I was also trying to run my program using the same wrapper from
>>> Bio.Blast.Application for psiblast commandline.
>>>
>>> i use the following code but this is not generating XML file.
>>>         psi_cline = NcbipsiblastCommandline('psiblast', db =
>>> 'refseq_protein', query = queryID+".fasta", evalue =  10 , out =
>>> queryID+"_psi.xml", outfmt = 7, out_pssm = queryID+"_pssm")
>>>         p =
>>> subprocess.Popen(str(psi_cline),stdout=subprocess.PIPE,stderr=subprocess.PIPE,shell=(sys.platform!="win32"))
>>>         blastParser(p.stdout)
>>>
>>> i have defined blastParser for parsing XML files which works perfectly
>>> with other xml files.
>>>
>>> i get the following error :
>>>
>>> Traceback (most recent call last):
>>>   File "psiBlast.py", line 110, in <module>
>>>     blastParser(p.stdout)
>>>
>>>   File
>>> "/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Blast/NCBIXML.py",
>>> line 617, in parse
>>>     raise ValueError("Your XML file was empty")
>>> ValueError: Your XML file was empty
>>>
>>>
>>> you can see that i am using python 2.6 and Biopython 1.57. Do you know
>>> where am i going incorrect?
>>>
>>> Molly
>>>
>>> On Wed, Jul 20, 2011 at 3:07 PM, malvika sharan <malvikasharan at gmail.com
>>> > wrote:
>>>
>>>
>>>>
>>>> ---------- Forwarded message ----------
>>>>
>>>>
>>>> Thank you Peter and Eric.
>>>>
>>>> you are right and i think i should have known this :(
>>>> I updated Biopython. and revising my codes. it should work now.
>>>>
>>>> Malvika
>>>>
>>>>
>>>> On Tue, Jul 19, 2011 at 8:08 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:
>>>>
>>>>> On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com>
>>>>> wrote:
>>>>> > On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <
>>>>> malvikasharan at gmail.com>wrote:
>>>>> >
>>>>> >> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>>>>> >>
>>>>> >
>>>>> > That's a very old version of Biopython. Are you able to install a
>>>>> more
>>>>> > recent version?
>>>>> >
>>>>> >
>>>>> > And well as i said that the the error shows at the import.
>>>>> >> import os, sys
>>>>> >> from Bio import SeqIO
>>>>> >> from Bio import Entrez
>>>>> >> from Bio.Blast import NCBIWWW*
>>>>> >> *from Bio.Blast.NCBIStandalone import PSIBlastParser
>>>>> >> *from Bio.Blast.Applications import NcbipsiblastCommandline*
>>>>> >> from Bio.Blast import NCBIXML
>>>>> >>
>>>>> >
>>>>> > If the earlier imports of SeqIO and Entrez work, then
>>>>> > NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I
>>>>> would
>>>>> > guess.
>>>>> >
>>>>>
>>>>> Correct. The BLAST+ wrappers were added in Biopython 1.53.
>>>>> You will need to update it, ideally to the current release, 1.57
>>>>>
>>>>> In general if some imports work and others fail, your library
>>>>> Is either too old (and what you want didn't exist in the old
>>>>> version), or too new (the code you want to use was obsolete
>>>>> and removed).
>>>>>
>>>>> Peter
>>>>>
>>>>

From from.d.putto at gmail.com  Wed Jul 20 12:22:37 2011
From: from.d.putto at gmail.com (Sheila the angel)
Date: Wed, 20 Jul 2011 18:22:37 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
Message-ID: <CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>

This method do not  work with Bio.Emboss.Applications!!!
I am trying to do the same with 'Bio.Emboss.Applications' as

seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence object
water_cline = WaterCommandline(asequence="-", bsequence="beta.fasta",
gapopen=10, gapextend=0.5, outfile="water.txt")
stdout, stderr =water_cline(stdin=seq_record.format("fasta"))

but it is displaying error.
How can I specify file handle or sequence only in  Emboss Applications???




On Thu, Jul 7, 2011 at 12:43 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 7, 2011 at 11:26 AM, Sheila the angel
> <from.d.putto at gmail.com> wrote:
> > Hi All,
> >
> > I want to download genbank file from NCBI and pass the protein sequence
> > directly to the local BLAST. But I am getting error in BLAST step
> >
> #-------------------------------------------------------------------------------------------
> > from Bio import SeqIO
> > from Bio import Entrez
> > from Bio.Blast.Applications import NcbiblastpCommandline
> > id='200203'
> > handle = Entrez.efetch(db="protein", id=id, rettype="gp")
> > seq_record = SeqIO.read(handle, "gb")
> > x=seq_record.seq                                            #getting the
> > sequence in a variable x
> > blastp_cline = NcbiblastpCommandline(query=x, db="protein_database",
> > evalue=0.001)    # My BLAST command
> > result_handle, stderr = blastp_cline()                    #Running BLAST
> and
> > getting error :(
> >
> >
> #-------------------------------------------------------------------------------------------
> >
> > At this last step I am getting error.....
> > I sort-of understand the problem.....it is taking value of x as a file
> name
> > while its a variable which contains the sequence.
> > Is there any way out to this problem without making temporary file.
>
> With the standalone blast tools you generally need to prepare an input
> FASTA file with your query sequence(s).
>
> However, in principle you can give the input filename as - (default),
> and instead pipe the query FASTA record in as stdin (standard input).
> Try something like this (untested):
>
> ...
> blastp_cline = NcbiblastpCommandline(query="-", db="protein_database",
> evalue=0.001)
> stdout, stderr = blastp_cline(stdin=seq_record.format("fasta"))
>
> Peter
>

From mollymutant at googlemail.com  Wed Jul 20 10:19:35 2011
From: mollymutant at googlemail.com (molly mutant)
Date: Wed, 20 Jul 2011 16:19:35 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
	<CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
	<CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>
Message-ID: <CAL6BeoJbXvJy9YGXJVDE2-oNFFANR9oJY_YThNGYHO7di8mT5Q@mail.gmail.com>

if it use cline() command:

        psi_cline = NcbipsiblastCommandline('psiblast', db =
'refseq_protein',\
                                            query = queryID+".fasta", evalue
=  10 , \
                                            out = queryID+"_psi.xml", outfmt
= 7, \
                                            out_pssm = queryID+"_pssm")
        str(psi_cline)
        psi_cline()

the following error occurs :
Traceback (most recent call last):
  File "psiBlast.py", line 113, in <module>
    psi_cline()
  File
"/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Application/__init__.py",
line 432, in __call__
    stdout_str, stderr_str)
Bio.Application.ApplicationError: Command 'psiblast -out NP_012649_psi.xml
-outfmt 7 -query NP_012649.fasta -db refseq_protein -evalue 10 -out_pssm
NP_012649_pssm' returned non-zero exit status 127, '/bin/sh: psiblast: not
found'

I think this error stands for that the command is not found, which means
that my command is incorrect, am i right??



On Wed, Jul 20, 2011 at 3:33 PM, molly mutant <mollymutant at googlemail.com>wrote:

> Oh, i forgot to mention :
>
> queryID here is a protein ID for example NP_010247.1
>  ' query = queryID+".fasta" ' is a fasta file for this protein.
> i want to get the XML output from the psi blast.
>
> Regards
> Molly
>
>
> On Wed, Jul 20, 2011 at 3:26 PM, molly mutant <mollymutant at googlemail.com>wrote:
>
>> hello all,
>>
>> I was also trying to run my program using the same wrapper from
>> Bio.Blast.Application for psiblast commandline.
>>
>> i use the following code but this is not generating XML file.
>>         psi_cline = NcbipsiblastCommandline('psiblast', db =
>> 'refseq_protein', query = queryID+".fasta", evalue =  10 , out =
>> queryID+"_psi.xml", outfmt = 7, out_pssm = queryID+"_pssm")
>>         p =
>> subprocess.Popen(str(psi_cline),stdout=subprocess.PIPE,stderr=subprocess.PIPE,shell=(sys.platform!="win32"))
>>         blastParser(p.stdout)
>>
>> i have defined blastParser for parsing XML files which works perfectly
>> with other xml files.
>>
>> i get the following error :
>>
>> Traceback (most recent call last):
>>   File "psiBlast.py", line 110, in <module>
>>     blastParser(p.stdout)
>>
>>   File
>> "/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Blast/NCBIXML.py",
>> line 617, in parse
>>     raise ValueError("Your XML file was empty")
>> ValueError: Your XML file was empty
>>
>>
>> you can see that i am using python 2.6 and Biopython 1.57. Do you know
>> where am i going incorrect?
>>
>> Molly
>>
>> On Wed, Jul 20, 2011 at 3:07 PM, malvika sharan <malvikasharan at gmail.com>wrote:
>>
>>
>>>
>>> ---------- Forwarded message ----------
>>>
>>>
>>> Thank you Peter and Eric.
>>>
>>> you are right and i think i should have known this :(
>>> I updated Biopython. and revising my codes. it should work now.
>>>
>>> Malvika
>>>
>>>
>>> On Tue, Jul 19, 2011 at 8:08 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:
>>>
>>>> On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com>
>>>> wrote:
>>>> > On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <
>>>> malvikasharan at gmail.com>wrote:
>>>> >
>>>> >> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>>>> >>
>>>> >
>>>> > That's a very old version of Biopython. Are you able to install a more
>>>> > recent version?
>>>> >
>>>> >
>>>> > And well as i said that the the error shows at the import.
>>>> >> import os, sys
>>>> >> from Bio import SeqIO
>>>> >> from Bio import Entrez
>>>> >> from Bio.Blast import NCBIWWW*
>>>> >> *from Bio.Blast.NCBIStandalone import PSIBlastParser
>>>> >> *from Bio.Blast.Applications import NcbipsiblastCommandline*
>>>> >> from Bio.Blast import NCBIXML
>>>> >>
>>>> >
>>>> > If the earlier imports of SeqIO and Entrez work, then
>>>> > NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I
>>>> would
>>>> > guess.
>>>> >
>>>>
>>>> Correct. The BLAST+ wrappers were added in Biopython 1.53.
>>>> You will need to update it, ideally to the current release, 1.57
>>>>
>>>> In general if some imports work and others fail, your library
>>>> Is either too old (and what you want didn't exist in the old
>>>> version), or too new (the code you want to use was obsolete
>>>> and removed).
>>>>
>>>> Peter
>>>>
>>>
>>>
>>>
>>
>
>
>


-- 
Regards,
Molly

From anaryin at gmail.com  Wed Jul 20 12:48:14 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Wed, 20 Jul 2011 18:48:14 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAL6BeoJnvhazEDR1-oG-FWK5fkf_woDr9OzTNfovt4_h2=F5Fg@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
	<CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
	<CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>
	<CAL6BeoJbXvJy9YGXJVDE2-oNFFANR9oJY_YThNGYHO7di8mT5Q@mail.gmail.com>
	<CAL6BeoJnvhazEDR1-oG-FWK5fkf_woDr9OzTNfovt4_h2=F5Fg@mail.gmail.com>
Message-ID: <CAJ9sUYMNGTabYrnSE=wobAYV-HRnM7AZJtw7MqonngyN9BuC5g@mail.gmail.com>

Dear Molly,

I never worked with that module so this might be wrong. But from my
experience, that error is common when you have aliased the executable, which
doesn't work. Try adding the directory where the executable 'psiblast' is
(usually something /bin) to your PATH variable:

export PATH="${PATH}:/my/blast/directory/bin/'

Troubleshooting and debugging are parts of coding, so I'd recommend you to
spend half an hour on this and I'm sure you'll get i through.

Best,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



On Wed, Jul 20, 2011 at 5:30 PM, molly mutant <mollymutant at googlemail.com>wrote:

> Can anyone please share the functioning codes for PSI-BLAST using NCBI
> commandline or suggest me the source from where i can get it?? i am in an
> urgent need of it :( and i can not find the problem with my command/code.
>
> Regards,
> Molly
>
> On Wed, Jul 20, 2011 at 4:19 PM, molly mutant <mollymutant at googlemail.com
> >wrote:
>
> > if it use cline() command:
> >
> >         psi_cline = NcbipsiblastCommandline('psiblast', db =
> > 'refseq_protein',\
> >                                             query = queryID+".fasta",
> > evalue =  10 , \
> >                                             out = queryID+"_psi.xml",
> > outfmt = 7, \
> >                                             out_pssm = queryID+"_pssm")
> >         str(psi_cline)
> >         psi_cline()
> >
> > the following error occurs :
> > Traceback (most recent call last):
> >   File "psiBlast.py", line 113, in <module>
> >     psi_cline()
> >   File
> >
> "/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Application/__init__.py",
> > line 432, in __call__
> >     stdout_str, stderr_str)
> > Bio.Application.ApplicationError: Command 'psiblast -out
> NP_012649_psi.xml
> > -outfmt 7 -query NP_012649.fasta -db refseq_protein -evalue 10 -out_pssm
> > NP_012649_pssm' returned non-zero exit status 127, '/bin/sh: psiblast:
> not
> > found'
> >
> > I think this error stands for that the command is not found, which means
> > that my command is incorrect, am i right??
> >
> >
> >
> > On Wed, Jul 20, 2011 at 3:33 PM, molly mutant <
> mollymutant at googlemail.com>wrote:
> >
> >> Oh, i forgot to mention :
> >>
> >> queryID here is a protein ID for example NP_010247.1
> >>  ' query = queryID+".fasta" ' is a fasta file for this protein.
> >> i want to get the XML output from the psi blast.
> >>
> >> Regards
> >> Molly
> >>
> >>
> >> On Wed, Jul 20, 2011 at 3:26 PM, molly mutant <
> mollymutant at googlemail.com
> >> > wrote:
> >>
> >>> hello all,
> >>>
> >>> I was also trying to run my program using the same wrapper from
> >>> Bio.Blast.Application for psiblast commandline.
> >>>
> >>> i use the following code but this is not generating XML file.
> >>>         psi_cline = NcbipsiblastCommandline('psiblast', db =
> >>> 'refseq_protein', query = queryID+".fasta", evalue =  10 , out =
> >>> queryID+"_psi.xml", outfmt = 7, out_pssm = queryID+"_pssm")
> >>>         p =
> >>>
> subprocess.Popen(str(psi_cline),stdout=subprocess.PIPE,stderr=subprocess.PIPE,shell=(sys.platform!="win32"))
> >>>         blastParser(p.stdout)
> >>>
> >>> i have defined blastParser for parsing XML files which works perfectly
> >>> with other xml files.
> >>>
> >>> i get the following error :
> >>>
> >>> Traceback (most recent call last):
> >>>   File "psiBlast.py", line 110, in <module>
> >>>     blastParser(p.stdout)
> >>>
> >>>   File
> >>>
> "/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Blast/NCBIXML.py",
> >>> line 617, in parse
> >>>     raise ValueError("Your XML file was empty")
> >>> ValueError: Your XML file was empty
> >>>
> >>>
> >>> you can see that i am using python 2.6 and Biopython 1.57. Do you know
> >>> where am i going incorrect?
> >>>
> >>> Molly
> >>>
> >>> On Wed, Jul 20, 2011 at 3:07 PM, malvika sharan <
> malvikasharan at gmail.com
> >>> > wrote:
> >>>
> >>>
> >>>>
> >>>> ---------- Forwarded message ----------
> >>>>
> >>>>
> >>>> Thank you Peter and Eric.
> >>>>
> >>>> you are right and i think i should have known this :(
> >>>> I updated Biopython. and revising my codes. it should work now.
> >>>>
> >>>> Malvika
> >>>>
> >>>>
> >>>> On Tue, Jul 19, 2011 at 8:08 AM, Peter Cock <
> p.j.a.cock at googlemail.com>wrote:
> >>>>
> >>>>> On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com>
> >>>>> wrote:
> >>>>> > On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <
> >>>>> malvikasharan at gmail.com>wrote:
> >>>>> >
> >>>>> >> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
> >>>>> >>
> >>>>> >
> >>>>> > That's a very old version of Biopython. Are you able to install a
> >>>>> more
> >>>>> > recent version?
> >>>>> >
> >>>>> >
> >>>>> > And well as i said that the the error shows at the import.
> >>>>> >> import os, sys
> >>>>> >> from Bio import SeqIO
> >>>>> >> from Bio import Entrez
> >>>>> >> from Bio.Blast import NCBIWWW*
> >>>>> >> *from Bio.Blast.NCBIStandalone import PSIBlastParser
> >>>>> >> *from Bio.Blast.Applications import NcbipsiblastCommandline*
> >>>>> >> from Bio.Blast import NCBIXML
> >>>>> >>
> >>>>> >
> >>>>> > If the earlier imports of SeqIO and Entrez work, then
> >>>>> > NcbipsiblastCommandline probably wasn't included in Biopython 1.50,
> I
> >>>>> would
> >>>>> > guess.
> >>>>> >
> >>>>>
> >>>>> Correct. The BLAST+ wrappers were added in Biopython 1.53.
> >>>>> You will need to update it, ideally to the current release, 1.57
> >>>>>
> >>>>> In general if some imports work and others fail, your library
> >>>>> Is either too old (and what you want didn't exist in the old
> >>>>> version), or too new (the code you want to use was obsolete
> >>>>> and removed).
> >>>>>
> >>>>> Peter
> >>>>>
> >>>>
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From eric.talevich at gmail.com  Wed Jul 20 12:54:18 2011
From: eric.talevich at gmail.com (Eric Talevich)
Date: Wed, 20 Jul 2011 12:54:18 -0400
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAL6BeoJnvhazEDR1-oG-FWK5fkf_woDr9OzTNfovt4_h2=F5Fg@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
	<CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
	<CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>
	<CAL6BeoJbXvJy9YGXJVDE2-oNFFANR9oJY_YThNGYHO7di8mT5Q@mail.gmail.com>
	<CAL6BeoJnvhazEDR1-oG-FWK5fkf_woDr9OzTNfovt4_h2=F5Fg@mail.gmail.com>
Message-ID: <CAMC681nnWxRaax_F2Od0qHGWBBVT3BKNJ98xruoLw3oT=QjzXQ@mail.gmail.com>

On Wed, Jul 20, 2011 at 11:30 AM, molly mutant
<mollymutant at googlemail.com>wrote:

> Can anyone please share the functioning codes for PSI-BLAST using NCBI
> commandline or suggest me the source from where i can get it?? i am in an
> urgent need of it :( and i can not find the problem with my command/code.
>
> Regards,
> Molly
>
> On Wed, Jul 20, 2011 at 4:19 PM, molly mutant <mollymutant at googlemail.com
> >wrote:
>  > the following error occurs :
> > Bio.Application.ApplicationError: Command 'psiblast -out
> NP_012649_psi.xml
> > -outfmt 7 -query NP_012649.fasta -db refseq_protein -evalue 10 -out_pssm
> > NP_012649_pssm' returned non-zero exit status 127, '/bin/sh: psiblast:
> not
> > found'
> >
> > I think this error stands for that the command is not found, which means
> > that my command is incorrect, am i right??
>

To follow up on what Jo?o wrote, the important error is:
'/bin/sh: psiblast: not found'

Which means that psiblast is not installed correctly on your system. If you
try running just that command on the command line:
psiblast -out NP_012649_psi.xml -outfmt 7 -query NP_012649.fasta -db
refseq_protein -evalue 10 -out_pssm NP_012649_pssm

will also report an error, even without using Python.

So, try making sure psiblast is available on your system path ($PATH). The
command "which psiblast" should print where the executable is, if it can be
found.

Or, if you don't want to mess with $PATH, you can include the complete path
to the psiblast executable:
psi_cline = NcbipsiblastCommandline('/usr/local/bin/psiblast', db = ...


Cheers,
Eric


From p.j.a.cock at googlemail.com  Wed Jul 20 13:27:00 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 20 Jul 2011 18:27:00 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
Message-ID: <CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>

On Wednesday, July 20, 2011, Sheila the angel <from.d.putto at gmail.com> wrote:
> This method do not ?work with Bio.Emboss.Applications!!!I am trying to do the same with 'Bio.Emboss.Applications' as
> seq_record = SeqIO.read(open("alpha.fasta"), "fasta") ?#or a sequence object
> water_cline = WaterCommandline(asequence="-", bsequence="beta.fasta", gapopen=10, gapextend=0.5, outfile="water.txt")
> stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
> but it is displaying error.How can I specify file handle or sequence only in ?Emboss Applications???
>

What is the error message?

I think you need asequence="stdin" not "-" (although the later is a
widely used convention in command line tools). See:

http://emboss.sourceforge.net/docs/themes/UniformSequenceAddress.html#stdin

Also try including auto=True in the command line, this tells EMBOSS
not to try and ask for user input (by default it will try and prompt
the user for any missing arguments, with the auto setting it uses it's
defaults).

Peter


From anaryin at gmail.com  Wed Jul 20 12:58:37 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Wed, 20 Jul 2011 18:58:37 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAMC681nnWxRaax_F2Od0qHGWBBVT3BKNJ98xruoLw3oT=QjzXQ@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
	<CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
	<CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>
	<CAL6BeoJbXvJy9YGXJVDE2-oNFFANR9oJY_YThNGYHO7di8mT5Q@mail.gmail.com>
	<CAL6BeoJnvhazEDR1-oG-FWK5fkf_woDr9OzTNfovt4_h2=F5Fg@mail.gmail.com>
	<CAMC681nnWxRaax_F2Od0qHGWBBVT3BKNJ98xruoLw3oT=QjzXQ@mail.gmail.com>
Message-ID: <CAJ9sUYNB_v-Y9VseSx4MLR-2m2uvfBQZ5z9yuzm=29vxgcvDFg@mail.gmail.com>

Adding to what Eric said, sometimes (depending on your config) *which* won't
tell you where the command is aliased to. Instead, try *locate*.

From from.d.putto at gmail.com  Thu Jul 21 05:14:06 2011
From: from.d.putto at gmail.com (Sheila the angel)
Date: Thu, 21 Jul 2011 11:14:06 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
Message-ID: <CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>

yes replacing '-' by 'stdin' works :)

seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence object
water_cline = WaterCommandline(asequence="stdin", bsequence="beta.fasta",
gapopen=10, gapextend=0.5, outfile="water.txt")
stdout, stderr =water_cline(stdin=seq_record.format("fasta"))

but I tried to replace bsequence also by 'stdin' and it shows error
#----------------------------------------------------------------------------------------------------------------------
seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence object
seq_record2 = SeqIO.read(open("beta.fasta"), "fasta")
water_cline = WaterCommandline(asequence="stdin", bsequence="stdin",
gapopen=10, gapextend=0.5, outfile="water.txt", auto=True)
stdout, stderr =water_cline(stdin=seq_record.format("fasta"),
stdin=seq_record2.format("fasta"))
#  File "<stdin>", line 1 # <the error msg.
#SyntaxError: keyword argument repeated
#----------------------------------------------------------------------------------------------------------------------





On Wed, Jul 20, 2011 at 7:27 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Wednesday, July 20, 2011, Sheila the angel <from.d.putto at gmail.com>
> wrote:
> > This method do not  work with Bio.Emboss.Applications!!!I am trying to do
> the same with 'Bio.Emboss.Applications' as
> > seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence
> object
> > water_cline = WaterCommandline(asequence="-", bsequence="beta.fasta",
> gapopen=10, gapextend=0.5, outfile="water.txt")
> > stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
> > but it is displaying error.How can I specify file handle or sequence only
> in  Emboss Applications???
> >
>
> What is the error message?
>
> I think you need asequence="stdin" not "-" (although the later is a
> widely used convention in command line tools). See:
>
> http://emboss.sourceforge.net/docs/themes/UniformSequenceAddress.html#stdin
>
> Also try including auto=True in the command line, this tells EMBOSS
> not to try and ask for user input (by default it will try and prompt
> the user for any missing arguments, with the auto setting it uses it's
> defaults).
>
> Peter
>

From p.j.a.cock at googlemail.com  Thu Jul 21 05:40:36 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 21 Jul 2011 10:40:36 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
Message-ID: <CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>

On Thu, Jul 21, 2011 at 10:14 AM, Sheila the angel
<from.d.putto at gmail.com> wrote:
> yes replacing '-' by 'stdin' works :)
>
> seq_record = SeqIO.read(open("alpha.fasta"), "fasta") ?#or a sequence object
> water_cline = WaterCommandline(asequence="stdin", bsequence="beta.fasta",
> gapopen=10, gapextend=0.5, outfile="water.txt")
> stdout, stderr =water_cline(stdin=seq_record.format("fasta"))

Good - thanks for letting us know.

I can probably make the tutorial text a little clearer here.


> but I tried to replace?bsequence also by 'stdin' and it shows error
> #----------------------------------------------------------------------------------------------------------------------
> seq_record = SeqIO.read(open("alpha.fasta"), "fasta") ?#or a sequence object
> seq_record2 = SeqIO.read(open("beta.fasta"), "fasta")
> water_cline = WaterCommandline(asequence="stdin", bsequence="stdin",
> gapopen=10, gapextend=0.5, outfile="water.txt", auto=True)

That won't work - there is only one stdin pipe in a Unix style command
line environment.
You have to use either two input files, or stdin and one file, (or one
file and stdin).

> stdout, stderr =water_cline(stdin=seq_record.format("fasta"),
> stdin=seq_record2.format("fasta"))
> # ?File "<stdin>", line 1 # <the error msg.
> #SyntaxError: keyword argument repeated

That is a python syntax error message because you tried to use the stdin
argument twice. Named Python function arguments can only be used once.

I hope that makes sense.

Peter


From from.d.putto at gmail.com  Thu Jul 21 05:48:28 2011
From: from.d.putto at gmail.com (Sheila the angel)
Date: Thu, 21 Jul 2011 11:48:28 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
Message-ID: <CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>

Thanks Peter,
Yes I understand that I can't use 'stdin' twice so this is not going to work

>>> water_cline = WaterCommandline(asequence="stdin",
bsequence="stdin",gapopen=10, gapextend=0.5, outfile="water.txt")
>>> stdout, stderr =water_cline(stdin=seq_record.format("fasta"),
stdin=seq_record2.format("fasta"))

>You have to use either two input files, or stdin and one file, (or one
>file and stdin).

