From jdiezperezj at gmail.com  Wed Aug  1 04:13:24 2007
From: jdiezperezj at gmail.com (=?ISO-8859-1?Q?Javier_D=EDez?=)
Date: Wed, 1 Aug 2007 10:13:24 +0200
Subject: [BioPython] blast output xml
In-Reply-To: <46AF51CA.2030005@maubp.freeserve.co.uk>
References: <e85a576d0707310738s1befce8ga78cb1a28dbe51fa@mail.gmail.com>
	<46AF51CA.2030005@maubp.freeserve.co.uk>
Message-ID: <e85a576d0708010113s7f11d238h7867b71570fa9151@mail.gmail.com>

Hy Peter,
I followed the tutorial cookbook steps but I got the same exception (see
below). The output I got running blast locally is not XML but text. I guess
it might be related to the version I'm using (python 2.5, biopython
1.42.2on ubuntu
7.4). Any idea?
On the other hand I think there is a mistake in the cookbook, instead of:
>>> from Bio.Blast import NCBIXML
>>> blast_records = NCBIXML.parse(result_handle)
I think it should be:
>>> blast_parser= NCBIXML.BlastParser()
>>> blast_result=blast_parser.parse(result_handle)
Thanks
Javi

Traceback (most recent call last):
  File "<stdin>", line 1, in <module>
  File "/var/lib/python-support/python2.5/Bio/Blast/NCBIXML.py", line 112,
in parse
    self._parser.parse(handler)
  File "/usr/lib/python2.5/site-packages/_xmlplus/sax/expatreader.py", line
109, in parse
    xmlreader.IncrementalParser.parse(self, source)
  File "/usr/lib/python2.5/site-packages/_xmlplus/sax/xmlreader.py", line
125, in parse
    self.close()
  File "/usr/lib/python2.5/site-packages/_xmlplus/sax/expatreader.py", line
226, in close
    self.feed("", isFinal = 1)
  File "/usr/lib/python2.5/site-packages/_xmlplus/sax/expatreader.py", line
220, in feed
    self._err_handler.fatalError(exc)
  File "/usr/lib/python2.5/site-packages/_xmlplus/sax/handler.py", line 38,
in fatalError
    raise exception
xml.sax._exceptions.SAXParseException: <fdopen>:1:0: no element found


On 7/31/07, Peter <biopython at maubp.freeserve.co.uk> wrote:
>
> Javier D?ez wrote:
> > Hi,
> > Does anyone knows if is it possible to get blast-xml output running
> blast
> > from biopython scripts?
> > How can I do that?
> > Thanks
> > Javi
>
> Yes, you can run standalone blast from Biopython, and parse its XML
> output. See "Chapter 3 BLAST" of the tutorial:
>
> http://biopython.org/DIST/docs/tutorial/Tutorial.html
>
> Note that while parsing the plain text worked well with older versions
> of BLAST. We don't recommend using this anymore - use the XML output.
>
> Peter
>


From mdehoon at c2b2.columbia.edu  Wed Aug  1 04:55:05 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Wed, 1 Aug 2007 04:55:05 -0400
Subject: [BioPython] blast output xml
References: <e85a576d0707310738s1befce8ga78cb1a28dbe51fa@mail.gmail.com><46AF51CA.2030005@maubp.freeserve.co.uk>
	<e85a576d0708010113s7f11d238h7867b71570fa9151@mail.gmail.com>
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>

Hi Javier,

> I followed the tutorial cookbook steps but I got the same exception (see
> below). The output I got running blast locally is not XML but text. I guess
> it might be related to the version I'm using (python 2.5, biopython
> 1.42.2on ubuntu 7.4). Any idea?

Use Biopython 1.43.

> On the other hand I think there is a mistake in the cookbook, instead of:
> >>> from Bio.Blast import NCBIXML
> >>> blast_records = NCBIXML.parse(result_handle)
> I think it should be:
> >>> blast_parser= NCBIXML.BlastParser()
> >>> blast_result=blast_parser.parse(result_handle)

The description in the cookbook is correct for Biopython 1.43.

As a note to the developers:
We should ask ourselves if distributing packages for various linuxes is
really a good idea. Installing Biopython isn't all that hard, and the
packages for linux tend to get behind as new Biopython versions come out,
causing confusion for our users.

--Michiel.


Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032


From biopython at maubp.freeserve.co.uk  Wed Aug  1 05:38:16 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 01 Aug 2007 10:38:16 +0100
Subject: [BioPython] blast output xml
In-Reply-To: <6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>
References: <e85a576d0707310738s1befce8ga78cb1a28dbe51fa@mail.gmail.com><46AF51CA.2030005@maubp.freeserve.co.uk>	<e85a576d0708010113s7f11d238h7867b71570fa9151@mail.gmail.com>
	<6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>
Message-ID: <46B05488.20609@maubp.freeserve.co.uk>

In Biopython 1.42, when calling standalone blast we defaulted requesting 
plain text output.

In Biopython 1.43, when calling standalone blast we default requesting 
to XML text output.

Around this time, the NCBI made a big change to how they produced XML 
output for multiple queries, and we had to change the way the NCBIXML 
library was used in Biopython 1.43 - and updated the documentation to match.

Michiel De Hoon wrote:
 >
 > The description in the cookbook is correct for Biopython 1.43.
 >

Maybe we should have added an explicit "you need Biopython 1.43 or 
later" rider on the Blast chapter?

> As a note to the developers:
> We should ask ourselves if distributing packages for various linuxes is
> really a good idea. Installing Biopython isn't all that hard, and the
> packages for linux tend to get behind as new Biopython versions come out,
> causing confusion for our users.

I think having the distributions provide (current) Biopython is great, 
as it is much simpler for new users to install it and its dependencies 
this way.  However, because of the problem of out of data packages, we 
should try and get in touch with the main distribution maintainers and 
try and bring them up to date more quickly.

Peter


From luca.beltrame at unimi.it  Wed Aug  1 05:34:36 2007
From: luca.beltrame at unimi.it (Luca Beltrame)
Date: Wed, 01 Aug 2007 11:34:36 +0200
Subject: [BioPython] blast output xml
In-Reply-To: <6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>
References: <e85a576d0707310738s1befce8ga78cb1a28dbe51fa@mail.gmail.com>
	<e85a576d0708010113s7f11d238h7867b71570fa9151@mail.gmail.com>
	<6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>
Message-ID: <200708011134.36479.luca.beltrame@unimi.it>

On Wednesday 01 August 2007 10:55:05 Michiel De Hoon wrote:

> We should ask ourselves if distributing packages for various linuxes is
> really a good idea. Installing Biopython isn't all that hard, and the

Some  (like myself) prefer to use the distribution's package management system 
which at least prevents conflicts with multiple versions and provides a 
better way to track what's installed and what's not.
So, personally I think it's a good idea to distribute packages.

-- 
Luca Beltrame, MSc. - Molecular Medicine PhD Student
Dipartimento di Scienze e Tecnologie Biomediche - UniMI
E-mail: luca dot beltrame at unimi dot it 

From sbassi at gmail.com  Wed Aug  1 13:48:33 2007
From: sbassi at gmail.com (Sebastian Bassi)
Date: Wed, 1 Aug 2007 14:48:33 -0300
Subject: [BioPython] blast output xml
In-Reply-To: <6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>
References: <e85a576d0707310738s1befce8ga78cb1a28dbe51fa@mail.gmail.com>
	<46AF51CA.2030005@maubp.freeserve.co.uk>
	<e85a576d0708010113s7f11d238h7867b71570fa9151@mail.gmail.com>
	<6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>
Message-ID: <b43bf2080708011048v76fb3fa5x31ec79ca3b2a2cf9@mail.gmail.com>

On 8/1/07, Michiel De Hoon <mdehoon at c2b2.columbia.edu> wrote:
> As a note to the developers:
> We should ask ourselves if distributing packages for various linuxes is
> really a good idea. Installing Biopython isn't all that hard, and the
> packages for linux tend to get behind as new Biopython versions come out,
> causing confusion for our users.

I think that packages should be distributed, but with a clear warning
about the benefits of installing the last version.
In some webhostings, webmasters won't let you install a tar.gz
package, but they would allow you to install a package in
Debian/Ubuntu repositories (for security reasons).
Best,
SB.

-- 
Bioinformatics news: http://www.bioinformatica.info
Lriser: http://www.linspire.com/lraiser_success.php?serial=318

From jodyhey at yahoo.com  Wed Aug  1 15:56:54 2007
From: jodyhey at yahoo.com (Emanuel Hey)
Date: Wed, 1 Aug 2007 12:56:54 -0700 (PDT)
Subject: [BioPython] accessing "data quality"  Phrap records in Genbank
Message-ID: <14649.20165.qm@web53907.mail.re2.yahoo.com>


for some sequence records, NCBI has a a record of the
Phrap scores corresponding to the sequence  (i.e. one
score for each base). 

These are typically records containing draft sequences
from genome projects

to see an example, try this link

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&qty=1&c_start=1&list_uids=153792835&uids=&dopt=qual&dispmax=5&sendto=&fmt_mask=0&from=begin&to=end&extrafeatpresent=1&ef_CDD=8&ef_MGC=16&ef_HPRD=32&ef_STS=64&ef_tRNA=128&ef_microRNA=256&ef_Exon=512


How could I go about downloading these sequence
quality scores?  

I need to filter the data by a certain score

thanks

jhey



       
____________________________________________________________________________________
Moody friends. Drama queens. Your life? Nope! - their life, your story. Play Sims Stories at Yahoo! Games.
http://sims.yahoo.com/  

From biopython at maubp.freeserve.co.uk  Wed Aug  1 17:05:33 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 01 Aug 2007 22:05:33 +0100
Subject: [BioPython] accessing "data quality"  Phrap records in Genbank
In-Reply-To: <14649.20165.qm@web53907.mail.re2.yahoo.com>
References: <14649.20165.qm@web53907.mail.re2.yahoo.com>
Message-ID: <46B0F59D.7080804@maubp.freeserve.co.uk>

Emanuel Hey wrote:
> for some sequence records, NCBI has a a record of the
> Phrap scores corresponding to the sequence  (i.e. one
> score for each base). 
> 
> These are typically records containing draft sequences
> from genome projects
> 
> to see an example, try this link
> 
> http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&qty=1&c_start=1&list_uids=153792835&uids=&dopt=qual&dispmax=5&sendto=&fmt_mask=0&from=begin&to=end&extrafeatpresent=1&ef_CDD=8&ef_MGC=16&ef_HPRD=32&ef_STS=64&ef_tRNA=128&ef_microRNA=256&ef_Exon=512
> 
> How could I go about downloading these sequence
> quality scores?  

One option for getting the data would be to construct the URL then 
download it using standard python tools, e.g. the urllib.urlretrieve 
function. Alternatively Biopython has some NCBI/Entrez code you might be 
able to use...

The second step is actually parsing the data file into a usable form. 
The "Base Quality" format looks very easy to parse, with a FASTA like 
header followed by space separated decimal scores.  Their XML format 
also looks fairly simple - the core data looks like its held as a string 
where each two characters represents one score in hex.  As far as I 
could see based on the URL you gave, none of the other format options 
actually contain the "data quality" information.

I'm not aware of any code in Biopython to cope with either of these file 
formats.

> I need to filter the data by a certain score

Are you trying to select parts of the associated sequence?

Peter


From fkauff at biologie.uni-kl.de  Thu Aug  2 03:54:24 2007
From: fkauff at biologie.uni-kl.de (Frank Kauff)
Date: Thu, 02 Aug 2007 09:54:24 +0200
Subject: [BioPython] accessing "data quality"  Phrap records in Genbank
In-Reply-To: <46B0F59D.7080804@maubp.freeserve.co.uk>
References: <14649.20165.qm@web53907.mail.re2.yahoo.com>
	<46B0F59D.7080804@maubp.freeserve.co.uk>
Message-ID: <web-40573246@uni-kl.de>


On Wed, 01 Aug 2007 22:05:33 +0100
  Peter <biopython at maubp.freeserve.co.uk> wrote:
> Emanuel Hey wrote:
>> for some sequence records, NCBI has a a record of the
>> Phrap scores corresponding to the sequence  (i.e. one
>> score for each base). 
>> 
...>
> I'm not aware of any code in Biopython to cope with 
>either of these file 
> formats.
>

Ace.py and Phd.py in Bio/Sequencing are two parsers that 
parse the phd and ace files generated by phred and phrap

Frank
  
>> I need to filter the data by a certain score
> 
> Are you trying to select parts of the associated 
>sequence?
> 
> Peter
> 
> _______________________________________________
> BioPython mailing list  -  BioPython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython

--
J-Prof. Dr. Frank Kauff
Molecular Phylogenetics
FB Biologie, 13/276
TU Kaiserslautern
Postfach 3049
67653 Kaiserslautern

Tel. +49 (0)631 205-2562
Fax. +49 (0)631 205-2998
email: fkauff at biologie.uni-kl.de
skype: frank.kauff

From jodyhey at yahoo.com  Thu Aug  2 21:20:38 2007
From: jodyhey at yahoo.com (Emanuel Hey)
Date: Thu, 2 Aug 2007 18:20:38 -0700 (PDT)
Subject: [BioPython] accessing "data quality"  Phrap records in Genbank
In-Reply-To: <46B0F59D.7080804@maubp.freeserve.co.uk>
Message-ID: <81290.42390.qm@web53907.mail.re2.yahoo.com>


Thanks.  urllib does the job quite well.

--- Peter <biopython at maubp.freeserve.co.uk> wrote:

> Emanuel Hey wrote:
> > for some sequence records, NCBI has a a record of
> the
> > Phrap scores corresponding to the sequence  (i.e.
> one
> > score for each base). 
> > 
> > These are typically records containing draft
> sequences
> > from genome projects
> > 
> > to see an example, try this link
> > 
> >
>
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&qty=1&c_start=1&list_uids=153792835&uids=&dopt=qual&dispmax=5&sendto=&fmt_mask=0&from=begin&to=end&extrafeatpresent=1&ef_CDD=8&ef_MGC=16&ef_HPRD=32&ef_STS=64&ef_tRNA=128&ef_microRNA=256&ef_Exon=512
> > 
> > How could I go about downloading these sequence
> > quality scores?  
> 
> One option for getting the data would be to
> construct the URL then 
> download it using standard python tools, e.g. the
> urllib.urlretrieve 
> function. Alternatively Biopython has some
> NCBI/Entrez code you might be 
> able to use...
> 
> The second step is actually parsing the data file
> into a usable form. 
> The "Base Quality" format looks very easy to parse,
> with a FASTA like 
> header followed by space separated decimal scores. 
> Their XML format 
> also looks fairly simple - the core data looks like
> its held as a string 
> where each two characters represents one score in
> hex.  As far as I 
> could see based on the URL you gave, none of the
> other format options 
> actually contain the "data quality" information.
> 
> I'm not aware of any code in Biopython to cope with
> either of these file 
> formats.
> 
> > I need to filter the data by a certain score
> 
> Are you trying to select parts of the associated
> sequence?
> 
> Peter
> 
> 



       
____________________________________________________________________________________
Be a better Globetrotter. Get better travel answers from someone who knows. Yahoo! Answers - Check it out.
http://answers.yahoo.com/dir/?link=list&sid=396545469

From letondal at pasteur.Fr  Fri Aug  3 04:55:12 2007
From: letondal at pasteur.Fr (Catherine Letondal)
Date: Fri, 3 Aug 2007 10:55:12 +0200
Subject: [BioPython] Course in informatics for biology 2008 at Institut
	Pasteur
Message-ID: <575EDD34-F5C4-4DF4-97FF-CCC1E4219A01@pasteur.Fr>

Hi,

    
************************************************************************ 
*
      Course in informatics for biology 2008 at Institut Pasteur
         http://www.pasteur.fr/formation/infobio-en.html
    
************************************************************************ 
*

      In the series of courses offered at the Pasteur Institute, a  
course
will be offered in informatics in biology. The next session will take
place from January to end of April 2008.

      The main goal of this course is to provide researchers in biology
an initial exposure to informatics. Admitance in the course is reserved
for those with a degree in biology or a related discipline.

      With more and more bioinformatics tools available, it becomes
increasingly important for researchers in biology to be able both to
manage their data, implement their ideas, and judge for themselves the
usefulness of new algorithms and software.

      This course will emphasize fundamental aspects of computer science
and apply them to biological examples. Theoretical aspects (algorithm
development, logic, problem modeling and design methods), and technical
applications (databases and web technologies) that are relevant for
biologists will be thoroughly discussed.

      Programming is presented through the object-oriented paradigm,
using a modern high-level language, Python, provided with tools for
biology and enabling both prototyping or scripting and the building of
important software systems. Learning of an additional language (C) will
be available for interested students.

      Learning during the course will be reinforced with computing
exercises, and effective training will be provided by a 2 month research
project.

      The working language of the course is French.

For further information, please consult:

      http://www.pasteur.fr/formation/infobio-en.html

   *** Registration will be closed on October 1 2007. ***

Sincerely,


--
Benno Schwikowski & Catherine Letondal
Institut Pasteur -- Course in Informatics for Biology
www.pasteur.fr/formation/infobio


From sbassi at gmail.com  Tue Aug 14 12:45:26 2007
From: sbassi at gmail.com (Sebastian Bassi)
Date: Tue, 14 Aug 2007 13:45:26 -0300
Subject: [BioPython] Inverse codon table?
Message-ID: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>

I am looking for a table in Biopython of amino-acids and its codons. I
found in Data.CodonTable a table but it should be used in the inverse
way I need:

>>> from Bio.Data import CodonTable
>>> t=CodonTable.standard_dna_table
>>> t.forward_table["ATG"]
'M'

I need a table that I coulld enter "M" and get the all triples that
translate into "M". Is this available in Biopyhon?


-- 
Bioinformatics news: http://www.bioinformatica.info
Lriser: http://www.linspire.com/lraiser_success.php?serial=318

From sbassi at gmail.com  Tue Aug 14 13:38:01 2007
From: sbassi at gmail.com (Sebastian Bassi)
Date: Tue, 14 Aug 2007 14:38:01 -0300
Subject: [BioPython] Inverse codon table?
In-Reply-To: <46C1E3AB.1000100@maubp.freeserve.co.uk>
References: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
	<46C1E3AB.1000100@maubp.freeserve.co.uk>
Message-ID: <b43bf2080708141038g429c95b5pb9e9e64331955aa6@mail.gmail.com>

On 8/14/07, Peter <biopython at maubp.freeserve.co.uk> wrote:
> I'm not sure without a thorough check, but its fairly be trivial to
> build such a dictionary from the CodonTable.standard_dna_table like this:
...

Thnaks.
That is nicer than my hand made back trans dictionary:

tdict={"A":("GCT","GCC","GCA","GCG"),"R":("CGT","CGC","CGA","CGG","AGA","AGG"),\
       "N":("AAT","ACC"),"D":("GAT","GAC"),"C":("TGT","TGC"),"Q":("CAA","CAG"),\
       "E":("GAA","GAG"),"G":("GGT","GGC","GGA","GGG"),"H":("CAT","CAC"),\
       "I":("ATT","ATC","ATA"),"L":("TTA","TTG","CTT","CTC","CTA","CTG"),\
       "K":("AAA","AAG"),"M":("AUG"),"F":("TTT","TTC"),"P":\
       ("CCT","CCC","CCA","CCG"),"S":("TCT","TCC","TCA","TCG","AGT","AGC"),\
       "T":("ACT","ACC","ACA","ACG"),"W":("TGG"),"Y":("TAT","TAC"),\
       "V":("GTT","GTC","GTA","GTG")}

And yours is better since allows to construct a back dict using
another translation table.

Best,
SB.

-- 
Bioinformatics news: http://www.bioinformatica.info
Lriser: http://www.linspire.com/lraiser_success.php?serial=318

From biopython at maubp.freeserve.co.uk  Tue Aug 14 13:17:31 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 14 Aug 2007 18:17:31 +0100
Subject: [BioPython] Inverse codon table?
In-Reply-To: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
References: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
Message-ID: <46C1E3AB.1000100@maubp.freeserve.co.uk>

Sebastian Bassi wrote:
> I am looking for a table in Biopython of amino-acids and its codons. I
> found in Data.CodonTable a table but it should be used in the inverse
> way I need:
> 
>>>> from Bio.Data import CodonTable
>>>> t=CodonTable.standard_dna_table
>>>> t.forward_table["ATG"]
> 'M'
> 
> I need a table that I coulld enter "M" and get the all triples that
> translate into "M". Is this available in Biopyhon?
> 

I'm not sure without a thorough check, but its fairly be trivial to 
build such a dictionary from the CodonTable.standard_dna_table like this:

from Bio.Data import CodonTable
t=CodonTable.standard_dna_table
t.forward_table["ATG"]

#Build a back table dict where the values are lists of codons...
bt = dict()
for a1 in "ATCG" :
     for a2 in "ATCG" :
         for a3 in "ATCG" :
             codon = a1+a2+a3
             try :
                 amino = t.forward_table[codon]
             except KeyError :
                 assert codon in t.stop_codons
                 continue
             try :
                 bt[amino].append(codon)
             except KeyError :
                 bt[amino] = [codon]

for amino in bt :
     print amino, bt[amino]


Peter




From p.pagel at gsf.de  Tue Aug 14 14:08:18 2007
From: p.pagel at gsf.de (Philipp Pagel)
Date: Tue, 14 Aug 2007 20:08:18 +0200
Subject: [BioPython] Inverse codon table?
In-Reply-To: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
References: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
Message-ID: <20070814180817.GA3154@gsf.de>


	Hi!

