[BioPython] Retrieving the raw sequence from sequence object...

Joydeep Mitra snakepit.rattlesnakes at gmail.com
Mon Mar 12 05:59:25 EDT 2007


Hi,
I'm a student of bioinformatics (coming from a biological background).

I've just started using biopython for parsing biological file formats.
The Bio.Fasta module contains the fasta iterator object, which spits out
sequence objects...of the form:

 Seq('CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAAT ...',
IUPACAmbiguousDNA())

I want to retrieve the sequence in it's entirety and in raw format....how
does one do that using an instance object?
I've tried a few things without success...will be glad if some1 could show
me how...

Thanking in advance,

Joy


More information about the BioPython mailing list