But how can I specify two input files, or stdin


On Thu, Jul 21, 2011 at 11:40 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 21, 2011 at 10:14 AM, Sheila the angel
> <from.d.putto at gmail.com> wrote:
> > yes replacing '-' by 'stdin' works :)
> >
> > seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence
> object
> > water_cline = WaterCommandline(asequence="stdin", bsequence="beta.fasta",
> > gapopen=10, gapextend=0.5, outfile="water.txt")
> > stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
>
> Good - thanks for letting us know.
>
> I can probably make the tutorial text a little clearer here.
>
>
> > but I tried to replace bsequence also by 'stdin' and it shows error
> >
> #----------------------------------------------------------------------------------------------------------------------
> > seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence
> object
> > seq_record2 = SeqIO.read(open("beta.fasta"), "fasta")
> > water_cline = WaterCommandline(asequence="stdin", bsequence="stdin",
> > gapopen=10, gapextend=0.5, outfile="water.txt", auto=True)
>
> That won't work - there is only one stdin pipe in a Unix style command
> line environment.
> You have to use either two input files, or stdin and one file, (or one
> file and stdin).
>
> > stdout, stderr =water_cline(stdin=seq_record.format("fasta"),
> > stdin=seq_record2.format("fasta"))
> > #  File "<stdin>", line 1 # <the error msg.
> > #SyntaxError: keyword argument repeated
>
> That is a python syntax error message because you tried to use the stdin
> argument twice. Named Python function arguments can only be used once.
>
> I hope that makes sense.
>
> Peter
>

From p.j.a.cock at googlemail.com  Thu Jul 21 05:56:17 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 21 Jul 2011 10:56:17 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
	<CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
Message-ID: <CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>

On Thu, Jul 21, 2011 at 10:48 AM, Sheila the angel
<from.d.putto at gmail.com> wrote:
> Thanks Peter,
> Yes I understand that I can't use 'stdin' twice so this is not going to work
>
>>You have to use either two input files, or stdin and one file, (or one
>>file and stdin).
>
> But how can I specify two input files, or stdin
>

Two files is covered in the Tutorial example you originally started
with, isn't it?:

water_cline = WaterCommandline(asequence="alpha.fasta",
bsequence="beta.fasta", gapopen=10, gapextend=0.5,
outfile="water.txt")
stdout, stderr =water_cline()

You've already done stdin and file for a and b, and said that works:

seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence object
water_cline = WaterCommandline(asequence="stdin",
bsequence="beta.fasta", gapopen=10, gapextend=0.5,
outfile="water.txt")
stdout, stderr =water_cline(stdin=seq_record.format("fasta"))

Doing it the other way round with a file and stdin for a and b would be just:

seq_record = SeqIO.read(open("beta.fasta"), "fasta")  #or a sequence object
water_cline = WaterCommandline(asequence="alpha.fasta",
bsequence="stdin", gapopen=10, gapextend=0.5, outfile="water.txt")
stdout, stderr =water_cline(stdin=seq_record.format("fasta"))

Obviously if you already have the sequences in FASTA files, then just give
the filenames to the EMBOSS tool (rather than needlessly loading them into
python just to write them to stdin).

Peter

From malvikasharan at gmail.com  Thu Jul 21 11:51:35 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Thu, 21 Jul 2011 17:51:35 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
	<CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
	<CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
Message-ID: <CACCz97JSy88Wj12Dn_uRND6N=DsrngFBbdeCFtyRMJQ6Brn3dQ@mail.gmail.com>

Hi,

i have tried this tool for aligning 1 sequence ( 'aseq.fasta ') against 5
sequence present in other file ('bseq.fasta'). as expected aseq.fasta gives
pairwise alignment with every fasta sequence present in bseq.fasta.

the alignment works perfectly and saves the alignment output as well.

1> the question is if there is anyway to extraxt consensus out of all
pairwise alignments? I know its is possible with clustalw or muscle or other
alignment tool. but i do not want pairwise alignment between all the
sequence with each other. In this case Emboss seemed the better tool where i
can align all sequence only with 1 query. but the crucial part is to extract
the conserved residue from the alignment.

2> The best would be to align all the sequence together against 1 sequence
(aseq.fasta) like it happens in COBALT. and find the conserved residue
directly. but i did not find any commandline tool like that unfortunately.
It would be great if you can suggest a tool if you know any.

thank you !
Malvika



On Thu, Jul 21, 2011 at 11:56 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 21, 2011 at 10:48 AM, Sheila the angel
> <from.d.putto at gmail.com> wrote:
> > Thanks Peter,
> > Yes I understand that I can't use 'stdin' twice so this is not going to
> work
> >
> >>You have to use either two input files, or stdin and one file, (or one
> >>file and stdin).
> >
> > But how can I specify two input files, or stdin
> >
>
> Two files is covered in the Tutorial example you originally started
> with, isn't it?:
>
> water_cline = WaterCommandline(asequence="alpha.fasta",
> bsequence="beta.fasta", gapopen=10, gapextend=0.5,
> outfile="water.txt")
> stdout, stderr =water_cline()
>
> You've already done stdin and file for a and b, and said that works:
>
> seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence
> object
> water_cline = WaterCommandline(asequence="stdin",
> bsequence="beta.fasta", gapopen=10, gapextend=0.5,
> outfile="water.txt")
> stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
>
> Doing it the other way round with a file and stdin for a and b would be
> just:
>
> seq_record = SeqIO.read(open("beta.fasta"), "fasta")  #or a sequence object
> water_cline = WaterCommandline(asequence="alpha.fasta",
> bsequence="stdin", gapopen=10, gapextend=0.5, outfile="water.txt")
> stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
>
> Obviously if you already have the sequences in FASTA files, then just give
> the filenames to the EMBOSS tool (rather than needlessly loading them into
> python just to write them to stdin).
>
> Peter
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>

From p.j.a.cock at googlemail.com  Thu Jul 21 12:09:18 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 21 Jul 2011 17:09:18 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CACCz97JSy88Wj12Dn_uRND6N=DsrngFBbdeCFtyRMJQ6Brn3dQ@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
	<CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
	<CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
	<CACCz97JSy88Wj12Dn_uRND6N=DsrngFBbdeCFtyRMJQ6Brn3dQ@mail.gmail.com>
Message-ID: <CAKVJ-_7j5NoCtAzSR+m5dMf+7ernGJGGavqBAd=o6Gq8181Q7A@mail.gmail.com>

On Thu, Jul 21, 2011 at 4:51 PM, malvika sharan <malvikasharan at gmail.com> wrote:
> Hi,
>
> i have tried this tool for aligning 1 sequence ( 'aseq.fasta ') against 5
> sequence present in other file ('bseq.fasta'). as expected aseq.fasta gives
> pairwise alignment with every fasta sequence present in bseq.fasta.
>
> the alignment works perfectly and saves the alignment output as well.
>
> 1> the question is if there is anyway to extraxt consensus out of all
> pairwise alignments? I know its is possible with clustalw or muscle or other
> alignment tool. but i do not want pairwise alignment between all the
> sequence with each other. In this case Emboss seemed the better tool where i
> can align all sequence only with 1 query. but the crucial part is to extract
> the conserved residue from the alignment.
>
> 2> The best would be to align all the sequence together against 1 sequence
> (aseq.fasta) like it happens in COBALT. and find the conserved residue
> directly. but i did not find any commandline tool like that unfortunately.
> It would be great if you can suggest a tool if you know any.
>
> thank you !
> Malvika

I don't understand what you are asking for - it is hard to define a
consensus from a pairwise alignment. Could you give a short example?

Also this thread really is going off topic, perhaps a new email thread
(with a more relevant title) would be better?

Peter

From malvikasharan at gmail.com  Thu Jul 21 12:32:52 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Thu, 21 Jul 2011 18:32:52 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_7j5NoCtAzSR+m5dMf+7ernGJGGavqBAd=o6Gq8181Q7A@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
	<CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
	<CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
	<CACCz97JSy88Wj12Dn_uRND6N=DsrngFBbdeCFtyRMJQ6Brn3dQ@mail.gmail.com>
	<CAKVJ-_7j5NoCtAzSR+m5dMf+7ernGJGGavqBAd=o6Gq8181Q7A@mail.gmail.com>
Message-ID: <CACCz97LSVEqbt1tG9dEbn1L=f-FQWG8ipzP0OJ7Fy2gamYJ4_Q@mail.gmail.com>

yup sure!!

On Thu, Jul 21, 2011 at 6:09 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 21, 2011 at 4:51 PM, malvika sharan <malvikasharan at gmail.com>
> wrote:
> > Hi,
> >
> > i have tried this tool for aligning 1 sequence ( 'aseq.fasta ') against 5
> > sequence present in other file ('bseq.fasta'). as expected aseq.fasta
> gives
> > pairwise alignment with every fasta sequence present in bseq.fasta.
> >
> > the alignment works perfectly and saves the alignment output as well.
> >
> > 1> the question is if there is anyway to extraxt consensus out of all
> > pairwise alignments? I know its is possible with clustalw or muscle or
> other
> > alignment tool. but i do not want pairwise alignment between all the
> > sequence with each other. In this case Emboss seemed the better tool
> where i
> > can align all sequence only with 1 query. but the crucial part is to
> extract
> > the conserved residue from the alignment.
> >
> > 2> The best would be to align all the sequence together against 1
> sequence
> > (aseq.fasta) like it happens in COBALT. and find the conserved residue
> > directly. but i did not find any commandline tool like that
> unfortunately.
> > It would be great if you can suggest a tool if you know any.
> >
> > thank you !
> > Malvika
>
> I don't understand what you are asking for - it is hard to define a
> consensus from a pairwise alignment. Could you give a short example?
>
> Also this thread really is going off topic, perhaps a new email thread
> (with a more relevant title) would be better?
>
> Peter
>

From from.d.putto at gmail.com  Fri Jul 22 06:58:53 2011
From: from.d.putto at gmail.com (Sheila the angel)
Date: Fri, 22 Jul 2011 12:58:53 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
	<CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
	<CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
Message-ID: <CAFinXcSM2wGfHeo8jQ6WrXzt1h0PbwdWL+Lcc8irQs5JK3P4zw@mail.gmail.com>

Oh I am sorry for the line
seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence object

This was meant to show that I have a sequence record object.
In my actual problem I have open 2 different genbank files which contains
many sequence record. I want to run EMBOSS to each sequence.

from Bio import SeqIO
for seq_record in SeqIO.parse("ls_orchid.gbk", "genbank"):
  seq1=seq_record.seq
  for seq_record2 in SeqIO.parse("other_file.gbk", "genbank"): #NOTE- this
is a different genbank file
       seq2=seq_record2.seq
       EMBOSS_OUT= RUN_EMBOSS_WATER_on_seq1_and_seq2(seq1,seq2)
       #Analyse 'EMBOSS_OUT' for further analysis

One possible way to do this - - convert genbank files to fasta and then use
one file as 'beta.fasta'. But in such case I can't analysis EMBOSS result
directly. I have to wait till EMBOSS is done with all the sequences.
Another way is to create 2 temporary files temp1 and temp2 and pass them
to EMBOSS. Though it makes code little slow. (Because every time 1st you
have write sequence in temporary files and after analysis delete it)
I tried another solution.....it may be little dirty but may be useful for
someone.
#---------------------------------------------------------------------------------------
def RUN_EMBOSS_WATER_on_seq1_and_seq2 (seq1,seq2,out_file='stdout'):
water_cline = WaterCommandline()
water_cline.asequence='asis:'+str(seq1)
water_cline.bsequence='asis:'+str(seq2)
water_cline.gapopen=10
water_cline.gapextend=0.5
water_cline.outfile=out_file
stdout, stderr = water_cline()
return (stdout)
#---------------------------------------------------------------------------------------

you can call the function as

EMBOSS_OUT=RUN_EMBOSS_WATER_on_seq1_and_seq2 (seq1,seq2)

and then can do analysis with 'EMBOSS_OUT'. Here neither you have to wait
till EMBOSS is done with all the sequences nor you have to
create temporary files :)
BUT the only problem is the name of the sequence are not present in output
and it writes only
# Aligned_sequences: 2
# 1: asis
# 2: asis

So if you don't care which sequence is what then it works :)


On Thu, Jul 21, 2011 at 11:56 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 21, 2011 at 10:48 AM, Sheila the angel
> <from.d.putto at gmail.com> wrote:
> > Thanks Peter,
> > Yes I understand that I can't use 'stdin' twice so this is not going to
> work
> >
> >>You have to use either two input files, or stdin and one file, (or one
> >>file and stdin).
> >
> > But how can I specify two input files, or stdin
> >
>
> Two files is covered in the Tutorial example you originally started
> with, isn't it?:
>
> water_cline = WaterCommandline(asequence="alpha.fasta",
> bsequence="beta.fasta", gapopen=10, gapextend=0.5,
> outfile="water.txt")
> stdout, stderr =water_cline()
>
> You've already done stdin and file for a and b, and said that works:
>
> seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence
> object
> water_cline = WaterCommandline(asequence="stdin",
> bsequence="beta.fasta", gapopen=10, gapextend=0.5,
> outfile="water.txt")
> stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
>
> Doing it the other way round with a file and stdin for a and b would be
> just:
>
> seq_record = SeqIO.read(open("beta.fasta"), "fasta")  #or a sequence object
> water_cline = WaterCommandline(asequence="alpha.fasta",
> bsequence="stdin", gapopen=10, gapextend=0.5, outfile="water.txt")
> stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
>
> Obviously if you already have the sequences in FASTA files, then just give
> the filenames to the EMBOSS tool (rather than needlessly loading them into
> python just to write them to stdin).
>
> Peter
>

From p.j.a.cock at googlemail.com  Fri Jul 22 07:18:08 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 22 Jul 2011 12:18:08 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAFinXcSM2wGfHeo8jQ6WrXzt1h0PbwdWL+Lcc8irQs5JK3P4zw@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
	<CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
	<CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
	<CAFinXcSM2wGfHeo8jQ6WrXzt1h0PbwdWL+Lcc8irQs5JK3P4zw@mail.gmail.com>
Message-ID: <CAKVJ-_7T9ZEJt8o=oas1ZJSdENy=nP6Rm9ZEa+ZELc7cc459mQ@mail.gmail.com>

On Fri, Jul 22, 2011 at 11:58 AM, Sheila the angel
<from.d.putto at gmail.com> wrote:
> Oh I am sorry for the line
> seq_record = SeqIO.read(open("alpha.fasta"), "fasta") ?#or a sequence object
> This was meant to show that I have a sequence record object.

I understood.

> In my actual problem I have open 2 different genbank files which contains
> many sequence record. I want to run EMBOSS to each sequence.

The EMBOSS tools can read GenBank files too. Try something like this
using their Uniform Sequence Address (USA) convention,

http://emboss.sourceforge.net/docs/#Usa
http://emboss.sourceforge.net/docs/themes/UniformSequenceAddress.html

water_cline = WaterCommandline(asequence="genbank::ls_orchid.gbk",
bsequence="genbank::other_file.gbk", gapopen=10, gapextend=0.5,
outfile="water.txt", auto=True)

Alternative some (all?) of the EMBOSS tools provide an explicit
separate argument for the input file format. In this case it wasn't
very obvious as it wasn't listed in the "water --help" text, you could
use -sformat1 and -sformat2 but it looks like our needle/water
wrappers don't include them. So go with the USA approach.

Peter


From gowencm at vcu.edu  Thu Jul 28 12:28:40 2011
From: gowencm at vcu.edu (Chris Gowen)
Date: Thu, 28 Jul 2011 12:28:40 -0400
Subject: [Biopython] PWM using gapped alignments
Message-ID: <CA+Sdz8c-wbP0KkF9HK1BDsLN7kgf+xjTodJb9JDBrWMAHC52Fw@mail.gmail.com>

Hello all,

We are trying to perform pwm calculations using the Motif.pwm() function,
and many of our alignments have gaps, which raise KeyError when it tries the
key '-'. I am fairly inexperienced with this analysis technique, but from
looking at the source, it seems the error itself may be avoided by adding a
line before line 97 to skip that letter in the calculation. Would this mess
up the calculation for the pwm scores? Has anyone dealt with this problem in
a more clever way?

Thanks for any advise you can offer.

Best,
Chris Gowen


82 - <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#> def
pwm<http://biopython.org/DIST/docs/api/Bio.Motif._Motif.Motif-class.html#pwm>
(self,laplace=True):
 83 """  84 returns the PWM computed for the set of instances  85  86 if
laplace=True (default), pseudocounts equal to self.background multiplied by
self.beta are added to all positions.  87 """  88  89 if self.
_pwm_is_current:  90 return
self._pwm<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
91 #we
need to compute new pwm  92
self._pwm<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
= []  93 for i<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
in xrange <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>(
self.length<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
):  94 dict = {}  95 #filling the dict with 0's  96 for letter in self.
alphabet <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>.
letters <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>: 97
if laplace:  98 dict[letter]=self.beta*self.background[letter]  99 else: 100
dict[letter]=0.0 101 if self.has_counts: 102 #taking the raw counts 103 for
letter in self.alphabet<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
.letters <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>:
104 dict[letter]+=self.counts[letter][i<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
] 105 elif self.has_instances: 106 #counting the occurences of letters in
instances 107 for
seq<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
in self.instances: 108 #dict[seq[i]]=dict[seq[i]]+1 109
dict[seq<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
[i <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>]]+=1
110 self._pwm<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
.append <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>(
FreqTable <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>.
FreqTable <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>(
dict,FreqTable<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
.COUNT <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>,
self.alphabet<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
)) 111 self._pwm_is_current=1 112 return
self._pwm<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>

From p.j.a.cock at googlemail.com  Thu Jul 28 12:54:40 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 28 Jul 2011 17:54:40 +0100
Subject: [Biopython] PWM using gapped alignments
In-Reply-To: <CA+Sdz8c-wbP0KkF9HK1BDsLN7kgf+xjTodJb9JDBrWMAHC52Fw@mail.gmail.com>
References: <CA+Sdz8c-wbP0KkF9HK1BDsLN7kgf+xjTodJb9JDBrWMAHC52Fw@mail.gmail.com>
Message-ID: <CAKVJ-_4DCVezggVD8bPdibrPug3i073NM9x6ck4-pQSCEqencA@mail.gmail.com>

On Thu, Jul 28, 2011 at 5:28 PM, Chris Gowen <gowencm at vcu.edu> wrote:
> Hello all,
>
> We are trying to perform pwm calculations using the Motif.pwm() function,
> and many of our alignments have gaps, which raise KeyError when it tries the
> key '-'. I am fairly inexperienced with this analysis technique, but from
> looking at the source, it seems the error itself may be avoided by adding a
> line before line 97 to skip that letter in the calculation. Would this mess
> up the calculation for the pwm scores? Has anyone dealt with this problem in
> a more clever way?
>
> Thanks for any advise you can offer.
>
> Best,
> Chris Gowen

Which alphabet are you using? My guess is you didn't have a gapped
alphabet.

As an aside, making the Seq object test this has certain appeal but
would impose a performance penalty.

Peter

From gowencm at vcu.edu  Thu Jul 28 13:14:03 2011
From: gowencm at vcu.edu (Chris Gowen)
Date: Thu, 28 Jul 2011 13:14:03 -0400
Subject: [Biopython] PWM using gapped alignments
In-Reply-To: <CAKVJ-_4DCVezggVD8bPdibrPug3i073NM9x6ck4-pQSCEqencA@mail.gmail.com>
References: <CA+Sdz8c-wbP0KkF9HK1BDsLN7kgf+xjTodJb9JDBrWMAHC52Fw@mail.gmail.com>
	<CAKVJ-_4DCVezggVD8bPdibrPug3i073NM9x6ck4-pQSCEqencA@mail.gmail.com>
Message-ID: <CA+Sdz8caGW7_q97gOpyL+=wNDyt7mSCXwWZOMhr2BTSaJOsSkA@mail.gmail.com>

Hi Peter,

Thanks for the response. We are initiating the alignments and motif as
Gapped(IUPAC.unambiguous_dna), so our letters are 'GATC-'. As far as I can
tell, there is no means for pwm() to know to skip the gaps, if that's even
the 'right' thing for it to do.

On Thu, Jul 28, 2011 at 12:54 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 28, 2011 at 5:28 PM, Chris Gowen <gowencm at vcu.edu> wrote:
> > Hello all,
> >
> > We are trying to perform pwm calculations using the Motif.pwm() function,
> > and many of our alignments have gaps, which raise KeyError when it tries
> the
> > key '-'. I am fairly inexperienced with this analysis technique, but from
> > looking at the source, it seems the error itself may be avoided by adding
> a
> > line before line 97 to skip that letter in the calculation. Would this
> mess
> > up the calculation for the pwm scores? Has anyone dealt with this problem
> in
> > a more clever way?
> >
> > Thanks for any advise you can offer.
> >
> > Best,
> > Chris Gowen
>
> Which alphabet are you using? My guess is you didn't have a gapped
> alphabet.
>
> As an aside, making the Seq object test this has certain appeal but
> would impose a performance penalty.
>
> Peter
>

From dilara.ally at gmail.com  Fri Jul  1 01:21:47 2011
From: dilara.ally at gmail.com (Dilara Ally)
Date: Thu, 30 Jun 2011 18:21:47 -0700
Subject: [Biopython] Having a hard time getting a handle on handles
Message-ID: <4E0D212B.4040206@gmail.com>

Hi All

I have ~700,000 contigs that I would like to blast search and then from 
the blast record parse out particular pieces of information from the 
BLAST report.  I can get my code to pull in files and then loop over 
seq_records, blast, and then write a BLAST report.  But since I don't 
want to have 700,000 BLAST reports, I'd like to parse particular pieces 
of information from the report and store it in a table.  This is the 
error I get from the code I have pasted below:

/Users/dally/Desktop/NextGenData/Python_Scripts/batchedfastafiles/group_1.fasta
1
0
GTCTTCGGCGTTGCACCGGCGATGAAGAACCAGTACGAGGCGTCTGGCGAGAGTAACAACGCTG
Traceback (most recent call last):
   File "<stdin>", line 13, in <module>
NameError: name 'NCBIXML' is not defined

Do i have to close the result_handle and then reopen it?  If so why?  
Thanks in advance for your help.
>
> from Bio import SeqIO
> from Bio.Blast import NCBIWWW
> import time
> import os
> import os.path
>
> dirname1="/Users/dally/Desktop/NextGenData/Python_Scripts/batchedfastafiles/"
> allfiles=os.listdir(dirname1)
> fanddir=[os.path.join(dirname1,fname) for fname in allfiles]
> i = 0
> for f in fanddir:
>     print f
>     handle = open(f, "rU")
>     contigs =list(SeqIO.parse(handle,"fasta"))
>     handle.close()
>     start=time.time()
>     for seq_record in contigs:
>         i=i+1
>         print seq_record.id
>         print seq_record.seq
>         result_handle=NCBIWWW.qblast("blastn", "nr", 
> seq_record.format("fasta"),hitlist_size=10)
>         blast_record=list(NCBIXML.read(result_handle)) <== HERE IS THE 
> PROBLEM
>         E_VALUE_THRESH = 0.000004
>         countr=0
>         for alignment in blast_record.alignments:
>             countr=countr+1
>             for hsp in alignment.hsps:
>                 if hsp.expect < E_VALUE_THRESH:
>                     print '****Alignment****'
>                     print 'sequence:', alignment.title
>                     print 'length:', alignment.length
>                     print 'e value:', hsp.expect
>                     print hsp.query[0:75] + '...'
>                     print hsp.match[0:75] + '...'
>                     print hsp.sbjct[0:75] + '...'



From eric.talevich at gmail.com  Fri Jul  1 03:24:04 2011
From: eric.talevich at gmail.com (Eric Talevich)
Date: Thu, 30 Jun 2011 23:24:04 -0400
Subject: [Biopython] Having a hard time getting a handle on handles
In-Reply-To: <4E0D212B.4040206@gmail.com>
References: <4E0D212B.4040206@gmail.com>
Message-ID: <BANLkTinF=T-0OMHJNmbg9bM2E2ZP61xrCw@mail.gmail.com>

On Thu, Jun 30, 2011 at 9:21 PM, Dilara Ally <dilara.ally at gmail.com> wrote:

> Hi All
>
> I have ~700,000 contigs that I would like to blast search and then from the
> blast record parse out particular pieces of information from the BLAST
> report.  I can get my code to pull in files and then loop over seq_records,
> blast, and then write a BLAST report.  But since I don't want to have
> 700,000 BLAST reports, I'd like to parse particular pieces of information
> from the report and store it in a table.  This is the error I get from the
> code I have pasted below:
>
> /Users/dally/Desktop/**NextGenData/Python_Scripts/**
> batchedfastafiles/group_1.**fasta
> 1
> 0
> GTCTTCGGCGTTGCACCGGCGATGAAGAAC**CAGTACGAGGCGTCTGGCGAGAGTAACAAC**GCTG
> Traceback (most recent call last):
>  File "<stdin>", line 13, in <module>
> NameError: name 'NCBIXML' is not defined
>
> Do i have to close the result_handle and then reopen it?  If so why?
>  Thanks in advance for your help.
>

Try adding this import to the top of your script:

from Bio.Blast import NCBIXML

Does it work now?

In general, whenever you see a NameError you should check for (a) missing
imports and (b) mis-typed variable names. The problem is usually one of
those.

Cheers,
Eric


From dilara.ally at gmail.com  Fri Jul  1 03:50:52 2011
From: dilara.ally at gmail.com (Dilara Ally)
Date: Thu, 30 Jun 2011 20:50:52 -0700
Subject: [Biopython] Having a hard time getting a handle on handles
In-Reply-To: <BANLkTinF=T-0OMHJNmbg9bM2E2ZP61xrCw@mail.gmail.com>
References: <4E0D212B.4040206@gmail.com>
	<BANLkTinF=T-0OMHJNmbg9bM2E2ZP61xrCw@mail.gmail.com>
Message-ID: <4E0D441C.5020600@gmail.com>

Thanks, I tried that and now the error is

Traceback (most recent call last):
   File "<stdin>", line 12, in <module>
TypeError: iteration over non-sequence

Dilara

On 6/30/11 8:24 PM, Eric Talevich wrote:
> from Bio.Blast import NCBIXML


From eric.talevich at gmail.com  Fri Jul  1 15:27:42 2011
From: eric.talevich at gmail.com (Eric Talevich)
Date: Fri, 1 Jul 2011 11:27:42 -0400
Subject: [Biopython] Having a hard time getting a handle on handles
In-Reply-To: <4E0D441C.5020600@gmail.com>
References: <4E0D212B.4040206@gmail.com>
	<BANLkTinF=T-0OMHJNmbg9bM2E2ZP61xrCw@mail.gmail.com>
	<4E0D441C.5020600@gmail.com>
Message-ID: <BANLkTimammQ2KbKy2m=8wxfBEQXhpX07zw@mail.gmail.com>

OK, the "iteration" is where you're trying to construct a list. Where it
says:

blast_record = list(NCBIXML.read(result_handle))

Try:

blast_record = NCBIXML.read(result_handle)
print blast_record

And see what's in the blast_record object. That should make it more clear
how the rest of your code should navigate it.

