[BioPython] blast

Stefanie Lück lueck at ipk-gatersleben.de
Wed Jul 23 10:30:10 EDT 2008


 >Peter wrote:
> Using hsp.score gives the raw score, which you are then scaling by the
> length and 100.  I'm not sure offhand what you've calculated, but if
> you want the percentage identity, I think its just the number of
> identically match letters divided by the alignment length:
> 
> percentage_identity = (100.0 * hsp.identities) / hsp.align_length


I tried and it dosen't work in my case. It's gives me wrong percentage. 

 

I need to know at which % my primer match to the query part:

 

query          --------taggcctcgcgcgcc-------

               ||||||||||||||||||||||||||||||

primer         tagcgctataggcctcgcgcgccatatagc

 

Here 50 %. 



More information about the BioPython mailing list