> I need a table that I coulld enter "M" and get the all triples that
> translate into "M". Is this available in Biopyhon?

Hm - I'm not sure but it's easy enough to make one yourself:

>>> foo = {}
>>> for codon, AA in t.forward_table.items():
...     if AA not in foo:
...             foo[AA] = []
...     foo[AA].append(codon)
...
>>> foo['L']
['CTT', 'CTG', 'CTA', 'CTC', 'TTA', 'TTG']
>>> foo['V']
['GTA', 'GTC', 'GTG', 'GTT']

cu
	Philipp

-- 
Dr. Philipp Pagel                              Tel.  +49-8161-71 2131
Lehrstuhl f?r Genomorientierte Bioinformatik   Fax.  +49-8161-71 2186
Technische Universit?t M?nchen
Wissenschaftszentrum Weihenstephan
85350 Freising, Germany

 and

Institut f?r Bioinformatik / MIPS
GSF - Forschungszentrum f?r Umwelt und Gesundheit
Ingolst?dter Landstrasse 1
85764 Neuherberg, Germany
http://mips.gsf.de/staff/pagel


From sbassi at gmail.com  Tue Aug 14 14:44:15 2007
From: sbassi at gmail.com (Sebastian Bassi)
Date: Tue, 14 Aug 2007 15:44:15 -0300
Subject: [BioPython] Inverse codon table?
In-Reply-To: <20070814180817.GA3154@gsf.de>
References: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
	<20070814180817.GA3154@gsf.de>
Message-ID: <b43bf2080708141144u757e1d5fo408ed95ef795cddb@mail.gmail.com>

On 8/14/07, Philipp Pagel <p.pagel at gsf.de> wrote:
> >>> foo = {}
> >>> for codon, AA in t.forward_table.items():
> ...     if AA not in foo:
> ...             foo[AA] = []
> ...     foo[AA].append(codon)

That is also woks!
My goal is to make a function that will return ALL possible
backtranslated sequences from a given peptide. The back_translate
function from Biopython just return one possible sequence. I want them
all :)

-- 
Bioinformatics news: http://www.bioinformatica.info
Lriser: http://www.linspire.com/lraiser_success.php?serial=318

From sbassi at gmail.com  Tue Aug 14 14:55:24 2007
From: sbassi at gmail.com (Sebastian Bassi)
Date: Tue, 14 Aug 2007 15:55:24 -0300
Subject: [BioPython] Inverse codon table?
In-Reply-To: <b43bf2080708141144u757e1d5fo408ed95ef795cddb@mail.gmail.com>
References: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
	<20070814180817.GA3154@gsf.de>
	<b43bf2080708141144u757e1d5fo408ed95ef795cddb@mail.gmail.com>
Message-ID: <b43bf2080708141155v19ac4c61ie5132b6d0dc0ac30@mail.gmail.com>

On 8/14/07, Sebastian Bassi <sbassi at gmail.com> wrote:
> function from Biopython just return one possible sequence. I want them
> all :)

This returns all possible combinations:

peptidoORI="MANCNGASK"
tot=0
for x in peptidoORI:
    tot=tot+len(bt[x])
allpepts=[""]*tot
for aa in peptidoORI:
    i=0
    for x in range(tot):
        if i==len(bt[aa]):
            i=0
        else:
            pass
        allpepts[x]=allpepts[x]+bt[aa][i]
        i=i+1

>>> allpepts
['ATGGCAAATTGTAATGGAGCAAGTAAA', 'ATGGCTAACTGCAACGGTGCTAGCAAG',
'ATGGCCAATTGTAATGGCGCCTCAAAA', 'ATGGCGAACTGCAACGGGGCGTCTAAG',
'ATGGCAAATTGTAATGGAGCATCCAAA', 'ATGGCTAACTGCAACGGTGCTTCGAAG',
'ATGGCCAATTGTAATGGCGCCAGTAAA', 'ATGGCGAACTGCAACGGGGCGAGCAAG',
'ATGGCAAATTGTAATGGAGCATCAAAA', 'ATGGCTAACTGCAACGGTGCTTCTAAG',
'ATGGCCAATTGTAATGGCGCCTCCAAA', 'ATGGCGAACTGCAACGGGGCGTCGAAG',
'ATGGCAAATTGTAATGGAGCAAGTAAA', 'ATGGCTAACTGCAACGGTGCTAGCAAG',
'ATGGCCAATTGTAATGGCGCCTCAAAA', 'ATGGCGAACTGCAACGGGGCGTCTAAG',
'ATGGCAAATTGTAATGGAGCATCCAAA', 'ATGGCTAACTGCAACGGTGCTTCGAAG',
'ATGGCCAATTGTAATGGCGCCAGTAAA', 'ATGGCGAACTGCAACGGGGCGAGCAAG',
'ATGGCAAATTGTAATGGAGCATCAAAA', 'ATGGCTAACTGCAACGGTGCTTCTAAG',
'ATGGCCAATTGTAATGGCGCCTCCAAA', 'ATGGCGAACTGCAACGGGGCGTCGAAG',
'ATGGCAAATTGTAATGGAGCAAGTAAA', 'ATGGCTAACTGCAACGGTGCTAGCAAG',
'ATGGCCAATTGTAATGGCGCCTCAAAA']

-- 
Bioinformatics news: http://www.bioinformatica.info
Lriser: http://www.linspire.com/lraiser_success.php?serial=318

From Gabino.Sanchez-Perez at Dal.Ca  Tue Aug 14 19:57:40 2007
From: Gabino.Sanchez-Perez at Dal.Ca (Gabino Sanchez-Perez)
Date: Tue, 14 Aug 2007 20:57:40 -0300
Subject: [BioPython] Problem to obtain Hit length parsing with NCBIXML
Message-ID: <20070814205740.rd456mf5ow844o8k@my3.dal.ca>

Hi

I'm parsing a blastp output in XML format using NCBIXML, but my problem is that
I don't know how to get the Hit length (not alignment length), even though is
defined in the parser:

    def _end_Hit_len(self):
        self._hit.length = int(self._value)

So in my script when I iterate

 for alignment in brecord.alignments:
      for hsp in alignment.hits:

it seems that is not defined and the error message is that hit.length does not
exist.

Thanks in advance

Gabino

From mdehoon at c2b2.columbia.edu  Tue Aug 14 20:45:26 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Tue, 14 Aug 2007 20:45:26 -0400
Subject: [BioPython] Problem to obtain Hit length parsing with NCBIXML
References: <20070814205740.rd456mf5ow844o8k@my3.dal.ca>
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B604@mail2.exch.c2b2.columbia.edu>

This should work:

>>> for alignment in brecord.alignments:
...      print alignment.length

If it doesn't, please send us the exact code you are using, and the exact
error message that you got.

--Michiel.


Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032



-----Original Message-----
From: biopython-bounces at lists.open-bio.org on behalf of Gabino Sanchez-Perez
Sent: Tue 8/14/2007 7:57 PM
To: biopython at lists.open-bio.org
Subject: [BioPython] Problem to obtain Hit length parsing with NCBIXML
 
Hi

I'm parsing a blastp output in XML format using NCBIXML, but my problem is
that
I don't know how to get the Hit length (not alignment length), even though is
defined in the parser:

    def _end_Hit_len(self):
        self._hit.length = int(self._value)

So in my script when I iterate

 for alignment in brecord.alignments:
      for hsp in alignment.hits:

it seems that is not defined and the error message is that hit.length does
not
exist.

Thanks in advance

Gabino
_______________________________________________
BioPython mailing list  -  BioPython at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biopython



From winter at biotec.tu-dresden.de  Wed Aug 15 03:36:47 2007
From: winter at biotec.tu-dresden.de (Christof Winter)
Date: Wed, 15 Aug 2007 09:36:47 +0200
Subject: [BioPython] Problem to obtain Hit length parsing with NCBIXML
In-Reply-To: <20070814205740.rd456mf5ow844o8k@my3.dal.ca>
References: <20070814205740.rd456mf5ow844o8k@my3.dal.ca>
Message-ID: <46C2AD0F.3050207@biotec.tu-dresden.de>

Gabino Sanchez-Perez wrote:
> Hi
> 
> I'm parsing a blastp output in XML format using NCBIXML, but my problem is that
> I don't know how to get the Hit length (not alignment length), even though is
> defined in the parser:
> 
>     def _end_Hit_len(self):
>         self._hit.length = int(self._value)
> 
> So in my script when I iterate
> 
>  for alignment in brecord.alignments:
>       for hsp in alignment.hits:
> 
> it seems that is not defined and the error message is that hit.length does not
> exist.

I can confirm what Michiel wrote:

alignment.length = total length of the unaligned hit sequence

HTH,
Christof

From Gabino.Sanchez-Perez at Dal.Ca  Wed Aug 15 08:23:26 2007
From: Gabino.Sanchez-Perez at Dal.Ca (Gabino Sanchez-Perez)
Date: Wed, 15 Aug 2007 09:23:26 -0300
Subject: [BioPython] Problem to obtain Hit length parsing with NCBIXML
In-Reply-To: <6243BAA9F5E0D24DA41B27997D1FD14402B604@mail2.exch.c2b2.columbia.edu>
References: <20070814205740.rd456mf5ow844o8k@my3.dal.ca>
	<6243BAA9F5E0D24DA41B27997D1FD14402B604@mail2.exch.c2b2.columbia.edu>
Message-ID: <20070815092326.ah56e2ud8w00k4wk@my5.dal.ca>

It works! I was confounded because I was looking for the length of the  
alignment (that now I see that is in hsp.sbjct) and I thought it was  
in alignment.length (Hit length).

Thank you very much for the help

Gabino

> This should work:
>
>>>> for alignment in brecord.alignments:
> ...      print alignment.length
>
> If it doesn't, please send us the exact code you are using, and the exact
> error message that you got.
>
> --Michiel.
>
>
> Michiel de Hoon
> Center for Computational Biology and Bioinformatics
> Columbia University
> 1150 St Nicholas Avenue
> New York, NY 10032
>
>
>
> -----Original Message-----
> From: biopython-bounces at lists.open-bio.org on behalf of Gabino Sanchez-Perez
> Sent: Tue 8/14/2007 7:57 PM
> To: biopython at lists.open-bio.org
> Subject: [BioPython] Problem to obtain Hit length parsing with NCBIXML
>
> Hi
>
> I'm parsing a blastp output in XML format using NCBIXML, but my problem is
> that
> I don't know how to get the Hit length (not alignment length), even though is
> defined in the parser:
>
>     def _end_Hit_len(self):
>         self._hit.length = int(self._value)
>
> So in my script when I iterate
>
>  for alignment in brecord.alignments:
>       for hsp in alignment.hits:
>
> it seems that is not defined and the error message is that hit.length does
> not
> exist.
>
> Thanks in advance
>
> Gabino
> _______________________________________________
> BioPython mailing list  -  BioPython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>
>





From douglas.kojetin at gmail.com  Wed Aug 15 14:30:41 2007
From: douglas.kojetin at gmail.com (Douglas Kojetin)
Date: Wed, 15 Aug 2007 14:30:41 -0400
Subject: [BioPython] Bio.PDB rotate/translate
Message-ID: <152CE16F-7F6D-46F3-B285-59FBB3671EED@gmail.com>

Hi All,

I would like to rotate a specific H and N vector in my structure  
file, so that it points in a different direction, but keep its  
location fixed in 3D space.  Here is what I've been working with, but  
it seems to move the atoms away from their original location.  I  
grabbed most of this from the Bio.PDB FAQ (the PDF file) and from the  
Bio.PDB documentation online.  I'm not sure if I should be using  
different values for the Vector/rotation line, or in the translation  
array, etc.

###
atom1 = structure[model.id][chain.id][residue.id[1]]['H']
atom2 = structure[model.id][chain.id][residue.id[1]]['N']

rotation = Bio.PDB.rotaxis( math.pi/2.0, Bio.PDB.Vector(1,0,0) )
translation = Numeric.array( (1,0,0), 'f' )

atom1.transform(rotation, translation)
atom2.transform(rotation, translation)
###

Thanks in advance for the help,

Doug


From jdiezperezj at gmail.com  Thu Aug 16 13:27:45 2007
From: jdiezperezj at gmail.com (=?ISO-8859-1?Q?Javier_D=EDez?=)
Date: Thu, 16 Aug 2007 19:27:45 +0200
Subject: [BioPython] psi mi
Message-ID: <e85a576d0708161027l2d5f75b5x9f8ed0b6e335341e@mail.gmail.com>

Hy,
Does anyone knows a python parser for PSI-MI format?
Thanks
Javi

From winter at biotec.tu-dresden.de  Thu Aug 16 13:53:01 2007
From: winter at biotec.tu-dresden.de (Christof Winter)
Date: Thu, 16 Aug 2007 19:53:01 +0200
Subject: [BioPython] psi mi
In-Reply-To: <e85a576d0708161027l2d5f75b5x9f8ed0b6e335341e@mail.gmail.com>
References: <e85a576d0708161027l2d5f75b5x9f8ed0b6e335341e@mail.gmail.com>
Message-ID: <46C48EFD.6080701@biotec.tu-dresden.de>

Javier D?ez wrote:
 > Hy,
 > Does anyone knows a python parser for PSI-MI format?
 > Thanks
 > Javi

Hi Javier:

I searched for one some time ago, and since I didn't find one, I wrote my own.
It's based on ElementTree:

http://effbot.org/zone/element-index.htm
http://docs.python.org/lib/module-xml.etree.ElementTree.html

It only parses some basic data from the PSIMI file, if you want to have a look 
at it, just drop me a line.

Cheers,
Christof

From meesters at uni-mainz.de  Thu Aug 16 14:33:56 2007
From: meesters at uni-mainz.de (Christian Meesters)
Date: Thu, 16 Aug 2007 20:33:56 +0200
Subject: [BioPython] Bio.PDB: possible to obtain chain identifier for atoms?
Message-ID: <1187289236.19033.17.camel@cmeesters>

Hi All,

I'm trying to build a somewhat bigger app which needs to calculate the
distance distribution function of a protein several times. For this
purpose I re-discovered BioPython today.
Speed is an issue, but since the protein in question isn't too big the
overhead of Python and BioPython might be tolerable.

Still, in order to speed up my code I would need to access the chain
identifier of atoms within a loop. To illustrate my question some
pseudo-code:

atoms = Selection.unfold_entities(structure, 'A')
for i, a in enumerate(atoms):
    for b in atoms[i+1:]:
	# do some calculations here ...

Now, I cannot avoid the double loop, but if I could check somehow
whether atoms a and b belong to the same chain (and which) I would have
to do this awkward looping only once this way.

Does anybody know an approach? As far as I understand the code of the
Atom class, there is no direct way, right?

TIA
Christian

From meesters at uni-mainz.de  Thu Aug 16 14:50:15 2007
From: meesters at uni-mainz.de (Christian Meesters)
Date: Thu, 16 Aug 2007 20:50:15 +0200
Subject: [BioPython] Bio.PDB rotate/translate
In-Reply-To: <152CE16F-7F6D-46F3-B285-59FBB3671EED@gmail.com>
References: <152CE16F-7F6D-46F3-B285-59FBB3671EED@gmail.com>
Message-ID: <1187290215.19033.34.camel@cmeesters>

Hi,

As you can see from my previous mail, I only just started to work with
BioPython today, again.

Still, I dare to ask back a few question.

Actually, I don't understand your question:
> I would like to rotate a specific H and N vector in my structure  
> file
Guess, this is a mistake and you don't want to rotate the vector itself.

I presume your structure looks like this:

H  N
 \/
 c1
 |
 c2

right?
And you want to turn around the axis defined by c1-c2? Then, if I
understand the 'PDB FAQ' correctly the code before the rotaxis line
should read:
c1 = residue[c1-identifier].get_vector()
c2 = residue[c2-identifier].get_vector()
rotation = rotaxis(angle, c1-c2)
Of course, your residue won't look like my sketch ...

> 
> rotation = Bio.PDB.rotaxis( math.pi/2.0, Bio.PDB.Vector(1,0,0) )
> translation = Numeric.array( (1,0,0), 'f' )
Here, you would shift the atoms by 1 ? along 'x'. Applied on only two
atoms, bonds would be stretched.

BTW, did you save the altered structure after applying the
rotation/translation?

If this was all wrong, please excuse a newbie answering this question.
But the mail was left unanswered for a while and it is still possible to
correct me ;-).

HTH
Christian


From meesters at uni-mainz.de  Fri Aug 17 03:15:39 2007
From: meesters at uni-mainz.de (Christian Meesters)
Date: Fri, 17 Aug 2007 09:15:39 +0200
Subject: [BioPython] Bio.PDB: possible to obtain chain identifier
	for	atoms?
In-Reply-To: <8e76d5310708161217s7e59e2ado6b4b514f6192c38e@mail.gmail.com>
References: <1187289236.19033.17.camel@cmeesters>
	<8e76d5310708161217s7e59e2ado6b4b514f6192c38e@mail.gmail.com>
Message-ID: <1187334939.26144.1.camel@cmeesters>

Hoi Katie,

apparently, yes. Life can be so easy ...

Thanks,
Christian

On Thu, 2007-08-16 at 15:17 -0400, Katie Edmonds wrote:
> Hi Christian,
> 
> are you looking for:
> chain1 = a.get_parent().get_parent()
> ?
> 
> Katie
> 
> On 8/16/07, Christian Meesters <meesters at uni-mainz.de> wrote:
>         Hi All,
>         
>         I'm trying to build a somewhat bigger app which needs to
>         calculate the 
>         distance distribution function of a protein several times. For
>         this
>         purpose I re-discovered BioPython today.
>         Speed is an issue, but since the protein in question isn't too
>         big the
>         overhead of Python and BioPython might be tolerable. 
>         
>         Still, in order to speed up my code I would need to access the
>         chain
>         identifier of atoms within a loop. To illustrate my question
>         some
>         pseudo-code:
>         
>         atoms = Selection.unfold_entities(structure, 'A') 
>         for i, a in enumerate(atoms):
>             for b in atoms[i+1:]:
>                 # do some calculations here ...
>         
>         Now, I cannot avoid the double loop, but if I could check
>         somehow
>         whether atoms a and b belong to the same chain (and which) I
>         would have 
>         to do this awkward looping only once this way.
>         
>         Does anybody know an approach? As far as I understand the code
>         of the
>         Atom class, there is no direct way, right?
>         
>         TIA
>         Christian
>         _______________________________________________ 
>         BioPython mailing list  -  BioPython at lists.open-bio.org
>         http://lists.open-bio.org/mailman/listinfo/biopython
> 

From Michael.Robeson at Colorado.EDU  Sat Aug 18 12:42:22 2007
From: Michael.Robeson at Colorado.EDU (Michael S. Robeson)
Date: Sat, 18 Aug 2007 10:42:22 -0600
Subject: [BioPython] qblast
Message-ID: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>

I have been using qblast (blastn) for a set of sequences. However, it  
gives me _completely_ different results than if I was to use the web  
interface at NCBI (also using blastn, nr). Is anyone else having this  
problem? Am I missing something?

Can anyone help with making sure that I am using the same settings in  
qblast as with the NCBI web interface?

Also, are there any plans for implementing megablast?

-Thanks!
-Mike

From biopython at maubp.freeserve.co.uk  Sat Aug 18 15:25:48 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Sat, 18 Aug 2007 20:25:48 +0100
Subject: [BioPython] qblast
In-Reply-To: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>
Message-ID: <46C747BC.6010002@maubp.freeserve.co.uk>

Michael S. Robeson wrote:
> I have been using qblast (blastn) for a set of sequences. However, it  
> gives me _completely_ different results than if I was to use the web  
> interface at NCBI (also using blastn, nr). Is anyone else having this  
> problem? Am I missing something?

Could you give us an example? Say three of sequences with details of how 
you use the web interface, and the code you are using in Biopython.