-E

On Thu, Jun 30, 2011 at 11:50 PM, Dilara Ally <dilara.ally at gmail.com> wrote:

> Thanks, I tried that and now the error is
>
>
> Traceback (most recent call last):
>  File "<stdin>", line 12, in <module>
> TypeError: iteration over non-sequence
>
> Dilara
>
>
> On 6/30/11 8:24 PM, Eric Talevich wrote:
>
>> from Bio.Blast import NCBIXML
>>
>


From p.j.a.cock at googlemail.com  Sat Jul  2 09:18:45 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Sat, 2 Jul 2011 10:18:45 +0100
Subject: [Biopython] multiple sequence blast
In-Reply-To: <20110630104227.GA2883@sobchak>
References: <4E0BAD67.70305@gmail.com>
	<20110630104227.GA2883@sobchak>
Message-ID: <CAKVJ-_5B1i9j+zp9b67tStmTVnvODGV7Xu_s-o9BPHwQNifBGg@mail.gmail.com>

On Thu, Jun 30, 2011 at 11:42 AM, Brad Chapman <chapmanb at 50mail.com> wrote:
> Dilara;
> Thanks for the message. It would be helpful if you'd include the
> error message traceback that you got stuck on; this will help
> pinpoint the problem.
>
> From reading your code, my guess is that you are getting and IOError
> about files not existing. When you do os.listdir, it only includes
> the name of the files, not the full path to where they are located.

I would have suggested the same thing.

In addition, are you really trying to run 100,000 contigs though
the NCBI online BLAST service? If it works it will take a long time,
but they might not like that and block your access. Big BLAST
jobs like this are better done by installing BLAST+ (and in this case
the NR database) locally. Biopython has wrappers to help call
standalone BLAST too.

Peter


From dilara.ally at gmail.com  Sun Jul  3 18:27:12 2011
From: dilara.ally at gmail.com (Dilara Ally)
Date: Sun, 03 Jul 2011 11:27:12 -0700
Subject: [Biopython] multiple sequence blast
In-Reply-To: <CAKVJ-_5B1i9j+zp9b67tStmTVnvODGV7Xu_s-o9BPHwQNifBGg@mail.gmail.com>
References: <4E0BAD67.70305@gmail.com>	<20110630104227.GA2883@sobchak>
	<CAKVJ-_5B1i9j+zp9b67tStmTVnvODGV7Xu_s-o9BPHwQNifBGg@mail.gmail.com>
Message-ID: <4E10B480.1030600@gmail.com>

Thanks Peter.

On 7/2/11 2:18 AM, Peter Cock wrote:
> On Thu, Jun 30, 2011 at 11:42 AM, Brad Chapman<chapmanb at 50mail.com>  wrote:
>> Dilara;
>> Thanks for the message. It would be helpful if you'd include the
>> error message traceback that you got stuck on; this will help
>> pinpoint the problem.
>>
>>  From reading your code, my guess is that you are getting and IOError
>> about files not existing. When you do os.listdir, it only includes
>> the name of the files, not the full path to where they are located.
> I would have suggested the same thing.
>
> In addition, are you really trying to run 100,000 contigs though
> the NCBI online BLAST service? If it works it will take a long time,
> but they might not like that and block your access. Big BLAST
> jobs like this are better done by installing BLAST+ (and in this case
> the NR database) locally. Biopython has wrappers to help call
> standalone BLAST too.
>
> Peter
>


From dilara.ally at gmail.com  Sun Jul  3 19:27:53 2011
From: dilara.ally at gmail.com (Dilara Ally)
Date: Sun, 03 Jul 2011 12:27:53 -0700
Subject: [Biopython] multiple sequence blast
In-Reply-To: <CAKVJ-_5B1i9j+zp9b67tStmTVnvODGV7Xu_s-o9BPHwQNifBGg@mail.gmail.com>
References: <4E0BAD67.70305@gmail.com>	<20110630104227.GA2883@sobchak>
	<CAKVJ-_5B1i9j+zp9b67tStmTVnvODGV7Xu_s-o9BPHwQNifBGg@mail.gmail.com>
Message-ID: <4E10C2B9.2000909@gmail.com>

Hi Peter

How long will it take then to do a big BLAST job that has over 600,000 
contigs.  Wouldn't downloading the databasese and doing a standalone 
BLAST take a lot of cpu memory?  Should I be doing this on a cluster?

Dilara

On 7/2/11 2:18 AM, Peter Cock wrote:
> On Thu, Jun 30, 2011 at 11:42 AM, Brad Chapman<chapmanb at 50mail.com>  wrote:
>> Dilara;
>> Thanks for the message. It would be helpful if you'd include the
>> error message traceback that you got stuck on; this will help
>> pinpoint the problem.
>>
>>  From reading your code, my guess is that you are getting and IOError
>> about files not existing. When you do os.listdir, it only includes
>> the name of the files, not the full path to where they are located.
> I would have suggested the same thing.
>
> In addition, are you really trying to run 100,000 contigs though
> the NCBI online BLAST service? If it works it will take a long time,
> but they might not like that and block your access. Big BLAST
> jobs like this are better done by installing BLAST+ (and in this case
> the NR database) locally. Biopython has wrappers to help call
> standalone BLAST too.
>
> Peter
>


From p.j.a.cock at googlemail.com  Sun Jul  3 23:52:34 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 4 Jul 2011 00:52:34 +0100
Subject: [Biopython] multiple sequence blast
In-Reply-To: <4E10C2B9.2000909@gmail.com>
References: <4E0BAD67.70305@gmail.com> <20110630104227.GA2883@sobchak>
	<CAKVJ-_5B1i9j+zp9b67tStmTVnvODGV7Xu_s-o9BPHwQNifBGg@mail.gmail.com>
	<4E10C2B9.2000909@gmail.com>
Message-ID: <CAKVJ-_44-QXPUooJ6Zu4VkYcTJQvharchYLdobuxu-qUXcycBQ@mail.gmail.com>

On Sun, Jul 3, 2011 at 8:27 PM, Dilara Ally wrote:
> Hi Peter
>
> How long will it take then to do a big BLAST job that has over
> 600,000 contigs.

How long is a piece of string? ;)

What I mean is this is hard to say without looking at your data.
Do you know the total sequence length of the contigs?

Try doing 60 representative contigs on your machine for an
estimate (note their lengths are important - shorter contigs
should be faster to run as BLAST queries).

Remember that standalone BLAST+ can be run multi-threaded.
It will depend on the number of CPUs and how much RAM you
have.

> Wouldn't downloading the databasese and doing a standalone
> BLAST take a lot of cpu memory?

Yes, it will take a lot of CPU time, and a moderate amount of
RAM (if you are doing genome assembly to get the contigs,
that will probably have needed far more RAM than running
BLAST will).

>?Should I be doing this on a cluster?

It would probably be worth while. You *might* manage with a
powerful multicore desktop (like a recent MacPro or similar)
or powerful server.

Peter



From kokomutai at gmail.com  Mon Jul  4 08:25:35 2011
From: kokomutai at gmail.com (Koko Mutai)
Date: Mon, 4 Jul 2011 11:25:35 +0300
Subject: [Biopython] (no subject)
Message-ID: <CA++B1TiDWe+TbzG=06SpCc5g5eaeZ4CXDsakVZKtoyu-c39nRg@mail.gmail.com>

hallo l would like to ask how to import,sequence matrix
metalloproteinases and DNA annotation using biopython


From from.d.putto at gmail.com  Thu Jul  7 10:26:48 2011
From: from.d.putto at gmail.com (Sheila the angel)
Date: Thu, 7 Jul 2011 12:26:48 +0200
Subject: [Biopython] Passing sequence to local BLAST
Message-ID: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>

Hi All,

I want to download genbank file from NCBI and pass the protein sequence
directly to the local BLAST. But I am getting error in BLAST step
#-------------------------------------------------------------------------------------------
from Bio import SeqIO
from Bio import Entrez
from Bio.Blast.Applications import NcbiblastpCommandline
id='200203'
handle = Entrez.efetch(db="protein", id=id, rettype="gp")
seq_record = SeqIO.read(handle, "gb")
x=seq_record.seq                                            #getting the
sequence in a variable x
blastp_cline = NcbiblastpCommandline(query=x, db="protein_database",
evalue=0.001)    # My BLAST command
result_handle, stderr = blastp_cline()                    #Running BLAST and
getting error :(

#-------------------------------------------------------------------------------------------

At this last step I am getting error.....
I sort-of understand the problem.....it is taking value of x as a file name
while its a variable which contains the sequence.
Is there any way out to this problem without making temporary file.


Thanks in Advance

--
Cheers
Sheila


From p.j.a.cock at googlemail.com  Thu Jul  7 10:43:22 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 7 Jul 2011 11:43:22 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
Message-ID: <CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>

On Thu, Jul 7, 2011 at 11:26 AM, Sheila the angel
<from.d.putto at gmail.com> wrote:
> Hi All,
>
> I want to download genbank file from NCBI and pass the protein sequence
> directly to the local BLAST. But I am getting error in BLAST step
> #-------------------------------------------------------------------------------------------
> from Bio import SeqIO
> from Bio import Entrez
> from Bio.Blast.Applications import NcbiblastpCommandline
> id='200203'
> handle = Entrez.efetch(db="protein", id=id, rettype="gp")
> seq_record = SeqIO.read(handle, "gb")
> x=seq_record.seq ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?#getting the
> sequence in a variable x
> blastp_cline = NcbiblastpCommandline(query=x, db="protein_database",
> evalue=0.001) ? ?# My BLAST command
> result_handle, stderr = blastp_cline() ? ? ? ? ? ? ? ? ? ?#Running BLAST and
> getting error :(
>
> #-------------------------------------------------------------------------------------------
>
> At this last step I am getting error.....
> I sort-of understand the problem.....it is taking value of x as a file name
> while its a variable which contains the sequence.
> Is there any way out to this problem without making temporary file.

With the standalone blast tools you generally need to prepare an input
FASTA file with your query sequence(s).

However, in principle you can give the input filename as - (default),
and instead pipe the query FASTA record in as stdin (standard input).
Try something like this (untested):

...
blastp_cline = NcbiblastpCommandline(query="-", db="protein_database",
evalue=0.001)
stdout, stderr = blastp_cline(stdin=seq_record.format("fasta"))

Peter



From from.d.putto at gmail.com  Thu Jul  7 10:53:28 2011
From: from.d.putto at gmail.com (Sheila the angel)
Date: Thu, 7 Jul 2011 12:53:28 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
Message-ID: <CAFinXcQmm3FRC6hEsXR77_ddMvA-4wWGDhJ70KvyfKrz8NsM_w@mail.gmail.com>

Great !!!! It works
Thanks a lot :)

On Thu, Jul 7, 2011 at 12:43 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 7, 2011 at 11:26 AM, Sheila the angel
> <from.d.putto at gmail.com> wrote:
> > Hi All,
> >
> > I want to download genbank file from NCBI and pass the protein sequence
> > directly to the local BLAST. But I am getting error in BLAST step
> >
> #-------------------------------------------------------------------------------------------
> > from Bio import SeqIO
> > from Bio import Entrez
> > from Bio.Blast.Applications import NcbiblastpCommandline
> > id='200203'
> > handle = Entrez.efetch(db="protein", id=id, rettype="gp")
> > seq_record = SeqIO.read(handle, "gb")
> > x=seq_record.seq                                            #getting the
> > sequence in a variable x
> > blastp_cline = NcbiblastpCommandline(query=x, db="protein_database",
> > evalue=0.001)    # My BLAST command
> > result_handle, stderr = blastp_cline()                    #Running BLAST
> and
> > getting error :(
> >
> >
> #-------------------------------------------------------------------------------------------
> >
> > At this last step I am getting error.....
> > I sort-of understand the problem.....it is taking value of x as a file
> name
> > while its a variable which contains the sequence.
> > Is there any way out to this problem without making temporary file.
>
> With the standalone blast tools you generally need to prepare an input
> FASTA file with your query sequence(s).
>
> However, in principle you can give the input filename as - (default),
> and instead pipe the query FASTA record in as stdin (standard input).
> Try something like this (untested):
>
> ...
> blastp_cline = NcbiblastpCommandline(query="-", db="protein_database",
> evalue=0.001)
> stdout, stderr = blastp_cline(stdin=seq_record.format("fasta"))
>
> Peter
>


From p.j.a.cock at googlemail.com  Thu Jul  7 10:55:29 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 7 Jul 2011 11:55:29 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAFinXcQmm3FRC6hEsXR77_ddMvA-4wWGDhJ70KvyfKrz8NsM_w@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcQmm3FRC6hEsXR77_ddMvA-4wWGDhJ70KvyfKrz8NsM_w@mail.gmail.com>
Message-ID: <CAKVJ-_7U52gqY3fR80fk8f5TNpYQiTovoVeTjPPyM5D7T6jMWg@mail.gmail.com>

On Thu, Jul 7, 2011 at 11:53 AM, Sheila the angel
<from.d.putto at gmail.com> wrote:
> Great !!!!?It works
> Thanks a lot :)

Thanks for letting us know.

Another solution would be to just download the file from the NCBI
in FASTA format rather than GenBank format - but I expect you
had other reasons for doing that.

Peter



From jessecolangelolillis at googlemail.com  Thu Jul  7 11:30:58 2011
From: jessecolangelolillis at googlemail.com (Jesse Colangelo-Lillis)
Date: Thu, 7 Jul 2011 04:30:58 -0700
Subject: [Biopython] Bio.Blast; entrez_query= multiple organisms
Message-ID: <CALgkfoahGpswsEg0d3DwmcTsAFihzZmjTaTZ8JFgxzKJ7HB-Sg@mail.gmail.com>

Can someone tell me the format for specifying multiple organisms
within the blast parameters?

I have this:

result_handle = NCBIWWW.qblast("blastp", "nr", gene_seq, expect=100,
hitlist_size=1, entrez_query="unclassified Caudovirales[orgn]")

but I actually want to blast against both 'Caudovirales' and
'unclassified Caudovirales'.
Thanks for any help.

-- 
Jesse Colangelo-Lillis
--
Australian National University
Research School Earth Sciences
Bldg 61. Mills Road
Canberra, ACT 0200
Australia
cell: 0415 380 105
--


From p.j.a.cock at googlemail.com  Thu Jul  7 11:42:45 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 7 Jul 2011 12:42:45 +0100
Subject: [Biopython] Bio.Blast; entrez_query= multiple organisms
In-Reply-To: <CALgkfoahGpswsEg0d3DwmcTsAFihzZmjTaTZ8JFgxzKJ7HB-Sg@mail.gmail.com>
References: <CALgkfoahGpswsEg0d3DwmcTsAFihzZmjTaTZ8JFgxzKJ7HB-Sg@mail.gmail.com>
Message-ID: <CAKVJ-_5DjqSjT1NVJnBsaA_VcYJECMwZz66ti3JWFuUDMsNPNA@mail.gmail.com>

On Thu, Jul 7, 2011 at 12:30 PM, Jesse Colangelo-Lillis
<jessecolangelolillis at googlemail.com> wrote:
> Can someone tell me the format for specifying multiple organisms
> within the blast parameters?
>
> I have this:
>
> result_handle = NCBIWWW.qblast("blastp", "nr", gene_seq, expect=100,
> hitlist_size=1, entrez_query="unclassified Caudovirales[orgn]")
>
> but I actually want to blast against both 'Caudovirales' and
> 'unclassified Caudovirales'.
> Thanks for any help.

You probably would need explicit quotes round unclassified Caudovirales
on the Entrez query, otherwise it will do this I think:

unclassified AND Caudovirales[orgn]

I would use the taxid rather than the name to avoid the space problem.

Is a taxid that covers both your clades of interest?

Otherwise combine fields with OR (or AND as appropriate). Play with
the web interface to build the right query:

http://www.ncbi.nlm.nih.gov/protein/advanced

Peter


From mnemonico at posthocergopropterhoc.net  Fri Jul  8 04:19:20 2011
From: mnemonico at posthocergopropterhoc.net (A M Torres, Hugo)
Date: Fri, 8 Jul 2011 01:19:20 -0300
Subject: [Biopython] error writing fasta file using SeqIO
Message-ID: <CAAVOifQE_=djoORwxsMmYNdXkiQz1jHNHo28TMEm8kMpXah87w@mail.gmail.com>

Hi. Can someone spot why I can't create a fasta file here? I tried following
the cookbook tutorial but something goes wrong when I try to write  the
sequence from a SeqRecord object to a fasta file:

 Lodge It

   - New <http://paste.pound-python.org/>
   - All <http://paste.pound-python.org/all/>
   - About <http://paste.pound-python.org/about/>
   - ? <http://paste.pound-python.org/help/>

 Paste #9205
Paste Details

reply <http://paste.pound-python.org/?reply_to=9205> |
raw<http://paste.pound-python.org/raw/9205/>

posted on Jul 8, 2011 4:12:16 AM

   - reply to this paste <http://paste.pound-python.org/?reply_to=9205>
   - download paste <http://paste.pound-python.org/raw/9205/>
   - compare with paste
   - select different colorscheme  Autumn Borland Bw Colorful Default Emacs
   Friendly Fruity Manni Monokai Murphy Native Pastie Perldoc Tango Trac Vs
   - toggle line numbers<http://paste.pound-python.org/show/9205/?linenos=no>

   1
 2
 3
 4
 5
 6
 7
 8
 9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78

import abifpy
from Bio.Seq import Seq
from Bio.SeqRecord import SeqRecord
from Bio.Emboss.Applications import NeedleCommandline
import os #uso a funcao listdir
from Bio import SeqIO

def acessa_ab1(arquivo,trim=True): #generalizar depois
    """acessa um arquivo ab1 e retorna um objeto SeqRecord"""
    dado = abifpy.Trace(arquivo)
    if trim:
        cortado = dado.trim(dado.seq(ambig=True))
        return SeqRecord(cortado, id=arquivo, description='dado cortado')
    else:
        return dado.seqrecord()

def abre_ref(arquivo):
    """acessa um arquivo contendo uma sequencia de referencia
      retorna um objeto SeqRecord"""
    with open(arquivo, 'rUb') as dado:
        referencia = SeqIO.read(dado, 'genbank')
    return referencia

def salva_fasta(obj_SeqRecord):
    """Pega um objeto SeqRecord e cria um fasta com a sua sequencia"""

    SeqIO.write([obj_SeqRecord], obj_SeqRecord + '.fasta','fasta')

def processar_lote(diretorio, ref):
    """abre os arquivos ab1 de uma pasta, apara, salva em fasta, faz o
alinhamento com
    o fasta de referencia e salva o alinhamento em um arquivo para analise
    posterior.
    diretorio --> uma string representando o caminho da pasta contendo
os arquivos
    ref --> uma string representando o caminho absoluto + genbank com a
    sequencia de referencia.
    """

    referencia = abre_ref(ref)
    referencia.id = 'sequencia de referencia'
    salva_fasta(referencia)
    ab1files = [x for x in os.listdir(diretorio) if x.endswith('.ab1')]
    for file in ab1files:
        dado = acessa_ab1(diretorio + file)
        salva_fasta(dado)
        needle_cline = NeedleCommandline(asequence='referencia.fasta',
                                        bsequence= file + '.fasta',
gapopen=10, gapextend=0.5,
                                        outfile=file + "_aligned.txt")
    stdout, stderr = needle_cline()




#pasta = '/home/mercutio22/Dropbox/My scripts/Fabi/vs/Seq_placa273 analisada/'
#referencia = '/home/mercutio22/Dropbox/My
scripts/Fabi/vs/Seq_placa273 analisada/BRCA1 (total) - Frag 3450.gb'

#processar_lote(pasta, referencia)

dado = acessa_ab1('/home/mercutio22/Dropbox/My
scripts/Fabi/vs/Seq_placa273 analisada/1174411_3450F_A01.ab1')
print type(dado)
salva_fasta(dado)


===============================error msg==============
<class 'Bio.SeqRecord.SeqRecord'>
Traceback (most recent call last):
  File "louise.py", line 59, in <module>
    salva_fasta(dado)
  File "louise.py", line 26, in salva_fasta
    SeqIO.write([obj_SeqRecord], obj_SeqRecord + '.fasta','fasta')
  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/__init__.py", line 412, in write
    count = writer_class(handle).write_file(sequences)
  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/Interfaces.py", line
271, in write_file
    count = self.write_records(records)
  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/Interfaces.py", line
256, in write_records
    self.write_record(record)
  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/FastaIO.py", line 134,
in write_record
    self.handle.write(">%s\n" % title)
AttributeError: 'SeqRecord' object has no attribute 'write'


From w.arindrarto at gmail.com  Fri Jul  8 04:46:11 2011
From: w.arindrarto at gmail.com (Wibowo Arindrarto)
Date: Fri, 8 Jul 2011 06:46:11 +0200
Subject: [Biopython] error writing fasta file using SeqIO
In-Reply-To: <CAAVOifQE_=djoORwxsMmYNdXkiQz1jHNHo28TMEm8kMpXah87w@mail.gmail.com>
References: <CAAVOifQE_=djoORwxsMmYNdXkiQz1jHNHo28TMEm8kMpXah87w@mail.gmail.com>
Message-ID: <CADEGkF5-VhP+_TsSb6FxoL32uWzuFqG5CxTN6WFvCd7hUwkOhw@mail.gmail.com>

Hi Hugo,

I think the problem is you tried to concatenate a SeqRecord object and a
string object. Do this in 'salva_fasta' instead:

SeqIO.write([obj_SeqRecord], obj_SeqRecord.id + '.fasta', 'fasta')

And just as an additional input, in the 'processar_lote' method, you can use
this to generate a list of absolute file name paths (import the os and glob
module beforehand).

files = [os.path.abspath(x) for x in glob.glob('*.ab1')]

os.path.abspath() returns the absolute file path for a given file, and
glob.glob() returns a list of names that matches the given pattern.

Hope that helps!
---
Wibowo Arindrarto (bow)
http://bow.web.id



On Fri, Jul 8, 2011 at 06:19, A M Torres, Hugo <
mnemonico at posthocergopropterhoc.net> wrote:

> Hi. Can someone spot why I can't create a fasta file here? I tried
> following
> the cookbook tutorial but something goes wrong when I try to write  the
> sequence from a SeqRecord object to a fasta file:
>
>  Lodge It
>
>   - New <http://paste.pound-python.org/>
>   - All <http://paste.pound-python.org/all/>
>   - About <http://paste.pound-python.org/about/>
>   - ? <http://paste.pound-python.org/help/>
>
>  Paste #9205
> Paste Details
>
> reply <http://paste.pound-python.org/?reply_to=9205> |
> raw<http://paste.pound-python.org/raw/9205/>
>
> posted on Jul 8, 2011 4:12:16 AM
>
>   - reply to this paste <http://paste.pound-python.org/?reply_to=9205>
>   - download paste <http://paste.pound-python.org/raw/9205/>
>   - compare with paste
>   - select different colorscheme  Autumn Borland Bw Colorful Default Emacs
>   Friendly Fruity Manni Monokai Murphy Native Pastie Perldoc Tango Trac Vs
>   - toggle line numbers<
> http://paste.pound-python.org/show/9205/?linenos=no>
>
>   1
>  2
>  3
>  4
>  5
>  6
>  7
>  8
>  9
> 10
> 11
> 12
> 13
> 14
> 15
> 16
> 17
> 18
> 19
> 20
> 21
> 22
> 23
> 24
> 25
> 26
> 27
> 28
> 29
> 30
> 31
> 32
> 33
> 34
> 35
> 36
> 37
> 38
> 39
> 40
> 41
> 42
> 43
> 44
> 45
> 46
> 47
> 48
> 49
> 50
> 51
> 52
> 53
> 54
> 55
> 56
> 57
> 58
> 59
> 60
> 61
> 62
> 63
> 64
> 65
> 66
> 67
> 68
> 69
> 70
> 71
> 72
> 73
> 74
> 75
> 76
> 77
> 78
>
> import abifpy
> from Bio.Seq import Seq
> from Bio.SeqRecord import SeqRecord
> from Bio.Emboss.Applications import NeedleCommandline
> import os #uso a funcao listdir
> from Bio import SeqIO
>
> def acessa_ab1(arquivo,trim=True): #generalizar depois
>    """acessa um arquivo ab1 e retorna um objeto SeqRecord"""
>    dado = abifpy.Trace(arquivo)
>    if trim:
>        cortado = dado.trim(dado.seq(ambig=True))
>        return SeqRecord(cortado, id=arquivo, description='dado cortado')
>    else:
>        return dado.seqrecord()
>
> def abre_ref(arquivo):
>    """acessa um arquivo contendo uma sequencia de referencia
>      retorna um objeto SeqRecord"""
>    with open(arquivo, 'rUb') as dado:
>        referencia = SeqIO.read(dado, 'genbank')
>    return referencia
>
> def salva_fasta(obj_SeqRecord):
>    """Pega um objeto SeqRecord e cria um fasta com a sua sequencia"""
>
>    SeqIO.write([obj_SeqRecord], obj_SeqRecord + '.fasta','fasta')
>
> def processar_lote(diretorio, ref):
>    """abre os arquivos ab1 de uma pasta, apara, salva em fasta, faz o
> alinhamento com
>    o fasta de referencia e salva o alinhamento em um arquivo para analise
>    posterior.
>    diretorio --> uma string representando o caminho da pasta contendo
> os arquivos
>    ref --> uma string representando o caminho absoluto + genbank com a
>    sequencia de referencia.
>    """
>
>    referencia = abre_ref(ref)
>    referencia.id = 'sequencia de referencia'
>    salva_fasta(referencia)
>    ab1files = [x for x in os.listdir(diretorio) if x.endswith('.ab1')]
>    for file in ab1files:
>        dado = acessa_ab1(diretorio + file)
>        salva_fasta(dado)
>        needle_cline = NeedleCommandline(asequence='referencia.fasta',
>                                        bsequence= file + '.fasta',
> gapopen=10, gapextend=0.5,
>                                        outfile=file + "_aligned.txt")
>    stdout, stderr = needle_cline()
>
>
>
>
> #pasta = '/home/mercutio22/Dropbox/My scripts/Fabi/vs/Seq_placa273
> analisada/'
> #referencia = '/home/mercutio22/Dropbox/My
> scripts/Fabi/vs/Seq_placa273 analisada/BRCA1 (total) - Frag 3450.gb'
>
> #processar_lote(pasta, referencia)
>
> dado = acessa_ab1('/home/mercutio22/Dropbox/My
> scripts/Fabi/vs/Seq_placa273 analisada/1174411_3450F_A01.ab1')
> print type(dado)
> salva_fasta(dado)
>
>
> ===============================error msg==============
> <class 'Bio.SeqRecord.SeqRecord'>
> Traceback (most recent call last):
>  File "louise.py", line 59, in <module>
>    salva_fasta(dado)
>  File "louise.py", line 26, in salva_fasta
>    SeqIO.write([obj_SeqRecord], obj_SeqRecord + '.fasta','fasta')
>  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/__init__.py", line 412, in
> write
>    count = writer_class(handle).write_file(sequences)
>  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/Interfaces.py", line
> 271, in write_file
>    count = self.write_records(records)
>  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/Interfaces.py", line
> 256, in write_records
>    self.write_record(record)
>  File "/usr/lib/pymodules/python2.6/Bio/SeqIO/FastaIO.py", line 134,
> in write_record
>    self.handle.write(">%s\n" % title)
> AttributeError: 'SeqRecord' object has no attribute 'write'
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From cmccoy at fhcrc.org  Fri Jul  8 22:33:35 2011
From: cmccoy at fhcrc.org (Connor McCoy)
Date: Fri, 8 Jul 2011 15:33:35 -0700
Subject: [Biopython] seqmagick
Message-ID: <CAChfGK1_-1+FABnHS+oT_3Unja-i+uXSLv3wABpfLfMwW-5bxQ@mail.gmail.com>

Hi all,

We wrote (and use) seqmagick, a little tool to conveniently access
BioPython's Sequence I/O and manipulation capabilities from the command
line.

