[BioPython] Sequence from Fasta
Peter
biopython at maubp.freeserve.co.uk
Tue Jul 1 07:32:26 EDT 2008
>> Could you try getting BioPerl to read in a TSV file like this:
>>
>> seq1 field2 field3(tab)acatcgatgcatgctagctactgtacgac
>> seq2 with a description here(tab)ctcgctgnnacatcctagctactgta
>>
>> I personally would prefer this sort of output as it preserves all the
>> data from a FASTA input file. On the other hand, if there are existing
>> tools which wouldn't read this then it would be a bad idea.
>
> It [BioPerl] gives an error warning for every space it encounters.
>
That isn't very nice, arguably a BioPerl limitation. However, it does
seem best that we try and avoid writing the full description in the
tab output. The downside is:
>identifer with a long description
acatcgatgcatgctagctactgtacgac
Would have to be saved follows to keep BioPerl happy:
identifier(tab)acatcgatgcatgctagctactgtacgac
Rather than:
identifer with a long description(tab)acatcgatgcatgctagctactgtacgac
Still - if you and Stefanie think this would be useful, I'll have a
look at implementing it.
Peter
More information about the BioPython
mailing list