[BioPython] Sequence from Fasta

Peter biopython at maubp.freeserve.co.uk
Tue Jul 1 07:32:26 EDT 2008


>> Could you try getting BioPerl to read in a TSV file like this:
>>
>> seq1 field2 field3(tab)acatcgatgcatgctagctactgtacgac
>> seq2 with a description here(tab)ctcgctgnnacatcctagctactgta
>>
>> I personally would prefer this sort of output as it preserves all the
>> data from a FASTA input file.  On the other hand, if there are existing
>> tools which wouldn't read this then it would be a bad idea.
>
> It [BioPerl] gives an error warning for every space it encounters.
>

That isn't very nice, arguably a BioPerl limitation.  However, it does
seem best that we try and avoid writing the full description in the
tab output.  The downside is:

>identifer with a long description
acatcgatgcatgctagctactgtacgac

Would have to be saved follows to keep BioPerl happy:

identifier(tab)acatcgatgcatgctagctactgtacgac

Rather than:

identifer with a long description(tab)acatcgatgcatgctagctactgtacgac

Still - if you and Stefanie think this would be useful, I'll have a
look at implementing it.

Peter


More information about the BioPython mailing list