Seqmagick allows one to extract summary information on sequence files,
convert between formats based on file extension, modify sequences, and
much more. For example:

# Convert from fasta to stockholm
> seqmagick convert seqfile.fasta seqfile.sto

# Reverse complement the first 5 sequences in file
> seqmagick convert --reverse-complement --head 5 seqfile.fasta seqfile.rev=
comp.fasta

# Remove all columns containing > 5% gaps, in place
> seqmagick mogrify --squeeze-threshold 0.95 seqfile.fasta

For more info, see: http://fhcrc.github.com/seqmagick/

Or to install:

     pip install seqmagick

Comments / contributions welcome.

Cheers,
Connor


From mnemonico at posthocergopropterhoc.net  Mon Jul 11 06:22:10 2011
From: mnemonico at posthocergopropterhoc.net (A M Torres, Hugo)
Date: Mon, 11 Jul 2011 03:22:10 -0300
Subject: [Biopython] error writing fasta file using SeqIO
In-Reply-To: <CADEGkF5-VhP+_TsSb6FxoL32uWzuFqG5CxTN6WFvCd7hUwkOhw@mail.gmail.com>
References: <CAAVOifQE_=djoORwxsMmYNdXkiQz1jHNHo28TMEm8kMpXah87w@mail.gmail.com>
	<CADEGkF5-VhP+_TsSb6FxoL32uWzuFqG5CxTN6WFvCd7hUwkOhw@mail.gmail.com>
Message-ID: <CAAVOifQFo9m=vcfn2vva8Rp+GyY+j9i15bTiDO4xxm_YeYnVxQ@mail.gmail.com>

Hi folks.

Thanks once again for helping me out. That problem is solved. I took a look
at the glob module. It is really just neat!

A new problem has arised when I try to call the process that should run the
sequence alignment. I try to use the 'needle' subprocess but it fails with
this error: http://paste.pound-python.org/show/9395/.

Here is how the code looks now: http://paste.pound-python.org/show/9394/.

The weird thing is needle executes ok when I use needle_cline as it is in a
bash shell. I took care to write full paths when pointing to individual
files and the needle binary but that hasn't solved the error.

Any clues?

On Fri, Jul 8, 2011 at 1:46 AM, Wibowo Arindrarto <w.arindrarto at gmail.com>wrote:

> Hi Hugo,
>
> I think the problem is you tried to concatenate a SeqRecord object and a
> string object. Do this in 'salva_fasta' instead:
>
> SeqIO.write([obj_SeqRecord], obj_SeqRecord.id + '.fasta', 'fasta')
>
> And just as an additional input, in the 'processar_lote' method, you can
> use this to generate a list of absolute file name paths (import the os and
> glob module beforehand).
>
> files = [os.path.abspath(x) for x in glob.glob('*.ab1')]
>
> os.path.abspath() returns the absolute file path for a given file, and
> glob.glob() returns a list of names that matches the given pattern.
>
> Hope that helps!
> ---
> Wibowo Arindrarto (bow)
> http://bow.web.id
>
>
>
>


From gori at cs.ru.nl  Mon Jul 11 16:07:59 2011
From: gori at cs.ru.nl (Fabio Gori)
Date: Mon, 11 Jul 2011 18:07:59 +0200
Subject: [Biopython] Parsing FASTA records based on headers
Message-ID: <201107111808.00013.gori@cs.ru.nl>

Hi all,

I tried to parse a FASTA file to select the sequences whose headers satisfy a 
condition. The condition is that the first word of the header belongs to a list 
named SelectedSequencesId.
In the page http://biopython.org/wiki/SeqIO, I found this example, where the 
condition is that sequence length <300:

1 from Bio import SeqIO
2 
3 input_seq_iterator = SeqIO.parse(open("cor6_6.gb", "rU"), "genbank")
4 short_seq_iterator = (record for record in input_seq_iterator \
5                      if len(record.seq) < 300)
6 
7 output_handle = open("short_seqs.fasta", "w")
8 SeqIO.write(short_seq_iterator, output_handle, "fasta")
9 output_handle.close()

so I tried to substitute line 5 with
5 record.id.split()[0] in SelectedSequencesId)

But it did not work.
I was able to get what I wanted generating a list with all the records and 
then parsing it, but I'd like to find a solution that uses a generating 
expression.

Thanks in advance,

Fabio

-- 

F. Gori, PhD student
Intelligent Systems
ICIS (Institute for Computing and Information Sciences)
Radboud University Nijmegen

Home Page: http://www.cs.ru.nl/~gori/


From surykartka at gmail.com  Mon Jul 11 17:02:51 2011
From: surykartka at gmail.com (Dorota Matelska)
Date: Mon, 11 Jul 2011 19:02:51 +0200
Subject: [Biopython]  Parsing FASTA records based on headers
In-Reply-To: <201107111808.00013.gori@cs.ru.nl>
References: <201107111808.00013.gori@cs.ru.nl>
Message-ID: <5EECA7AF-1767-4BFB-9ECC-D8EACFCEED54@gmail.com>

Hi Fabio,

You forgot to change also the format name of your input file while using SeqIO.parse(). Your input is of fasta format, so instead of "genbank" put there "fasta", and it should work.

Hope this will help you :-)

Dorota

On Jul 11, 2011, at 6:07 PM, Fabio Gori wrote:

> Hi all,
> 
> I tried to parse a FASTA file to select the sequences whose headers satisfy a 
> condition. The condition is that the first word of the header belongs to a list 
> named SelectedSequencesId.
> In the page http://biopython.org/wiki/SeqIO, I found this example, where the 
> condition is that sequence length <300:
> 
> 1 from Bio import SeqIO
> 2 
> 3 input_seq_iterator = SeqIO.parse(open("cor6_6.gb", "rU"), "genbank")
> 4 short_seq_iterator = (record for record in input_seq_iterator \
> 5                      if len(record.seq) < 300)
> 6 
> 7 output_handle = open("short_seqs.fasta", "w")
> 8 SeqIO.write(short_seq_iterator, output_handle, "fasta")
> 9 output_handle.close()
> 
> so I tried to substitute line 5 with
> 5 record.id.split()[0] in SelectedSequencesId)
> 
> But it did not work.
> I was able to get what I wanted generating a list with all the records and 
> then parsing it, but I'd like to find a solution that uses a generating 
> expression.
> 
> Thanks in advance,
> 
> Fabio
> 
> -- 
> 
> F. Gori, PhD student
> Intelligent Systems
> ICIS (Institute for Computing and Information Sciences)
> Radboud University Nijmegen
> 
> Home Page: http://www.cs.ru.nl/~gori/
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython




From w.arindrarto at gmail.com  Mon Jul 11 17:02:36 2011
From: w.arindrarto at gmail.com (Wibowo Arindrarto)
Date: Mon, 11 Jul 2011 19:02:36 +0200
Subject: [Biopython] error writing fasta file using SeqIO
In-Reply-To: <CAAVOifQFo9m=vcfn2vva8Rp+GyY+j9i15bTiDO4xxm_YeYnVxQ@mail.gmail.com>
References: <CAAVOifQE_=djoORwxsMmYNdXkiQz1jHNHo28TMEm8kMpXah87w@mail.gmail.com>
	<CADEGkF5-VhP+_TsSb6FxoL32uWzuFqG5CxTN6WFvCd7hUwkOhw@mail.gmail.com>
	<CAAVOifQFo9m=vcfn2vva8Rp+GyY+j9i15bTiDO4xxm_YeYnVxQ@mail.gmail.com>
Message-ID: <CADEGkF5OkZB+YXLF35t03KLDH-viSScOQ3CWdahVnCyrwdwZjQ@mail.gmail.com>

Hi Hugo,

I think you should pass 'alinhar' as the argument for subprocess.call()
instead of 'needle_cline'. You can use the 'needle_cline' for the argument,
but you should also set shell to true, so the command
is subprocess.call(needle_cline, shell=True).

Hope that helps.
---
Wibowo Arindrarto (bow)
http://bow.web.id



On Mon, Jul 11, 2011 at 08:22, A M Torres, Hugo <
mnemonico at posthocergopropterhoc.net> wrote:

> Hi folks.
>
> Thanks once again for helping me out. That problem is solved. I took a look
> at the glob module. It is really just neat!
>
> A new problem has arised when I try to call the process that should run the
> sequence alignment. I try to use the 'needle' subprocess but it fails with
> this error: http://paste.pound-python.org/show/9395/.
>
> Here is how the code looks now: http://paste.pound-python.org/show/9394/.
>
> The weird thing is needle executes ok when I use needle_cline as it is in a
> bash shell. I took care to write full paths when pointing to individual
> files and the needle binary but that hasn't solved the error.
>
> Any clues?
>
>
> On Fri, Jul 8, 2011 at 1:46 AM, Wibowo Arindrarto <w.arindrarto at gmail.com>wrote:
>
>> Hi Hugo,
>>
>> I think the problem is you tried to concatenate a SeqRecord object and a
>> string object. Do this in 'salva_fasta' instead:
>>
>> SeqIO.write([obj_SeqRecord], obj_SeqRecord.id + '.fasta', 'fasta')
>>
>> And just as an additional input, in the 'processar_lote' method, you can
>> use this to generate a list of absolute file name paths (import the os and
>> glob module beforehand).
>>
>> files = [os.path.abspath(x) for x in glob.glob('*.ab1')]
>>
>> os.path.abspath() returns the absolute file path for a given file, and
>> glob.glob() returns a list of names that matches the given pattern.
>>
>> Hope that helps!
>> ---
>> Wibowo Arindrarto (bow)
>> http://bow.web.id
>>
>>
>>
>>
>


From devaniranjan at gmail.com  Mon Jul 11 19:43:56 2011
From: devaniranjan at gmail.com (George Devaniranjan)
Date: Mon, 11 Jul 2011 15:43:56 -0400
Subject: [Biopython] comparision of alignment scores
Message-ID: <CAFU65Pc-6uaZLwMZ-1LN-0ZK0vAtRt-P7B2yzfN=kDn00n5=4Q@mail.gmail.com>

I have several statistical comparison of alignment scores for a list of
proteins--generated using biopython with the use of BLOSUM and other matrix
generated by me.

All matrix methods (inc BLOSUM) correctly identies it's own sequence in a
collection of seq (high score set apart from the other scores) but I want to
see if my own matrix is better performing than the BLOSUM.
i.e --is my matrix more sensitive than BLOSUM.

Is there a way using statistics to find this out?
I know that this might not be the most appropriate forum to ask this
question but since many of you work in this area  I thought I will try.

Thank you,
George


From p.j.a.cock at googlemail.com  Mon Jul 11 19:51:09 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 11 Jul 2011 20:51:09 +0100
Subject: [Biopython] Parsing FASTA records based on headers
In-Reply-To: <201107111808.00013.gori@cs.ru.nl>
References: <201107111808.00013.gori@cs.ru.nl>
Message-ID: <CAKVJ-_4nUR+QdLc3h=2fhUppTk8s8XVgCrw9mqEGHmHSC7eDGw@mail.gmail.com>

On Mon, Jul 11, 2011 at 5:07 PM, Fabio Gori <gori at cs.ru.nl> wrote:
> Hi all,
>
> I tried to parse a FASTA file to select the sequences whose headers
> satisfy a condition.
>
> The condition is that the first word of the header belongs to a list
> named SelectedSequencesId.
>
> In the page http://biopython.org/wiki/SeqIO, I found this example, where the
> condition is that sequence length <300:
>
> ...
>
> so I tried to substitute line 5 with
> 5 record.id.split()[0] in SelectedSequencesId)

The SeqIO parse uses the first word of the ">" line as the id,
so all you need is this: record.id in SelectedSequencesId
rather than: len(record.seq) < 300

> But it did not work.

In what way? Did you also change the format to "fasta"
as Dorota pointed out?

Peter


From mnemonico at posthocergopropterhoc.net  Tue Jul 12 07:59:54 2011
From: mnemonico at posthocergopropterhoc.net (A M Torres, Hugo)
Date: Tue, 12 Jul 2011 04:59:54 -0300
Subject: [Biopython] error writing fasta file using SeqIO
In-Reply-To: <CADEGkF5OkZB+YXLF35t03KLDH-viSScOQ3CWdahVnCyrwdwZjQ@mail.gmail.com>
References: <CAAVOifQE_=djoORwxsMmYNdXkiQz1jHNHo28TMEm8kMpXah87w@mail.gmail.com>
	<CADEGkF5-VhP+_TsSb6FxoL32uWzuFqG5CxTN6WFvCd7hUwkOhw@mail.gmail.com>
	<CAAVOifQFo9m=vcfn2vva8Rp+GyY+j9i15bTiDO4xxm_YeYnVxQ@mail.gmail.com>
	<CADEGkF5OkZB+YXLF35t03KLDH-viSScOQ3CWdahVnCyrwdwZjQ@mail.gmail.com>
Message-ID: <CAAVOifQQUmkT46XK5EurQ6ZYnWAUatOCaVHu-Uq8GxKW3=Rh6g@mail.gmail.com>

Yes of course! I should've known. Thanks a bunch, this one was killing me.

On Mon, Jul 11, 2011 at 2:02 PM, Wibowo Arindrarto
<w.arindrarto at gmail.com>wrote:

> Hi Hugo,
>
> I think you should pass 'alinhar' as the argument for subprocess.call()
> instead of 'needle_cline'. You can use the 'needle_cline' for the argument,
> but you should also set shell to true, so the command
> is subprocess.call(needle_cline, shell=True).
>
> Hope that helps.
> ---
> Wibowo Arindrarto (bow)
> http://bow.web.id
>
>
>
> On Mon, Jul 11, 2011 at 08:22, A M Torres, Hugo <
> mnemonico at posthocergopropterhoc.net> wrote:
>
>> Hi folks.
>>
>> Thanks once again for helping me out. That problem is solved. I took a
>> look at the glob module. It is really just neat!
>>
>> A new problem has arised when I try to call the process that should run
>> the sequence alignment. I try to use the 'needle' subprocess but it fails
>> with this error: http://paste.pound-python.org/show/9395/.
>>
>> Here is how the code looks now: http://paste.pound-python.org/show/9394/.
>>
>> The weird thing is needle executes ok when I use needle_cline as it is in
>> a bash shell. I took care to write full paths when pointing to individual
>> files and the needle binary but that hasn't solved the error.
>>
>> Any clues?
>>
>>
>> On Fri, Jul 8, 2011 at 1:46 AM, Wibowo Arindrarto <w.arindrarto at gmail.com
>> > wrote:
>>
>>> Hi Hugo,
>>>
>>> I think the problem is you tried to concatenate a SeqRecord object and a
>>> string object. Do this in 'salva_fasta' instead:
>>>
>>> SeqIO.write([obj_SeqRecord], obj_SeqRecord.id + '.fasta', 'fasta')
>>>
>>> And just as an additional input, in the 'processar_lote' method, you can
>>> use this to generate a list of absolute file name paths (import the os and
>>> glob module beforehand).
>>>
>>> files = [os.path.abspath(x) for x in glob.glob('*.ab1')]
>>>
>>> os.path.abspath() returns the absolute file path for a given file, and
>>> glob.glob() returns a list of names that matches the given pattern.
>>>
>>> Hope that helps!
>>> ---
>>> Wibowo Arindrarto (bow)
>>> http://bow.web.id
>>>
>>>
>>>
>>>
>>
>


From lawson.jones at gmail.com  Wed Jul 13 18:40:18 2011
From: lawson.jones at gmail.com (Daniel Jones)
Date: Wed, 13 Jul 2011 14:40:18 -0400
Subject: [Biopython] clustalw align multiple sequences to reference.
Message-ID: <CAK0-BZ26e8=QKNjkxjcepsZcst0Bg7oMe-efu1bff_Y-Zg_Y+g@mail.gmail.com>

Hi Biopython users,
I have a file with many (~50,000) 200 bp sequences, each of which I would
like to align to a fixed reference sequence. I *don't* care about aligning
all 50,000 sequences with each other; I only care about aligning each one
with the reference sequence. I can't figure out a way to do this without
generating 50,000 files, which seems like ridiculous unnecessary overhead.
It seems like ClustalW's interface is quite inflexible in demanding separate
input and output files for each alignment, but I don't have much experience
using it so maybe I'm completely missing something.

Incidentally, I'm not wedded to the idea of using ClustalW, so if there's an
alternate alignment program that would make this easier, I'd certainly be
open to trying it.

Thanks,
Daniel Jones


From eric.talevich at gmail.com  Wed Jul 13 20:38:42 2011
From: eric.talevich at gmail.com (Eric Talevich)
Date: Wed, 13 Jul 2011 16:38:42 -0400
Subject: [Biopython] clustalw align multiple sequences to reference.
In-Reply-To: <CAK0-BZ26e8=QKNjkxjcepsZcst0Bg7oMe-efu1bff_Y-Zg_Y+g@mail.gmail.com>
References: <CAK0-BZ26e8=QKNjkxjcepsZcst0Bg7oMe-efu1bff_Y-Zg_Y+g@mail.gmail.com>
Message-ID: <CAMC681k=wjNkpZJMSsoR7to+HN1ooH+9x4R4Mco+HjpSX6JJ2Q@mail.gmail.com>

On Wed, Jul 13, 2011 at 2:40 PM, Daniel Jones <lawson.jones at gmail.com>wrote:

> Hi Biopython users,
> I have a file with many (~50,000) 200 bp sequences, each of which I would
> like to align to a fixed reference sequence. I *don't* care about aligning
> all 50,000 sequences with each other; I only care about aligning each one
> with the reference sequence. I can't figure out a way to do this without
> generating 50,000 files, which seems like ridiculous unnecessary overhead.
> It seems like ClustalW's interface is quite inflexible in demanding
> separate
> input and output files for each alignment, but I don't have much experience
> using it so maybe I'm completely missing something.
>
> Incidentally, I'm not wedded to the idea of using ClustalW, so if there's
> an
> alternate alignment program that would make this easier, I'd certainly be
> open to trying it.
>
>
Are these reads from sequencing? If so, then BWA or Bowtie might be what you
want:

http://bio-bwa.sourceforge.net/
http://bowtie-bio.sourceforge.net/index.shtml

If not, then you could try BLAST with your reference sequence as the query
and the short sequences as your database.

Cheers,
Eric


From p.j.a.cock at googlemail.com  Wed Jul 13 21:44:55 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 13 Jul 2011 22:44:55 +0100
Subject: [Biopython]  clustalw align multiple sequences to reference.
In-Reply-To: <CAMC681k=wjNkpZJMSsoR7to+HN1ooH+9x4R4Mco+HjpSX6JJ2Q@mail.gmail.com>
References: <CAK0-BZ26e8=QKNjkxjcepsZcst0Bg7oMe-efu1bff_Y-Zg_Y+g@mail.gmail.com>
	<CAMC681k=wjNkpZJMSsoR7to+HN1ooH+9x4R4Mco+HjpSX6JJ2Q@mail.gmail.com>
Message-ID: <CAKVJ-_4uBUNmYLt1xFoEE3saX-B7mD-mW3_3YzQKaCp7ezODaA@mail.gmail.com>

On Wednesday, July 13, 2011, Daniel Jones <lawson.jones at gmail.com> wrote:
> Hi Biopython users,
> I have a file with many (~50,000) 200 bp sequences, each of which I would
> like to align to a fixed reference sequence. I *don't* care about aligning
> all 50,000 sequences with each other; I only care about aligning each one
> with the reference sequence. I can't figure out a way to do this without
> generating 50,000 files, which seems like ridiculous unnecessary overhead.
> It seems like ClustalW's interface is quite inflexible in demanding separate
> input and output files for each alignment, but I don't have much experience
> using it so maybe I'm completely missing something.
>
> Incidentally, I'm not wedded to the idea of using ClustalW, so if there's an
> alternate alignment program that would make this easier, I'd certainly be
> open to trying it.
>
> Thanks,
> Daniel Jones

You need a pairwise alignment tool. Perhaps needle or water from the
EMBOSS suite, or Biopython's pairwise2 module would be suitable (not
in the tutorial, read the API docs).

However, as Eric suggested, an NGS alignment tool might be more appropriate.

Peter


From mnemonico at posthocergopropterhoc.net  Thu Jul 14 04:19:22 2011
From: mnemonico at posthocergopropterhoc.net (A M Torres, Hugo)
Date: Thu, 14 Jul 2011 01:19:22 -0300
Subject: [Biopython] clustalw align multiple sequences to reference.
In-Reply-To: <CAKVJ-_4uBUNmYLt1xFoEE3saX-B7mD-mW3_3YzQKaCp7ezODaA@mail.gmail.com>
References: <CAK0-BZ26e8=QKNjkxjcepsZcst0Bg7oMe-efu1bff_Y-Zg_Y+g@mail.gmail.com>
	<CAMC681k=wjNkpZJMSsoR7to+HN1ooH+9x4R4Mco+HjpSX6JJ2Q@mail.gmail.com>
	<CAKVJ-_4uBUNmYLt1xFoEE3saX-B7mD-mW3_3YzQKaCp7ezODaA@mail.gmail.com>
Message-ID: <CAAVOifQbad-PbsZ+caSxKPKdkwJNFM3ZOHAr02ubA+qb5n06kw@mail.gmail.com>

I am having the same problem. First I was running "needle" on each
sequencing data and its reference then I thought of generating a big fasta
containing all sequences and then running MUSCLE. Like Daniel Jones I don't
mind that sequences are aligned against each other but they should be
aligned properly against the reference sequence.

On a side note: I have sequenced DNA data which I need to align to a
reference sequence and look for mutations. I am confused. Should I use a
global alignment algorithm or a local alignment algorithm? I have data for
forward and reverse strands, so it could be useful if I had both aligned
with the reference in a single file.

I don't mean to hijack the thread, but this seems exactly like my problem.
Excuse me for any inconvenience.

Hugo Torres

On Wed, Jul 13, 2011 at 6:44 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Wednesday, July 13, 2011, Daniel Jones <lawson.jones at gmail.com> wrote:
> > Hi Biopython users,
> > I have a file with many (~50,000) 200 bp sequences, each of which I would
> > like to align to a fixed reference sequence. I *don't* care about
> aligning
> > all 50,000 sequences with each other; I only care about aligning each one
> > with the reference sequence. I can't figure out a way to do this without
> > generating 50,000 files, which seems like ridiculous unnecessary
> overhead.
> > It seems like ClustalW's interface is quite inflexible in demanding
> separate
> > input and output files for each alignment, but I don't have much
> experience
> > using it so maybe I'm completely missing something.
> >
> > Incidentally, I'm not wedded to the idea of using ClustalW, so if there's
> an
> > alternate alignment program that would make this easier, I'd certainly be
> > open to trying it.
> >
> > Thanks,
> > Daniel Jones
>
> You need a pairwise alignment tool. Perhaps needle or water from the
> EMBOSS suite, or Biopython's pairwise2 module would be suitable (not
> in the tutorial, read the API docs).
>
> However, as Eric suggested, an NGS alignment tool might be more
> appropriate.
>
> Peter
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From gori at cs.ru.nl  Thu Jul 14 11:21:31 2011
From: gori at cs.ru.nl (Fabio Gori)
Date: Thu, 14 Jul 2011 13:21:31 +0200
Subject: [Biopython] Parsing FASTA records based on headers
In-Reply-To: <CAKVJ-_4nUR+QdLc3h=2fhUppTk8s8XVgCrw9mqEGHmHSC7eDGw@mail.gmail.com>
References: <201107111808.00013.gori@cs.ru.nl>
	<CAKVJ-_4nUR+QdLc3h=2fhUppTk8s8XVgCrw9mqEGHmHSC7eDGw@mail.gmail.com>
Message-ID: <201107141321.31160.gori@cs.ru.nl>

The condition "if record.id in SelectedSequencesId " works fine now, thank you.