Peter


From Michael.Robeson at Colorado.EDU  Sat Aug 18 16:51:24 2007
From: Michael.Robeson at Colorado.EDU (Michael S. Robeson)
Date: Sat, 18 Aug 2007 14:51:24 -0600
Subject: [BioPython] qblast
In-Reply-To: <46C747BC.6010002@maubp.freeserve.co.uk>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>
	<46C747BC.6010002@maubp.freeserve.co.uk>
Message-ID: <EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>

Sure, I am using a really simple script that I wrote (link below) to  
start getting familiar w/ biopython. So, any other comments would be  
greatly appreciated.

http://ucsu.colorado.edu/~robeson/documents/blast.txt

Using this sequence:

TGTGATGGATATCTGCAGAATTCGCCCTTTAAACTTCAGGGTGACCAAAA
AATCAAAATAAATGTTGAAATAATACTGGATCTCCACCACCACTAACTTC
AAAAAATGTTGTATTAAAATTTCTATCAGTTAATAACATTGTTATAGCAC
CCCCTAATACTGGTAATGATAATAATAATAATCATGCTGTTATAAATACA
GCTCAAACAAATAAAGGTAACTTAAACATACTCATACCAGGTGTTCGCAT
ATTAATAACAGTAACAATAAAATTTATTGAACCTAATATTGATGATATAC
CAGCTAAATGTAAACTAAATATTGCACATTCTATTGAACCTCCTGAATGT
GAAAATATACCAGATAATGGTGGATAAACAGTTCAACCTGTACCTGCCCC
CATCTCGACTACAGATGATCAAATTAATAAAAAAAATGATGGTACTAATA
ATCAAAAACTTATATTATTTAATCTTGGGAATGCCATATCAGGAGCTCCT
ATCATTAAAGGTAAAAATCAATTACCAAAACCACCCATTAATGCAGGCAT
AACCATAAAAAATATCATTATTAAAGCATGTGCTGTTATTAACACATTAT
ATGCTTGATGATTGTAATTTAATATTACTGCACCAGCATCTGATAATTCT
ATACGTATTAATATAGATCAAAATGTTCCTATTAAACCTGCTAAAAATGC
AAATATTAAATATAATGTTCCAATATCTTTATGATTTGTTGACCAAGGGC
GAATTCCAGCACACTGGCGGCCGTTACTAG

Using blastn. When I use the web site I set the following:

Database = Others (nr etc..) w/ drop menu set to 'Nucleotide  
collection (nr/nt)'
Optimize for = 'Somewhat similar sequences (blastn)'

I assumed the above was the same as biopython's default qblast when  
using blastn. Basically, my script seemed worked fine until NCBI  
changed the layout of their site (I'd check every so often with a set  
of samples). I also tried to change my code with some of the new  
biopython code. But it is very hard to find good up-to-date  
tutorials. Last time I looked none of them worked.

Anyway, no matter what settings I use via the NCBI web interface I  
cannot get the same results as I do with qblast. So, unless I am  
missing something I wonder if there is something wrong with the back- 
end?

-Mike


On Aug 18, 2007, at 1:25 PM, Peter wrote:

> Michael S. Robeson wrote:
>> I have been using qblast (blastn) for a set of sequences. However,  
>> it  gives me _completely_ different results than if I was to use  
>> the web  interface at NCBI (also using blastn, nr). Is anyone else  
>> having this  problem? Am I missing something?
>
> Could you give us an example? Say three of sequences with details  
> of how you use the web interface, and the code you are using in  
> Biopython.
>
> Peter
>

----------------------------------------------
Michael S. Robeson II
Ecology and Evolutionary Biology
N122 Ramaley Hall
Campus Box 334
University of Colorado
Boulder, CO 80309
robeson at colorado.edu
http://ucsu.colorado.edu/~robeson/


From biopython at maubp.freeserve.co.uk  Sat Aug 18 17:55:08 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Sat, 18 Aug 2007 22:55:08 +0100
Subject: [BioPython] qblast
In-Reply-To: <EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>	<46C747BC.6010002@maubp.freeserve.co.uk>
	<EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>
Message-ID: <46C76ABC.9040608@maubp.freeserve.co.uk>

Michael S. Robeson wrote:
> Sure, I am using a really simple script that I wrote (link below) to  
> start getting familiar w/ biopython. So, any other comments would be  
> greatly appreciated.
 >
 > http://ucsu.colorado.edu/~robeson/documents/blast.txt

Assuming you are using Biopython 1.43, then I would have suggested using 
Bio.SeqIO rather than Bio.Fasta for reading/writing FASTA files. See the 
tutorial or http://www.biopython.org/wiki/SeqIO

I'm also unclear why you want to save individual output blast HTML pages 
(one file per sequence). Trying to parse these HTML files later will be 
a pain - go from the XML output if you want to read the blast output 
with Biopython.

> I assumed the above was the same as biopython's default qblast when  
> using blastn. Basically, my script seemed worked fine until NCBI  
> changed the layout of their site (I'd check every so often with a set  
> of samples).

See my other email - they should be the same if all the parameters are 
the same (specifically it looks like the NCBI seems to be using 
different defaults for the gap penalties, which was very confusing).

 > I also tried to change my code with some of the new
> biopython code. But it is very hard to find good up-to-date  
> tutorials. Last time I looked none of them worked.

Can you point out any out of date documentation please?
As far as I know, the BLAST examples in our tutorial work fine:
http://biopython.org/DIST/docs/tutorial/Tutorial.html

Peter


From biopython at maubp.freeserve.co.uk  Sat Aug 18 17:38:52 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Sat, 18 Aug 2007 22:38:52 +0100
Subject: [BioPython] qblast
In-Reply-To: <EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>	<46C747BC.6010002@maubp.freeserve.co.uk>
	<EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>
Message-ID: <46C766EC.6030601@maubp.freeserve.co.uk>

Hi Michael,

Here is a short script based on your example, which I have tested for 
calling qblast:

from Bio.Blast.NCBIWWW import qblast
seq_string = "TGTGATGGATATCTGCAGAATTCGCCCTTTAAACTTCAGGGTGACCAAAA" \
            + "AATCAAAATAAATGTTGAAATAATACTGGATCTCCACCACCACTAACTTC" \
            + "AAAAAATGTTGTATTAAAATTTCTATCAGTTAATAACATTGTTATAGCAC" \
            + "CCCCTAATACTGGTAATGATAATAATAATAATCATGCTGTTATAAATACA" \
            + "GCTCAAACAAATAAAGGTAACTTAAACATACTCATACCAGGTGTTCGCAT" \
            + "ATTAATAACAGTAACAATAAAATTTATTGAACCTAATATTGATGATATAC" \
            + "CAGCTAAATGTAAACTAAATATTGCACATTCTATTGAACCTCCTGAATGT" \
            + "GAAAATATACCAGATAATGGTGGATAAACAGTTCAACCTGTACCTGCCCC" \
            + "CATCTCGACTACAGATGATCAAATTAATAAAAAAAATGATGGTACTAATA" \
            + "ATCAAAAACTTATATTATTTAATCTTGGGAATGCCATATCAGGAGCTCCT" \
            + "ATCATTAAAGGTAAAAATCAATTACCAAAACCACCCATTAATGCAGGCAT" \
            + "AACCATAAAAAATATCATTATTAAAGCATGTGCTGTTATTAACACATTAT" \
            + "ATGCTTGATGATTGTAATTTAATATTACTGCACCAGCATCTGATAATTCT" \
            + "ATACGTATTAATATAGATCAAAATGTTCCTATTAAACCTGCTAAAAATGC" \
            + "AAATATTAAATATAATGTTCCAATATCTTTATGATTTGTTGACCAAGGGC" \
            + "GAATTCCAGCACACTGGCGGCCGTTACTAG"
#result_handle = qblast('blastn', 'nr', seq_string, format_type='HTML')
#output_handle = open("test.html", "w")
#output_handle.write(result_handle.read())
#output_handle.close()
result_handle = qblast('blastn', 'nr', seq_string, format_type='Text')
output_handle = open("test.txt", "w")
output_handle.write(result_handle.read())
output_handle.close()
#result_handle = qblast('blastn', 'nr', seq_string, format_type='XML')
#output_handle = open("test.xml", "w")
#output_handle.write(result_handle.read())
#output_handle.close()
print "Done"

The top hits from the script were:

gb|AY916130.1|  Epidermophyton floccosum mitochondrion, complete
gb|EF180206.1|  Penicillium confertum voucher 171.87 cytochrom...
gb|EF180399.1|  Penicillium soppii voucher IBT 14908 cytochrom...
gb|EF180398.1|  Penicillium soppii voucher IBT 3331 cytochrome...
gb|EF180397.1|  Penicillium soppii voucher IBT 18220 cytochrom...
gb|EF180396.1|  Penicillium soppii voucher 226.28 cytochrome o...
gb|EF180395.1|  Penicillium soppii voucher 144.83 cytochrome o...

The top hits for me using online nblast for the same sequence also on 
the nr database:

gb|AY129164.1|  Pythium aphanidermatum cytochrome oxidase I ge...
gb|AY561976.1|  Scopalina ruetzleri cytochrome oxidase subunit...
gb|EF468468.1|  Phytophthora sp. H-6/02 cytochrome oxidase sub...
gb|DQ832717.1|  Phytophthora sojae mitochondrion, complete genome
gb|EF468470.1|  Phytophthora sp. H-8/02 cytochrome oxidase sub...
gb|EF468469.1|  Phytophthora sp. H-7/02 cytochrome oxidase sub...
gb|AY129166.1|  Phytophthora capsici cytochrome oxidase I gene...

i.e. Very different!

I switched to using plain text output as its easier to read by hand.

Both correctly understood the input query was 780 letters long.
Both claimed to be output from BLASTN 2.2.17
Both claimed to be output from the same database

There where some differences in the parameters footer - but I'm not sure 
why.  Using the script:

   Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, 
GSS,environmental
samples or phase 0, 1 or 2 HTGS sequences)
     Posted date:  Aug 16, 2007  6:06 PM
   Number of letters in database: -51,729,944
   Number of sequences in database:  5,751,035
Lambda     K      H
     1.37    0.711     1.31
Gapped
Lambda     K      H
     1.37    0.711     1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
...

While using the web browser:

   Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, 
GSS,environmental
samples or phase 0, 1 or 2 HTGS sequences)
     Posted date:  Aug 16, 2007  6:06 PM
   Number of letters in database: -51,729,944
   Number of sequences in database:  5,751,035
Lambda     K      H
    0.634    0.408    0.912
Gapped
Lambda     K      H
    0.634    0.408    0.912
Matrix: blastn matrix:2 -3
Gap Penalties: Existence: 5, Extension: 2
...


There is something funny here... does this throw any light on things?

Peter


From biopython at maubp.freeserve.co.uk  Sat Aug 18 17:47:31 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Sat, 18 Aug 2007 22:47:31 +0100
Subject: [BioPython] qblast
In-Reply-To: <46C766EC.6030601@maubp.freeserve.co.uk>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>	<46C747BC.6010002@maubp.freeserve.co.uk>
	<EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>
	<46C766EC.6030601@maubp.freeserve.co.uk>
Message-ID: <46C768F3.7020608@maubp.freeserve.co.uk>

Peter wrote:
> I switched to using plain text output as its easier to read by hand.
> 
> Both correctly understood the input query was 780 letters long.
> Both claimed to be output from BLASTN 2.2.17
> Both claimed to be output from the same database
> 
> There where some differences in the parameters footer - but I'm not sure 
> why.  Using the script:
> 
>   Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, 
> GSS,environmental
> samples or phase 0, 1 or 2 HTGS sequences)
>     Posted date:  Aug 16, 2007  6:06 PM
>   Number of letters in database: -51,729,944
>   Number of sequences in database:  5,751,035
> Lambda     K      H
>     1.37    0.711     1.31
> Gapped
> Lambda     K      H
>     1.37    0.711     1.31
> Matrix: blastn matrix:1 -3
> Gap Penalties: Existence: 5, Extension: 2
> ...
> 
> While using the web browser:
> 
>   Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, 
> GSS,environmental
> samples or phase 0, 1 or 2 HTGS sequences)
>     Posted date:  Aug 16, 2007  6:06 PM
>   Number of letters in database: -51,729,944
>   Number of sequences in database:  5,751,035
> Lambda     K      H
>    0.634    0.408    0.912
> Gapped
> Lambda     K      H
>    0.634    0.408    0.912
> Matrix: blastn matrix:2 -3
> Gap Penalties: Existence: 5, Extension: 2
> ...

Solved: Using qblast in a script defaulted to blastn matrix:1 -3, while 
the new webpage instead defaults to blastn matrix:2 -3

You can check this (and change it) on the webpage by clicking on 
"Algorithm parameters" and under "Scoring Parameters" changing 
"Match/Mismatch Scores" from "2, -3" to "1, -3".

Then the results seem to agree. Does that work for you?

Peter


From Michael.Robeson at Colorado.EDU  Sat Aug 18 20:13:10 2007
From: Michael.Robeson at Colorado.EDU (Michael S. Robeson)
Date: Sat, 18 Aug 2007 18:13:10 -0600
Subject: [BioPython] qblast
In-Reply-To: <46C76ABC.9040608@maubp.freeserve.co.uk>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>	<46C747BC.6010002@maubp.freeserve.co.uk>
	<EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>
	<46C76ABC.9040608@maubp.freeserve.co.uk>
Message-ID: <D4CFCAF1-0D46-4E6D-B07C-E450ADF5B2EA@colorado.edu>

>
> Assuming you are using Biopython 1.43, then I would have suggested  
> using Bio.SeqIO rather than Bio.Fasta for reading/writing FASTA  
> files. See the tutorial or http://www.biopython.org/wiki/SeqIO

Okay will do!

> I'm also unclear why you want to save individual output blast HTML  
> pages (one file per sequence). Trying to parse these HTML files  
> later will be a pain - go from the XML output if you want to read  
> the blast output with Biopython.

Actually I have another script which actually parses the blast and  
genbank data but this was one of the first scripts I wrote to make  
sure I can to the 'simple' things first. But I essectially use the  
same code to run blast.
>
> See my other email - they should be the same if all the parameters  
> are the same (specifically it looks like the NCBI seems to be using  
> different defaults for the gap penalties, which was very confusing).

Yes it is. I must have thought I changed those parameters when in  
fact I didn't. Thanks for checking on this!

> > I also tried to change my code with some of the new
>> biopython code. But it is very hard to find good up-to-date   
>> tutorials. Last time I looked none of them worked.
>
> Can you point out any out of date documentation please?
> As far as I know, the BLAST examples in our tutorial work fine:
> http://biopython.org/DIST/docs/tutorial/Tutorial.html

Okay, I must have been looking in the wrong places then. I'll go  
through the listed tutorials again. Is there a particular one you'd  
suggest? I have only looked at a few of the 'Online course notes'  
which is probably why. I just noticed the tutorial cookbook links. I  
must be blind!

And I am using the latest biopython (1.43) package as installed via  
fink for OS X.

Again, thanks! I'll play around with this more over the next day or  
so. I'll see if I can get my code to switch settings and see how the  
results are affected.

-Mike

From biopython at maubp.freeserve.co.uk  Sun Aug 19 08:36:42 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Sun, 19 Aug 2007 13:36:42 +0100
Subject: [BioPython] qblast + documentation
In-Reply-To: <D4CFCAF1-0D46-4E6D-B07C-E450ADF5B2EA@colorado.edu>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>	<46C747BC.6010002@maubp.freeserve.co.uk>	<EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>	<46C76ABC.9040608@maubp.freeserve.co.uk>
	<D4CFCAF1-0D46-4E6D-B07C-E450ADF5B2EA@colorado.edu>
Message-ID: <46C8395A.3040301@maubp.freeserve.co.uk>

Michael S. Robeson wrote:
>>> I also tried to change my code with some of the new
>>> biopython code. But it is very hard to find good up-to-date   
>>> tutorials. Last time I looked none of them worked.
>>
>> Can you point out any out of date documentation please?
>> As far as I know, the BLAST examples in our tutorial work fine:
>> http://biopython.org/DIST/docs/tutorial/Tutorial.html
> 
> Okay, I must have been looking in the wrong places then. I'll go  
> through the listed tutorials again. Is there a particular one you'd  
> suggest?

The main tutorial is probably best, and most up to date.
http://biopython.org/DIST/docs/tutorial/Tutorial.html

If you are interested in RPS-BLAST, then have a look here too:
http://www.warwick.ac.uk/go/peter_cock/python/rpsblast/

 > I have only looked at a few of the 'Online course notes'
> which is probably why. I just noticed the tutorial cookbook links. I  
> must be blind!

There have been changes in how we handle parsing Blast output in recent 
releases of Biopython (driven by changes the NCBI made).  We are are now 
recommending the use of XML output, but the Biopython code used to do 
this had to change a little compared to older releases.

This may mean that any "third party" tutorials are a little out of date now.

Peter


From meesters at uni-mainz.de  Mon Aug 20 11:15:39 2007
From: meesters at uni-mainz.de (Christian Meesters)
Date: Mon, 20 Aug 2007 17:15:39 +0200
Subject: [BioPython] deleting and inserting 'chains' in Bio.PDB
Message-ID: <1187622939.19858.18.camel@cmeesters>

Hi,

I'd like delete and insert subunits in my structure object. But the
following code does not work:

>>> parser = PDBParser()
>>> s = parser.get_structure('name','name.pdb')
>>> cs = [chain for chain in s.get_chains()]
>>> cs
[<Chain id=A>, <Chain id=B>, <Chain id=C>, <Chain id=D>, <Chain id=E>,
<Chain id=F>]
>>> c = cs[0]
>>> c
<Chain id=A>
>>> c.id
'A'
>>> c.get_id()
'A'
>>> s.detach_child('A')
Traceback (most recent call last):
  File "<stdin>", line 1, in <module>
  File "/var/lib/python-support/python2.5/Bio/PDB/Entity.py", line 70,
in detach_child
    child=self.child_dict[id] 
KeyError: 'A'
>>> s.detach_child("<Chain id=A>")
Traceback (most recent call last):
  File "<stdin>", line 1, in <module>
  File "/var/lib/python-support/python2.5/Bio/PDB/Entity.py", line 70,
in detach_child
    child=self.child_dict[id] 
KeyError: '<Chain id=A>'

Can somebody give me a hint of what I'm missing?

Thanks,
Christian

From thamelry at binf.ku.dk  Mon Aug 20 11:51:51 2007
From: thamelry at binf.ku.dk (Thomas Hamelryck)
Date: Mon, 20 Aug 2007 17:51:51 +0200
Subject: [BioPython] deleting and inserting 'chains' in Bio.PDB
In-Reply-To: <1187622939.19858.18.camel@cmeesters>
References: <1187622939.19858.18.camel@cmeesters>
Message-ID: <2d7c25310708200851v5732e2adpf1fdc49baed0cc09@mail.gmail.com>

On 8/20/07, Christian Meesters <meesters at uni-mainz.de> wrote:
> Hi,
>
> I'd like delete and insert subunits in my structure object. But the
> following code does not work:

A chain object should be removed at the level of the model object, not
at the level of the  structure object.

Remember:

Structure<-Model<-Chain<-Residue<-Atom

Cheers,

-Thomas

From meesters at uni-mainz.de  Mon Aug 20 12:01:08 2007
From: meesters at uni-mainz.de (Christian Meesters)
Date: Mon, 20 Aug 2007 18:01:08 +0200
Subject: [BioPython] deleting and inserting 'chains' in Bio.PDB
In-Reply-To: <2d7c25310708200851v5732e2adpf1fdc49baed0cc09@mail.gmail.com>
References: <1187622939.19858.18.camel@cmeesters>
	<2d7c25310708200851v5732e2adpf1fdc49baed0cc09@mail.gmail.com>
Message-ID: <1187625668.19858.21.camel@cmeesters>

Thanks! And thank you, Thomas, for your wonderful module!
The module is actually easy to use, despite of my questions ... ;-)

Cheers,
Christian


On Mon, 2007-08-20 at 17:51 +0200, Thomas Hamelryck wrote:
> On 8/20/07, Christian Meesters <meesters at uni-mainz.de> wrote:
> > Hi,
> >
> > I'd like delete and insert subunits in my structure object. But the
> > following code does not work:
> 
> A chain object should be removed at the level of the model object, not
> at the level of the  structure object.
> 
> Remember:
> 
> Structure<-Model<-Chain<-Residue<-Atom
> 
> Cheers,
> 
> -Thomas

From jodyhey at yahoo.com  Mon Aug 20 13:48:36 2007
From: jodyhey at yahoo.com (Emanuel Hey)
Date: Mon, 20 Aug 2007 10:48:36 -0700 (PDT)
Subject: [BioPython] Blast to genome specific databases?
In-Reply-To: <46C768F3.7020608@maubp.freeserve.co.uk>
Message-ID: <897102.52773.qm@web53903.mail.re2.yahoo.com>

NCBI has a blast form for genome specific datbases
that returns more information than does a blast to the
generic nucleotide database

http://www.ncbi.nlm.nih.gov/BLAST/

See e.g. for the human genome

http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=9606


I've used NCBIWWW.qblast and used biopython for stand
alone blasting,  but otherwise am not that experience.


