[BioPython] Sequence from Fasta

[Giovanni Marco Dall'Olio]

On Sun, Jun 29, 2008 at 4:42 PM, Stefanie Lück <lueck at ipk-gatersleben.de> wrote:

> If I try the code from page 10 in the tutorial, I get of course this:

Seq('CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAA
...', SingleLetterAlphabet())

Try with seq_record.seq.data.


> But I'm looking for something like this:
>
> Name Sequence without linebreak
>
> Example:
>
> MySequence atgcgcgctcggcgcgctcgfcgcgccccccatggctcgcgcactacagcg
> MySequence2 atgcgctctgcgcgctcgatgtagaatatgagatctctatgagatcagcatca

Bioperl's SeqIO has support for a 'tab sequence format' which is
similar to this[1].
Maybe it could be useful in the future to add support for such a
format in biopython.

[1] http://www.bioperl.org/wiki/Tab_sequence_format


>
> Regards
> Stefanie
> _______________________________________________
> BioPython mailing list  -  BioPython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>



-- 
-----------------------------------------------------------

My Blog on Bioinformatics (italian): http://bioinfoblog.it