Fabio

On Monday, July 11, 2011 09:51:09 pm Peter Cock wrote:
> On Mon, Jul 11, 2011 at 5:07 PM, Fabio Gori <gori at cs.ru.nl> wrote:
> > Hi all,
> > 
> > I tried to parse a FASTA file to select the sequences whose headers
> > satisfy a condition.
> > 
> > The condition is that the first word of the header belongs to a list
> > named SelectedSequencesId.
> > 
> > In the page http://biopython.org/wiki/SeqIO, I found this example, where
> > the condition is that sequence length <300:
> > 
> > ...
> > 
> > so I tried to substitute line 5 with
> > 5 record.id.split()[0] in SelectedSequencesId)
> 
> The SeqIO parse uses the first word of the ">" line as the id,
> so all you need is this: record.id in SelectedSequencesId
> rather than: len(record.seq) < 300
> 
> > But it did not work.
> 
> In what way? Did you also change the format to "fasta"
> as Dorota pointed out?
> 
> Peter

-- 

F. Gori, PhD student
Intelligent Systems
ICIS (Institute for Computing and Information Sciences)
Radboud University Nijmegen

Post Address:
    Intelligent Systems
    Postbus 9010 
    6500 GL  Nijmegen 
    The Netherlands 
Visiting Address:
    Room HG02.517 
    Faculty of Science 
    Heyendaalseweg 135
    6525 AJ  Nijmegen 
Tel.:   +31 (0)24 36 52703
E-mail: gori at cs.ru.nl
Home Page: http://www.cs.ru.nl/~gori/


From srivastavaisha.06 at gmail.com  Fri Jul 15 07:29:42 2011
From: srivastavaisha.06 at gmail.com (isha srivastava)
Date: Fri, 15 Jul 2011 12:59:42 +0530
Subject: [Biopython] Query
Message-ID: <CAEN7hu0aWy68-VZKrmPYWomO7sB5ab7bzOunBV1AyWPYi+oiwQ@mail.gmail.com>

    Hello,

    I am new user of BioPython.
    I have Downloaded the latest version of BioPython  i.e. BioPython 1.57.
    fallowed all the instructions according to tutorial.
    but wen i am running the program :

     >>> from Bio import SeqIO
     >>> for seq_record in SeqIO.parse("ls_orchid.fasta", "fasta"):
     ...         print seq_record.id
     ...         print repr(seq_record.seq)
     ...         print len(seq_record)
     ...


    it is showing error as fallows :-

    Traceback (most recent call last):
     File "<stdin>", line 1, in <module>
     File "/usr/lib/pymodules/python2.6/Bio/SeqIO/__init__.py", line 424, in
parse
     raise TypeError("Need a file handle, not a string (i.e. not a
filename)")
    TypeError: Need a file handle, not a string (i.e. not a filename)

Sir, how to solve this error?
Kindly make a soon reply.


With due regards,
Isha


From anaryin at gmail.com  Fri Jul 15 07:44:02 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Fri, 15 Jul 2011 09:44:02 +0200
Subject: [Biopython] Query
In-Reply-To: <CAEN7hu0aWy68-VZKrmPYWomO7sB5ab7bzOunBV1AyWPYi+oiwQ@mail.gmail.com>
References: <CAEN7hu0aWy68-VZKrmPYWomO7sB5ab7bzOunBV1AyWPYi+oiwQ@mail.gmail.com>
Message-ID: <CAJ9sUYON6j=fMcQkzr-ueA_osdKmBRx84EhcH2KMQfK5mO1sbA@mail.gmail.com>

Hello Isha,

As the error message says, you should not provide the filename to the
function, but instead a file handle. In other words, you need to open the
file first and then provide this to the function.

handle = open("ls_orchid.fasta")
> for seq_record in SeqIO.parse(handle, "fasta"):
>   blablabla


Regards,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



On Fri, Jul 15, 2011 at 9:29 AM, isha srivastava <
srivastavaisha.06 at gmail.com> wrote:

>    Hello,
>
>    I am new user of BioPython.
>    I have Downloaded the latest version of BioPython  i.e. BioPython 1.57.
>    fallowed all the instructions according to tutorial.
>    but wen i am running the program :
>
>     >>> from Bio import SeqIO
>     >>> for seq_record in SeqIO.parse("ls_orchid.fasta", "fasta"):
>     ...         print seq_record.id
>     ...         print repr(seq_record.seq)
>     ...         print len(seq_record)
>     ...
>
>
>    it is showing error as fallows :-
>
>    Traceback (most recent call last):
>     File "<stdin>", line 1, in <module>
>     File "/usr/lib/pymodules/python2.6/Bio/SeqIO/__init__.py", line 424, in
> parse
>     raise TypeError("Need a file handle, not a string (i.e. not a
> filename)")
>    TypeError: Need a file handle, not a string (i.e. not a filename)
>
> Sir, how to solve this error?
> Kindly make a soon reply.
>
>
> With due regards,
> Isha
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



From p.j.a.cock at googlemail.com  Fri Jul 15 09:37:03 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 15 Jul 2011 10:37:03 +0100
Subject: [Biopython] Query
In-Reply-To: <CAEN7hu0aWy68-VZKrmPYWomO7sB5ab7bzOunBV1AyWPYi+oiwQ@mail.gmail.com>
References: <CAEN7hu0aWy68-VZKrmPYWomO7sB5ab7bzOunBV1AyWPYi+oiwQ@mail.gmail.com>
Message-ID: <CAKVJ-_72r0TWPKEH+RW1V1Nu88ymPXV5+v029Z8E6Yzc1gCQag@mail.gmail.com>

On Fri, Jul 15, 2011 at 8:29 AM, isha srivastava
<srivastavaisha.06 at gmail.com> wrote:
> ? ?Hello,
>
> ? ?I am new user of BioPython.
> ? ?I have Downloaded the latest version of BioPython ?i.e. BioPython 1.57.
> ? ?fallowed all the instructions according to tutorial.
> ? ?but wen i am running the program :
>
> ? ? >>> from Bio import SeqIO
> ? ? >>> for seq_record in SeqIO.parse("ls_orchid.fasta", "fasta"):
> ? ? ... ? ? ? ? print seq_record.id
> ? ? ... ? ? ? ? print repr(seq_record.seq)
> ? ? ... ? ? ? ? print len(seq_record)
> ? ? ...
>
>
> ? ?it is showing error as fallows :-
>
> ? ?Traceback (most recent call last):
> ? ? File "<stdin>", line 1, in <module>
> ? ? File "/usr/lib/pymodules/python2.6/Bio/SeqIO/__init__.py", line 424, in
> parse
> ? ? raise TypeError("Need a file handle, not a string (i.e. not a
> filename)")
> ? ?TypeError: Need a file handle, not a string (i.e. not a filename)
>
> Sir, how to solve this error?

That happens on older versions of Biopython - you can check
what is being used within python with:

import Bio
print Bio.__version__

My guess is your install of Biopython 1.57 hasn't worked properly,
and an older version is still being used.

Peter



From p.j.a.cock at googlemail.com  Fri Jul 15 12:48:36 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 15 Jul 2011 13:48:36 +0100
Subject: [Biopython] Query
In-Reply-To: <CAKVJ-_72r0TWPKEH+RW1V1Nu88ymPXV5+v029Z8E6Yzc1gCQag@mail.gmail.com>
References: <CAEN7hu0aWy68-VZKrmPYWomO7sB5ab7bzOunBV1AyWPYi+oiwQ@mail.gmail.com>
	<CAKVJ-_72r0TWPKEH+RW1V1Nu88ymPXV5+v029Z8E6Yzc1gCQag@mail.gmail.com>
Message-ID: <CAKVJ-_5mUzyMLNa0UiucMQaBSbnm7d5mSLra6wdLH-Ze4+eUAQ@mail.gmail.com>

On Fri, Jul 15, 2011 at 10:37 AM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
>>
>> That happens on older versions of Biopython - you can check
>> what is being used within python with:
>>
>> import Bio
>> print Bio.__version__
>>
>> My guess is your install of Biopython 1.57 hasn't worked properly,
>> and an older version is still being used.
>>
>> Peter
>>


On Fri, Jul 15, 2011 at 12:56 PM, isha srivastava
<srivastavaisha.06 at gmail.com> wrote:
> Hi Peter,
>
> you were right. i checked the version of biopython and it is showing version
> 1.53.
> how to get rid of this problem?
>
> hope for your soon reply.
>
> Thanx so much
> isha
>

Hi again,

Please CC the mailing list rather than emailing me directly with
things like this.

How was Biopython installed? What OS are you using?

Peter


From srivastavaisha.06 at gmail.com  Fri Jul 15 18:03:18 2011
From: srivastavaisha.06 at gmail.com (isha srivastava)
Date: Fri, 15 Jul 2011 23:33:18 +0530
Subject: [Biopython] Hi
Message-ID: <CAEN7hu22+jpbZG=0X1K_sd6BRCq1jVgqq7uLqrkxJQUT8Si7iw@mail.gmail.com>

Hello Peter,

I am sorry . Further i will not mail on your email directly.
I am using UBUNTU. ya I ll reinstall BioPython 1.57 again.



Regards,
Isha


From p.j.a.cock at googlemail.com  Sun Jul 17 20:19:02 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Sun, 17 Jul 2011 21:19:02 +0100
Subject: [Biopython] Hi
In-Reply-To: <CAEN7hu22+jpbZG=0X1K_sd6BRCq1jVgqq7uLqrkxJQUT8Si7iw@mail.gmail.com>
References: <CAEN7hu22+jpbZG=0X1K_sd6BRCq1jVgqq7uLqrkxJQUT8Si7iw@mail.gmail.com>
Message-ID: <CAKVJ-_6S77YAH8S3gNkgaucQ-ga=qeiFHD43zE_XS72KYyARSA@mail.gmail.com>

On Fri, Jul 15, 2011 at 7:03 PM, isha srivastava
<srivastavaisha.06 at gmail.com> wrote:
> Hello Peter,
>
> I am sorry . Further i will not mail on your email directly.

One reason I asked was I am at a conference at the moment,
so it was possible someone else might have been able to try
to help first.

The main reason is the mailing list is public, and people can
search it for solutions to this kind of problem in future.

>
> I am using UBUNTU. ya I ll reinstall BioPython 1.57 again.
>

Was Biopython 1.53 installed using the Ubuntu package system?
If so, please use the package manager to uninstall this old version
before trying to reinstall Biopython 1.57.

Peter


From malvikasharan at gmail.com  Sun Jul 17 21:53:03 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Sun, 17 Jul 2011 23:53:03 +0200
Subject: [Biopython] PSI-BLAST
Message-ID: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>

Hi All,

I am trying to code WWW version of PSI-BLAST. My intention is to integrate
PSI-Blast in my tool in order to find distant homologs.

i some how can not run the commandline version of psi blast (from
Bio.Blast.Applications import *NcbipsiblastCommandline*) as it states the
error
*" **Python* error: ImportError: *cannot* import *name
**NcbipsiblastCommandline
"*
*
*
*There are not much information available about it. Can somebody figure out
why?*
*
*
*Malvika*
*
*


From senthil.debian at gmail.com  Sun Jul 17 22:23:50 2011
From: senthil.debian at gmail.com (Senthil Kumar M)
Date: Sun, 17 Jul 2011 15:23:50 -0700
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
Message-ID: <CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>

On Sun, Jul 17, 2011 at 2:53 PM, malvika sharan <malvikasharan at gmail.com> wrote:
> Hi All,
>
> I am trying to code WWW version of PSI-BLAST. My intention is to integrate
> PSI-Blast in my tool in order to find distant homologs.
>
> i some how can not run the commandline version of psi blast (from
> Bio.Blast.Applications import *NcbipsiblastCommandline*) as it states the
> error
> *" **Python* error: ImportError: *cannot* import *name
> **NcbipsiblastCommandline
> "*
> *
> *
> *There are not much information available about it. Can somebody figure out
> why?*
> *
> *
> *Malvika*
> *
> *

Hi,

According to the Biopython tutorial
http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc93 (2 April
2011 version):

"You can run the standalone verion of PSI-BLAST (the legacy NCBI
command line tool blastpgp, or its replacement psiblast) using the
wrappers in Bio.Blast.Applications module.
At the time of writing, the NCBI do not appear to support tools
running a PSI-BLAST search via the internet."

HTH,

Senthil

-/
"You know, it's at times like this when I'm trapped in a Vogon
airlock with a man from Betelgeuse and about to die of asphyxiation in
deep space that I really wish I'd listened to what my mother told me
when I was young!"
	"Why, what did she tell you?"
	"I don't know, I didn't listen."
		-- Douglas Adams, "The Hitchhiker's Guide to the Galaxy"


From malvikasharan at gmail.com  Sun Jul 17 22:58:57 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Mon, 18 Jul 2011 00:58:57 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
Message-ID: <CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>

Thanks Senthil, but that is what i mentioned that i am trying to use
wrappers in Bio.Blast.Applications module. It just does not seem to work. I
have the whole Biopython installed and i am using Python 2.7.

the problem occurs while importing itself, i mentioned the error as well.
here is the whole error description:
Traceback (most recent call last):
    File "psiBlast.py", line 6, in <module>
        from Bio.Blast.Applications import NcbipsiblastCommandline
ImportError: cannot importname NcbipsiblastCommandline

i just cant figure out why.


On Mon, Jul 18, 2011 at 12:23 AM, Senthil Kumar M
<senthil.debian at gmail.com>wrote:

> On Sun, Jul 17, 2011 at 2:53 PM, malvika sharan <malvikasharan at gmail.com>
> wrote:
> > Hi All,
> >
> > I am trying to code WWW version of PSI-BLAST. My intention is to
> integrate
> > PSI-Blast in my tool in order to find distant homologs.
> >
> > i some how can not run the commandline version of psi blast (from
> > Bio.Blast.Applications import *NcbipsiblastCommandline*) as it states the
> > error
> > *" **Python* error: ImportError: *cannot* import *name
> > **NcbipsiblastCommandline
> > "*
> > *
> > *
> > *There are not much information available about it. Can somebody figure
> out
> > why?*
> > *
> > *
> > *Malvika*
> > *
> > *
>
> Hi,
>
> According to the Biopython tutorial
> http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc93 (2 April
> 2011 version):
>
> "You can run the standalone verion of PSI-BLAST (the legacy NCBI
> command line tool blastpgp, or its replacement psiblast) using the
> wrappers in Bio.Blast.Applications module.
> At the time of writing, the NCBI do not appear to support tools
> running a PSI-BLAST search via the internet."
>
> HTH,
>
> Senthil
>
> -/
> "You know, it's at times like this when I'm trapped in a Vogon
> airlock with a man from Betelgeuse and about to die of asphyxiation in
> deep space that I really wish I'd listened to what my mother told me
> when I was young!"
>        "Why, what did she tell you?"
>        "I don't know, I didn't listen."
>                -- Douglas Adams, "The Hitchhiker's Guide to the Galaxy"
>


From senthil.debian at gmail.com  Sun Jul 17 23:20:17 2011
From: senthil.debian at gmail.com (Senthil Kumar M)
Date: Sun, 17 Jul 2011 16:20:17 -0700
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
Message-ID: <CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>

On Sun, Jul 17, 2011 at 3:58 PM, malvika sharan <malvikasharan at gmail.com> wrote:
> Thanks Senthil, but that is what i mentioned that i am trying to use
> wrappers in Bio.Blast.Applications module. It just does not seem to work. I
> have the whole Biopython installed and i am using Python 2.7.
>
> the problem occurs while importing itself, i mentioned the error as well.
> here is the whole error description:
> Traceback (most recent call last):
> ??? File "psiBlast.py", line 6, in <module>
> ??????? from Bio.Blast.Applications import NcbipsiblastCommandline
> ImportError: cannot importname NcbipsiblastCommandline
>
> i just cant figure out why.

Hi,

Could you please provide more details such as your operating system,
python/biopython versions and a minimal example of your script?

On my system for example, 'from Bio.Blast.Applications import
NcbipsiblastCommandline' does not raise an error.

senthil at deepthought ~ $ python
Python 2.6.6 (r266:84292, Sep 15 2010, 16:22:56)
[GCC 4.4.5] on linux2
Type "help", "copyright", "credits" or "license" for more information.
>>> import Bio
>>> print Bio.__version__
1.57
>>> from Bio.Blast.Applications import NcbipsiblastCommandline
>>>

senthil at deepthought ~ $ uname -srm
Linux 2.6.35-22-generic x86_64

HTH

Senthil

-/
Time is an illusion, lunchtime doubly so.
		-- The Hitchhiker's Guide to the Galaxy



From malvikasharan at gmail.com  Sun Jul 17 23:27:33 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Mon, 18 Jul 2011 01:27:33 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
Message-ID: <CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>

My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.

And well as i said that the the error shows at the import.
import os, sys
from Bio import SeqIO
from Bio import Entrez
from Bio.Blast import NCBIWWW*
*from Bio.Blast.NCBIStandalone import PSIBlastParser
*from Bio.Blast.Applications import NcbipsiblastCommandline*
from Bio.Blast import NCBIXML

its irrelevant with my programming cos the program dies at line 6.

On Mon, Jul 18, 2011 at 1:20 AM, Senthil Kumar M
<senthil.debian at gmail.com>wrote:

> On Sun, Jul 17, 2011 at 3:58 PM, malvika sharan <malvikasharan at gmail.com>
> wrote:
> > Thanks Senthil, but that is what i mentioned that i am trying to use
> > wrappers in Bio.Blast.Applications module. It just does not seem to work.
> I
> > have the whole Biopython installed and i am using Python 2.7.
> >
> > the problem occurs while importing itself, i mentioned the error as well.
> > here is the whole error description:
> > Traceback (most recent call last):
> >     File "psiBlast.py", line 6, in <module>
> >         from Bio.Blast.Applications import NcbipsiblastCommandline
> > ImportError: cannot importname NcbipsiblastCommandline
> >
> > i just cant figure out why.
>
> Hi,
>
> Could you please provide more details such as your operating system,
> python/biopython versions and a minimal example of your script?
>
> On my system for example, 'from Bio.Blast.Applications import
> NcbipsiblastCommandline' does not raise an error.
>
> senthil at deepthought ~ $ python
> Python 2.6.6 (r266:84292, Sep 15 2010, 16:22:56)
> [GCC 4.4.5] on linux2
> Type "help", "copyright", "credits" or "license" for more information.
> >>> import Bio
> >>> print Bio.__version__
> 1.57
> >>> from Bio.Blast.Applications import NcbipsiblastCommandline
> >>>
>
> senthil at deepthought ~ $ uname -srm
> Linux 2.6.35-22-generic x86_64
>
> HTH
>
> Senthil
>
> -/
> Time is an illusion, lunchtime doubly so.
>                -- The Hitchhiker's Guide to the Galaxy
>


From malvikasharan at gmail.com  Sun Jul 17 23:48:20 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Mon, 18 Jul 2011 01:48:20 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
Message-ID: <CACCz97K_6QcbUwxXixXrcnUwz9i6s2uZ31pi63UF5MEec=dc2Q@mail.gmail.com>

please ignore the asterisk * , it appeared due to ctrl b.

On Mon, Jul 18, 2011 at 1:27 AM, malvika sharan <malvikasharan at gmail.com>wrote:

> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>
> And well as i said that the the error shows at the import.
> import os, sys
> from Bio import SeqIO
> from Bio import Entrez
> from Bio.Blast import NCBIWWW*
> *from Bio.Blast.NCBIStandalone import PSIBlastParser
>
> *from Bio.Blast.Applications import NcbipsiblastCommandline*
> from Bio.Blast import NCBIXML
>
> its irrelevant with my programming cos the program dies at line 6.
>
>
> On Mon, Jul 18, 2011 at 1:20 AM, Senthil Kumar M <senthil.debian at gmail.com
> > wrote:
>
>> On Sun, Jul 17, 2011 at 3:58 PM, malvika sharan <malvikasharan at gmail.com>
>> wrote:
>> > Thanks Senthil, but that is what i mentioned that i am trying to use
>> > wrappers in Bio.Blast.Applications module. It just does not seem to
>> work. I
>> > have the whole Biopython installed and i am using Python 2.7.
>> >
>> > the problem occurs while importing itself, i mentioned the error as
>> well.
>> > here is the whole error description:
>> > Traceback (most recent call last):
>> >     File "psiBlast.py", line 6, in <module>
>> >         from Bio.Blast.Applications import NcbipsiblastCommandline
>> > ImportError: cannot importname NcbipsiblastCommandline
>> >
>> > i just cant figure out why.
>>
>> Hi,
>>
>> Could you please provide more details such as your operating system,
>> python/biopython versions and a minimal example of your script?
>>
>> On my system for example, 'from Bio.Blast.Applications import
>> NcbipsiblastCommandline' does not raise an error.
>>
>> senthil at deepthought ~ $ python
>> Python 2.6.6 (r266:84292, Sep 15 2010, 16:22:56)
>> [GCC 4.4.5] on linux2
>> Type "help", "copyright", "credits" or "license" for more information.
>> >>> import Bio
>> >>> print Bio.__version__
>> 1.57
>> >>> from Bio.Blast.Applications import NcbipsiblastCommandline
>> >>>
>>
>> senthil at deepthought ~ $ uname -srm
>> Linux 2.6.35-22-generic x86_64
>>
>> HTH
>>
>> Senthil
>>
>> -/
>> Time is an illusion, lunchtime doubly so.
>>                -- The Hitchhiker's Guide to the Galaxy
>>
>
>


From alrakib at hotmail.com  Mon Jul 18 07:54:23 2011
From: alrakib at hotmail.com (L. Zarel)
Date: Mon, 18 Jul 2011 09:54:23 +0200
Subject: [Biopython] translating a FASTA file of CDS entries
Message-ID: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>


Good morning,

I'm Luis Zarel, from Spain. I'm a new user.

My question is: How I can make a translation into FASTA from CCDS entries? Any examples?

Thank you very much.


	   		 	   		  


From p.j.a.cock at googlemail.com  Mon Jul 18 09:14:30 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 18 Jul 2011 10:14:30 +0100
Subject: [Biopython] translating a FASTA file of CDS entries
In-Reply-To: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>
References: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>
Message-ID: <CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>

On Monday, July 18, 2011, L. Zarel <alrakib at hotmail.com> wrote:
>
> Good morning,
>
> I'm Luis Zarel, from Spain. I'm a new user.
>
> My question is: How I can make a translation into FASTA from CCDS entries? Any examples?
>
> Thank you very much.
>


Hi Luis,

Could you clarify your question? Did you mean CDS (coding sequences),
for example from GenBank files?

Peter


From alrakib at hotmail.com  Mon Jul 18 10:54:41 2011
From: alrakib at hotmail.com (L. Zarel)
Date: Mon, 18 Jul 2011 12:54:41 +0200
Subject: [Biopython] translating a FASTA file of CDS entries
In-Reply-To: <CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
References: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>,
	<CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
Message-ID: <BAY152-w18DF41D3EF4C7B930DCF5B14A0@phx.gbl>



Yes, I mean CDS

> Hi Luis,
> 
> Could you clarify your question? Did you mean CDS (coding sequences),
> for example from GenBank files?
> 
> Peter
 		 	   		  


From p.j.a.cock at googlemail.com  Mon Jul 18 12:07:37 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 18 Jul 2011 13:07:37 +0100
Subject: [Biopython] translating a FASTA file of CDS entries
In-Reply-To: <BAY152-w18DF41D3EF4C7B930DCF5B14A0@phx.gbl>
References: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>
	<CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
	<BAY152-w18DF41D3EF4C7B930DCF5B14A0@phx.gbl>
Message-ID: <CAKVJ-_7c7ZUYHLA7SPO96v5ZA1k67Eqk44RZdasemN1MNW7e6A@mail.gmail.com>

On Monday, July 18, 2011, L. Zarel <alrakib at hotmail.com> wrote:
>
> Yes, I mean CDS
>

Hi Luis,

So you have a FASTA file containing CDS nucleotide sequences,
and you want to turn this into a FASTA file containing translated
protein sequences? Have you looked at the documentation?

http://biopython.org/DIST/docs/tutorial/Tutorial.html
http://biopython.org/DIST/docs/tutorial/Tutorial.pdf

In particular, in the Cookbook chapter there is a section
"Translating a FASTA file of CDS entries".

If not, what form do you have your CDS data in? For example,
do you have an annotated GenBank file, or a tabular file of
co-ordinates and strands, or a GFF3 file, or something else?

Peter


From srivastavaisha.06 at gmail.com  Mon Jul 18 12:48:24 2011
From: srivastavaisha.06 at gmail.com (isha srivastava)
Date: Mon, 18 Jul 2011 18:18:24 +0530
Subject: [Biopython] Biopyhton 1.57 version problem
Message-ID: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>

Hello Sir / Mam

Sir , last days i asked problem about biopython 1.57 version that i have
downloaded the latest version that is 1.57 of biopython.
when i am giving the print Bio.__version__ command within the BioPython
directory this is showing correct version 1.57. But
when i am giving this command outside the biopyton directory then this is
showing biopython version 1.53.

I searched about the problem and found that my python 2.6.5 has already some
files of biopython such as ---

1)  python-biopython
1.53-1                                          Python library for
bioinformatics
2)  python-biopython-doc
1.53-1                                          Documentation for the
Biopython library
3)  python-biopython-sql
1.53-1                                          Biopython support for the
BioSQL database sc


I think the problem is because of these already existing biopython 1.53
files. Am i right?
If yes then how to get rid off this proble,?
If no then can anyone suggest me whats the problem and solution?

Kindly reply me soon.

Thanku very much.

regards
isha


From anaryin at gmail.com  Mon Jul 18 13:00:53 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Mon, 18 Jul 2011 15:00:53 +0200
Subject: [Biopython] Biopyhton 1.57 version problem
In-Reply-To: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>
References: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>
Message-ID: <CAJ9sUYOCEo6PdnCDWti2tvKoyEwzRxz4NBBCkLrTOM50k6PY_Q@mail.gmail.com>

Dear Isha,

The problem most likely is that you didn't completely remove 1.53, and your
PYTHONPATH variable is likely still pointing to it. When you start python
from the Biopython directory and import Bio, it will not load system-wide
packages but instead the one it has at hand.

I'd suggest you:

1) Do sudo aptitude remove/purge python-biopython

At this point, if you do:

cd $HOME
python
>> import Bio

It should give an ImportError. If not, there is still some version somewhere
that you need to remove.

2) Install Biopython 1.57 from the directory you downloaded, using sudo make
install and not giving any --home option during setup. This will ensure it
is installed system-wide and accessible from any python call.

Best,

Jo?o



From eric.talevich at gmail.com  Mon Jul 18 15:13:54 2011
From: eric.talevich at gmail.com (Eric Talevich)
Date: Mon, 18 Jul 2011 11:13:54 -0400
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
Message-ID: <CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>

On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <malvikasharan at gmail.com>wrote:

> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>

That's a very old version of Biopython. Are you able to install a more
recent version?