Is there a way to script a search that generates the
same results as provided by these newere genome
specific interfaces?

Thanks

Jhey



       
____________________________________________________________________________________
Got a little couch potato? 
Check out fun summer activities for kids.
http://search.yahoo.com/search?fr=oni_on_mail&p=summer+activities+for+kids&cs=bz 

From cjfields at uiuc.edu  Mon Aug 20 15:17:48 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 20 Aug 2007 14:17:48 -0500
Subject: [BioPython] Blast to genome specific databases?
In-Reply-To: <897102.52773.qm@web53903.mail.re2.yahoo.com>
References: <897102.52773.qm@web53903.mail.re2.yahoo.com>
Message-ID: <F47FC071-2989-49A1-8C64-FD0E12029E07@uiuc.edu>

If you follow the directions on this page:

http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/remote_blastdblist.html

you should be able to modify the URLAPI DATABASE parameter to that in  
the list; another option would be to limit the results to a specific  
taxid (like 9606) using the ENTREZ_QUERY.  Not sure how that would be  
done for biopython (being a bioperler myself) but I'm sure someone  
could chip in?

chris

On Aug 20, 2007, at 12:48 PM, Emanuel Hey wrote:

> NCBI has a blast form for genome specific datbases
> that returns more information than does a blast to the
> generic nucleotide database
>
> http://www.ncbi.nlm.nih.gov/BLAST/
>
> See e.g. for the human genome
>
> http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi? 
> taxid=9606
>
>
> I've used NCBIWWW.qblast and used biopython for stand
> alone blasting,  but otherwise am not that experience.
>
>
> Is there a way to script a search that generates the
> same results as provided by these newere genome
> specific interfaces?
>
> Thanks
>
> Jhey
>
>
>
>
> ______________________________________________________________________ 
> ______________
> Got a little couch potato?
> Check out fun summer activities for kids.
> http://search.yahoo.com/search?fr=oni_on_mail&p=summer+activities 
> +for+kids&cs=bz
> _______________________________________________
> BioPython mailing list  -  BioPython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From biopython at maubp.freeserve.co.uk  Wed Aug 22 11:05:31 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 22 Aug 2007 16:05:31 +0100
Subject: [BioPython] Making the Seq object act more like a string
Message-ID: <46CC50BB.1090902@maubp.freeserve.co.uk>

Dear Biopython users,

A couple of times (on bugs or the developers mailing list), Michiel de 
Hoon has previously suggested we could make the Seq class (Bio.Seq.Seq) 
a subclass of python string. I agree with him - the Seq object should 
act more like a string.

I'm posting on the main discussion list to get some feedback on this, as 
any sudden changes could affect lots of people.

As a simple example, although there are functions in Biopython to 
calculate GC percentages, for a beginner playing with Seq objects, it 
would be nice to be able to do things like this (where s is a Seq object):

print float(s.count("G") + s.count("C")) / len(s)

rather for example this:

print float(s.tostring().count("G") + s.tostring().count("C")) / len(s)

I also don't think the current behaviour of str(seq) is helpful.  To 
recap, here is a simple example using a simple string:

 >>> ss = 'ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATGA'
 >>> print repr(ss)
'ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATGA'
 >>> print str(ss)
ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATGA
 >>> print ss
ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATGA

And the equivalent using a Seq object as of Biopython 1.43:

 >>> s = Seq("ACAGGTACGATCGATCCTGTTGTACGTGCTC"\
... +"GTCGACTGCTAGCTCGTCGTGGTCCGATGA")
 >>> print repr(s)
Seq('ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATGA', 
Alphabet())
 >>> print s.tostring()
ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATGA
 >>> print str(s)
Seq('ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATG ...', 
Alphabet())
 >>> print s
Seq('ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATG ...', 
Alphabet())

Note that currently doing str() on a Seq object gives a truncated 
version of what repr() gives. The only nice things about this is when 
working at the python command line, doing "print s" will only take one 
line even when working with a genome. And it makes it really clear you 
don't just have a string object.

That was the motivation/background part. Feel free to chime in :)

-----------------------------------------------------------------------

This next bit of the email gets a bit more technical... and might be 
better off on the developers mailing list. We'll see where any 
discussion goes.

If we can agree to that making Seq inherit from the basic string is a 
good idea, then I would advocate a gradual transition... my thoughts are 
that for the next release of Biopython we:

(1) Modify Seq .__str__() method to act like the existing .tostring(), 
i.e. return self.data

I don't think changing the __str__ method will break any serious code, 
because as shown above, currently its like a truncated version of 
__repr__ so all its useful for at the moment is getting a truncated 
sequence for display.

(2) Consider adding alphabet aware versions selected string methods to 
the Seq object (e.g. count, find)

Adding new methods to the Seq class should have no effect on existing usage.

Then, for the release afterwards:
(3) actually do the class inheritance with all the horrors entailed.

As part of this, we'll need to address how the __eq__ method of the Seq 
object should act: Looking at the sequence only, or considering the 
alphabet too? Currently this method is not implemented at all.

This is part of a larger question - how to cope with multiple Seq/string 
operations where there is more than one alphabet.  e.g. 
comparing/adding/joining a nucleotide Seq to a protein Seq object. I 
would opt for the simple solution that the alphabets must match or some 
sort of ValueError is raised. Alternatively, as the alphabets have a 
class hierarchy, we could choose the parent alphabet (e.g. the generic 
single letter alphabet when dealing with a DNA and Protein; or the 
generic single nucleotide alphabet when dealing with RNA and DNA).

Any thoughts?

Peter

[In fact, Michiel has also suggested making the SeqRecord class a 
subclass of the Seq class, which raises even more questions]


From sbassi at gmail.com  Wed Aug 22 11:41:53 2007
From: sbassi at gmail.com (Sebastian Bassi)
Date: Wed, 22 Aug 2007 12:41:53 -0300
Subject: [BioPython] Making the Seq object act more like a string
In-Reply-To: <46CC50BB.1090902@maubp.freeserve.co.uk>
References: <46CC50BB.1090902@maubp.freeserve.co.uk>
Message-ID: <b43bf2080708220841s7ba6bf7cof74a99866e4ef93a@mail.gmail.com>

On 8/22/07, Peter <biopython at maubp.freeserve.co.uk> wrote:
> A couple of times (on bugs or the developers mailing list), Michiel de
> Hoon has previously suggested we could make the Seq class (Bio.Seq.Seq)
> a subclass of python string. I agree with him - the Seq object should
> act more like a string.

I agree. Seq acting more like a str would also lower the entry level
to use biopython for non OOP seasoned programmers.

> As a simple example, although there are functions in Biopython to
...

Here is another example (from
http://www.biopython.org/wiki/SeqIO#Using_the_SEGUID_checksum):

Current situation:

from Bio import SeqIO
from Bio.SeqUtils.CheckSum import seguid
seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), "genbank"),
                            lambda rec : seguid(rec.seq))
record = seguid_dict["MN/s0q9zDoCVEEc+k/IFwCNF2pY"]
print record.id
print record.description

If seq were more like a string:

...
seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), "genbank"),
                            seguid(rec.seq))
....

This way you avoid using a lambda.


-- 
Bioinformatics news: http://www.bioinformatica.info
Lriser: http://www.linspire.com/lraiser_success.php?serial=318

From biopython at maubp.freeserve.co.uk  Wed Aug 22 11:53:59 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 22 Aug 2007 16:53:59 +0100
Subject: [BioPython] Making the Seq object act more like a string
In-Reply-To: <b43bf2080708220841s7ba6bf7cof74a99866e4ef93a@mail.gmail.com>
References: <46CC50BB.1090902@maubp.freeserve.co.uk>
	<b43bf2080708220841s7ba6bf7cof74a99866e4ef93a@mail.gmail.com>
Message-ID: <46CC5C17.4000709@maubp.freeserve.co.uk>

Sebastian Bassi wrote:
> On 8/22/07, Peter <biopython at maubp.freeserve.co.uk> wrote:
>> A couple of times (on bugs or the developers mailing list), Michiel de
>> Hoon has previously suggested we could make the Seq class (Bio.Seq.Seq)
>> a subclass of python string. I agree with him - the Seq object should
>> act more like a string.
> 
> I agree. Seq acting more like a str would also lower the entry level
> to use biopython for non OOP seasoned programmers.

Good :)

>> As a simple example, although there are functions in Biopython to
> ...
> 
> Here is another example (from
> http://www.biopython.org/wiki/SeqIO#Using_the_SEGUID_checksum ):

I added that to the wiki recently - although it is perhaps premature 
given your CheckSum code hasn't been officially release yet. This was my 
draft, moving/adding it to the tutorial is on my to do list.

> Current situation:
> 
> from Bio import SeqIO
> from Bio.SeqUtils.CheckSum import seguid
> seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), "genbank"),
>                             lambda rec : seguid(rec.seq))
> record = seguid_dict["MN/s0q9zDoCVEEc+k/IFwCNF2pY"]
> print record.id
> print record.description
> 
> If seq were more like a string:
> 
> ...
> seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), "genbank"),
>                             seguid(rec.seq))

Nope ;)

You have to give a function to the key_function argument in 
SeqIO.to_dict(), and in your example seguid(rec.seq) would be a string 
(the result of the seguid function acting on a seq object). Or at least, 
it would if you had a rec variable in scope.

However, if SeqRecord acted more like a Seq (and therefore more like a 
string) then you could do this which does avoid the lambda:

seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), \
                             "genbank"), seguid)

Or, we could enhance your the CheckSum functions to cope with a 
SeqRecord, a Seq or a string - right now they cope with a Seq or a string.

Peter


From mdehoon at c2b2.columbia.edu  Thu Aug 23 02:06:27 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Thu, 23 Aug 2007 02:06:27 -0400
Subject: [BioPython] Making the Seq object act more like a string
References: <46CC50BB.1090902@maubp.freeserve.co.uk><b43bf2080708220841s7ba6bf7cof74a99866e4ef93a@mail.gmail.com>
	<46CC5C17.4000709@maubp.freeserve.co.uk>
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B609@mail2.exch.c2b2.columbia.edu>

Peter wrote:
> However, if SeqRecord acted more like a Seq (and therefore more like a 
> string) then you could do this which does avoid the lambda:
> 
> seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), \
>                              "genbank"), seguid)
> 
> Or, we could enhance your the CheckSum functions to cope with a 
> SeqRecord, a Seq or a string - right now they cope with a Seq or a string.
>
Nice example.

The SeqRecord class is one of those classes in Biopython for which I never
understood why they exist. A SeqRecord is nothing more than a Seq with some
attributes attached. If we add those attributes to the Seq class directly,
then we can get rid of the SeqRecord class. Then, functions such as those in
CheckSum only need to cope with strings.

--Micheil.




Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032







From mdehoon at c2b2.columbia.edu  Thu Aug 23 02:06:27 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Thu, 23 Aug 2007 02:06:27 -0400
Subject: [BioPython] Making the Seq object act more like a string
References: <46CC50BB.1090902@maubp.freeserve.co.uk><b43bf2080708220841s7ba6bf7cof74a99866e4ef93a@mail.gmail.com>
	<46CC5C17.4000709@maubp.freeserve.co.uk>
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B609@mail2.exch.c2b2.columbia.edu>

Peter wrote:
> However, if SeqRecord acted more like a Seq (and therefore more like a 
> string) then you could do this which does avoid the lambda:
> 
> seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), \
>                              "genbank"), seguid)
> 
> Or, we could enhance your the CheckSum functions to cope with a 
> SeqRecord, a Seq or a string - right now they cope with a Seq or a string.
>
Nice example.

The SeqRecord class is one of those classes in Biopython for which I never
understood why they exist. A SeqRecord is nothing more than a Seq with some
attributes attached. If we add those attributes to the Seq class directly,
then we can get rid of the SeqRecord class. Then, functions such as those in
CheckSum only need to cope with strings.

--Micheil.




Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032





-------------- next part --------------
A non-text attachment was scrubbed...
Name: not available
Type: application/ms-tnef
Size: 3293 bytes
Desc: not available
Url : http://lists.open-bio.org/pipermail/biopython/attachments/20070823/b40defae/attachment.bin 

From Michael.Robeson at Colorado.EDU  Thu Aug 23 16:13:17 2007
From: Michael.Robeson at Colorado.EDU (Michael S. Robeson)
Date: Thu, 23 Aug 2007 14:13:17 -0600
Subject: [BioPython] qblast + documentation
In-Reply-To: <46C8395A.3040301@maubp.freeserve.co.uk>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>	<46C747BC.6010002@maubp.freeserve.co.uk>	<EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>	<46C76ABC.9040608@maubp.freeserve.co.uk>
	<D4CFCAF1-0D46-4E6D-B07C-E450ADF5B2EA@colorado.edu>
	<46C8395A.3040301@maubp.freeserve.co.uk>
Message-ID: <2EEE2FCD-6A73-408D-9984-D3806D717BD1@colorado.edu>

Why is there no way to add other parameters like gap penalties to  
qblast? Like can be done on the web site? Am I missing something? Is  
there code I can add?

-Thanks
-Mike


From Michael.Robeson at Colorado.EDU  Thu Aug 23 16:20:26 2007
From: Michael.Robeson at Colorado.EDU (Michael S. Robeson)
Date: Thu, 23 Aug 2007 14:20:26 -0600
Subject: [BioPython] qblast + documentation
Message-ID: <A58FA3CF-1D84-466E-AD55-EE1EB7D0DC2D@colorado.edu>

I meant to add to the other e-mail:  Since we know it has to do with  
the blast setting differences on the NCBI web site versus the  
biopython back-end. How can I get around that? I've tried a few  
things, but have not been successful.

-Mike

From mdehoon at c2b2.columbia.edu  Thu Aug 23 19:01:17 2007
From: mdehoon at c2b2.columbia.edu (Michiel de Hoon)
Date: Fri, 24 Aug 2007 08:01:17 +0900
Subject: [BioPython] qblast + documentation
In-Reply-To: <A58FA3CF-1D84-466E-AD55-EE1EB7D0DC2D@colorado.edu>
References: <A58FA3CF-1D84-466E-AD55-EE1EB7D0DC2D@colorado.edu>
Message-ID: <46CE11BD.2020307@c2b2.columbia.edu>

Have you looked at the qblast function definition in 
http://cvs.biopython.org/cgi-bin/viewcvs/viewcvs.cgi/biopython/Bio/Blast/NCBIWWW.py?rev=1.46&cvsroot=biopython&content-type=text/vnd.viewcvs-markup

I believe all the Blast parameters are there.

--Michiel.

Michael S. Robeson wrote:
> I meant to add to the other e-mail:  Since we know it has to do with  
> the blast setting differences on the NCBI web site versus the  
> biopython back-end. How can I get around that? I've tried a few  
> things, but have not been successful.
> 
> -Mike
> _______________________________________________
> BioPython mailing list  -  BioPython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython


From Michael.Robeson at Colorado.EDU  Thu Aug 23 21:12:30 2007
From: Michael.Robeson at Colorado.EDU (Michael S. Robeson)
Date: Thu, 23 Aug 2007 19:12:30 -0600
Subject: [BioPython] qblast + documentation
In-Reply-To: <46CDFFE8.2040900@maubp.freeserve.co.uk>
References: <A58FA3CF-1D84-466E-AD55-EE1EB7D0DC2D@colorado.edu>
	<46CDFFE8.2040900@maubp.freeserve.co.uk>
Message-ID: <8963513B-811D-458B-BAB8-1BE64D3CA76C@colorado.edu>

> http://cvs.biopython.org/cgi-bin/viewcvs/viewcvs.cgi/biopython/Bio/ 
> Blast/NCBIWWW.py?rev=1.46&cvsroot=biopython&content-type=text/ 
> vnd.viewcvs-markup
Are those new parameters? They do exist in the code I downloaded?  
Guess I will download again from fink.

> If you are familiar with the BLAST terminology this is probably  
> very obvious, but you need to set the NUCL_REWARD and NUCL_PENALTY  
> options in the URL.

Yeah, I did not mean to say it was biopython's fault, but the version  
of the code I have had no parameters under qblast for me to alter  
after we new there was a difference with the web interface end at  
NCBI. The version I have (latest via fink, biopython version:  
1.43-1001) showed this:

def qblast(program, database, sequence,
            ncbi_gi=None, descriptions=None, alignments=None,
            expect=None, matrix=None,
            filter=None, format_type="XML", hitlist_size=None,
            entrez_query='(none)',
            ):

and not:

def qblast(program, database, sequence,
            auto_format=None,composition_based_statistics=None,
            db_genetic_code=None,endpoints=None,entrez_query='(none)',
            expect=10.0,filter=None,gapcosts=None,genetic_code=None,
            hitlist_size=50,i_thresh=None,layout=None,lcase_mask=None,
            matrix_name=None,nucl_penalty=None,nucl_reward=None,
            other_advanced=None,perc_ident=None,phi_pattern=None,
            query_file=None,query_believe_defline=None,query_from=None,
            query_to=None,searchsp_eff=None,service=None,threshold=None,
            ungapped_alignment=None,word_size=None,
            alignments=500,alignment_view=None,descriptions=500,
             
entrez_links_new_window=None,expect_low=None,expect_high=None,
             
format_entrez_query=None,format_object=None,format_type='XML',
            ncbi_gi=None,results_file=None,show_overview=None
            ):

So, there must be a problem with my fink installation or something. I  
will try and uninstall and re-install biopython via fink.

-Mike

From mdehoon at c2b2.columbia.edu  Thu Aug 23 22:08:29 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Thu, 23 Aug 2007 22:08:29 -0400
Subject: [BioPython] qblast + documentation
References: <A58FA3CF-1D84-466E-AD55-EE1EB7D0DC2D@colorado.edu><46CDFFE8.2040900@maubp.freeserve.co.uk>
	<8963513B-811D-458B-BAB8-1BE64D3CA76C@colorado.edu>
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B60B@mail2.exch.c2b2.columbia.edu>

> > http://cvs.biopython.org/cgi-bin/viewcvs/viewcvs.cgi/biopython/Bio/ 
> > Blast/NCBIWWW.py?rev=1.46&cvsroot=biopython&content-type=text/ 
> > vnd.viewcvs-markup
> Are those new parameters? They do exist in the code I downloaded?  
> Guess I will download again from fink.

It looks like these are coming from a recent improvement of Biopython. So you
won't find this in Biopython release 1.43. You can just take the new
NCBIWWW.py from CVS and copy it over the NCBIWWW.py in Biopython 1.43.

Maybe this is a good time for a new Biopython release?

--Michiel.


Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032





From biopython at maubp.freeserve.co.uk  Fri Aug 24 05:35:16 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Fri, 24 Aug 2007 10:35:16 +0100
Subject: [BioPython] [Fwd: Re:  qblast + documentation]
Message-ID: <46CEA654.1070706@maubp.freeserve.co.uk>

I managed to send this to Michael Robeson only, and not the list.

In the mean time Michiel de Hoon pointed out that support for lots of 
parameters (including NUCL_REWARD and NUCL_PENALTY) was added after the 
release of Biopython 1.43, so you would have to update the file 
Bio/Blast/NCBIWWW.py

If you don't want to bother with CVS, the easy way to do this is backup 
the original and then replace it with the download from here:

http://cvs.biopython.org/cgi-bin/viewcvs/viewcvs.cgi/*checkout*/biopython/Bio/Blast/NCBIWWW.py?rev=HEAD&cvsroot=biopython&content-type=text/x-python

Looking at the history, that shouldn't impact anything else.

Peter

-------- Original Message --------
Subject: Re: [BioPython] qblast + documentation
Date: Thu, 23 Aug 2007 22:45:12 +0100
From: Peter <biopython at maubp.freeserve.co.uk>
Reply-To: biopython at lists.open-bio.org
To: Michael S. Robeson <Michael.Robeson at colorado.edu>
References: <A58FA3CF-1D84-466E-AD55-EE1EB7D0DC2D at colorado.edu>

Michael S. Robeson wrote:
> I meant to add to the other e-mail:  Since we know it has to do with  
> the blast setting differences on the NCBI web site versus the  
> biopython back-end. How can I get around that? I've tried a few  
> things, but have not been successful.

I'd just like to point out this isn't Biopython's fault - its the NCBI
who seem to be using different match/mismatch penalties on their GUI
webserver and their QBLAST web API.

The simple answer for how to get the two queries to agree, is whenever
you do any manual queries on the website, click on "Algorithm
parameters" and under "Scoring Parameters" change "Match/Mismatch
Scores" from "2, -3" to "1, -3" (grin).

