[BioPython] Sequence from Fasta
Giovanni Marco Dall'Olio
dalloliogm at gmail.com
Tue Jul 1 07:49:34 EDT 2008
On Tue, Jul 1, 2008 at 1:32 PM, Peter <biopython at maubp.freeserve.co.uk> wrote:
>>
>> It [BioPerl] gives an error warning for every space it encounters.
>>
>
> That isn't very nice, arguably a BioPerl limitation. However, it does
> seem best that we try and avoid writing the full description in the
> tab output. The downside is:
>
>>identifer with a long description
> acatcgatgcatgctagctactgtacgac
I am not sure, but I think it is because spaces are not allowed in the
header of standard fasta files.
Maybe a good solution would be to convert automatically all spaces to
pipes (|) in the output.
> Still - if you and Stefanie think this would be useful, I'll have a
> look at implementing it.
yes, I think it will be useful to implement.
I know of people who have written a customized fasta2tab script and
use it quite frequently, so it would be good to support such a task.
As you said before this format is commonly used in combination with
grep/gawk scripts.
>
> Peter
>
--
-----------------------------------------------------------
My Blog on Bioinformatics (italian): http://bioinfoblog.it
More information about the BioPython
mailing list