And well as i said that the the error shows at the import.
> import os, sys
> from Bio import SeqIO
> from Bio import Entrez
> from Bio.Blast import NCBIWWW*
> *from Bio.Blast.NCBIStandalone import PSIBlastParser
> *from Bio.Blast.Applications import NcbipsiblastCommandline*
> from Bio.Blast import NCBIXML
>

If the earlier imports of SeqIO and Entrez work, then
NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I would
guess.



On Mon, Jul 18, 2011 at 1:20 AM, Senthil Kumar M
> <senthil.debian at gmail.com>wrote:
>
> > On Sun, Jul 17, 2011 at 3:58 PM, malvika sharan <malvikasharan at gmail.com
> >
> > wrote:
> > > Thanks Senthil, but that is what i mentioned that i am trying to use
> > > wrappers in Bio.Blast.Applications module. It just does not seem to
> work.
> > I
> > > have the whole Biopython installed and i am using Python 2.7.
> > >
> > > the problem occurs while importing itself, i mentioned the error as
> well.
> > > here is the whole error description:
> > > Traceback (most recent call last):
> > >     File "psiBlast.py", line 6, in <module>
> > >         from Bio.Blast.Applications import NcbipsiblastCommandline
> > > ImportError: cannot importname NcbipsiblastCommandline
> > >
> > > i just cant figure out why.
> >
> > Hi,
> >
> > Could you please provide more details such as your operating system,
> > python/biopython versions and a minimal example of your script?
> >
> > On my system for example, 'from Bio.Blast.Applications import
> > NcbipsiblastCommandline' does not raise an error.
> >
> > senthil at deepthought ~ $ python
> > Python 2.6.6 (r266:84292, Sep 15 2010, 16:22:56)
> > [GCC 4.4.5] on linux2
> > Type "help", "copyright", "credits" or "license" for more information.
> > >>> import Bio
> > >>> print Bio.__version__
> > 1.57
> > >>> from Bio.Blast.Applications import NcbipsiblastCommandline
> > >>>
> >
> > senthil at deepthought ~ $ uname -srm
> > Linux 2.6.35-22-generic x86_64
> >
> > HTH
> >
> > Senthil
> >
> > -/
> > Time is an illusion, lunchtime doubly so.
> >                -- The Hitchhiker's Guide to the Galaxy
> >
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From akooser at unm.edu  Mon Jul 18 15:15:39 2011
From: akooser at unm.edu (Ara Kooser)
Date: Mon, 18 Jul 2011 09:15:39 -0600
Subject: [Biopython] NCBIWWW genbank files
In-Reply-To: <CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
References: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>
	<CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
Message-ID: <E205E214-5EEC-4FA9-A9D9-D8A864CA5484@unm.edu>

Good morning all,


   I am in the process of writing some code for pulling down files from NCBI. I wrote this based on the Biopython manual:

from Bio.Blast import NCBIWWW

def query():
    file_query = raw_input("Please enter the name of your sequence file: ")
    fasta_seq = open(file_query).read()
    result_handle = NCBIWWW.qblast("blastn","nr", fasta_seq, expect=1e-30, hitlist_size=20000)
    save_file = open("blast_results.xml","w")
    save_file.write(result_handle.read())
    save_file.close()
    result_handle.close()


query()

Everything works fine. But I was wondering is there a way to pull down the Genbank files using this method. I used the help(NCBIWWW.qblast) to look at all the options but didn't see the Genbank file format. Downstream in the program I use information extracted from both the .xml and genbank files since they contain different information to we need. I was hoping to combine everything into one program. Currently we use the web interface to pull down the xml and genbank files.

Thanks!
Ara






From srivastavaisha.06 at gmail.com  Tue Jul 19 05:34:43 2011
From: srivastavaisha.06 at gmail.com (isha srivastava)
Date: Tue, 19 Jul 2011 11:04:43 +0530
Subject: [Biopython] Biopyhton 1.57 version problem
In-Reply-To: <CAJ9sUYOCEo6PdnCDWti2tvKoyEwzRxz4NBBCkLrTOM50k6PY_Q@mail.gmail.com>
References: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>
	<CAJ9sUYOCEo6PdnCDWti2tvKoyEwzRxz4NBBCkLrTOM50k6PY_Q@mail.gmail.com>
Message-ID: <CAEN7hu01U61ORK+mkDBLBeqQkhx4kye8dmLSE8mFd1gq9KHe4A@mail.gmail.com>

Hi

Thanx for ur answer sir.
ya have already tried sudo apt-get remove python-biopython.it was worked
properly. even i removes python-biopython-doc and sql too.
Now when i m giving the command -->

>>>import Bio
>>>print Bio.__version__

this is showing error . which is good. but import Bio is still working .
which is not gd and it means biopython is not completely removed ..
thats y i m giving the fallowing command to findout all biopython named
files in my PC --

$ dpkg --list | grep 'biopython'

this command is showing no any result means there is no any biopyhton
file.If there is no any biopython directory then why ( import Bio )
is still working.

Hope for ur soon reply.

Thanx
isha


From p.j.a.cock at googlemail.com  Tue Jul 19 05:54:12 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 19 Jul 2011 06:54:12 +0100
Subject: [Biopython] NCBIWWW genbank files
In-Reply-To: <E205E214-5EEC-4FA9-A9D9-D8A864CA5484@unm.edu>
References: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>
	<CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
	<E205E214-5EEC-4FA9-A9D9-D8A864CA5484@unm.edu>
Message-ID: <CAKVJ-_7ZLJab9OXkC6NPg5sTNdt2SrkSdLaAy-oQ3UmyruQ95w@mail.gmail.com>

On Monday, July 18, 2011, Ara Kooser <akooser at unm.edu> wrote:
> Good morning all,
>
>
>  ? I am in the process of writing some code for pulling down files from NCBI. I wrote this based on the Biopython manual:
>
> from Bio.Blast import NCBIWWW
>
> def query():
>  ? ?file_query = raw_input("Please enter the name of your sequence file: ")
>  ? ?fasta_seq = open(file_query).read()
>  ? ?result_handle = NCBIWWW.qblast("blastn","nr", fasta_seq, expect=1e-30, hitlist_size=20000)
>  ? ?save_file = open("blast_results.xml","w")
>  ? ?save_file.write(result_handle.read())
>  ? ?save_file.close()
>  ? ?result_handle.close()
>
>
> query()
>
> Everything works fine. But I was wondering is there a way to pull down the Genbank files using this method. I used the help(NCBIWWW.qblast) to look at all the options but didn't see the Genbank file format. Downstream in the program I use information extracted from both the .xml and genbank files since they contain different information to we need. I was hoping to combine everything into one program. Currently we use the web interface to pull down the xml and genbank files.
>
> Thanks!
> Ara
>

Hi Ara,

BLAST does not offer GenBank as an output format.

Assuming I have understood your aim, this can be done as a multi step
process: Run BLAST, extract a list of matching record accessions,
download these records in GenBank format from the NCBI.

You may find it useful to request tabular output from BLAST and
extract the match names (column two). This should be faster as the XML
version of the data is much larger.

Also to avoid trying to download the same GenBank record more than
once, I would use a Python set rather than a Python list object when
recording this information from the BLAST file.

You can use the NCBI Entrez utilities API to download GenBank files,
see Bio.Entrez in the Biopython tutorial, function efetch.

Peter



From p.j.a.cock at googlemail.com  Tue Jul 19 06:03:44 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 19 Jul 2011 07:03:44 +0100
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
Message-ID: <CAKVJ-_4Za3PNgMHz35fUWLhw-HG6moRqhXrKNgP0_r5_bXmYaA@mail.gmail.com>

Senthil wrote:
>
> Hi,
>
> According to the Biopython tutorial
> http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc93 (2 April
> 2011 version):
>
> "You can run the standalone verion of PSI-BLAST (the legacy NCBI
> command line tool blastpgp, or its replacement psiblast) using the
> wrappers in Bio.Blast.Applications module.
> At the time of writing, the NCBI do not appear to support tools
> running a PSI-BLAST search via the internet."
>
> HTH,
>
> Senthil
>

That might be possibly after all, see this information reported
recently by F?bio Madeira:

https://github.com/biopython/biopython/pull/12

It should be possible with any recent Biopython, Fabio's
change was to the documentation for the blast function
only. We'd want to update the tutorial too ideally.

Peter



From p.j.a.cock at googlemail.com  Tue Jul 19 06:08:59 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Tue, 19 Jul 2011 07:08:59 +0100
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
Message-ID: <CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>

On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com> wrote:
> On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <malvikasharan at gmail.com>wrote:
>
>> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>>
>
> That's a very old version of Biopython. Are you able to install a more
> recent version?
>
>
> And well as i said that the the error shows at the import.
>> import os, sys
>> from Bio import SeqIO
>> from Bio import Entrez
>> from Bio.Blast import NCBIWWW*
>> *from Bio.Blast.NCBIStandalone import PSIBlastParser
>> *from Bio.Blast.Applications import NcbipsiblastCommandline*
>> from Bio.Blast import NCBIXML
>>
>
> If the earlier imports of SeqIO and Entrez work, then
> NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I would
> guess.
>

Correct. The BLAST+ wrappers were added in Biopython 1.53.
You will need to update it, ideally to the current release, 1.57

In general if some imports work and others fail, your library
Is either too old (and what you want didn't exist in the old
version), or too new (the code you want to use was obsolete
and removed).

Peter


From anaryin at gmail.com  Tue Jul 19 06:48:29 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 19 Jul 2011 08:48:29 +0200
Subject: [Biopython] Biopyhton 1.57 version problem
In-Reply-To: <CAEN7hu01U61ORK+mkDBLBeqQkhx4kye8dmLSE8mFd1gq9KHe4A@mail.gmail.com>
References: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>
	<CAJ9sUYOCEo6PdnCDWti2tvKoyEwzRxz4NBBCkLrTOM50k6PY_Q@mail.gmail.com>
	<CAEN7hu01U61ORK+mkDBLBeqQkhx4kye8dmLSE8mFd1gq9KHe4A@mail.gmail.com>
Message-ID: <CAJ9sUYO1JcXUEENJyA5K=mNgyj80hV092EdA+0Q_8+sDOChcCw@mail.gmail.com>

What error does print Bio.__version__ give?

In which directory are you executing those python commands?


From anaryin at gmail.com  Tue Jul 19 09:28:25 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 19 Jul 2011 11:28:25 +0200
Subject: [Biopython] Biopyhton 1.57 version problem
In-Reply-To: <CAEN7hu0w4Piv5XRxYGfWDd9OWgAj1_1=yPhFGEDbbDo0w-KxOg@mail.gmail.com>
References: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>
	<CAJ9sUYOCEo6PdnCDWti2tvKoyEwzRxz4NBBCkLrTOM50k6PY_Q@mail.gmail.com>
	<CAEN7hu01U61ORK+mkDBLBeqQkhx4kye8dmLSE8mFd1gq9KHe4A@mail.gmail.com>
	<CAJ9sUYO1JcXUEENJyA5K=mNgyj80hV092EdA+0Q_8+sDOChcCw@mail.gmail.com>
	<CAEN7hu0w4Piv5XRxYGfWDd9OWgAj1_1=yPhFGEDbbDo0w-KxOg@mail.gmail.com>
Message-ID: <CAJ9sUYOzNb=fC75XFqy3HRpKHcumgVNv1xN_1ONNGTRJbHEFjA@mail.gmail.com>

Hello Isha,

Where did you run the Python interpreter (i.e. in which directory were you
when you typed "python" and then "import Bio")?

Did you install the new version of Biopython correctly? Go to that
~/Downloads/python/biopython-1.57/ directory and run sudo python setup.py
install (assuming you have super user privileges).

Regards,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



On Tue, Jul 19, 2011 at 11:24 AM, isha srivastava <
srivastavaisha.06 at gmail.com> wrote:

> error is -->
>
>
> Traceback (most recent call last):
>   File "<stdin>", line 1, in <module>
> AttributeError: 'module' object has no attribute '__version__'
>
> in python directory i made a biopython directory .
>
> isha at desktop:~/Downloads/python$ ls
>
> biopython-1.57            numpy-1.6.1rc3  python.mk         Tutorial_files
> debian_defaults          ori_fasta             pyversions.py
> Tutorial.html
> egenix-mx-base-3.2.0  prog                reportlab-2.5
> fetch.py                      pyProgram.py      runtime.d
>
> isha at -desktop:~/Downloads/python$ cd biopython-1.57/
> isha at -desktop:~/Downloads/python/biopython-1.57$ ls
>
> Bio    build     DEPRECATED  LICENSE      NEWS        README   setup.py
> BioSQL    CONTRIB  Doc         MANIFEST.in  PKG-INFO  Scripts  Tests
>
>



From malvikasharan at gmail.com  Tue Jul 19 09:49:53 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Tue, 19 Jul 2011 11:49:53 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
Message-ID: <CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>

Thank you Peter and Eric.

you are right and i think i should have known this :(
I updated Biopython. and revising my codes. it should work now.

Malvika

On Tue, Jul 19, 2011 at 8:08 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com> wrote:
> > On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <malvikasharan at gmail.com
> >wrote:
> >
> >> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
> >>
> >
> > That's a very old version of Biopython. Are you able to install a more
> > recent version?
> >
> >
> > And well as i said that the the error shows at the import.
> >> import os, sys
> >> from Bio import SeqIO
> >> from Bio import Entrez
> >> from Bio.Blast import NCBIWWW*
> >> *from Bio.Blast.NCBIStandalone import PSIBlastParser
> >> *from Bio.Blast.Applications import NcbipsiblastCommandline*
> >> from Bio.Blast import NCBIXML
> >>
> >
> > If the earlier imports of SeqIO and Entrez work, then
> > NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I
> would
> > guess.
> >
>
> Correct. The BLAST+ wrappers were added in Biopython 1.53.
> You will need to update it, ideally to the current release, 1.57
>
> In general if some imports work and others fail, your library
> Is either too old (and what you want didn't exist in the old
> version), or too new (the code you want to use was obsolete
> and removed).
>
> Peter
>


From anaryin at gmail.com  Tue Jul 19 09:54:29 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Tue, 19 Jul 2011 11:54:29 +0200
Subject: [Biopython] Biopyhton 1.57 version problem
In-Reply-To: <CAEN7hu1toRxGGZPycNQpkskmSZCQi33_fKbDtCXt=pY6v3_zbw@mail.gmail.com>
References: <CAEN7hu2wAcnx+jcAXRvrNwbO5cMX_YBm_SY7cFv92aVvsc8G5Q@mail.gmail.com>
	<CAJ9sUYOCEo6PdnCDWti2tvKoyEwzRxz4NBBCkLrTOM50k6PY_Q@mail.gmail.com>
	<CAEN7hu01U61ORK+mkDBLBeqQkhx4kye8dmLSE8mFd1gq9KHe4A@mail.gmail.com>
	<CAJ9sUYO1JcXUEENJyA5K=mNgyj80hV092EdA+0Q_8+sDOChcCw@mail.gmail.com>
	<CAEN7hu0w4Piv5XRxYGfWDd9OWgAj1_1=yPhFGEDbbDo0w-KxOg@mail.gmail.com>
	<CAJ9sUYOzNb=fC75XFqy3HRpKHcumgVNv1xN_1ONNGTRJbHEFjA@mail.gmail.com>
	<CAEN7hu1toRxGGZPycNQpkskmSZCQi33_fKbDtCXt=pY6v3_zbw@mail.gmail.com>
Message-ID: <CAJ9sUYPvPaCTHyDzzyU1UmMRM_WX6LsgZj1qSjneXvDmpi4smg@mail.gmail.com>

Dear Isha,

If you run the interpreter in biopython-1.57 directory it will load the
modules from that folder, even if it is not installed in the system. You
have to do "sudo python setup.py install" in the biopython-1.57 directory,
wait for completion of the installation, and then move to another directory,
say for example your home directory or the Desktop, and there type "python"
and try "import Bio".

You don't have to remove anything..

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



On Tue, Jul 19, 2011 at 11:40 AM, isha srivastava <
srivastavaisha.06 at gmail.com> wrote:

>  Hello Sir
>
>  I run in the terminal.
>  I typed that in Python directory.
>  Now i m removing the Biopyhton -1.57 and ll again download and install
> that.
>
> Regards
> isha
>



From akooser at unm.edu  Tue Jul 19 15:07:23 2011
From: akooser at unm.edu (Ara Kooser)
Date: Tue, 19 Jul 2011 09:07:23 -0600
Subject: [Biopython] NCBIWWW genbank files
In-Reply-To: <CAKVJ-_7ZLJab9OXkC6NPg5sTNdt2SrkSdLaAy-oQ3UmyruQ95w@mail.gmail.com>
References: <BAY152-w510C3AC496D1885FAF048FB14A0@phx.gbl>
	<CAKVJ-_7LaA47JmfUUKzz82PhBfxZEyyfH9r_tSwGO=Qy+iQLiA@mail.gmail.com>
	<E205E214-5EEC-4FA9-A9D9-D8A864CA5484@unm.edu>
	<CAKVJ-_7ZLJab9OXkC6NPg5sTNdt2SrkSdLaAy-oQ3UmyruQ95w@mail.gmail.com>
Message-ID: <D5751A91-2F17-4AA7-9AC8-4920142CE78C@unm.edu>

Peter,

  Thanks for the clarification there. I was a little confused. I'll give this a try.

Regards,
Ara

On Jul 18, 2011, at 11:54 PM, Peter Cock wrote:

> On Monday, July 18, 2011, Ara Kooser <akooser at unm.edu> wrote:
>> Good morning all,
>> 
>> 
>>   I am in the process of writing some code for pulling down files from NCBI. I wrote this based on the Biopython manual:
>> 
>> from Bio.Blast import NCBIWWW
>> 
>> def query():
>>    file_query = raw_input("Please enter the name of your sequence file: ")
>>    fasta_seq = open(file_query).read()
>>    result_handle = NCBIWWW.qblast("blastn","nr", fasta_seq, expect=1e-30, hitlist_size=20000)
>>    save_file = open("blast_results.xml","w")
>>    save_file.write(result_handle.read())
>>    save_file.close()
>>    result_handle.close()
>> 
>> 
>> query()
>> 
>> Everything works fine. But I was wondering is there a way to pull down the Genbank files using this method. I used the help(NCBIWWW.qblast) to look at all the options but didn't see the Genbank file format. Downstream in the program I use information extracted from both the .xml and genbank files since they contain different information to we need. I was hoping to combine everything into one program. Currently we use the web interface to pull down the xml and genbank files.
>> 
>> Thanks!
>> Ara
>> 
> 
> Hi Ara,
> 
> BLAST does not offer GenBank as an output format.
> 
> Assuming I have understood your aim, this can be done as a multi step
> process: Run BLAST, extract a list of matching record accessions,
> download these records in GenBank format from the NCBI.
> 
> You may find it useful to request tabular output from BLAST and
> extract the match names (column two). This should be faster as the XML
> version of the data is much larger.
> 
> Also to avoid trying to download the same GenBank record more than
> once, I would use a Python set rather than a Python list object when
> recording this information from the BLAST file.
> 
> You can use the NCBI Entrez utilities API to download GenBank files,
> see Bio.Entrez in the Biopython tutorial, function efetch.
> 
> Peter




From mollymutant at googlemail.com  Wed Jul 20 13:26:33 2011
From: mollymutant at googlemail.com (molly mutant)
Date: Wed, 20 Jul 2011 15:26:33 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
Message-ID: <CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>

hello all,

I was also trying to run my program using the same wrapper from
Bio.Blast.Application for psiblast commandline.

i use the following code but this is not generating XML file.
        psi_cline = NcbipsiblastCommandline('psiblast', db =
'refseq_protein', query = queryID+".fasta", evalue =  10 , out =
queryID+"_psi.xml", outfmt = 7, out_pssm = queryID+"_pssm")
        p =
subprocess.Popen(str(psi_cline),stdout=subprocess.PIPE,stderr=subprocess.PIPE,shell=(sys.platform!="win32"))
        blastParser(p.stdout)

i have defined blastParser for parsing XML files which works perfectly with
other xml files.

i get the following error :

Traceback (most recent call last):
  File "psiBlast.py", line 110, in <module>
    blastParser(p.stdout)

  File
"/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Blast/NCBIXML.py",
line 617, in parse
    raise ValueError("Your XML file was empty")
ValueError: Your XML file was empty


you can see that i am using python 2.6 and Biopython 1.57. Do you know where
am i going incorrect?

Molly

On Wed, Jul 20, 2011 at 3:07 PM, malvika sharan <malvikasharan at gmail.com>wrote:

>
>
> ---------- Forwarded message ----------
>
>
> Thank you Peter and Eric.
>
> you are right and i think i should have known this :(
> I updated Biopython. and revising my codes. it should work now.
>
> Malvika
>
>
> On Tue, Jul 19, 2011 at 8:08 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:
>
>> On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com> wrote:
>> > On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <
>> malvikasharan at gmail.com>wrote:
>> >
>> >> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>> >>
>> >
>> > That's a very old version of Biopython. Are you able to install a more
>> > recent version?
>> >
>> >
>> > And well as i said that the the error shows at the import.
>> >> import os, sys
>> >> from Bio import SeqIO
>> >> from Bio import Entrez
>> >> from Bio.Blast import NCBIWWW*
>> >> *from Bio.Blast.NCBIStandalone import PSIBlastParser
>> >> *from Bio.Blast.Applications import NcbipsiblastCommandline*
>> >> from Bio.Blast import NCBIXML
>> >>
>> >
>> > If the earlier imports of SeqIO and Entrez work, then
>> > NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I
>> would
>> > guess.
>> >
>>
>> Correct. The BLAST+ wrappers were added in Biopython 1.53.
>> You will need to update it, ideally to the current release, 1.57
>>
>> In general if some imports work and others fail, your library
>> Is either too old (and what you want didn't exist in the old
>> version), or too new (the code you want to use was obsolete
>> and removed).
>>
>> Peter
>>
>
>
>


From mollymutant at googlemail.com  Wed Jul 20 13:33:04 2011
From: mollymutant at googlemail.com (molly mutant)
Date: Wed, 20 Jul 2011 15:33:04 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
	<CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
Message-ID: <CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>

Oh, i forgot to mention :

queryID here is a protein ID for example NP_010247.1
 ' query = queryID+".fasta" ' is a fasta file for this protein.
i want to get the XML output from the psi blast.

Regards
Molly

On Wed, Jul 20, 2011 at 3:26 PM, molly mutant <mollymutant at googlemail.com>wrote:

> hello all,
>
> I was also trying to run my program using the same wrapper from
> Bio.Blast.Application for psiblast commandline.
>
> i use the following code but this is not generating XML file.
>         psi_cline = NcbipsiblastCommandline('psiblast', db =
> 'refseq_protein', query = queryID+".fasta", evalue =  10 , out =
> queryID+"_psi.xml", outfmt = 7, out_pssm = queryID+"_pssm")
>         p =
> subprocess.Popen(str(psi_cline),stdout=subprocess.PIPE,stderr=subprocess.PIPE,shell=(sys.platform!="win32"))
>         blastParser(p.stdout)
>
> i have defined blastParser for parsing XML files which works perfectly with
> other xml files.
>
> i get the following error :
>
> Traceback (most recent call last):
>   File "psiBlast.py", line 110, in <module>
>     blastParser(p.stdout)
>
>   File
> "/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Blast/NCBIXML.py",
> line 617, in parse
>     raise ValueError("Your XML file was empty")
> ValueError: Your XML file was empty
>
>
> you can see that i am using python 2.6 and Biopython 1.57. Do you know
> where am i going incorrect?
>
> Molly
>
> On Wed, Jul 20, 2011 at 3:07 PM, malvika sharan <malvikasharan at gmail.com>wrote:
>
>
>>
>> ---------- Forwarded message ----------
>>
>>
>> Thank you Peter and Eric.
>>
>> you are right and i think i should have known this :(
>> I updated Biopython. and revising my codes. it should work now.
>>
>> Malvika
>>
>>
>> On Tue, Jul 19, 2011 at 8:08 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:
>>
>>> On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com> wrote:
>>> > On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <
>>> malvikasharan at gmail.com>wrote:
>>> >
>>> >> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>>> >>
>>> >
>>> > That's a very old version of Biopython. Are you able to install a more
>>> > recent version?
>>> >
>>> >
>>> > And well as i said that the the error shows at the import.
>>> >> import os, sys
>>> >> from Bio import SeqIO
>>> >> from Bio import Entrez
>>> >> from Bio.Blast import NCBIWWW*
>>> >> *from Bio.Blast.NCBIStandalone import PSIBlastParser
>>> >> *from Bio.Blast.Applications import NcbipsiblastCommandline*
>>> >> from Bio.Blast import NCBIXML
>>> >>
>>> >
>>> > If the earlier imports of SeqIO and Entrez work, then
>>> > NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I
>>> would
>>> > guess.
>>> >
>>>
>>> Correct. The BLAST+ wrappers were added in Biopython 1.53.
>>> You will need to update it, ideally to the current release, 1.57
>>>
>>> In general if some imports work and others fail, your library
>>> Is either too old (and what you want didn't exist in the old
>>> version), or too new (the code you want to use was obsolete
>>> and removed).
>>>
>>> Peter
>>>
>>
>>
>>
>


From mollymutant at googlemail.com  Wed Jul 20 15:30:13 2011
From: mollymutant at googlemail.com (molly mutant)
Date: Wed, 20 Jul 2011 17:30:13 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAL6BeoJbXvJy9YGXJVDE2-oNFFANR9oJY_YThNGYHO7di8mT5Q@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
	<CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
	<CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>
	<CAL6BeoJbXvJy9YGXJVDE2-oNFFANR9oJY_YThNGYHO7di8mT5Q@mail.gmail.com>
Message-ID: <CAL6BeoJnvhazEDR1-oG-FWK5fkf_woDr9OzTNfovt4_h2=F5Fg@mail.gmail.com>

Can anyone please share the functioning codes for PSI-BLAST using NCBI
commandline or suggest me the source from where i can get it?? i am in an
urgent need of it :( and i can not find the problem with my command/code.