Or, if you want to change the gap penalties in the qblast call, what
Biopython is doing is providing a python interface to this URL scheme:

http://www.ncbi.nlm.nih.gov/BLAST/Doc/node5.html

If you are familiar with the BLAST terminology this is probably very
obvious, but you need to set the NUCL_REWARD and NUCL_PENALTY options in
the URL.

i.e. In Biopython use the optional nucl_reward and nucl_penalty
arguments to the Bio.Blast.NCBIWWW.qblast function.

from Bio.Blast.NCBIWWW import qblast
seq_string = "TGTGATGGATATCTGCAGAATTCGCCCTTTAAACTTCAGGGTGACCAAAA" \
             + "AATCAAAATAAATGTTGAAATAATACTGGATCTCCACCACCACTAACTTC" \
             + "AAAAAATGTTGTATTAAAATTTCTATCAGTTAATAACATTGTTATAGCAC" \
             + "CCCCTAATACTGGTAATGATAATAATAATAATCATGCTGTTATAAATACA" \
             + "GCTCAAACAAATAAAGGTAACTTAAACATACTCATACCAGGTGTTCGCAT" \
             + "ATTAATAACAGTAACAATAAAATTTATTGAACCTAATATTGATGATATAC" \
             + "CAGCTAAATGTAAACTAAATATTGCACATTCTATTGAACCTCCTGAATGT" \
             + "GAAAATATACCAGATAATGGTGGATAAACAGTTCAACCTGTACCTGCCCC" \
             + "CATCTCGACTACAGATGATCAAATTAATAAAAAAAATGATGGTACTAATA" \
             + "ATCAAAAACTTATATTATTTAATCTTGGGAATGCCATATCAGGAGCTCCT" \
             + "ATCATTAAAGGTAAAAATCAATTACCAAAACCACCCATTAATGCAGGCAT" \
             + "AACCATAAAAAATATCATTATTAAAGCATGTGCTGTTATTAACACATTAT" \
             + "ATGCTTGATGATTGTAATTTAATATTACTGCACCAGCATCTGATAATTCT" \
             + "ATACGTATTAATATAGATCAAAATGTTCCTATTAAACCTGCTAAAAATGC" \
             + "AAATATTAAATATAATGTTCCAATATCTTTATGATTTGTTGACCAAGGGC" \
             + "GAATTCCAGCACACTGGCGGCCGTTACTAG"

#filename, format = "test.html", "HTML"
#filename, format = "test.txt",  "Text"
filename, format = "test.xml",  "XML"

result_handle = qblast('blastn', 'nr', seq_string, format_type=format,
                        nucl_reward=2, nucl_penalty=-3)
output_handle = open(filename, "w")
output_handle.write(result_handle.read())
output_handle.close()

print "Done"


And this does seem to agree with the results from doing the query by
hand on their website with the default settings.

Peter



From biopython at maubp.freeserve.co.uk  Mon Aug 27 14:48:55 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Mon, 27 Aug 2007 19:48:55 +0100
Subject: [BioPython] Making the Seq object act more like a string
In-Reply-To: <6243BAA9F5E0D24DA41B27997D1FD14402B609@mail2.exch.c2b2.columbia.edu>
References: <46CC50BB.1090902@maubp.freeserve.co.uk><b43bf2080708220841s7ba6bf7cof74a99866e4ef93a@mail.gmail.com>	<46CC5C17.4000709@maubp.freeserve.co.uk>
	<6243BAA9F5E0D24DA41B27997D1FD14402B609@mail2.exch.c2b2.columbia.edu>
Message-ID: <46D31C97.1070200@maubp.freeserve.co.uk>

Michiel De Hoon wrote:
> Peter wrote:
>> However, if SeqRecord acted more like a Seq (and therefore more like a 
>> string) then you could do this which does avoid the lambda:
>>
>> seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), \
>>                              "genbank"), seguid)
>>
>> Or, we could enhance your the CheckSum functions to cope with a 
>> SeqRecord, a Seq or a string - right now they cope with a Seq or a string.
>>
> Nice example.
> 
> The SeqRecord class is one of those classes in Biopython for which I never
> understood why they exist. A SeqRecord is nothing more than a Seq with some
> attributes attached. If we add those attributes to the Seq class directly,
> then we can get rid of the SeqRecord class. Then, functions such as those in
> CheckSum only need to cope with strings.
> 
> --Micheil.

I think having SeqRecord subclass Seq is nicer than simply adding 
annotation to the Seq class. Seq objects would (still) just have a 
sequence and alphabet, the SeqRecord becomes a rich/annotated Seq object.

I think this would be close to BioPerl's Seq and RichSeq objects.

I have filed an enhancement on Bugzilla to hold any suggested patches 
etc (I hope to upload something later tonight):

Bug 2351 - Make SeqRecord subclass Seq subclass string?
http://bugzilla.open-bio.org/show_bug.cgi?id=2351

Peter


From mdehoon at c2b2.columbia.edu  Wed Aug 29 22:20:01 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Wed, 29 Aug 2007 22:20:01 -0400
Subject: [BioPython] Bio.MarkupEditor
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B60D@mail2.exch.c2b2.columbia.edu>

Does anybody use this module? It is not used anywhere in Biopython. If it is
not being used, I suggest to deprecate it.

--Michiel.


Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032



From jimmy.musselwhite at gmail.com  Wed Aug 29 23:46:51 2007
From: jimmy.musselwhite at gmail.com (Jimmy Musselwhite)
Date: Wed, 29 Aug 2007 23:46:51 -0400
Subject: [BioPython] Cluster problem keeping me from getting started
Message-ID: <86e5e8970708292046m55ffa549p4544d2a1ffd2c294@mail.gmail.com>

Hi everyone
I'm trying to start an assignment I have using BioPython but a critical
functionality is not working for me. When I do

python run_tests.py

It "hangs" at

test_Cluster ...

and if I run test_Cluster.py by itself it does not complete properly.

I installed Cluster 3.0 from the bonsai website and then I even re-installed
PyCluster from the source there. I don't know what else could be wrong here!
I really need Cluster to work. It's pretty much the point of my assignment.

Thanks!

From mdehoon at c2b2.columbia.edu  Wed Aug 29 23:59:51 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Wed, 29 Aug 2007 23:59:51 -0400
Subject: [BioPython] Cluster problem keeping me from getting started
References: <86e5e8970708292046m55ffa549p4544d2a1ffd2c294@mail.gmail.com>
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B60F@mail2.exch.c2b2.columbia.edu>

This was fixed in CVS. If you pick up the new Bio.Cluster source files from
here:

http://cvs.biopython.org/cgi-bin/viewcvs/viewcvs.cgi/biopython/Bio/Cluster/?c
vsroot=biopython

copy them over the corresponding files in the biopython-1.43 distribution,
and reinstall, the test should run to completion. If it doesn't, please let
me know.

--Michiel.


Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032



-----Original Message-----
From: biopython-bounces at lists.open-bio.org on behalf of Jimmy Musselwhite
Sent: Wed 8/29/2007 11:46 PM
To: biopython at lists.open-bio.org
Subject: [BioPython] Cluster problem keeping me from getting started
 
Hi everyone
I'm trying to start an assignment I have using BioPython but a critical
functionality is not working for me. When I do

python run_tests.py

It "hangs" at

test_Cluster ...

and if I run test_Cluster.py by itself it does not complete properly.

I installed Cluster 3.0 from the bonsai website and then I even re-installed
PyCluster from the source there. I don't know what else could be wrong here!
I really need Cluster to work. It's pretty much the point of my assignment.

Thanks!
_______________________________________________
BioPython mailing list  -  BioPython at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biopython



From jdiezperezj at gmail.com  Wed Aug  1 08:13:24 2007
From: jdiezperezj at gmail.com (=?ISO-8859-1?Q?Javier_D=EDez?=)
Date: Wed, 1 Aug 2007 10:13:24 +0200
Subject: [BioPython] blast output xml
In-Reply-To: <46AF51CA.2030005@maubp.freeserve.co.uk>
References: <e85a576d0707310738s1befce8ga78cb1a28dbe51fa@mail.gmail.com>
	<46AF51CA.2030005@maubp.freeserve.co.uk>
Message-ID: <e85a576d0708010113s7f11d238h7867b71570fa9151@mail.gmail.com>

Hy Peter,
I followed the tutorial cookbook steps but I got the same exception (see
below). The output I got running blast locally is not XML but text. I guess
it might be related to the version I'm using (python 2.5, biopython
1.42.2on ubuntu
7.4). Any idea?
On the other hand I think there is a mistake in the cookbook, instead of:
>>> from Bio.Blast import NCBIXML
>>> blast_records = NCBIXML.parse(result_handle)
I think it should be:
>>> blast_parser= NCBIXML.BlastParser()
>>> blast_result=blast_parser.parse(result_handle)
Thanks
Javi

Traceback (most recent call last):
  File "<stdin>", line 1, in <module>
  File "/var/lib/python-support/python2.5/Bio/Blast/NCBIXML.py", line 112,
in parse
    self._parser.parse(handler)
  File "/usr/lib/python2.5/site-packages/_xmlplus/sax/expatreader.py", line
109, in parse
    xmlreader.IncrementalParser.parse(self, source)
  File "/usr/lib/python2.5/site-packages/_xmlplus/sax/xmlreader.py", line
125, in parse
    self.close()
  File "/usr/lib/python2.5/site-packages/_xmlplus/sax/expatreader.py", line
226, in close
    self.feed("", isFinal = 1)
  File "/usr/lib/python2.5/site-packages/_xmlplus/sax/expatreader.py", line
220, in feed
    self._err_handler.fatalError(exc)
  File "/usr/lib/python2.5/site-packages/_xmlplus/sax/handler.py", line 38,
in fatalError
    raise exception
xml.sax._exceptions.SAXParseException: <fdopen>:1:0: no element found


On 7/31/07, Peter <biopython at maubp.freeserve.co.uk> wrote:
>
> Javier D?ez wrote:
> > Hi,
> > Does anyone knows if is it possible to get blast-xml output running
> blast
> > from biopython scripts?
> > How can I do that?
> > Thanks
> > Javi
>
> Yes, you can run standalone blast from Biopython, and parse its XML
> output. See "Chapter 3 BLAST" of the tutorial:
>
> http://biopython.org/DIST/docs/tutorial/Tutorial.html
>
> Note that while parsing the plain text worked well with older versions
> of BLAST. We don't recommend using this anymore - use the XML output.
>
> Peter
>



From mdehoon at c2b2.columbia.edu  Wed Aug  1 08:55:05 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Wed, 1 Aug 2007 04:55:05 -0400
Subject: [BioPython] blast output xml
References: <e85a576d0707310738s1befce8ga78cb1a28dbe51fa@mail.gmail.com><46AF51CA.2030005@maubp.freeserve.co.uk>
	<e85a576d0708010113s7f11d238h7867b71570fa9151@mail.gmail.com>
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>

Hi Javier,

> I followed the tutorial cookbook steps but I got the same exception (see
> below). The output I got running blast locally is not XML but text. I guess
> it might be related to the version I'm using (python 2.5, biopython
> 1.42.2on ubuntu 7.4). Any idea?

Use Biopython 1.43.

> On the other hand I think there is a mistake in the cookbook, instead of:
> >>> from Bio.Blast import NCBIXML
> >>> blast_records = NCBIXML.parse(result_handle)
> I think it should be:
> >>> blast_parser= NCBIXML.BlastParser()
> >>> blast_result=blast_parser.parse(result_handle)

The description in the cookbook is correct for Biopython 1.43.

As a note to the developers:
We should ask ourselves if distributing packages for various linuxes is
really a good idea. Installing Biopython isn't all that hard, and the
packages for linux tend to get behind as new Biopython versions come out,
causing confusion for our users.

--Michiel.


Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032



From biopython at maubp.freeserve.co.uk  Wed Aug  1 09:38:16 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 01 Aug 2007 10:38:16 +0100
Subject: [BioPython] blast output xml
In-Reply-To: <6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>
References: <e85a576d0707310738s1befce8ga78cb1a28dbe51fa@mail.gmail.com><46AF51CA.2030005@maubp.freeserve.co.uk>	<e85a576d0708010113s7f11d238h7867b71570fa9151@mail.gmail.com>
	<6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>
Message-ID: <46B05488.20609@maubp.freeserve.co.uk>

In Biopython 1.42, when calling standalone blast we defaulted requesting 
plain text output.

In Biopython 1.43, when calling standalone blast we default requesting 
to XML text output.

Around this time, the NCBI made a big change to how they produced XML 
output for multiple queries, and we had to change the way the NCBIXML 
library was used in Biopython 1.43 - and updated the documentation to match.

Michiel De Hoon wrote:
 >
 > The description in the cookbook is correct for Biopython 1.43.
 >

Maybe we should have added an explicit "you need Biopython 1.43 or 
later" rider on the Blast chapter?

> As a note to the developers:
> We should ask ourselves if distributing packages for various linuxes is
> really a good idea. Installing Biopython isn't all that hard, and the
> packages for linux tend to get behind as new Biopython versions come out,
> causing confusion for our users.

I think having the distributions provide (current) Biopython is great, 
as it is much simpler for new users to install it and its dependencies 
this way.  However, because of the problem of out of data packages, we 
should try and get in touch with the main distribution maintainers and 
try and bring them up to date more quickly.

Peter



From luca.beltrame at unimi.it  Wed Aug  1 09:34:36 2007
From: luca.beltrame at unimi.it (Luca Beltrame)
Date: Wed, 01 Aug 2007 11:34:36 +0200
Subject: [BioPython] blast output xml
In-Reply-To: <6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>
References: <e85a576d0707310738s1befce8ga78cb1a28dbe51fa@mail.gmail.com>
	<e85a576d0708010113s7f11d238h7867b71570fa9151@mail.gmail.com>
	<6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>
Message-ID: <200708011134.36479.luca.beltrame@unimi.it>

On Wednesday 01 August 2007 10:55:05 Michiel De Hoon wrote:

> We should ask ourselves if distributing packages for various linuxes is
> really a good idea. Installing Biopython isn't all that hard, and the

Some  (like myself) prefer to use the distribution's package management system 
which at least prevents conflicts with multiple versions and provides a 
better way to track what's installed and what's not.
So, personally I think it's a good idea to distribute packages.

-- 
Luca Beltrame, MSc. - Molecular Medicine PhD Student
Dipartimento di Scienze e Tecnologie Biomediche - UniMI
E-mail: luca dot beltrame at unimi dot it 


From sbassi at gmail.com  Wed Aug  1 17:48:33 2007
From: sbassi at gmail.com (Sebastian Bassi)
Date: Wed, 1 Aug 2007 14:48:33 -0300
Subject: [BioPython] blast output xml
In-Reply-To: <6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>
References: <e85a576d0707310738s1befce8ga78cb1a28dbe51fa@mail.gmail.com>
	<46AF51CA.2030005@maubp.freeserve.co.uk>
	<e85a576d0708010113s7f11d238h7867b71570fa9151@mail.gmail.com>
	<6243BAA9F5E0D24DA41B27997D1FD14402B5FE@mail2.exch.c2b2.columbia.edu>
Message-ID: <b43bf2080708011048v76fb3fa5x31ec79ca3b2a2cf9@mail.gmail.com>

On 8/1/07, Michiel De Hoon <mdehoon at c2b2.columbia.edu> wrote:
> As a note to the developers:
> We should ask ourselves if distributing packages for various linuxes is
> really a good idea. Installing Biopython isn't all that hard, and the
> packages for linux tend to get behind as new Biopython versions come out,
> causing confusion for our users.

I think that packages should be distributed, but with a clear warning
about the benefits of installing the last version.
In some webhostings, webmasters won't let you install a tar.gz
package, but they would allow you to install a package in
Debian/Ubuntu repositories (for security reasons).
Best,
SB.

-- 
Bioinformatics news: http://www.bioinformatica.info
Lriser: http://www.linspire.com/lraiser_success.php?serial=318


From jodyhey at yahoo.com  Wed Aug  1 19:56:54 2007
From: jodyhey at yahoo.com (Emanuel Hey)
Date: Wed, 1 Aug 2007 12:56:54 -0700 (PDT)
Subject: [BioPython] accessing "data quality"  Phrap records in Genbank
Message-ID: <14649.20165.qm@web53907.mail.re2.yahoo.com>


for some sequence records, NCBI has a a record of the
Phrap scores corresponding to the sequence  (i.e. one
score for each base). 

These are typically records containing draft sequences
from genome projects

to see an example, try this link

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&qty=1&c_start=1&list_uids=153792835&uids=&dopt=qual&dispmax=5&sendto=&fmt_mask=0&from=begin&to=end&extrafeatpresent=1&ef_CDD=8&ef_MGC=16&ef_HPRD=32&ef_STS=64&ef_tRNA=128&ef_microRNA=256&ef_Exon=512


How could I go about downloading these sequence
quality scores?  

I need to filter the data by a certain score

thanks

jhey



       
____________________________________________________________________________________
Moody friends. Drama queens. Your life? Nope! - their life, your story. Play Sims Stories at Yahoo! Games.
http://sims.yahoo.com/  


From biopython at maubp.freeserve.co.uk  Wed Aug  1 21:05:33 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 01 Aug 2007 22:05:33 +0100
Subject: [BioPython] accessing "data quality"  Phrap records in Genbank
In-Reply-To: <14649.20165.qm@web53907.mail.re2.yahoo.com>
References: <14649.20165.qm@web53907.mail.re2.yahoo.com>
Message-ID: <46B0F59D.7080804@maubp.freeserve.co.uk>

Emanuel Hey wrote:
> for some sequence records, NCBI has a a record of the
> Phrap scores corresponding to the sequence  (i.e. one
> score for each base). 
> 
> These are typically records containing draft sequences
> from genome projects
> 
> to see an example, try this link
> 
> http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&qty=1&c_start=1&list_uids=153792835&uids=&dopt=qual&dispmax=5&sendto=&fmt_mask=0&from=begin&to=end&extrafeatpresent=1&ef_CDD=8&ef_MGC=16&ef_HPRD=32&ef_STS=64&ef_tRNA=128&ef_microRNA=256&ef_Exon=512
> 
> How could I go about downloading these sequence
> quality scores?  

One option for getting the data would be to construct the URL then 
download it using standard python tools, e.g. the urllib.urlretrieve 
function. Alternatively Biopython has some NCBI/Entrez code you might be 
able to use...

The second step is actually parsing the data file into a usable form. 
The "Base Quality" format looks very easy to parse, with a FASTA like 
header followed by space separated decimal scores.  Their XML format 
also looks fairly simple - the core data looks like its held as a string 
where each two characters represents one score in hex.  As far as I 
could see based on the URL you gave, none of the other format options 
actually contain the "data quality" information.

I'm not aware of any code in Biopython to cope with either of these file 
formats.

> I need to filter the data by a certain score

Are you trying to select parts of the associated sequence?

Peter



From fkauff at biologie.uni-kl.de  Thu Aug  2 07:54:24 2007
From: fkauff at biologie.uni-kl.de (Frank Kauff)
Date: Thu, 02 Aug 2007 09:54:24 +0200
Subject: [BioPython] accessing "data quality"  Phrap records in Genbank
In-Reply-To: <46B0F59D.7080804@maubp.freeserve.co.uk>
References: <14649.20165.qm@web53907.mail.re2.yahoo.com>
	<46B0F59D.7080804@maubp.freeserve.co.uk>
Message-ID: <web-40573246@uni-kl.de>


On Wed, 01 Aug 2007 22:05:33 +0100
  Peter <biopython at maubp.freeserve.co.uk> wrote:
> Emanuel Hey wrote:
>> for some sequence records, NCBI has a a record of the
>> Phrap scores corresponding to the sequence  (i.e. one
>> score for each base). 
>> 
...>
> I'm not aware of any code in Biopython to cope with 
>either of these file 
> formats.
>

Ace.py and Phd.py in Bio/Sequencing are two parsers that 
parse the phd and ace files generated by phred and phrap

Frank
  
>> I need to filter the data by a certain score
> 
> Are you trying to select parts of the associated 
>sequence?
> 
> Peter
> 
> _______________________________________________
> BioPython mailing list  -  BioPython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython

--
J-Prof. Dr. Frank Kauff
Molecular Phylogenetics
FB Biologie, 13/276
TU Kaiserslautern
Postfach 3049
67653 Kaiserslautern

Tel. +49 (0)631 205-2562
Fax. +49 (0)631 205-2998
email: fkauff at biologie.uni-kl.de
skype: frank.kauff


From jodyhey at yahoo.com  Fri Aug  3 01:20:38 2007
From: jodyhey at yahoo.com (Emanuel Hey)
Date: Thu, 2 Aug 2007 18:20:38 -0700 (PDT)
Subject: [BioPython] accessing "data quality"  Phrap records in Genbank
In-Reply-To: <46B0F59D.7080804@maubp.freeserve.co.uk>
Message-ID: <81290.42390.qm@web53907.mail.re2.yahoo.com>


Thanks.  urllib does the job quite well.

