[BioPython] blast
Stefanie Lück
lueck at ipk-gatersleben.de
Wed Jul 23 10:30:10 EDT 2008
>Peter wrote:
> Using hsp.score gives the raw score, which you are then scaling by the
> length and 100. I'm not sure offhand what you've calculated, but if
> you want the percentage identity, I think its just the number of
> identically match letters divided by the alignment length:
>
> percentage_identity = (100.0 * hsp.identities) / hsp.align_length
I tried and it dosen't work in my case. It's gives me wrong percentage.
I need to know at which % my primer match to the query part:
query --------taggcctcgcgcgcc-------
||||||||||||||||||||||||||||||
primer tagcgctataggcctcgcgcgccatatagc
Here 50 %.
More information about the BioPython
mailing list