Regards,
Molly

On Wed, Jul 20, 2011 at 4:19 PM, molly mutant <mollymutant at googlemail.com>wrote:

> if it use cline() command:
>
>         psi_cline = NcbipsiblastCommandline('psiblast', db =
> 'refseq_protein',\
>                                             query = queryID+".fasta",
> evalue =  10 , \
>                                             out = queryID+"_psi.xml",
> outfmt = 7, \
>                                             out_pssm = queryID+"_pssm")
>         str(psi_cline)
>         psi_cline()
>
> the following error occurs :
> Traceback (most recent call last):
>   File "psiBlast.py", line 113, in <module>
>     psi_cline()
>   File
> "/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Application/__init__.py",
> line 432, in __call__
>     stdout_str, stderr_str)
> Bio.Application.ApplicationError: Command 'psiblast -out NP_012649_psi.xml
> -outfmt 7 -query NP_012649.fasta -db refseq_protein -evalue 10 -out_pssm
> NP_012649_pssm' returned non-zero exit status 127, '/bin/sh: psiblast: not
> found'
>
> I think this error stands for that the command is not found, which means
> that my command is incorrect, am i right??
>
>
>
> On Wed, Jul 20, 2011 at 3:33 PM, molly mutant <mollymutant at googlemail.com>wrote:
>
>> Oh, i forgot to mention :
>>
>> queryID here is a protein ID for example NP_010247.1
>>  ' query = queryID+".fasta" ' is a fasta file for this protein.
>> i want to get the XML output from the psi blast.
>>
>> Regards
>> Molly
>>
>>
>> On Wed, Jul 20, 2011 at 3:26 PM, molly mutant <mollymutant at googlemail.com
>> > wrote:
>>
>>> hello all,
>>>
>>> I was also trying to run my program using the same wrapper from
>>> Bio.Blast.Application for psiblast commandline.
>>>
>>> i use the following code but this is not generating XML file.
>>>         psi_cline = NcbipsiblastCommandline('psiblast', db =
>>> 'refseq_protein', query = queryID+".fasta", evalue =  10 , out =
>>> queryID+"_psi.xml", outfmt = 7, out_pssm = queryID+"_pssm")
>>>         p =
>>> subprocess.Popen(str(psi_cline),stdout=subprocess.PIPE,stderr=subprocess.PIPE,shell=(sys.platform!="win32"))
>>>         blastParser(p.stdout)
>>>
>>> i have defined blastParser for parsing XML files which works perfectly
>>> with other xml files.
>>>
>>> i get the following error :
>>>
>>> Traceback (most recent call last):
>>>   File "psiBlast.py", line 110, in <module>
>>>     blastParser(p.stdout)
>>>
>>>   File
>>> "/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Blast/NCBIXML.py",
>>> line 617, in parse
>>>     raise ValueError("Your XML file was empty")
>>> ValueError: Your XML file was empty
>>>
>>>
>>> you can see that i am using python 2.6 and Biopython 1.57. Do you know
>>> where am i going incorrect?
>>>
>>> Molly
>>>
>>> On Wed, Jul 20, 2011 at 3:07 PM, malvika sharan <malvikasharan at gmail.com
>>> > wrote:
>>>
>>>
>>>>
>>>> ---------- Forwarded message ----------
>>>>
>>>>
>>>> Thank you Peter and Eric.
>>>>
>>>> you are right and i think i should have known this :(
>>>> I updated Biopython. and revising my codes. it should work now.
>>>>
>>>> Malvika
>>>>
>>>>
>>>> On Tue, Jul 19, 2011 at 8:08 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:
>>>>
>>>>> On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com>
>>>>> wrote:
>>>>> > On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <
>>>>> malvikasharan at gmail.com>wrote:
>>>>> >
>>>>> >> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>>>>> >>
>>>>> >
>>>>> > That's a very old version of Biopython. Are you able to install a
>>>>> more
>>>>> > recent version?
>>>>> >
>>>>> >
>>>>> > And well as i said that the the error shows at the import.
>>>>> >> import os, sys
>>>>> >> from Bio import SeqIO
>>>>> >> from Bio import Entrez
>>>>> >> from Bio.Blast import NCBIWWW*
>>>>> >> *from Bio.Blast.NCBIStandalone import PSIBlastParser
>>>>> >> *from Bio.Blast.Applications import NcbipsiblastCommandline*
>>>>> >> from Bio.Blast import NCBIXML
>>>>> >>
>>>>> >
>>>>> > If the earlier imports of SeqIO and Entrez work, then
>>>>> > NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I
>>>>> would
>>>>> > guess.
>>>>> >
>>>>>
>>>>> Correct. The BLAST+ wrappers were added in Biopython 1.53.
>>>>> You will need to update it, ideally to the current release, 1.57
>>>>>
>>>>> In general if some imports work and others fail, your library
>>>>> Is either too old (and what you want didn't exist in the old
>>>>> version), or too new (the code you want to use was obsolete
>>>>> and removed).
>>>>>
>>>>> Peter
>>>>>
>>>>


From from.d.putto at gmail.com  Wed Jul 20 16:22:37 2011
From: from.d.putto at gmail.com (Sheila the angel)
Date: Wed, 20 Jul 2011 18:22:37 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
Message-ID: <CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>

This method do not  work with Bio.Emboss.Applications!!!
I am trying to do the same with 'Bio.Emboss.Applications' as

seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence object
water_cline = WaterCommandline(asequence="-", bsequence="beta.fasta",
gapopen=10, gapextend=0.5, outfile="water.txt")
stdout, stderr =water_cline(stdin=seq_record.format("fasta"))

but it is displaying error.
How can I specify file handle or sequence only in  Emboss Applications???




On Thu, Jul 7, 2011 at 12:43 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 7, 2011 at 11:26 AM, Sheila the angel
> <from.d.putto at gmail.com> wrote:
> > Hi All,
> >
> > I want to download genbank file from NCBI and pass the protein sequence
> > directly to the local BLAST. But I am getting error in BLAST step
> >
> #-------------------------------------------------------------------------------------------
> > from Bio import SeqIO
> > from Bio import Entrez
> > from Bio.Blast.Applications import NcbiblastpCommandline
> > id='200203'
> > handle = Entrez.efetch(db="protein", id=id, rettype="gp")
> > seq_record = SeqIO.read(handle, "gb")
> > x=seq_record.seq                                            #getting the
> > sequence in a variable x
> > blastp_cline = NcbiblastpCommandline(query=x, db="protein_database",
> > evalue=0.001)    # My BLAST command
> > result_handle, stderr = blastp_cline()                    #Running BLAST
> and
> > getting error :(
> >
> >
> #-------------------------------------------------------------------------------------------
> >
> > At this last step I am getting error.....
> > I sort-of understand the problem.....it is taking value of x as a file
> name
> > while its a variable which contains the sequence.
> > Is there any way out to this problem without making temporary file.
>
> With the standalone blast tools you generally need to prepare an input
> FASTA file with your query sequence(s).
>
> However, in principle you can give the input filename as - (default),
> and instead pipe the query FASTA record in as stdin (standard input).
> Try something like this (untested):
>
> ...
> blastp_cline = NcbiblastpCommandline(query="-", db="protein_database",
> evalue=0.001)
> stdout, stderr = blastp_cline(stdin=seq_record.format("fasta"))
>
> Peter
>


From mollymutant at googlemail.com  Wed Jul 20 14:19:35 2011
From: mollymutant at googlemail.com (molly mutant)
Date: Wed, 20 Jul 2011 16:19:35 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
	<CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
	<CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>
Message-ID: <CAL6BeoJbXvJy9YGXJVDE2-oNFFANR9oJY_YThNGYHO7di8mT5Q@mail.gmail.com>

if it use cline() command:

        psi_cline = NcbipsiblastCommandline('psiblast', db =
'refseq_protein',\
                                            query = queryID+".fasta", evalue
=  10 , \
                                            out = queryID+"_psi.xml", outfmt
= 7, \
                                            out_pssm = queryID+"_pssm")
        str(psi_cline)
        psi_cline()

the following error occurs :
Traceback (most recent call last):
  File "psiBlast.py", line 113, in <module>
    psi_cline()
  File
"/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Application/__init__.py",
line 432, in __call__
    stdout_str, stderr_str)
Bio.Application.ApplicationError: Command 'psiblast -out NP_012649_psi.xml
-outfmt 7 -query NP_012649.fasta -db refseq_protein -evalue 10 -out_pssm
NP_012649_pssm' returned non-zero exit status 127, '/bin/sh: psiblast: not
found'

I think this error stands for that the command is not found, which means
that my command is incorrect, am i right??



On Wed, Jul 20, 2011 at 3:33 PM, molly mutant <mollymutant at googlemail.com>wrote:

> Oh, i forgot to mention :
>
> queryID here is a protein ID for example NP_010247.1
>  ' query = queryID+".fasta" ' is a fasta file for this protein.
> i want to get the XML output from the psi blast.
>
> Regards
> Molly
>
>
> On Wed, Jul 20, 2011 at 3:26 PM, molly mutant <mollymutant at googlemail.com>wrote:
>
>> hello all,
>>
>> I was also trying to run my program using the same wrapper from
>> Bio.Blast.Application for psiblast commandline.
>>
>> i use the following code but this is not generating XML file.
>>         psi_cline = NcbipsiblastCommandline('psiblast', db =
>> 'refseq_protein', query = queryID+".fasta", evalue =  10 , out =
>> queryID+"_psi.xml", outfmt = 7, out_pssm = queryID+"_pssm")
>>         p =
>> subprocess.Popen(str(psi_cline),stdout=subprocess.PIPE,stderr=subprocess.PIPE,shell=(sys.platform!="win32"))
>>         blastParser(p.stdout)
>>
>> i have defined blastParser for parsing XML files which works perfectly
>> with other xml files.
>>
>> i get the following error :
>>
>> Traceback (most recent call last):
>>   File "psiBlast.py", line 110, in <module>
>>     blastParser(p.stdout)
>>
>>   File
>> "/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Blast/NCBIXML.py",
>> line 617, in parse
>>     raise ValueError("Your XML file was empty")
>> ValueError: Your XML file was empty
>>
>>
>> you can see that i am using python 2.6 and Biopython 1.57. Do you know
>> where am i going incorrect?
>>
>> Molly
>>
>> On Wed, Jul 20, 2011 at 3:07 PM, malvika sharan <malvikasharan at gmail.com>wrote:
>>
>>
>>>
>>> ---------- Forwarded message ----------
>>>
>>>
>>> Thank you Peter and Eric.
>>>
>>> you are right and i think i should have known this :(
>>> I updated Biopython. and revising my codes. it should work now.
>>>
>>> Malvika
>>>
>>>
>>> On Tue, Jul 19, 2011 at 8:08 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:
>>>
>>>> On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com>
>>>> wrote:
>>>> > On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <
>>>> malvikasharan at gmail.com>wrote:
>>>> >
>>>> >> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
>>>> >>
>>>> >
>>>> > That's a very old version of Biopython. Are you able to install a more
>>>> > recent version?
>>>> >
>>>> >
>>>> > And well as i said that the the error shows at the import.
>>>> >> import os, sys
>>>> >> from Bio import SeqIO
>>>> >> from Bio import Entrez
>>>> >> from Bio.Blast import NCBIWWW*
>>>> >> *from Bio.Blast.NCBIStandalone import PSIBlastParser
>>>> >> *from Bio.Blast.Applications import NcbipsiblastCommandline*
>>>> >> from Bio.Blast import NCBIXML
>>>> >>
>>>> >
>>>> > If the earlier imports of SeqIO and Entrez work, then
>>>> > NcbipsiblastCommandline probably wasn't included in Biopython 1.50, I
>>>> would
>>>> > guess.
>>>> >
>>>>
>>>> Correct. The BLAST+ wrappers were added in Biopython 1.53.
>>>> You will need to update it, ideally to the current release, 1.57
>>>>
>>>> In general if some imports work and others fail, your library
>>>> Is either too old (and what you want didn't exist in the old
>>>> version), or too new (the code you want to use was obsolete
>>>> and removed).
>>>>
>>>> Peter
>>>>
>>>
>>>
>>>
>>
>
>
>


-- 
Regards,
Molly


From anaryin at gmail.com  Wed Jul 20 16:48:14 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Wed, 20 Jul 2011 18:48:14 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAL6BeoJnvhazEDR1-oG-FWK5fkf_woDr9OzTNfovt4_h2=F5Fg@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
	<CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
	<CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>
	<CAL6BeoJbXvJy9YGXJVDE2-oNFFANR9oJY_YThNGYHO7di8mT5Q@mail.gmail.com>
	<CAL6BeoJnvhazEDR1-oG-FWK5fkf_woDr9OzTNfovt4_h2=F5Fg@mail.gmail.com>
Message-ID: <CAJ9sUYMNGTabYrnSE=wobAYV-HRnM7AZJtw7MqonngyN9BuC5g@mail.gmail.com>

Dear Molly,

I never worked with that module so this might be wrong. But from my
experience, that error is common when you have aliased the executable, which
doesn't work. Try adding the directory where the executable 'psiblast' is
(usually something /bin) to your PATH variable:

export PATH="${PATH}:/my/blast/directory/bin/'

Troubleshooting and debugging are parts of coding, so I'd recommend you to
spend half an hour on this and I'm sure you'll get i through.

Best,

Jo?o [...] Rodrigues
http://nmr.chem.uu.nl/~joao



On Wed, Jul 20, 2011 at 5:30 PM, molly mutant <mollymutant at googlemail.com>wrote:

> Can anyone please share the functioning codes for PSI-BLAST using NCBI
> commandline or suggest me the source from where i can get it?? i am in an
> urgent need of it :( and i can not find the problem with my command/code.
>
> Regards,
> Molly
>
> On Wed, Jul 20, 2011 at 4:19 PM, molly mutant <mollymutant at googlemail.com
> >wrote:
>
> > if it use cline() command:
> >
> >         psi_cline = NcbipsiblastCommandline('psiblast', db =
> > 'refseq_protein',\
> >                                             query = queryID+".fasta",
> > evalue =  10 , \
> >                                             out = queryID+"_psi.xml",
> > outfmt = 7, \
> >                                             out_pssm = queryID+"_pssm")
> >         str(psi_cline)
> >         psi_cline()
> >
> > the following error occurs :
> > Traceback (most recent call last):
> >   File "psiBlast.py", line 113, in <module>
> >     psi_cline()
> >   File
> >
> "/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Application/__init__.py",
> > line 432, in __call__
> >     stdout_str, stderr_str)
> > Bio.Application.ApplicationError: Command 'psiblast -out
> NP_012649_psi.xml
> > -outfmt 7 -query NP_012649.fasta -db refseq_protein -evalue 10 -out_pssm
> > NP_012649_pssm' returned non-zero exit status 127, '/bin/sh: psiblast:
> not
> > found'
> >
> > I think this error stands for that the command is not found, which means
> > that my command is incorrect, am i right??
> >
> >
> >
> > On Wed, Jul 20, 2011 at 3:33 PM, molly mutant <
> mollymutant at googlemail.com>wrote:
> >
> >> Oh, i forgot to mention :
> >>
> >> queryID here is a protein ID for example NP_010247.1
> >>  ' query = queryID+".fasta" ' is a fasta file for this protein.
> >> i want to get the XML output from the psi blast.
> >>
> >> Regards
> >> Molly
> >>
> >>
> >> On Wed, Jul 20, 2011 at 3:26 PM, molly mutant <
> mollymutant at googlemail.com
> >> > wrote:
> >>
> >>> hello all,
> >>>
> >>> I was also trying to run my program using the same wrapper from
> >>> Bio.Blast.Application for psiblast commandline.
> >>>
> >>> i use the following code but this is not generating XML file.
> >>>         psi_cline = NcbipsiblastCommandline('psiblast', db =
> >>> 'refseq_protein', query = queryID+".fasta", evalue =  10 , out =
> >>> queryID+"_psi.xml", outfmt = 7, out_pssm = queryID+"_pssm")
> >>>         p =
> >>>
> subprocess.Popen(str(psi_cline),stdout=subprocess.PIPE,stderr=subprocess.PIPE,shell=(sys.platform!="win32"))
> >>>         blastParser(p.stdout)
> >>>
> >>> i have defined blastParser for parsing XML files which works perfectly
> >>> with other xml files.
> >>>
> >>> i get the following error :
> >>>
> >>> Traceback (most recent call last):
> >>>   File "psiBlast.py", line 110, in <module>
> >>>     blastParser(p.stdout)
> >>>
> >>>   File
> >>>
> "/usr/local/lib/python2.6/dist-packages/biopython-1.57-py2.6-linux-x86_64.egg/Bio/Blast/NCBIXML.py",
> >>> line 617, in parse
> >>>     raise ValueError("Your XML file was empty")
> >>> ValueError: Your XML file was empty
> >>>
> >>>
> >>> you can see that i am using python 2.6 and Biopython 1.57. Do you know
> >>> where am i going incorrect?
> >>>
> >>> Molly
> >>>
> >>> On Wed, Jul 20, 2011 at 3:07 PM, malvika sharan <
> malvikasharan at gmail.com
> >>> > wrote:
> >>>
> >>>
> >>>>
> >>>> ---------- Forwarded message ----------
> >>>>
> >>>>
> >>>> Thank you Peter and Eric.
> >>>>
> >>>> you are right and i think i should have known this :(
> >>>> I updated Biopython. and revising my codes. it should work now.
> >>>>
> >>>> Malvika
> >>>>
> >>>>
> >>>> On Tue, Jul 19, 2011 at 8:08 AM, Peter Cock <
> p.j.a.cock at googlemail.com>wrote:
> >>>>
> >>>>> On Monday, July 18, 2011, Eric Talevich <eric.talevich at gmail.com>
> >>>>> wrote:
> >>>>> > On Sun, Jul 17, 2011 at 7:27 PM, malvika sharan <
> >>>>> malvikasharan at gmail.com>wrote:
> >>>>> >
> >>>>> >> My OS is mac, Python is 2.7 as mentioned,Biopython 1.50.
> >>>>> >>
> >>>>> >
> >>>>> > That's a very old version of Biopython. Are you able to install a
> >>>>> more
> >>>>> > recent version?
> >>>>> >
> >>>>> >
> >>>>> > And well as i said that the the error shows at the import.
> >>>>> >> import os, sys
> >>>>> >> from Bio import SeqIO
> >>>>> >> from Bio import Entrez
> >>>>> >> from Bio.Blast import NCBIWWW*
> >>>>> >> *from Bio.Blast.NCBIStandalone import PSIBlastParser
> >>>>> >> *from Bio.Blast.Applications import NcbipsiblastCommandline*
> >>>>> >> from Bio.Blast import NCBIXML
> >>>>> >>
> >>>>> >
> >>>>> > If the earlier imports of SeqIO and Entrez work, then
> >>>>> > NcbipsiblastCommandline probably wasn't included in Biopython 1.50,
> I
> >>>>> would
> >>>>> > guess.
> >>>>> >
> >>>>>
> >>>>> Correct. The BLAST+ wrappers were added in Biopython 1.53.
> >>>>> You will need to update it, ideally to the current release, 1.57
> >>>>>
> >>>>> In general if some imports work and others fail, your library
> >>>>> Is either too old (and what you want didn't exist in the old
> >>>>> version), or too new (the code you want to use was obsolete
> >>>>> and removed).
> >>>>>
> >>>>> Peter
> >>>>>
> >>>>
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



From eric.talevich at gmail.com  Wed Jul 20 16:54:18 2011
From: eric.talevich at gmail.com (Eric Talevich)
Date: Wed, 20 Jul 2011 12:54:18 -0400
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAL6BeoJnvhazEDR1-oG-FWK5fkf_woDr9OzTNfovt4_h2=F5Fg@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
	<CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
	<CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>
	<CAL6BeoJbXvJy9YGXJVDE2-oNFFANR9oJY_YThNGYHO7di8mT5Q@mail.gmail.com>
	<CAL6BeoJnvhazEDR1-oG-FWK5fkf_woDr9OzTNfovt4_h2=F5Fg@mail.gmail.com>
Message-ID: <CAMC681nnWxRaax_F2Od0qHGWBBVT3BKNJ98xruoLw3oT=QjzXQ@mail.gmail.com>

On Wed, Jul 20, 2011 at 11:30 AM, molly mutant
<mollymutant at googlemail.com>wrote:

> Can anyone please share the functioning codes for PSI-BLAST using NCBI
> commandline or suggest me the source from where i can get it?? i am in an
> urgent need of it :( and i can not find the problem with my command/code.
>
> Regards,
> Molly
>
> On Wed, Jul 20, 2011 at 4:19 PM, molly mutant <mollymutant at googlemail.com
> >wrote:
>  > the following error occurs :
> > Bio.Application.ApplicationError: Command 'psiblast -out
> NP_012649_psi.xml
> > -outfmt 7 -query NP_012649.fasta -db refseq_protein -evalue 10 -out_pssm
> > NP_012649_pssm' returned non-zero exit status 127, '/bin/sh: psiblast:
> not
> > found'
> >
> > I think this error stands for that the command is not found, which means
> > that my command is incorrect, am i right??
>

To follow up on what Jo?o wrote, the important error is:
'/bin/sh: psiblast: not found'

Which means that psiblast is not installed correctly on your system. If you
try running just that command on the command line:
psiblast -out NP_012649_psi.xml -outfmt 7 -query NP_012649.fasta -db
refseq_protein -evalue 10 -out_pssm NP_012649_pssm

will also report an error, even without using Python.

So, try making sure psiblast is available on your system path ($PATH). The
command "which psiblast" should print where the executable is, if it can be
found.

Or, if you don't want to mess with $PATH, you can include the complete path
to the psiblast executable:
psi_cline = NcbipsiblastCommandline('/usr/local/bin/psiblast', db = ...


Cheers,
Eric



From p.j.a.cock at googlemail.com  Wed Jul 20 17:27:00 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Wed, 20 Jul 2011 18:27:00 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
Message-ID: <CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>

On Wednesday, July 20, 2011, Sheila the angel <from.d.putto at gmail.com> wrote:
> This method do not ?work with Bio.Emboss.Applications!!!I am trying to do the same with 'Bio.Emboss.Applications' as
> seq_record = SeqIO.read(open("alpha.fasta"), "fasta") ?#or a sequence object
> water_cline = WaterCommandline(asequence="-", bsequence="beta.fasta", gapopen=10, gapextend=0.5, outfile="water.txt")
> stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
> but it is displaying error.How can I specify file handle or sequence only in ?Emboss Applications???
>

What is the error message?

I think you need asequence="stdin" not "-" (although the later is a
widely used convention in command line tools). See:

http://emboss.sourceforge.net/docs/themes/UniformSequenceAddress.html#stdin

Also try including auto=True in the command line, this tells EMBOSS
not to try and ask for user input (by default it will try and prompt
the user for any missing arguments, with the auto setting it uses it's
defaults).

Peter



From anaryin at gmail.com  Wed Jul 20 16:58:37 2011
From: anaryin at gmail.com (=?UTF-8?Q?Jo=C3=A3o_Rodrigues?=)
Date: Wed, 20 Jul 2011 18:58:37 +0200
Subject: [Biopython] PSI-BLAST
In-Reply-To: <CAMC681nnWxRaax_F2Od0qHGWBBVT3BKNJ98xruoLw3oT=QjzXQ@mail.gmail.com>
References: <CACCz97JMRAcNOULX1reWDiibdFoahL028DZm3=raVbJNetJXYA@mail.gmail.com>
	<CAG+C5iuFTKAw731R9gr7Vax9e7DVvgn9j+SLSz-A=uJKf32v+w@mail.gmail.com>
	<CACCz97Jsqcua5tkn04rbx=rAGVHMzWE88pHgFcz7omvnq+QE2g@mail.gmail.com>
	<CAG+C5ivwwS=o=_MZ1UsEag4v1-9b9Eqw6_v6wKbS1ukT4j9nJQ@mail.gmail.com>
	<CACCz97+FH7PkUzGwGQW42qz-ecwR4FP9w8qqmA2VrYidnWXPgg@mail.gmail.com>
	<CAMC681kUvz5_z3UGKcHSw9n6rzg2Lr+GdyOXmyH=rG7YXcafBg@mail.gmail.com>
	<CAKVJ-_5uhsga4D0UU6ZbFTLcXJN4osexjJTvtcxRRSJf=js3Cw@mail.gmail.com>
	<CACCz97Jq2B_B367HG6Ehip-hB0Pnp1WYxXEr3v9Rr-SnqV9aYw@mail.gmail.com>
	<CACCz97LkLj9RzGKcxHwyMmBTsd6bauzJiQH13D8nrDu4GAJ_aw@mail.gmail.com>
	<CAL6BeoJD5Ugi2iKNjgEYuuHqM97ERL3aZxJ4BvPW+ZEGAhfD0Q@mail.gmail.com>
	<CAL6Beo+mOFjshtVzFNc+XiBw-oOAxL1AfUDnwAHdkmkOYtsdwg@mail.gmail.com>
	<CAL6BeoJbXvJy9YGXJVDE2-oNFFANR9oJY_YThNGYHO7di8mT5Q@mail.gmail.com>
	<CAL6BeoJnvhazEDR1-oG-FWK5fkf_woDr9OzTNfovt4_h2=F5Fg@mail.gmail.com>
	<CAMC681nnWxRaax_F2Od0qHGWBBVT3BKNJ98xruoLw3oT=QjzXQ@mail.gmail.com>
Message-ID: <CAJ9sUYNB_v-Y9VseSx4MLR-2m2uvfBQZ5z9yuzm=29vxgcvDFg@mail.gmail.com>

Adding to what Eric said, sometimes (depending on your config) *which* won't
tell you where the command is aliased to. Instead, try *locate*.