--- Peter <biopython at maubp.freeserve.co.uk> wrote:

> Emanuel Hey wrote:
> > for some sequence records, NCBI has a a record of
> the
> > Phrap scores corresponding to the sequence  (i.e.
> one
> > score for each base). 
> > 
> > These are typically records containing draft
> sequences
> > from genome projects
> > 
> > to see an example, try this link
> > 
> >
>
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&qty=1&c_start=1&list_uids=153792835&uids=&dopt=qual&dispmax=5&sendto=&fmt_mask=0&from=begin&to=end&extrafeatpresent=1&ef_CDD=8&ef_MGC=16&ef_HPRD=32&ef_STS=64&ef_tRNA=128&ef_microRNA=256&ef_Exon=512
> > 
> > How could I go about downloading these sequence
> > quality scores?  
> 
> One option for getting the data would be to
> construct the URL then 
> download it using standard python tools, e.g. the
> urllib.urlretrieve 
> function. Alternatively Biopython has some
> NCBI/Entrez code you might be 
> able to use...
> 
> The second step is actually parsing the data file
> into a usable form. 
> The "Base Quality" format looks very easy to parse,
> with a FASTA like 
> header followed by space separated decimal scores. 
> Their XML format 
> also looks fairly simple - the core data looks like
> its held as a string 
> where each two characters represents one score in
> hex.  As far as I 
> could see based on the URL you gave, none of the
> other format options 
> actually contain the "data quality" information.
> 
> I'm not aware of any code in Biopython to cope with
> either of these file 
> formats.
> 
> > I need to filter the data by a certain score
> 
> Are you trying to select parts of the associated
> sequence?
> 
> Peter
> 
> 



       
____________________________________________________________________________________
Be a better Globetrotter. Get better travel answers from someone who knows. Yahoo! Answers - Check it out.
http://answers.yahoo.com/dir/?link=list&sid=396545469


From letondal at pasteur.Fr  Fri Aug  3 08:55:12 2007
From: letondal at pasteur.Fr (Catherine Letondal)
Date: Fri, 3 Aug 2007 10:55:12 +0200
Subject: [BioPython] Course in informatics for biology 2008 at Institut
	Pasteur
Message-ID: <575EDD34-F5C4-4DF4-97FF-CCC1E4219A01@pasteur.Fr>

Hi,

    
************************************************************************ 
*
      Course in informatics for biology 2008 at Institut Pasteur
         http://www.pasteur.fr/formation/infobio-en.html
    
************************************************************************ 
*

      In the series of courses offered at the Pasteur Institute, a  
course
will be offered in informatics in biology. The next session will take
place from January to end of April 2008.

      The main goal of this course is to provide researchers in biology
an initial exposure to informatics. Admitance in the course is reserved
for those with a degree in biology or a related discipline.

      With more and more bioinformatics tools available, it becomes
increasingly important for researchers in biology to be able both to
manage their data, implement their ideas, and judge for themselves the
usefulness of new algorithms and software.

      This course will emphasize fundamental aspects of computer science
and apply them to biological examples. Theoretical aspects (algorithm
development, logic, problem modeling and design methods), and technical
applications (databases and web technologies) that are relevant for
biologists will be thoroughly discussed.

      Programming is presented through the object-oriented paradigm,
using a modern high-level language, Python, provided with tools for
biology and enabling both prototyping or scripting and the building of
important software systems. Learning of an additional language (C) will
be available for interested students.

      Learning during the course will be reinforced with computing
exercises, and effective training will be provided by a 2 month research
project.

      The working language of the course is French.

For further information, please consult:

      http://www.pasteur.fr/formation/infobio-en.html

   *** Registration will be closed on October 1 2007. ***

Sincerely,


--
Benno Schwikowski & Catherine Letondal
Institut Pasteur -- Course in Informatics for Biology
www.pasteur.fr/formation/infobio



From sbassi at gmail.com  Tue Aug 14 16:45:26 2007
From: sbassi at gmail.com (Sebastian Bassi)
Date: Tue, 14 Aug 2007 13:45:26 -0300
Subject: [BioPython] Inverse codon table?
Message-ID: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>

I am looking for a table in Biopython of amino-acids and its codons. I
found in Data.CodonTable a table but it should be used in the inverse
way I need:

>>> from Bio.Data import CodonTable
>>> t=CodonTable.standard_dna_table
>>> t.forward_table["ATG"]
'M'

I need a table that I coulld enter "M" and get the all triples that
translate into "M". Is this available in Biopyhon?


-- 
Bioinformatics news: http://www.bioinformatica.info
Lriser: http://www.linspire.com/lraiser_success.php?serial=318


From sbassi at gmail.com  Tue Aug 14 17:38:01 2007
From: sbassi at gmail.com (Sebastian Bassi)
Date: Tue, 14 Aug 2007 14:38:01 -0300
Subject: [BioPython] Inverse codon table?
In-Reply-To: <46C1E3AB.1000100@maubp.freeserve.co.uk>
References: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
	<46C1E3AB.1000100@maubp.freeserve.co.uk>
Message-ID: <b43bf2080708141038g429c95b5pb9e9e64331955aa6@mail.gmail.com>

On 8/14/07, Peter <biopython at maubp.freeserve.co.uk> wrote:
> I'm not sure without a thorough check, but its fairly be trivial to
> build such a dictionary from the CodonTable.standard_dna_table like this:
...

Thnaks.
That is nicer than my hand made back trans dictionary:

tdict={"A":("GCT","GCC","GCA","GCG"),"R":("CGT","CGC","CGA","CGG","AGA","AGG"),\
       "N":("AAT","ACC"),"D":("GAT","GAC"),"C":("TGT","TGC"),"Q":("CAA","CAG"),\
       "E":("GAA","GAG"),"G":("GGT","GGC","GGA","GGG"),"H":("CAT","CAC"),\
       "I":("ATT","ATC","ATA"),"L":("TTA","TTG","CTT","CTC","CTA","CTG"),\
       "K":("AAA","AAG"),"M":("AUG"),"F":("TTT","TTC"),"P":\
       ("CCT","CCC","CCA","CCG"),"S":("TCT","TCC","TCA","TCG","AGT","AGC"),\
       "T":("ACT","ACC","ACA","ACG"),"W":("TGG"),"Y":("TAT","TAC"),\
       "V":("GTT","GTC","GTA","GTG")}

And yours is better since allows to construct a back dict using
another translation table.

Best,
SB.

-- 
Bioinformatics news: http://www.bioinformatica.info
Lriser: http://www.linspire.com/lraiser_success.php?serial=318


From biopython at maubp.freeserve.co.uk  Tue Aug 14 17:17:31 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 14 Aug 2007 18:17:31 +0100
Subject: [BioPython] Inverse codon table?
In-Reply-To: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
References: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
Message-ID: <46C1E3AB.1000100@maubp.freeserve.co.uk>

Sebastian Bassi wrote:
> I am looking for a table in Biopython of amino-acids and its codons. I
> found in Data.CodonTable a table but it should be used in the inverse
> way I need:
> 
>>>> from Bio.Data import CodonTable
>>>> t=CodonTable.standard_dna_table
>>>> t.forward_table["ATG"]
> 'M'
> 
> I need a table that I coulld enter "M" and get the all triples that
> translate into "M". Is this available in Biopyhon?
> 

I'm not sure without a thorough check, but its fairly be trivial to 
build such a dictionary from the CodonTable.standard_dna_table like this:

from Bio.Data import CodonTable
t=CodonTable.standard_dna_table
t.forward_table["ATG"]

#Build a back table dict where the values are lists of codons...
bt = dict()
for a1 in "ATCG" :
     for a2 in "ATCG" :
         for a3 in "ATCG" :
             codon = a1+a2+a3
             try :
                 amino = t.forward_table[codon]
             except KeyError :
                 assert codon in t.stop_codons
                 continue
             try :
                 bt[amino].append(codon)
             except KeyError :
                 bt[amino] = [codon]

for amino in bt :
     print amino, bt[amino]


Peter





From p.pagel at gsf.de  Tue Aug 14 18:08:18 2007
From: p.pagel at gsf.de (Philipp Pagel)
Date: Tue, 14 Aug 2007 20:08:18 +0200
Subject: [BioPython] Inverse codon table?
In-Reply-To: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
References: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
Message-ID: <20070814180817.GA3154@gsf.de>


	Hi!

> I need a table that I coulld enter "M" and get the all triples that
> translate into "M". Is this available in Biopyhon?

Hm - I'm not sure but it's easy enough to make one yourself:

>>> foo = {}
>>> for codon, AA in t.forward_table.items():
...     if AA not in foo:
...             foo[AA] = []
...     foo[AA].append(codon)
...
>>> foo['L']
['CTT', 'CTG', 'CTA', 'CTC', 'TTA', 'TTG']
>>> foo['V']
['GTA', 'GTC', 'GTG', 'GTT']

cu
	Philipp

-- 
Dr. Philipp Pagel                              Tel.  +49-8161-71 2131
Lehrstuhl f?r Genomorientierte Bioinformatik   Fax.  +49-8161-71 2186
Technische Universit?t M?nchen
Wissenschaftszentrum Weihenstephan
85350 Freising, Germany

 and

Institut f?r Bioinformatik / MIPS
GSF - Forschungszentrum f?r Umwelt und Gesundheit
Ingolst?dter Landstrasse 1
85764 Neuherberg, Germany
http://mips.gsf.de/staff/pagel



From sbassi at gmail.com  Tue Aug 14 18:44:15 2007
From: sbassi at gmail.com (Sebastian Bassi)
Date: Tue, 14 Aug 2007 15:44:15 -0300
Subject: [BioPython] Inverse codon table?
In-Reply-To: <20070814180817.GA3154@gsf.de>
References: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
	<20070814180817.GA3154@gsf.de>
Message-ID: <b43bf2080708141144u757e1d5fo408ed95ef795cddb@mail.gmail.com>

On 8/14/07, Philipp Pagel <p.pagel at gsf.de> wrote:
> >>> foo = {}
> >>> for codon, AA in t.forward_table.items():
> ...     if AA not in foo:
> ...             foo[AA] = []
> ...     foo[AA].append(codon)

That is also woks!
My goal is to make a function that will return ALL possible
backtranslated sequences from a given peptide. The back_translate
function from Biopython just return one possible sequence. I want them
all :)

-- 
Bioinformatics news: http://www.bioinformatica.info
Lriser: http://www.linspire.com/lraiser_success.php?serial=318


From sbassi at gmail.com  Tue Aug 14 18:55:24 2007
From: sbassi at gmail.com (Sebastian Bassi)
Date: Tue, 14 Aug 2007 15:55:24 -0300
Subject: [BioPython] Inverse codon table?
In-Reply-To: <b43bf2080708141144u757e1d5fo408ed95ef795cddb@mail.gmail.com>
References: <b43bf2080708140945j2c5b61bfva05ae009c17c53b9@mail.gmail.com>
	<20070814180817.GA3154@gsf.de>
	<b43bf2080708141144u757e1d5fo408ed95ef795cddb@mail.gmail.com>
Message-ID: <b43bf2080708141155v19ac4c61ie5132b6d0dc0ac30@mail.gmail.com>

On 8/14/07, Sebastian Bassi <sbassi at gmail.com> wrote:
> function from Biopython just return one possible sequence. I want them
> all :)

This returns all possible combinations:

peptidoORI="MANCNGASK"
tot=0
for x in peptidoORI:
    tot=tot+len(bt[x])
allpepts=[""]*tot
for aa in peptidoORI:
    i=0
    for x in range(tot):
        if i==len(bt[aa]):
            i=0
        else:
            pass
        allpepts[x]=allpepts[x]+bt[aa][i]
        i=i+1

>>> allpepts
['ATGGCAAATTGTAATGGAGCAAGTAAA', 'ATGGCTAACTGCAACGGTGCTAGCAAG',
'ATGGCCAATTGTAATGGCGCCTCAAAA', 'ATGGCGAACTGCAACGGGGCGTCTAAG',
'ATGGCAAATTGTAATGGAGCATCCAAA', 'ATGGCTAACTGCAACGGTGCTTCGAAG',
'ATGGCCAATTGTAATGGCGCCAGTAAA', 'ATGGCGAACTGCAACGGGGCGAGCAAG',
'ATGGCAAATTGTAATGGAGCATCAAAA', 'ATGGCTAACTGCAACGGTGCTTCTAAG',
'ATGGCCAATTGTAATGGCGCCTCCAAA', 'ATGGCGAACTGCAACGGGGCGTCGAAG',
'ATGGCAAATTGTAATGGAGCAAGTAAA', 'ATGGCTAACTGCAACGGTGCTAGCAAG',
'ATGGCCAATTGTAATGGCGCCTCAAAA', 'ATGGCGAACTGCAACGGGGCGTCTAAG',
'ATGGCAAATTGTAATGGAGCATCCAAA', 'ATGGCTAACTGCAACGGTGCTTCGAAG',
'ATGGCCAATTGTAATGGCGCCAGTAAA', 'ATGGCGAACTGCAACGGGGCGAGCAAG',
'ATGGCAAATTGTAATGGAGCATCAAAA', 'ATGGCTAACTGCAACGGTGCTTCTAAG',
'ATGGCCAATTGTAATGGCGCCTCCAAA', 'ATGGCGAACTGCAACGGGGCGTCGAAG',
'ATGGCAAATTGTAATGGAGCAAGTAAA', 'ATGGCTAACTGCAACGGTGCTAGCAAG',
'ATGGCCAATTGTAATGGCGCCTCAAAA']

-- 
Bioinformatics news: http://www.bioinformatica.info
Lriser: http://www.linspire.com/lraiser_success.php?serial=318


From Gabino.Sanchez-Perez at Dal.Ca  Tue Aug 14 23:57:40 2007
From: Gabino.Sanchez-Perez at Dal.Ca (Gabino Sanchez-Perez)
Date: Tue, 14 Aug 2007 20:57:40 -0300
Subject: [BioPython] Problem to obtain Hit length parsing with NCBIXML
Message-ID: <20070814205740.rd456mf5ow844o8k@my3.dal.ca>

Hi

I'm parsing a blastp output in XML format using NCBIXML, but my problem is that
I don't know how to get the Hit length (not alignment length), even though is
defined in the parser:

    def _end_Hit_len(self):
        self._hit.length = int(self._value)

So in my script when I iterate

 for alignment in brecord.alignments:
      for hsp in alignment.hits:

it seems that is not defined and the error message is that hit.length does not
exist.

Thanks in advance

Gabino


From mdehoon at c2b2.columbia.edu  Wed Aug 15 00:45:26 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Tue, 14 Aug 2007 20:45:26 -0400
Subject: [BioPython] Problem to obtain Hit length parsing with NCBIXML
References: <20070814205740.rd456mf5ow844o8k@my3.dal.ca>
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B604@mail2.exch.c2b2.columbia.edu>

This should work:

>>> for alignment in brecord.alignments:
...      print alignment.length

If it doesn't, please send us the exact code you are using, and the exact
error message that you got.

--Michiel.


Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032



-----Original Message-----
From: biopython-bounces at lists.open-bio.org on behalf of Gabino Sanchez-Perez
Sent: Tue 8/14/2007 7:57 PM
To: biopython at lists.open-bio.org
Subject: [BioPython] Problem to obtain Hit length parsing with NCBIXML
 
Hi

I'm parsing a blastp output in XML format using NCBIXML, but my problem is
that
I don't know how to get the Hit length (not alignment length), even though is
defined in the parser:

    def _end_Hit_len(self):
        self._hit.length = int(self._value)

So in my script when I iterate

 for alignment in brecord.alignments:
      for hsp in alignment.hits:

it seems that is not defined and the error message is that hit.length does
not
exist.

Thanks in advance

Gabino
_______________________________________________
BioPython mailing list  -  BioPython at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biopython




From winter at biotec.tu-dresden.de  Wed Aug 15 07:36:47 2007
From: winter at biotec.tu-dresden.de (Christof Winter)
Date: Wed, 15 Aug 2007 09:36:47 +0200
Subject: [BioPython] Problem to obtain Hit length parsing with NCBIXML
In-Reply-To: <20070814205740.rd456mf5ow844o8k@my3.dal.ca>
References: <20070814205740.rd456mf5ow844o8k@my3.dal.ca>
Message-ID: <46C2AD0F.3050207@biotec.tu-dresden.de>

Gabino Sanchez-Perez wrote:
> Hi
> 
> I'm parsing a blastp output in XML format using NCBIXML, but my problem is that
> I don't know how to get the Hit length (not alignment length), even though is
> defined in the parser:
> 
>     def _end_Hit_len(self):
>         self._hit.length = int(self._value)
> 
> So in my script when I iterate
> 
>  for alignment in brecord.alignments:
>       for hsp in alignment.hits:
> 
> it seems that is not defined and the error message is that hit.length does not
> exist.

I can confirm what Michiel wrote:

alignment.length = total length of the unaligned hit sequence

HTH,
Christof


From Gabino.Sanchez-Perez at Dal.Ca  Wed Aug 15 12:23:26 2007
From: Gabino.Sanchez-Perez at Dal.Ca (Gabino Sanchez-Perez)
Date: Wed, 15 Aug 2007 09:23:26 -0300
Subject: [BioPython] Problem to obtain Hit length parsing with NCBIXML
In-Reply-To: <6243BAA9F5E0D24DA41B27997D1FD14402B604@mail2.exch.c2b2.columbia.edu>
References: <20070814205740.rd456mf5ow844o8k@my3.dal.ca>
	<6243BAA9F5E0D24DA41B27997D1FD14402B604@mail2.exch.c2b2.columbia.edu>
Message-ID: <20070815092326.ah56e2ud8w00k4wk@my5.dal.ca>

It works! I was confounded because I was looking for the length of the  
alignment (that now I see that is in hsp.sbjct) and I thought it was  
in alignment.length (Hit length).

Thank you very much for the help

Gabino

> This should work:
>
>>>> for alignment in brecord.alignments:
> ...      print alignment.length
>
> If it doesn't, please send us the exact code you are using, and the exact
> error message that you got.
>
> --Michiel.
>
>
> Michiel de Hoon
> Center for Computational Biology and Bioinformatics
> Columbia University
> 1150 St Nicholas Avenue
> New York, NY 10032
>
>
>
> -----Original Message-----
> From: biopython-bounces at lists.open-bio.org on behalf of Gabino Sanchez-Perez
> Sent: Tue 8/14/2007 7:57 PM
> To: biopython at lists.open-bio.org
> Subject: [BioPython] Problem to obtain Hit length parsing with NCBIXML
>
> Hi
>
> I'm parsing a blastp output in XML format using NCBIXML, but my problem is
> that
> I don't know how to get the Hit length (not alignment length), even though is
> defined in the parser:
>
>     def _end_Hit_len(self):
>         self._hit.length = int(self._value)
>
> So in my script when I iterate
>
>  for alignment in brecord.alignments:
>       for hsp in alignment.hits:
>
> it seems that is not defined and the error message is that hit.length does
> not
> exist.
>
> Thanks in advance
>
> Gabino
> _______________________________________________
> BioPython mailing list  -  BioPython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>
>






From douglas.kojetin at gmail.com  Wed Aug 15 18:30:41 2007
From: douglas.kojetin at gmail.com (Douglas Kojetin)
Date: Wed, 15 Aug 2007 14:30:41 -0400
Subject: [BioPython] Bio.PDB rotate/translate
Message-ID: <152CE16F-7F6D-46F3-B285-59FBB3671EED@gmail.com>

Hi All,

I would like to rotate a specific H and N vector in my structure  
file, so that it points in a different direction, but keep its  
location fixed in 3D space.  Here is what I've been working with, but  
it seems to move the atoms away from their original location.  I  
grabbed most of this from the Bio.PDB FAQ (the PDF file) and from the  
Bio.PDB documentation online.  I'm not sure if I should be using  
different values for the Vector/rotation line, or in the translation  
array, etc.

###
atom1 = structure[model.id][chain.id][residue.id[1]]['H']
atom2 = structure[model.id][chain.id][residue.id[1]]['N']

rotation = Bio.PDB.rotaxis( math.pi/2.0, Bio.PDB.Vector(1,0,0) )
translation = Numeric.array( (1,0,0), 'f' )

atom1.transform(rotation, translation)
atom2.transform(rotation, translation)
###

Thanks in advance for the help,

Doug



From jdiezperezj at gmail.com  Thu Aug 16 17:27:45 2007
From: jdiezperezj at gmail.com (=?ISO-8859-1?Q?Javier_D=EDez?=)
Date: Thu, 16 Aug 2007 19:27:45 +0200
Subject: [BioPython] psi mi
Message-ID: <e85a576d0708161027l2d5f75b5x9f8ed0b6e335341e@mail.gmail.com>

Hy,
Does anyone knows a python parser for PSI-MI format?
Thanks
Javi


From winter at biotec.tu-dresden.de  Thu Aug 16 17:53:01 2007
From: winter at biotec.tu-dresden.de (Christof Winter)
Date: Thu, 16 Aug 2007 19:53:01 +0200
Subject: [BioPython] psi mi
In-Reply-To: <e85a576d0708161027l2d5f75b5x9f8ed0b6e335341e@mail.gmail.com>
References: <e85a576d0708161027l2d5f75b5x9f8ed0b6e335341e@mail.gmail.com>
Message-ID: <46C48EFD.6080701@biotec.tu-dresden.de>

Javier D?ez wrote:
 > Hy,
 > Does anyone knows a python parser for PSI-MI format?
 > Thanks
 > Javi

Hi Javier:

I searched for one some time ago, and since I didn't find one, I wrote my own.
It's based on ElementTree:

http://effbot.org/zone/element-index.htm
http://docs.python.org/lib/module-xml.etree.ElementTree.html

It only parses some basic data from the PSIMI file, if you want to have a look 
at it, just drop me a line.

Cheers,
Christof


From meesters at uni-mainz.de  Thu Aug 16 18:33:56 2007
From: meesters at uni-mainz.de (Christian Meesters)
Date: Thu, 16 Aug 2007 20:33:56 +0200
Subject: [BioPython] Bio.PDB: possible to obtain chain identifier for atoms?
Message-ID: <1187289236.19033.17.camel@cmeesters>

Hi All,

I'm trying to build a somewhat bigger app which needs to calculate the
distance distribution function of a protein several times. For this
purpose I re-discovered BioPython today.
Speed is an issue, but since the protein in question isn't too big the
overhead of Python and BioPython might be tolerable.

Still, in order to speed up my code I would need to access the chain
identifier of atoms within a loop. To illustrate my question some
pseudo-code:

atoms = Selection.unfold_entities(structure, 'A')
for i, a in enumerate(atoms):
    for b in atoms[i+1:]:
	# do some calculations here ...

Now, I cannot avoid the double loop, but if I could check somehow
whether atoms a and b belong to the same chain (and which) I would have
to do this awkward looping only once this way.

Does anybody know an approach? As far as I understand the code of the
Atom class, there is no direct way, right?

TIA
Christian


From meesters at uni-mainz.de  Thu Aug 16 18:50:15 2007
From: meesters at uni-mainz.de (Christian Meesters)
Date: Thu, 16 Aug 2007 20:50:15 +0200
Subject: [BioPython] Bio.PDB rotate/translate
In-Reply-To: <152CE16F-7F6D-46F3-B285-59FBB3671EED@gmail.com>
References: <152CE16F-7F6D-46F3-B285-59FBB3671EED@gmail.com>
Message-ID: <1187290215.19033.34.camel@cmeesters>

Hi,

As you can see from my previous mail, I only just started to work with
BioPython today, again.

Still, I dare to ask back a few question.

Actually, I don't understand your question:
> I would like to rotate a specific H and N vector in my structure  
> file
Guess, this is a mistake and you don't want to rotate the vector itself.

I presume your structure looks like this:

H  N
 \/
 c1
 |
 c2

right?
And you want to turn around the axis defined by c1-c2? Then, if I
understand the 'PDB FAQ' correctly the code before the rotaxis line
should read:
c1 = residue[c1-identifier].get_vector()
c2 = residue[c2-identifier].get_vector()
rotation = rotaxis(angle, c1-c2)
Of course, your residue won't look like my sketch ...

> 
> rotation = Bio.PDB.rotaxis( math.pi/2.0, Bio.PDB.Vector(1,0,0) )
> translation = Numeric.array( (1,0,0), 'f' )
Here, you would shift the atoms by 1 ? along 'x'. Applied on only two
atoms, bonds would be stretched.

BTW, did you save the altered structure after applying the
rotation/translation?

If this was all wrong, please excuse a newbie answering this question.
But the mail was left unanswered for a while and it is still possible to
correct me ;-).

HTH
Christian



From meesters at uni-mainz.de  Fri Aug 17 07:15:39 2007
From: meesters at uni-mainz.de (Christian Meesters)
Date: Fri, 17 Aug 2007 09:15:39 +0200
Subject: [BioPython] Bio.PDB: possible to obtain chain identifier
	for	atoms?
In-Reply-To: <8e76d5310708161217s7e59e2ado6b4b514f6192c38e@mail.gmail.com>
References: <1187289236.19033.17.camel@cmeesters>
	<8e76d5310708161217s7e59e2ado6b4b514f6192c38e@mail.gmail.com>
Message-ID: <1187334939.26144.1.camel@cmeesters>

Hoi Katie,

apparently, yes. Life can be so easy ...

Thanks,
Christian

On Thu, 2007-08-16 at 15:17 -0400, Katie Edmonds wrote:
> Hi Christian,
> 
> are you looking for:
> chain1 = a.get_parent().get_parent()
> ?
> 
> Katie
> 
> On 8/16/07, Christian Meesters <meesters at uni-mainz.de> wrote:
>         Hi All,
>         
>         I'm trying to build a somewhat bigger app which needs to
>         calculate the 
>         distance distribution function of a protein several times. For
>         this
>         purpose I re-discovered BioPython today.
>         Speed is an issue, but since the protein in question isn't too
>         big the
>         overhead of Python and BioPython might be tolerable. 
>         
>         Still, in order to speed up my code I would need to access the
>         chain
>         identifier of atoms within a loop. To illustrate my question
>         some
>         pseudo-code:
>         
>         atoms = Selection.unfold_entities(structure, 'A') 
>         for i, a in enumerate(atoms):
>             for b in atoms[i+1:]:
>                 # do some calculations here ...
>         
>         Now, I cannot avoid the double loop, but if I could check
>         somehow
>         whether atoms a and b belong to the same chain (and which) I
>         would have 
>         to do this awkward looping only once this way.
>         
>         Does anybody know an approach? As far as I understand the code
>         of the
>         Atom class, there is no direct way, right?
>         
>         TIA
>         Christian
>         _______________________________________________ 
>         BioPython mailing list  -  BioPython at lists.open-bio.org
>         http://lists.open-bio.org/mailman/listinfo/biopython
> 


From Michael.Robeson at Colorado.EDU  Sat Aug 18 16:42:22 2007
From: Michael.Robeson at Colorado.EDU (Michael S. Robeson)
Date: Sat, 18 Aug 2007 10:42:22 -0600
Subject: [BioPython] qblast
Message-ID: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>

I have been using qblast (blastn) for a set of sequences. However, it  
gives me _completely_ different results than if I was to use the web  
interface at NCBI (also using blastn, nr). Is anyone else having this  
problem? Am I missing something?

Can anyone help with making sure that I am using the same settings in  
qblast as with the NCBI web interface?

Also, are there any plans for implementing megablast?

-Thanks!
-Mike


From biopython at maubp.freeserve.co.uk  Sat Aug 18 19:25:48 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Sat, 18 Aug 2007 20:25:48 +0100
Subject: [BioPython] qblast
In-Reply-To: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>
Message-ID: <46C747BC.6010002@maubp.freeserve.co.uk>

Michael S. Robeson wrote:
> I have been using qblast (blastn) for a set of sequences. However, it  
> gives me _completely_ different results than if I was to use the web  
> interface at NCBI (also using blastn, nr). Is anyone else having this  
> problem? Am I missing something?

Could you give us an example? Say three of sequences with details of how 
you use the web interface, and the code you are using in Biopython.

Peter



From Michael.Robeson at Colorado.EDU  Sat Aug 18 20:51:24 2007
From: Michael.Robeson at Colorado.EDU (Michael S. Robeson)
Date: Sat, 18 Aug 2007 14:51:24 -0600
Subject: [BioPython] qblast
In-Reply-To: <46C747BC.6010002@maubp.freeserve.co.uk>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>
	<46C747BC.6010002@maubp.freeserve.co.uk>
Message-ID: <EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>

Sure, I am using a really simple script that I wrote (link below) to  
start getting familiar w/ biopython. So, any other comments would be  
greatly appreciated.

http://ucsu.colorado.edu/~robeson/documents/blast.txt

Using this sequence:

TGTGATGGATATCTGCAGAATTCGCCCTTTAAACTTCAGGGTGACCAAAA
AATCAAAATAAATGTTGAAATAATACTGGATCTCCACCACCACTAACTTC
AAAAAATGTTGTATTAAAATTTCTATCAGTTAATAACATTGTTATAGCAC
CCCCTAATACTGGTAATGATAATAATAATAATCATGCTGTTATAAATACA
GCTCAAACAAATAAAGGTAACTTAAACATACTCATACCAGGTGTTCGCAT
ATTAATAACAGTAACAATAAAATTTATTGAACCTAATATTGATGATATAC
CAGCTAAATGTAAACTAAATATTGCACATTCTATTGAACCTCCTGAATGT
GAAAATATACCAGATAATGGTGGATAAACAGTTCAACCTGTACCTGCCCC
CATCTCGACTACAGATGATCAAATTAATAAAAAAAATGATGGTACTAATA
ATCAAAAACTTATATTATTTAATCTTGGGAATGCCATATCAGGAGCTCCT
ATCATTAAAGGTAAAAATCAATTACCAAAACCACCCATTAATGCAGGCAT
AACCATAAAAAATATCATTATTAAAGCATGTGCTGTTATTAACACATTAT
ATGCTTGATGATTGTAATTTAATATTACTGCACCAGCATCTGATAATTCT
ATACGTATTAATATAGATCAAAATGTTCCTATTAAACCTGCTAAAAATGC
AAATATTAAATATAATGTTCCAATATCTTTATGATTTGTTGACCAAGGGC
GAATTCCAGCACACTGGCGGCCGTTACTAG

Using blastn. When I use the web site I set the following:

Database = Others (nr etc..) w/ drop menu set to 'Nucleotide  
collection (nr/nt)'
Optimize for = 'Somewhat similar sequences (blastn)'

I assumed the above was the same as biopython's default qblast when  
using blastn. Basically, my script seemed worked fine until NCBI  
changed the layout of their site (I'd check every so often with a set  
of samples). I also tried to change my code with some of the new  
biopython code. But it is very hard to find good up-to-date  
tutorials. Last time I looked none of them worked.

Anyway, no matter what settings I use via the NCBI web interface I  
cannot get the same results as I do with qblast. So, unless I am  
missing something I wonder if there is something wrong with the back- 
end?

-Mike


On Aug 18, 2007, at 1:25 PM, Peter wrote:

> Michael S. Robeson wrote:
>> I have been using qblast (blastn) for a set of sequences. However,  
>> it  gives me _completely_ different results than if I was to use  
>> the web  interface at NCBI (also using blastn, nr). Is anyone else  
>> having this  problem? Am I missing something?
>
> Could you give us an example? Say three of sequences with details  
> of how you use the web interface, and the code you are using in  
> Biopython.
>
> Peter
>

----------------------------------------------
Michael S. Robeson II
Ecology and Evolutionary Biology
N122 Ramaley Hall
Campus Box 334
University of Colorado
Boulder, CO 80309
robeson at colorado.edu
http://ucsu.colorado.edu/~robeson/



From biopython at maubp.freeserve.co.uk  Sat Aug 18 21:55:08 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Sat, 18 Aug 2007 22:55:08 +0100
Subject: [BioPython] qblast
In-Reply-To: <EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>	<46C747BC.6010002@maubp.freeserve.co.uk>
	<EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>
Message-ID: <46C76ABC.9040608@maubp.freeserve.co.uk>

Michael S. Robeson wrote:
> Sure, I am using a really simple script that I wrote (link below) to  
> start getting familiar w/ biopython. So, any other comments would be  
> greatly appreciated.
 >
 > http://ucsu.colorado.edu/~robeson/documents/blast.txt

Assuming you are using Biopython 1.43, then I would have suggested using 
Bio.SeqIO rather than Bio.Fasta for reading/writing FASTA files. See the 
tutorial or http://www.biopython.org/wiki/SeqIO

I'm also unclear why you want to save individual output blast HTML pages 
(one file per sequence). Trying to parse these HTML files later will be 
a pain - go from the XML output if you want to read the blast output 
with Biopython.

> I assumed the above was the same as biopython's default qblast when  
> using blastn. Basically, my script seemed worked fine until NCBI  
> changed the layout of their site (I'd check every so often with a set  
> of samples).

See my other email - they should be the same if all the parameters are 
the same (specifically it looks like the NCBI seems to be using 
different defaults for the gap penalties, which was very confusing).

 > I also tried to change my code with some of the new
> biopython code. But it is very hard to find good up-to-date  
> tutorials. Last time I looked none of them worked.

Can you point out any out of date documentation please?
As far as I know, the BLAST examples in our tutorial work fine:
http://biopython.org/DIST/docs/tutorial/Tutorial.html

Peter



From biopython at maubp.freeserve.co.uk  Sat Aug 18 21:38:52 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Sat, 18 Aug 2007 22:38:52 +0100
Subject: [BioPython] qblast
In-Reply-To: <EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>	<46C747BC.6010002@maubp.freeserve.co.uk>
	<EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>
Message-ID: <46C766EC.6030601@maubp.freeserve.co.uk>

Hi Michael,

Here is a short script based on your example, which I have tested for 
calling qblast:

from Bio.Blast.NCBIWWW import qblast
seq_string = "TGTGATGGATATCTGCAGAATTCGCCCTTTAAACTTCAGGGTGACCAAAA" \
            + "AATCAAAATAAATGTTGAAATAATACTGGATCTCCACCACCACTAACTTC" \
            + "AAAAAATGTTGTATTAAAATTTCTATCAGTTAATAACATTGTTATAGCAC" \
            + "CCCCTAATACTGGTAATGATAATAATAATAATCATGCTGTTATAAATACA" \
            + "GCTCAAACAAATAAAGGTAACTTAAACATACTCATACCAGGTGTTCGCAT" \
            + "ATTAATAACAGTAACAATAAAATTTATTGAACCTAATATTGATGATATAC" \
            + "CAGCTAAATGTAAACTAAATATTGCACATTCTATTGAACCTCCTGAATGT" \
            + "GAAAATATACCAGATAATGGTGGATAAACAGTTCAACCTGTACCTGCCCC" \
            + "CATCTCGACTACAGATGATCAAATTAATAAAAAAAATGATGGTACTAATA" \
            + "ATCAAAAACTTATATTATTTAATCTTGGGAATGCCATATCAGGAGCTCCT" \
            + "ATCATTAAAGGTAAAAATCAATTACCAAAACCACCCATTAATGCAGGCAT" \
            + "AACCATAAAAAATATCATTATTAAAGCATGTGCTGTTATTAACACATTAT" \
            + "ATGCTTGATGATTGTAATTTAATATTACTGCACCAGCATCTGATAATTCT" \
            + "ATACGTATTAATATAGATCAAAATGTTCCTATTAAACCTGCTAAAAATGC" \
            + "AAATATTAAATATAATGTTCCAATATCTTTATGATTTGTTGACCAAGGGC" \
            + "GAATTCCAGCACACTGGCGGCCGTTACTAG"
#result_handle = qblast('blastn', 'nr', seq_string, format_type='HTML')
#output_handle = open("test.html", "w")
#output_handle.write(result_handle.read())
#output_handle.close()
result_handle = qblast('blastn', 'nr', seq_string, format_type='Text')
output_handle = open("test.txt", "w")
output_handle.write(result_handle.read())
output_handle.close()
#result_handle = qblast('blastn', 'nr', seq_string, format_type='XML')
#output_handle = open("test.xml", "w")
#output_handle.write(result_handle.read())
#output_handle.close()
print "Done"

The top hits from the script were:

gb|AY916130.1|  Epidermophyton floccosum mitochondrion, complete
gb|EF180206.1|  Penicillium confertum voucher 171.87 cytochrom...
gb|EF180399.1|  Penicillium soppii voucher IBT 14908 cytochrom...
gb|EF180398.1|  Penicillium soppii voucher IBT 3331 cytochrome...
gb|EF180397.1|  Penicillium soppii voucher IBT 18220 cytochrom...
gb|EF180396.1|  Penicillium soppii voucher 226.28 cytochrome o...
gb|EF180395.1|  Penicillium soppii voucher 144.83 cytochrome o...

The top hits for me using online nblast for the same sequence also on 
the nr database:

gb|AY129164.1|  Pythium aphanidermatum cytochrome oxidase I ge...
gb|AY561976.1|  Scopalina ruetzleri cytochrome oxidase subunit...
gb|EF468468.1|  Phytophthora sp. H-6/02 cytochrome oxidase sub...
gb|DQ832717.1|  Phytophthora sojae mitochondrion, complete genome
gb|EF468470.1|  Phytophthora sp. H-8/02 cytochrome oxidase sub...
gb|EF468469.1|  Phytophthora sp. H-7/02 cytochrome oxidase sub...
gb|AY129166.1|  Phytophthora capsici cytochrome oxidase I gene...

i.e. Very different!

I switched to using plain text output as its easier to read by hand.

Both correctly understood the input query was 780 letters long.
Both claimed to be output from BLASTN 2.2.17
Both claimed to be output from the same database

There where some differences in the parameters footer - but I'm not sure 
why.  Using the script:

   Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, 
GSS,environmental
samples or phase 0, 1 or 2 HTGS sequences)
     Posted date:  Aug 16, 2007  6:06 PM
   Number of letters in database: -51,729,944
   Number of sequences in database:  5,751,035
Lambda     K      H
     1.37    0.711     1.31
Gapped
Lambda     K      H
     1.37    0.711     1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
...

While using the web browser:

   Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, 
GSS,environmental
samples or phase 0, 1 or 2 HTGS sequences)
     Posted date:  Aug 16, 2007  6:06 PM
   Number of letters in database: -51,729,944
   Number of sequences in database:  5,751,035
Lambda     K      H
    0.634    0.408    0.912
Gapped
Lambda     K      H
    0.634    0.408    0.912
Matrix: blastn matrix:2 -3
Gap Penalties: Existence: 5, Extension: 2
...


There is something funny here... does this throw any light on things?

Peter



From biopython at maubp.freeserve.co.uk  Sat Aug 18 21:47:31 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Sat, 18 Aug 2007 22:47:31 +0100
Subject: [BioPython] qblast
In-Reply-To: <46C766EC.6030601@maubp.freeserve.co.uk>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>	<46C747BC.6010002@maubp.freeserve.co.uk>
	<EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>
	<46C766EC.6030601@maubp.freeserve.co.uk>
Message-ID: <46C768F3.7020608@maubp.freeserve.co.uk>

Peter wrote:
> I switched to using plain text output as its easier to read by hand.
> 
> Both correctly understood the input query was 780 letters long.
> Both claimed to be output from BLASTN 2.2.17
> Both claimed to be output from the same database
> 
> There where some differences in the parameters footer - but I'm not sure 
> why.  Using the script:
> 
>   Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, 
> GSS,environmental
> samples or phase 0, 1 or 2 HTGS sequences)
>     Posted date:  Aug 16, 2007  6:06 PM
>   Number of letters in database: -51,729,944
>   Number of sequences in database:  5,751,035
> Lambda     K      H
>     1.37    0.711     1.31
> Gapped
> Lambda     K      H
>     1.37    0.711     1.31
> Matrix: blastn matrix:1 -3
> Gap Penalties: Existence: 5, Extension: 2
> ...
> 
> While using the web browser:
> 
>   Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, 
> GSS,environmental
> samples or phase 0, 1 or 2 HTGS sequences)
>     Posted date:  Aug 16, 2007  6:06 PM
>   Number of letters in database: -51,729,944
>   Number of sequences in database:  5,751,035
> Lambda     K      H
>    0.634    0.408    0.912
> Gapped
> Lambda     K      H
>    0.634    0.408    0.912
> Matrix: blastn matrix:2 -3
> Gap Penalties: Existence: 5, Extension: 2
> ...

Solved: Using qblast in a script defaulted to blastn matrix:1 -3, while 
the new webpage instead defaults to blastn matrix:2 -3

You can check this (and change it) on the webpage by clicking on 
"Algorithm parameters" and under "Scoring Parameters" changing 
"Match/Mismatch Scores" from "2, -3" to "1, -3".

Then the results seem to agree. Does that work for you?

Peter



From Michael.Robeson at Colorado.EDU  Sun Aug 19 00:13:10 2007
From: Michael.Robeson at Colorado.EDU (Michael S. Robeson)
Date: Sat, 18 Aug 2007 18:13:10 -0600
Subject: [BioPython] qblast
In-Reply-To: <46C76ABC.9040608@maubp.freeserve.co.uk>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>	<46C747BC.6010002@maubp.freeserve.co.uk>
	<EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>
	<46C76ABC.9040608@maubp.freeserve.co.uk>
Message-ID: <D4CFCAF1-0D46-4E6D-B07C-E450ADF5B2EA@colorado.edu>

>
> Assuming you are using Biopython 1.43, then I would have suggested  
> using Bio.SeqIO rather than Bio.Fasta for reading/writing FASTA  
> files. See the tutorial or http://www.biopython.org/wiki/SeqIO

Okay will do!

> I'm also unclear why you want to save individual output blast HTML  
> pages (one file per sequence). Trying to parse these HTML files  
> later will be a pain - go from the XML output if you want to read  
> the blast output with Biopython.