From from.d.putto at gmail.com  Thu Jul 21 09:14:06 2011
From: from.d.putto at gmail.com (Sheila the angel)
Date: Thu, 21 Jul 2011 11:14:06 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
Message-ID: <CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>

yes replacing '-' by 'stdin' works :)

seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence object
water_cline = WaterCommandline(asequence="stdin", bsequence="beta.fasta",
gapopen=10, gapextend=0.5, outfile="water.txt")
stdout, stderr =water_cline(stdin=seq_record.format("fasta"))

but I tried to replace bsequence also by 'stdin' and it shows error
#----------------------------------------------------------------------------------------------------------------------
seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence object
seq_record2 = SeqIO.read(open("beta.fasta"), "fasta")
water_cline = WaterCommandline(asequence="stdin", bsequence="stdin",
gapopen=10, gapextend=0.5, outfile="water.txt", auto=True)
stdout, stderr =water_cline(stdin=seq_record.format("fasta"),
stdin=seq_record2.format("fasta"))
#  File "<stdin>", line 1 # <the error msg.
#SyntaxError: keyword argument repeated
#----------------------------------------------------------------------------------------------------------------------





On Wed, Jul 20, 2011 at 7:27 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Wednesday, July 20, 2011, Sheila the angel <from.d.putto at gmail.com>
> wrote:
> > This method do not  work with Bio.Emboss.Applications!!!I am trying to do
> the same with 'Bio.Emboss.Applications' as
> > seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence
> object
> > water_cline = WaterCommandline(asequence="-", bsequence="beta.fasta",
> gapopen=10, gapextend=0.5, outfile="water.txt")
> > stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
> > but it is displaying error.How can I specify file handle or sequence only
> in  Emboss Applications???
> >
>
> What is the error message?
>
> I think you need asequence="stdin" not "-" (although the later is a
> widely used convention in command line tools). See:
>
> http://emboss.sourceforge.net/docs/themes/UniformSequenceAddress.html#stdin
>
> Also try including auto=True in the command line, this tells EMBOSS
> not to try and ask for user input (by default it will try and prompt
> the user for any missing arguments, with the auto setting it uses it's
> defaults).
>
> Peter
>


From p.j.a.cock at googlemail.com  Thu Jul 21 09:40:36 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 21 Jul 2011 10:40:36 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
Message-ID: <CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>

On Thu, Jul 21, 2011 at 10:14 AM, Sheila the angel
<from.d.putto at gmail.com> wrote:
> yes replacing '-' by 'stdin' works :)
>
> seq_record = SeqIO.read(open("alpha.fasta"), "fasta") ?#or a sequence object
> water_cline = WaterCommandline(asequence="stdin", bsequence="beta.fasta",
> gapopen=10, gapextend=0.5, outfile="water.txt")
> stdout, stderr =water_cline(stdin=seq_record.format("fasta"))

Good - thanks for letting us know.

I can probably make the tutorial text a little clearer here.


> but I tried to replace?bsequence also by 'stdin' and it shows error
> #----------------------------------------------------------------------------------------------------------------------
> seq_record = SeqIO.read(open("alpha.fasta"), "fasta") ?#or a sequence object
> seq_record2 = SeqIO.read(open("beta.fasta"), "fasta")
> water_cline = WaterCommandline(asequence="stdin", bsequence="stdin",
> gapopen=10, gapextend=0.5, outfile="water.txt", auto=True)

That won't work - there is only one stdin pipe in a Unix style command
line environment.
You have to use either two input files, or stdin and one file, (or one
file and stdin).

> stdout, stderr =water_cline(stdin=seq_record.format("fasta"),
> stdin=seq_record2.format("fasta"))
> # ?File "<stdin>", line 1 # <the error msg.
> #SyntaxError: keyword argument repeated

That is a python syntax error message because you tried to use the stdin
argument twice. Named Python function arguments can only be used once.

I hope that makes sense.

Peter



From from.d.putto at gmail.com  Thu Jul 21 09:48:28 2011
From: from.d.putto at gmail.com (Sheila the angel)
Date: Thu, 21 Jul 2011 11:48:28 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
Message-ID: <CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>

Thanks Peter,
Yes I understand that I can't use 'stdin' twice so this is not going to work

>>> water_cline = WaterCommandline(asequence="stdin",
bsequence="stdin",gapopen=10, gapextend=0.5, outfile="water.txt")
>>> stdout, stderr =water_cline(stdin=seq_record.format("fasta"),
stdin=seq_record2.format("fasta"))

>You have to use either two input files, or stdin and one file, (or one
>file and stdin).

But how can I specify two input files, or stdin


On Thu, Jul 21, 2011 at 11:40 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 21, 2011 at 10:14 AM, Sheila the angel
> <from.d.putto at gmail.com> wrote:
> > yes replacing '-' by 'stdin' works :)
> >
> > seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence
> object
> > water_cline = WaterCommandline(asequence="stdin", bsequence="beta.fasta",
> > gapopen=10, gapextend=0.5, outfile="water.txt")
> > stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
>
> Good - thanks for letting us know.
>
> I can probably make the tutorial text a little clearer here.
>
>
> > but I tried to replace bsequence also by 'stdin' and it shows error
> >
> #----------------------------------------------------------------------------------------------------------------------
> > seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence
> object
> > seq_record2 = SeqIO.read(open("beta.fasta"), "fasta")
> > water_cline = WaterCommandline(asequence="stdin", bsequence="stdin",
> > gapopen=10, gapextend=0.5, outfile="water.txt", auto=True)
>
> That won't work - there is only one stdin pipe in a Unix style command
> line environment.
> You have to use either two input files, or stdin and one file, (or one
> file and stdin).
>
> > stdout, stderr =water_cline(stdin=seq_record.format("fasta"),
> > stdin=seq_record2.format("fasta"))
> > #  File "<stdin>", line 1 # <the error msg.
> > #SyntaxError: keyword argument repeated
>
> That is a python syntax error message because you tried to use the stdin
> argument twice. Named Python function arguments can only be used once.
>
> I hope that makes sense.
>
> Peter
>


From p.j.a.cock at googlemail.com  Thu Jul 21 09:56:17 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 21 Jul 2011 10:56:17 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
	<CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
Message-ID: <CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>

On Thu, Jul 21, 2011 at 10:48 AM, Sheila the angel
<from.d.putto at gmail.com> wrote:
> Thanks Peter,
> Yes I understand that I can't use 'stdin' twice so this is not going to work
>
>>You have to use either two input files, or stdin and one file, (or one
>>file and stdin).
>
> But how can I specify two input files, or stdin
>

Two files is covered in the Tutorial example you originally started
with, isn't it?:

water_cline = WaterCommandline(asequence="alpha.fasta",
bsequence="beta.fasta", gapopen=10, gapextend=0.5,
outfile="water.txt")
stdout, stderr =water_cline()

You've already done stdin and file for a and b, and said that works:

seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence object
water_cline = WaterCommandline(asequence="stdin",
bsequence="beta.fasta", gapopen=10, gapextend=0.5,
outfile="water.txt")
stdout, stderr =water_cline(stdin=seq_record.format("fasta"))

Doing it the other way round with a file and stdin for a and b would be just:

seq_record = SeqIO.read(open("beta.fasta"), "fasta")  #or a sequence object
water_cline = WaterCommandline(asequence="alpha.fasta",
bsequence="stdin", gapopen=10, gapextend=0.5, outfile="water.txt")
stdout, stderr =water_cline(stdin=seq_record.format("fasta"))

Obviously if you already have the sequences in FASTA files, then just give
the filenames to the EMBOSS tool (rather than needlessly loading them into
python just to write them to stdin).

Peter


From malvikasharan at gmail.com  Thu Jul 21 15:51:35 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Thu, 21 Jul 2011 17:51:35 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
	<CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
	<CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
Message-ID: <CACCz97JSy88Wj12Dn_uRND6N=DsrngFBbdeCFtyRMJQ6Brn3dQ@mail.gmail.com>

Hi,

i have tried this tool for aligning 1 sequence ( 'aseq.fasta ') against 5
sequence present in other file ('bseq.fasta'). as expected aseq.fasta gives
pairwise alignment with every fasta sequence present in bseq.fasta.

the alignment works perfectly and saves the alignment output as well.

1> the question is if there is anyway to extraxt consensus out of all
pairwise alignments? I know its is possible with clustalw or muscle or other
alignment tool. but i do not want pairwise alignment between all the
sequence with each other. In this case Emboss seemed the better tool where i
can align all sequence only with 1 query. but the crucial part is to extract
the conserved residue from the alignment.

2> The best would be to align all the sequence together against 1 sequence
(aseq.fasta) like it happens in COBALT. and find the conserved residue
directly. but i did not find any commandline tool like that unfortunately.
It would be great if you can suggest a tool if you know any.

thank you !
Malvika



On Thu, Jul 21, 2011 at 11:56 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 21, 2011 at 10:48 AM, Sheila the angel
> <from.d.putto at gmail.com> wrote:
> > Thanks Peter,
> > Yes I understand that I can't use 'stdin' twice so this is not going to
> work
> >
> >>You have to use either two input files, or stdin and one file, (or one
> >>file and stdin).
> >
> > But how can I specify two input files, or stdin
> >
>
> Two files is covered in the Tutorial example you originally started
> with, isn't it?:
>
> water_cline = WaterCommandline(asequence="alpha.fasta",
> bsequence="beta.fasta", gapopen=10, gapextend=0.5,
> outfile="water.txt")
> stdout, stderr =water_cline()
>
> You've already done stdin and file for a and b, and said that works:
>
> seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence
> object
> water_cline = WaterCommandline(asequence="stdin",
> bsequence="beta.fasta", gapopen=10, gapextend=0.5,
> outfile="water.txt")
> stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
>
> Doing it the other way round with a file and stdin for a and b would be
> just:
>
> seq_record = SeqIO.read(open("beta.fasta"), "fasta")  #or a sequence object
> water_cline = WaterCommandline(asequence="alpha.fasta",
> bsequence="stdin", gapopen=10, gapextend=0.5, outfile="water.txt")
> stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
>
> Obviously if you already have the sequences in FASTA files, then just give
> the filenames to the EMBOSS tool (rather than needlessly loading them into
> python just to write them to stdin).
>
> Peter
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>


From p.j.a.cock at googlemail.com  Thu Jul 21 16:09:18 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 21 Jul 2011 17:09:18 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CACCz97JSy88Wj12Dn_uRND6N=DsrngFBbdeCFtyRMJQ6Brn3dQ@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
	<CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
	<CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
	<CACCz97JSy88Wj12Dn_uRND6N=DsrngFBbdeCFtyRMJQ6Brn3dQ@mail.gmail.com>
Message-ID: <CAKVJ-_7j5NoCtAzSR+m5dMf+7ernGJGGavqBAd=o6Gq8181Q7A@mail.gmail.com>

On Thu, Jul 21, 2011 at 4:51 PM, malvika sharan <malvikasharan at gmail.com> wrote:
> Hi,
>
> i have tried this tool for aligning 1 sequence ( 'aseq.fasta ') against 5
> sequence present in other file ('bseq.fasta'). as expected aseq.fasta gives
> pairwise alignment with every fasta sequence present in bseq.fasta.
>
> the alignment works perfectly and saves the alignment output as well.
>
> 1> the question is if there is anyway to extraxt consensus out of all
> pairwise alignments? I know its is possible with clustalw or muscle or other
> alignment tool. but i do not want pairwise alignment between all the
> sequence with each other. In this case Emboss seemed the better tool where i
> can align all sequence only with 1 query. but the crucial part is to extract
> the conserved residue from the alignment.
>
> 2> The best would be to align all the sequence together against 1 sequence
> (aseq.fasta) like it happens in COBALT. and find the conserved residue
> directly. but i did not find any commandline tool like that unfortunately.
> It would be great if you can suggest a tool if you know any.
>
> thank you !
> Malvika

I don't understand what you are asking for - it is hard to define a
consensus from a pairwise alignment. Could you give a short example?

Also this thread really is going off topic, perhaps a new email thread
(with a more relevant title) would be better?

Peter


From malvikasharan at gmail.com  Thu Jul 21 16:32:52 2011
From: malvikasharan at gmail.com (malvika sharan)
Date: Thu, 21 Jul 2011 18:32:52 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_7j5NoCtAzSR+m5dMf+7ernGJGGavqBAd=o6Gq8181Q7A@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
	<CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
	<CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
	<CACCz97JSy88Wj12Dn_uRND6N=DsrngFBbdeCFtyRMJQ6Brn3dQ@mail.gmail.com>
	<CAKVJ-_7j5NoCtAzSR+m5dMf+7ernGJGGavqBAd=o6Gq8181Q7A@mail.gmail.com>
Message-ID: <CACCz97LSVEqbt1tG9dEbn1L=f-FQWG8ipzP0OJ7Fy2gamYJ4_Q@mail.gmail.com>

yup sure!!

On Thu, Jul 21, 2011 at 6:09 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 21, 2011 at 4:51 PM, malvika sharan <malvikasharan at gmail.com>
> wrote:
> > Hi,
> >
> > i have tried this tool for aligning 1 sequence ( 'aseq.fasta ') against 5
> > sequence present in other file ('bseq.fasta'). as expected aseq.fasta
> gives
> > pairwise alignment with every fasta sequence present in bseq.fasta.
> >
> > the alignment works perfectly and saves the alignment output as well.
> >
> > 1> the question is if there is anyway to extraxt consensus out of all
> > pairwise alignments? I know its is possible with clustalw or muscle or
> other
> > alignment tool. but i do not want pairwise alignment between all the
> > sequence with each other. In this case Emboss seemed the better tool
> where i
> > can align all sequence only with 1 query. but the crucial part is to
> extract
> > the conserved residue from the alignment.
> >
> > 2> The best would be to align all the sequence together against 1
> sequence
> > (aseq.fasta) like it happens in COBALT. and find the conserved residue
> > directly. but i did not find any commandline tool like that
> unfortunately.
> > It would be great if you can suggest a tool if you know any.
> >
> > thank you !
> > Malvika
>
> I don't understand what you are asking for - it is hard to define a
> consensus from a pairwise alignment. Could you give a short example?
>
> Also this thread really is going off topic, perhaps a new email thread
> (with a more relevant title) would be better?
>
> Peter
>


From from.d.putto at gmail.com  Fri Jul 22 10:58:53 2011
From: from.d.putto at gmail.com (Sheila the angel)
Date: Fri, 22 Jul 2011 12:58:53 +0200
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
	<CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
	<CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
Message-ID: <CAFinXcSM2wGfHeo8jQ6WrXzt1h0PbwdWL+Lcc8irQs5JK3P4zw@mail.gmail.com>

Oh I am sorry for the line
seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence object

This was meant to show that I have a sequence record object.
In my actual problem I have open 2 different genbank files which contains
many sequence record. I want to run EMBOSS to each sequence.

from Bio import SeqIO
for seq_record in SeqIO.parse("ls_orchid.gbk", "genbank"):
  seq1=seq_record.seq
  for seq_record2 in SeqIO.parse("other_file.gbk", "genbank"): #NOTE- this
is a different genbank file
       seq2=seq_record2.seq
       EMBOSS_OUT= RUN_EMBOSS_WATER_on_seq1_and_seq2(seq1,seq2)
       #Analyse 'EMBOSS_OUT' for further analysis

One possible way to do this - - convert genbank files to fasta and then use
one file as 'beta.fasta'. But in such case I can't analysis EMBOSS result
directly. I have to wait till EMBOSS is done with all the sequences.
Another way is to create 2 temporary files temp1 and temp2 and pass them
to EMBOSS. Though it makes code little slow. (Because every time 1st you
have write sequence in temporary files and after analysis delete it)
I tried another solution.....it may be little dirty but may be useful for
someone.
#---------------------------------------------------------------------------------------
def RUN_EMBOSS_WATER_on_seq1_and_seq2 (seq1,seq2,out_file='stdout'):
water_cline = WaterCommandline()
water_cline.asequence='asis:'+str(seq1)
water_cline.bsequence='asis:'+str(seq2)
water_cline.gapopen=10
water_cline.gapextend=0.5
water_cline.outfile=out_file
stdout, stderr = water_cline()
return (stdout)
#---------------------------------------------------------------------------------------

you can call the function as

EMBOSS_OUT=RUN_EMBOSS_WATER_on_seq1_and_seq2 (seq1,seq2)

and then can do analysis with 'EMBOSS_OUT'. Here neither you have to wait
till EMBOSS is done with all the sequences nor you have to
create temporary files :)
BUT the only problem is the name of the sequence are not present in output
and it writes only
# Aligned_sequences: 2
# 1: asis
# 2: asis

So if you don't care which sequence is what then it works :)


On Thu, Jul 21, 2011 at 11:56 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 21, 2011 at 10:48 AM, Sheila the angel
> <from.d.putto at gmail.com> wrote:
> > Thanks Peter,
> > Yes I understand that I can't use 'stdin' twice so this is not going to
> work
> >
> >>You have to use either two input files, or stdin and one file, (or one
> >>file and stdin).
> >
> > But how can I specify two input files, or stdin
> >
>
> Two files is covered in the Tutorial example you originally started
> with, isn't it?:
>
> water_cline = WaterCommandline(asequence="alpha.fasta",
> bsequence="beta.fasta", gapopen=10, gapextend=0.5,
> outfile="water.txt")
> stdout, stderr =water_cline()
>
> You've already done stdin and file for a and b, and said that works:
>
> seq_record = SeqIO.read(open("alpha.fasta"), "fasta")  #or a sequence
> object
> water_cline = WaterCommandline(asequence="stdin",
> bsequence="beta.fasta", gapopen=10, gapextend=0.5,
> outfile="water.txt")
> stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
>
> Doing it the other way round with a file and stdin for a and b would be
> just:
>
> seq_record = SeqIO.read(open("beta.fasta"), "fasta")  #or a sequence object
> water_cline = WaterCommandline(asequence="alpha.fasta",
> bsequence="stdin", gapopen=10, gapextend=0.5, outfile="water.txt")
> stdout, stderr =water_cline(stdin=seq_record.format("fasta"))
>
> Obviously if you already have the sequences in FASTA files, then just give
> the filenames to the EMBOSS tool (rather than needlessly loading them into
> python just to write them to stdin).
>
> Peter
>


From p.j.a.cock at googlemail.com  Fri Jul 22 11:18:08 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Fri, 22 Jul 2011 12:18:08 +0100
Subject: [Biopython] Passing sequence to local BLAST
In-Reply-To: <CAFinXcSM2wGfHeo8jQ6WrXzt1h0PbwdWL+Lcc8irQs5JK3P4zw@mail.gmail.com>
References: <CAFinXcSW9X786GQZC+hfTb_X-PUVH4pz7XN+XUOgLRu9aKP1cA@mail.gmail.com>
	<CAKVJ-_5BY6oe548p2f39Ygj1X_b64MdUnqBpgQZzz7VWVAiq1w@mail.gmail.com>
	<CAFinXcSuy1H3TRuPnW7YHU2L6gZwZofaK7-JZe2UsptWC8EDYA@mail.gmail.com>
	<CAKVJ-_4AHr3AS3a3Q_1wvbeF2x=b9ZfupmFcLS+sPAX+wLWSVA@mail.gmail.com>
	<CAFinXcSeFYXsNNtBzZVmxmVaW5WK=UqrC7qkXpiYS+yOTSkVTw@mail.gmail.com>
	<CAKVJ-_5-hpxS+DbB=XSyDzW6v=pRLDorA3xm6-Z+G0qZn4VyUA@mail.gmail.com>
	<CAFinXcTfy6CydD19TRRNQZ0w8Ajv7EYFU87a2OW4JHY2kkp5vg@mail.gmail.com>
	<CAKVJ-_7U4bWu7W5B-iA86EoO=1kH96qmJSxzEF21-e-5AM5q_Q@mail.gmail.com>
	<CAFinXcSM2wGfHeo8jQ6WrXzt1h0PbwdWL+Lcc8irQs5JK3P4zw@mail.gmail.com>
Message-ID: <CAKVJ-_7T9ZEJt8o=oas1ZJSdENy=nP6Rm9ZEa+ZELc7cc459mQ@mail.gmail.com>

On Fri, Jul 22, 2011 at 11:58 AM, Sheila the angel
<from.d.putto at gmail.com> wrote:
> Oh I am sorry for the line
> seq_record = SeqIO.read(open("alpha.fasta"), "fasta") ?#or a sequence object
> This was meant to show that I have a sequence record object.

I understood.

> In my actual problem I have open 2 different genbank files which contains
> many sequence record. I want to run EMBOSS to each sequence.

The EMBOSS tools can read GenBank files too. Try something like this
using their Uniform Sequence Address (USA) convention,

http://emboss.sourceforge.net/docs/#Usa
http://emboss.sourceforge.net/docs/themes/UniformSequenceAddress.html

water_cline = WaterCommandline(asequence="genbank::ls_orchid.gbk",
bsequence="genbank::other_file.gbk", gapopen=10, gapextend=0.5,
outfile="water.txt", auto=True)

Alternative some (all?) of the EMBOSS tools provide an explicit
separate argument for the input file format. In this case it wasn't
very obvious as it wasn't listed in the "water --help" text, you could
use -sformat1 and -sformat2 but it looks like our needle/water
wrappers don't include them. So go with the USA approach.

Peter



From gowencm at vcu.edu  Thu Jul 28 16:28:40 2011
From: gowencm at vcu.edu (Chris Gowen)
Date: Thu, 28 Jul 2011 12:28:40 -0400
Subject: [Biopython] PWM using gapped alignments
Message-ID: <CA+Sdz8c-wbP0KkF9HK1BDsLN7kgf+xjTodJb9JDBrWMAHC52Fw@mail.gmail.com>

Hello all,

We are trying to perform pwm calculations using the Motif.pwm() function,
and many of our alignments have gaps, which raise KeyError when it tries the
key '-'. I am fairly inexperienced with this analysis technique, but from
looking at the source, it seems the error itself may be avoided by adding a
line before line 97 to skip that letter in the calculation. Would this mess
up the calculation for the pwm scores? Has anyone dealt with this problem in
a more clever way?

Thanks for any advise you can offer.

Best,
Chris Gowen


82 - <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#> def
pwm<http://biopython.org/DIST/docs/api/Bio.Motif._Motif.Motif-class.html#pwm>
(self,laplace=True):
 83 """  84 returns the PWM computed for the set of instances  85  86 if
laplace=True (default), pseudocounts equal to self.background multiplied by
self.beta are added to all positions.  87 """  88  89 if self.
_pwm_is_current:  90 return
self._pwm<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
91 #we
need to compute new pwm  92
self._pwm<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
= []  93 for i<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
in xrange <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>(
self.length<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
):  94 dict = {}  95 #filling the dict with 0's  96 for letter in self.
alphabet <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>.
letters <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>: 97
if laplace:  98 dict[letter]=self.beta*self.background[letter]  99 else: 100
dict[letter]=0.0 101 if self.has_counts: 102 #taking the raw counts 103 for
letter in self.alphabet<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
.letters <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>:
104 dict[letter]+=self.counts[letter][i<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
] 105 elif self.has_instances: 106 #counting the occurences of letters in
instances 107 for
seq<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
in self.instances: 108 #dict[seq[i]]=dict[seq[i]]+1 109
dict[seq<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
[i <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>]]+=1
110 self._pwm<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
.append <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>(
FreqTable <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>.
FreqTable <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>(
dict,FreqTable<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
.COUNT <http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>,
self.alphabet<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>
)) 111 self._pwm_is_current=1 112 return
self._pwm<http://biopython.org/DIST/docs/api/Bio.Motif._Motif-pysrc.html#>


From p.j.a.cock at googlemail.com  Thu Jul 28 16:54:40 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Thu, 28 Jul 2011 17:54:40 +0100
Subject: [Biopython] PWM using gapped alignments
In-Reply-To: <CA+Sdz8c-wbP0KkF9HK1BDsLN7kgf+xjTodJb9JDBrWMAHC52Fw@mail.gmail.com>
References: <CA+Sdz8c-wbP0KkF9HK1BDsLN7kgf+xjTodJb9JDBrWMAHC52Fw@mail.gmail.com>
Message-ID: <CAKVJ-_4DCVezggVD8bPdibrPug3i073NM9x6ck4-pQSCEqencA@mail.gmail.com>

On Thu, Jul 28, 2011 at 5:28 PM, Chris Gowen <gowencm at vcu.edu> wrote:
> Hello all,
>
> We are trying to perform pwm calculations using the Motif.pwm() function,
> and many of our alignments have gaps, which raise KeyError when it tries the
> key '-'. I am fairly inexperienced with this analysis technique, but from
> looking at the source, it seems the error itself may be avoided by adding a
> line before line 97 to skip that letter in the calculation. Would this mess
> up the calculation for the pwm scores? Has anyone dealt with this problem in
> a more clever way?
>
> Thanks for any advise you can offer.
>
> Best,
> Chris Gowen

Which alphabet are you using? My guess is you didn't have a gapped
alphabet.

As an aside, making the Seq object test this has certain appeal but
would impose a performance penalty.

Peter


From gowencm at vcu.edu  Thu Jul 28 17:14:03 2011
From: gowencm at vcu.edu (Chris Gowen)
Date: Thu, 28 Jul 2011 13:14:03 -0400
Subject: [Biopython] PWM using gapped alignments
In-Reply-To: <CAKVJ-_4DCVezggVD8bPdibrPug3i073NM9x6ck4-pQSCEqencA@mail.gmail.com>
References: <CA+Sdz8c-wbP0KkF9HK1BDsLN7kgf+xjTodJb9JDBrWMAHC52Fw@mail.gmail.com>
	<CAKVJ-_4DCVezggVD8bPdibrPug3i073NM9x6ck4-pQSCEqencA@mail.gmail.com>
Message-ID: <CA+Sdz8caGW7_q97gOpyL+=wNDyt7mSCXwWZOMhr2BTSaJOsSkA@mail.gmail.com>

Hi Peter,

Thanks for the response. We are initiating the alignments and motif as
Gapped(IUPAC.unambiguous_dna), so our letters are 'GATC-'. As far as I can
tell, there is no means for pwm() to know to skip the gaps, if that's even
the 'right' thing for it to do.

On Thu, Jul 28, 2011 at 12:54 PM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Thu, Jul 28, 2011 at 5:28 PM, Chris Gowen <gowencm at vcu.edu> wrote:
> > Hello all,
> >
> > We are trying to perform pwm calculations using the Motif.pwm() function,
> > and many of our alignments have gaps, which raise KeyError when it tries
> the
> > key '-'. I am fairly inexperienced with this analysis technique, but from
> > looking at the source, it seems the error itself may be avoided by adding
> a
> > line before line 97 to skip that letter in the calculation. Would this
> mess
> > up the calculation for the pwm scores? Has anyone dealt with this problem
> in
> > a more clever way?
> >
> > Thanks for any advise you can offer.
> >
> > Best,
> > Chris Gowen
>
> Which alphabet are you using? My guess is you didn't have a gapped
> alphabet.
>
> As an aside, making the Seq object test this has certain appeal but
> would impose a performance penalty.
>
> Peter
>