Actually I have another script which actually parses the blast and  
genbank data but this was one of the first scripts I wrote to make  
sure I can to the 'simple' things first. But I essectially use the  
same code to run blast.
>
> See my other email - they should be the same if all the parameters  
> are the same (specifically it looks like the NCBI seems to be using  
> different defaults for the gap penalties, which was very confusing).

Yes it is. I must have thought I changed those parameters when in  
fact I didn't. Thanks for checking on this!

> > I also tried to change my code with some of the new
>> biopython code. But it is very hard to find good up-to-date   
>> tutorials. Last time I looked none of them worked.
>
> Can you point out any out of date documentation please?
> As far as I know, the BLAST examples in our tutorial work fine:
> http://biopython.org/DIST/docs/tutorial/Tutorial.html

Okay, I must have been looking in the wrong places then. I'll go  
through the listed tutorials again. Is there a particular one you'd  
suggest? I have only looked at a few of the 'Online course notes'  
which is probably why. I just noticed the tutorial cookbook links. I  
must be blind!

And I am using the latest biopython (1.43) package as installed via  
fink for OS X.

Again, thanks! I'll play around with this more over the next day or  
so. I'll see if I can get my code to switch settings and see how the  
results are affected.

-Mike


From biopython at maubp.freeserve.co.uk  Sun Aug 19 12:36:42 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Sun, 19 Aug 2007 13:36:42 +0100
Subject: [BioPython] qblast + documentation
In-Reply-To: <D4CFCAF1-0D46-4E6D-B07C-E450ADF5B2EA@colorado.edu>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>	<46C747BC.6010002@maubp.freeserve.co.uk>	<EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>	<46C76ABC.9040608@maubp.freeserve.co.uk>
	<D4CFCAF1-0D46-4E6D-B07C-E450ADF5B2EA@colorado.edu>
Message-ID: <46C8395A.3040301@maubp.freeserve.co.uk>

Michael S. Robeson wrote:
>>> I also tried to change my code with some of the new
>>> biopython code. But it is very hard to find good up-to-date   
>>> tutorials. Last time I looked none of them worked.
>>
>> Can you point out any out of date documentation please?
>> As far as I know, the BLAST examples in our tutorial work fine:
>> http://biopython.org/DIST/docs/tutorial/Tutorial.html
> 
> Okay, I must have been looking in the wrong places then. I'll go  
> through the listed tutorials again. Is there a particular one you'd  
> suggest?

The main tutorial is probably best, and most up to date.
http://biopython.org/DIST/docs/tutorial/Tutorial.html

If you are interested in RPS-BLAST, then have a look here too:
http://www.warwick.ac.uk/go/peter_cock/python/rpsblast/

 > I have only looked at a few of the 'Online course notes'
> which is probably why. I just noticed the tutorial cookbook links. I  
> must be blind!

There have been changes in how we handle parsing Blast output in recent 
releases of Biopython (driven by changes the NCBI made).  We are are now 
recommending the use of XML output, but the Biopython code used to do 
this had to change a little compared to older releases.

This may mean that any "third party" tutorials are a little out of date now.

Peter



From meesters at uni-mainz.de  Mon Aug 20 15:15:39 2007
From: meesters at uni-mainz.de (Christian Meesters)
Date: Mon, 20 Aug 2007 17:15:39 +0200
Subject: [BioPython] deleting and inserting 'chains' in Bio.PDB
Message-ID: <1187622939.19858.18.camel@cmeesters>

Hi,

I'd like delete and insert subunits in my structure object. But the
following code does not work:

>>> parser = PDBParser()
>>> s = parser.get_structure('name','name.pdb')
>>> cs = [chain for chain in s.get_chains()]
>>> cs
[<Chain id=A>, <Chain id=B>, <Chain id=C>, <Chain id=D>, <Chain id=E>,
<Chain id=F>]
>>> c = cs[0]
>>> c
<Chain id=A>
>>> c.id
'A'
>>> c.get_id()
'A'
>>> s.detach_child('A')
Traceback (most recent call last):
  File "<stdin>", line 1, in <module>
  File "/var/lib/python-support/python2.5/Bio/PDB/Entity.py", line 70,
in detach_child
    child=self.child_dict[id] 
KeyError: 'A'
>>> s.detach_child("<Chain id=A>")
Traceback (most recent call last):
  File "<stdin>", line 1, in <module>
  File "/var/lib/python-support/python2.5/Bio/PDB/Entity.py", line 70,
in detach_child
    child=self.child_dict[id] 
KeyError: '<Chain id=A>'

Can somebody give me a hint of what I'm missing?

Thanks,
Christian


From thamelry at binf.ku.dk  Mon Aug 20 15:51:51 2007
From: thamelry at binf.ku.dk (Thomas Hamelryck)
Date: Mon, 20 Aug 2007 17:51:51 +0200
Subject: [BioPython] deleting and inserting 'chains' in Bio.PDB
In-Reply-To: <1187622939.19858.18.camel@cmeesters>
References: <1187622939.19858.18.camel@cmeesters>
Message-ID: <2d7c25310708200851v5732e2adpf1fdc49baed0cc09@mail.gmail.com>

On 8/20/07, Christian Meesters <meesters at uni-mainz.de> wrote:
> Hi,
>
> I'd like delete and insert subunits in my structure object. But the
> following code does not work:

A chain object should be removed at the level of the model object, not
at the level of the  structure object.

Remember:

Structure<-Model<-Chain<-Residue<-Atom

Cheers,

-Thomas


From meesters at uni-mainz.de  Mon Aug 20 16:01:08 2007
From: meesters at uni-mainz.de (Christian Meesters)
Date: Mon, 20 Aug 2007 18:01:08 +0200
Subject: [BioPython] deleting and inserting 'chains' in Bio.PDB
In-Reply-To: <2d7c25310708200851v5732e2adpf1fdc49baed0cc09@mail.gmail.com>
References: <1187622939.19858.18.camel@cmeesters>
	<2d7c25310708200851v5732e2adpf1fdc49baed0cc09@mail.gmail.com>
Message-ID: <1187625668.19858.21.camel@cmeesters>

Thanks! And thank you, Thomas, for your wonderful module!
The module is actually easy to use, despite of my questions ... ;-)

Cheers,
Christian


On Mon, 2007-08-20 at 17:51 +0200, Thomas Hamelryck wrote:
> On 8/20/07, Christian Meesters <meesters at uni-mainz.de> wrote:
> > Hi,
> >
> > I'd like delete and insert subunits in my structure object. But the
> > following code does not work:
> 
> A chain object should be removed at the level of the model object, not
> at the level of the  structure object.
> 
> Remember:
> 
> Structure<-Model<-Chain<-Residue<-Atom
> 
> Cheers,
> 
> -Thomas


From jodyhey at yahoo.com  Mon Aug 20 17:48:36 2007
From: jodyhey at yahoo.com (Emanuel Hey)
Date: Mon, 20 Aug 2007 10:48:36 -0700 (PDT)
Subject: [BioPython] Blast to genome specific databases?
In-Reply-To: <46C768F3.7020608@maubp.freeserve.co.uk>
Message-ID: <897102.52773.qm@web53903.mail.re2.yahoo.com>

NCBI has a blast form for genome specific datbases
that returns more information than does a blast to the
generic nucleotide database

http://www.ncbi.nlm.nih.gov/BLAST/

See e.g. for the human genome

http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=9606


I've used NCBIWWW.qblast and used biopython for stand
alone blasting,  but otherwise am not that experience.


Is there a way to script a search that generates the
same results as provided by these newere genome
specific interfaces?

Thanks

Jhey



       
____________________________________________________________________________________
Got a little couch potato? 
Check out fun summer activities for kids.
http://search.yahoo.com/search?fr=oni_on_mail&p=summer+activities+for+kids&cs=bz 


From cjfields at uiuc.edu  Mon Aug 20 19:17:48 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 20 Aug 2007 14:17:48 -0500
Subject: [BioPython] Blast to genome specific databases?
In-Reply-To: <897102.52773.qm@web53903.mail.re2.yahoo.com>
References: <897102.52773.qm@web53903.mail.re2.yahoo.com>
Message-ID: <F47FC071-2989-49A1-8C64-FD0E12029E07@uiuc.edu>

If you follow the directions on this page:

http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/remote_blastdblist.html

you should be able to modify the URLAPI DATABASE parameter to that in  
the list; another option would be to limit the results to a specific  
taxid (like 9606) using the ENTREZ_QUERY.  Not sure how that would be  
done for biopython (being a bioperler myself) but I'm sure someone  
could chip in?

chris

On Aug 20, 2007, at 12:48 PM, Emanuel Hey wrote:

> NCBI has a blast form for genome specific datbases
> that returns more information than does a blast to the
> generic nucleotide database
>
> http://www.ncbi.nlm.nih.gov/BLAST/
>
> See e.g. for the human genome
>
> http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi? 
> taxid=9606
>
>
> I've used NCBIWWW.qblast and used biopython for stand
> alone blasting,  but otherwise am not that experience.
>
>
> Is there a way to script a search that generates the
> same results as provided by these newere genome
> specific interfaces?
>
> Thanks
>
> Jhey
>
>
>
>
> ______________________________________________________________________ 
> ______________
> Got a little couch potato?
> Check out fun summer activities for kids.
> http://search.yahoo.com/search?fr=oni_on_mail&p=summer+activities 
> +for+kids&cs=bz
> _______________________________________________
> BioPython mailing list  -  BioPython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From biopython at maubp.freeserve.co.uk  Wed Aug 22 15:05:31 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 22 Aug 2007 16:05:31 +0100
Subject: [BioPython] Making the Seq object act more like a string
Message-ID: <46CC50BB.1090902@maubp.freeserve.co.uk>

Dear Biopython users,

A couple of times (on bugs or the developers mailing list), Michiel de 
Hoon has previously suggested we could make the Seq class (Bio.Seq.Seq) 
a subclass of python string. I agree with him - the Seq object should 
act more like a string.

I'm posting on the main discussion list to get some feedback on this, as 
any sudden changes could affect lots of people.

As a simple example, although there are functions in Biopython to 
calculate GC percentages, for a beginner playing with Seq objects, it 
would be nice to be able to do things like this (where s is a Seq object):

print float(s.count("G") + s.count("C")) / len(s)

rather for example this:

print float(s.tostring().count("G") + s.tostring().count("C")) / len(s)

I also don't think the current behaviour of str(seq) is helpful.  To 
recap, here is a simple example using a simple string:

 >>> ss = 'ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATGA'
 >>> print repr(ss)
'ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATGA'
 >>> print str(ss)
ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATGA
 >>> print ss
ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATGA

And the equivalent using a Seq object as of Biopython 1.43:

 >>> s = Seq("ACAGGTACGATCGATCCTGTTGTACGTGCTC"\
... +"GTCGACTGCTAGCTCGTCGTGGTCCGATGA")
 >>> print repr(s)
Seq('ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATGA', 
Alphabet())
 >>> print s.tostring()
ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATGA
 >>> print str(s)
Seq('ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATG ...', 
Alphabet())
 >>> print s
Seq('ACAGGTACGATCGATCCTGTTGTACGTGCTCGTCGACTGCTAGCTCGTCGTGGTCCGATG ...', 
Alphabet())

Note that currently doing str() on a Seq object gives a truncated 
version of what repr() gives. The only nice things about this is when 
working at the python command line, doing "print s" will only take one 
line even when working with a genome. And it makes it really clear you 
don't just have a string object.

That was the motivation/background part. Feel free to chime in :)

-----------------------------------------------------------------------

This next bit of the email gets a bit more technical... and might be 
better off on the developers mailing list. We'll see where any 
discussion goes.

If we can agree to that making Seq inherit from the basic string is a 
good idea, then I would advocate a gradual transition... my thoughts are 
that for the next release of Biopython we:

(1) Modify Seq .__str__() method to act like the existing .tostring(), 
i.e. return self.data

I don't think changing the __str__ method will break any serious code, 
because as shown above, currently its like a truncated version of 
__repr__ so all its useful for at the moment is getting a truncated 
sequence for display.

(2) Consider adding alphabet aware versions selected string methods to 
the Seq object (e.g. count, find)

Adding new methods to the Seq class should have no effect on existing usage.

Then, for the release afterwards:
(3) actually do the class inheritance with all the horrors entailed.

As part of this, we'll need to address how the __eq__ method of the Seq 
object should act: Looking at the sequence only, or considering the 
alphabet too? Currently this method is not implemented at all.

This is part of a larger question - how to cope with multiple Seq/string 
operations where there is more than one alphabet.  e.g. 
comparing/adding/joining a nucleotide Seq to a protein Seq object. I 
would opt for the simple solution that the alphabets must match or some 
sort of ValueError is raised. Alternatively, as the alphabets have a 
class hierarchy, we could choose the parent alphabet (e.g. the generic 
single letter alphabet when dealing with a DNA and Protein; or the 
generic single nucleotide alphabet when dealing with RNA and DNA).

Any thoughts?

Peter

[In fact, Michiel has also suggested making the SeqRecord class a 
subclass of the Seq class, which raises even more questions]



From sbassi at gmail.com  Wed Aug 22 15:41:53 2007
From: sbassi at gmail.com (Sebastian Bassi)
Date: Wed, 22 Aug 2007 12:41:53 -0300
Subject: [BioPython] Making the Seq object act more like a string
In-Reply-To: <46CC50BB.1090902@maubp.freeserve.co.uk>
References: <46CC50BB.1090902@maubp.freeserve.co.uk>
Message-ID: <b43bf2080708220841s7ba6bf7cof74a99866e4ef93a@mail.gmail.com>

On 8/22/07, Peter <biopython at maubp.freeserve.co.uk> wrote:
> A couple of times (on bugs or the developers mailing list), Michiel de
> Hoon has previously suggested we could make the Seq class (Bio.Seq.Seq)
> a subclass of python string. I agree with him - the Seq object should
> act more like a string.

I agree. Seq acting more like a str would also lower the entry level
to use biopython for non OOP seasoned programmers.

> As a simple example, although there are functions in Biopython to
...

Here is another example (from
http://www.biopython.org/wiki/SeqIO#Using_the_SEGUID_checksum):

Current situation:

from Bio import SeqIO
from Bio.SeqUtils.CheckSum import seguid
seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), "genbank"),
                            lambda rec : seguid(rec.seq))
record = seguid_dict["MN/s0q9zDoCVEEc+k/IFwCNF2pY"]
print record.id
print record.description

If seq were more like a string:

...
seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), "genbank"),
                            seguid(rec.seq))
....

This way you avoid using a lambda.


-- 
Bioinformatics news: http://www.bioinformatica.info
Lriser: http://www.linspire.com/lraiser_success.php?serial=318


From biopython at maubp.freeserve.co.uk  Wed Aug 22 15:53:59 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 22 Aug 2007 16:53:59 +0100
Subject: [BioPython] Making the Seq object act more like a string
In-Reply-To: <b43bf2080708220841s7ba6bf7cof74a99866e4ef93a@mail.gmail.com>
References: <46CC50BB.1090902@maubp.freeserve.co.uk>
	<b43bf2080708220841s7ba6bf7cof74a99866e4ef93a@mail.gmail.com>
Message-ID: <46CC5C17.4000709@maubp.freeserve.co.uk>

Sebastian Bassi wrote:
> On 8/22/07, Peter <biopython at maubp.freeserve.co.uk> wrote:
>> A couple of times (on bugs or the developers mailing list), Michiel de
>> Hoon has previously suggested we could make the Seq class (Bio.Seq.Seq)
>> a subclass of python string. I agree with him - the Seq object should
>> act more like a string.
> 
> I agree. Seq acting more like a str would also lower the entry level
> to use biopython for non OOP seasoned programmers.

Good :)

>> As a simple example, although there are functions in Biopython to
> ...
> 
> Here is another example (from
> http://www.biopython.org/wiki/SeqIO#Using_the_SEGUID_checksum ):

I added that to the wiki recently - although it is perhaps premature 
given your CheckSum code hasn't been officially release yet. This was my 
draft, moving/adding it to the tutorial is on my to do list.

> Current situation:
> 
> from Bio import SeqIO
> from Bio.SeqUtils.CheckSum import seguid
> seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), "genbank"),
>                             lambda rec : seguid(rec.seq))
> record = seguid_dict["MN/s0q9zDoCVEEc+k/IFwCNF2pY"]
> print record.id
> print record.description
> 
> If seq were more like a string:
> 
> ...
> seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), "genbank"),
>                             seguid(rec.seq))

Nope ;)

You have to give a function to the key_function argument in 
SeqIO.to_dict(), and in your example seguid(rec.seq) would be a string 
(the result of the seguid function acting on a seq object). Or at least, 
it would if you had a rec variable in scope.

However, if SeqRecord acted more like a Seq (and therefore more like a 
string) then you could do this which does avoid the lambda:

seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), \
                             "genbank"), seguid)

Or, we could enhance your the CheckSum functions to cope with a 
SeqRecord, a Seq or a string - right now they cope with a Seq or a string.

Peter



From mdehoon at c2b2.columbia.edu  Thu Aug 23 06:06:27 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Thu, 23 Aug 2007 02:06:27 -0400
Subject: [BioPython] Making the Seq object act more like a string
References: <46CC50BB.1090902@maubp.freeserve.co.uk><b43bf2080708220841s7ba6bf7cof74a99866e4ef93a@mail.gmail.com>
	<46CC5C17.4000709@maubp.freeserve.co.uk>
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B609@mail2.exch.c2b2.columbia.edu>

Peter wrote:
> However, if SeqRecord acted more like a Seq (and therefore more like a 
> string) then you could do this which does avoid the lambda:
> 
> seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), \
>                              "genbank"), seguid)
> 
> Or, we could enhance your the CheckSum functions to cope with a 
> SeqRecord, a Seq or a string - right now they cope with a Seq or a string.
>
Nice example.

The SeqRecord class is one of those classes in Biopython for which I never
understood why they exist. A SeqRecord is nothing more than a Seq with some
attributes attached. If we add those attributes to the Seq class directly,
then we can get rid of the SeqRecord class. Then, functions such as those in
CheckSum only need to cope with strings.

--Micheil.




Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032








From mdehoon at c2b2.columbia.edu  Thu Aug 23 06:06:27 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Thu, 23 Aug 2007 02:06:27 -0400
Subject: [BioPython] Making the Seq object act more like a string
References: <46CC50BB.1090902@maubp.freeserve.co.uk><b43bf2080708220841s7ba6bf7cof74a99866e4ef93a@mail.gmail.com>
	<46CC5C17.4000709@maubp.freeserve.co.uk>
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B609@mail2.exch.c2b2.columbia.edu>

Peter wrote:
> However, if SeqRecord acted more like a Seq (and therefore more like a 
> string) then you could do this which does avoid the lambda:
> 
> seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), \
>                              "genbank"), seguid)
> 
> Or, we could enhance your the CheckSum functions to cope with a 
> SeqRecord, a Seq or a string - right now they cope with a Seq or a string.
>
Nice example.

The SeqRecord class is one of those classes in Biopython for which I never
understood why they exist. A SeqRecord is nothing more than a Seq with some
attributes attached. If we add those attributes to the Seq class directly,
then we can get rid of the SeqRecord class. Then, functions such as those in
CheckSum only need to cope with strings.

--Micheil.




Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032





-------------- next part --------------
A non-text attachment was scrubbed...
Name: winmail.dat
Type: application/ms-tnef
Size: 3293 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/biopython/attachments/20070823/b40defae/attachment-0002.bin>

From Michael.Robeson at Colorado.EDU  Thu Aug 23 20:13:17 2007
From: Michael.Robeson at Colorado.EDU (Michael S. Robeson)
Date: Thu, 23 Aug 2007 14:13:17 -0600
Subject: [BioPython] qblast + documentation
In-Reply-To: <46C8395A.3040301@maubp.freeserve.co.uk>
References: <6FD85196-34A9-4641-B454-DBA9A589679F@colorado.edu>	<46C747BC.6010002@maubp.freeserve.co.uk>	<EE08AD5D-3FBA-44F5-880E-D5AA3EC485E1@colorado.edu>	<46C76ABC.9040608@maubp.freeserve.co.uk>
	<D4CFCAF1-0D46-4E6D-B07C-E450ADF5B2EA@colorado.edu>
	<46C8395A.3040301@maubp.freeserve.co.uk>
Message-ID: <2EEE2FCD-6A73-408D-9984-D3806D717BD1@colorado.edu>

Why is there no way to add other parameters like gap penalties to  
qblast? Like can be done on the web site? Am I missing something? Is  
there code I can add?

-Thanks
-Mike



From Michael.Robeson at Colorado.EDU  Thu Aug 23 20:20:26 2007
From: Michael.Robeson at Colorado.EDU (Michael S. Robeson)
Date: Thu, 23 Aug 2007 14:20:26 -0600
Subject: [BioPython] qblast + documentation
Message-ID: <A58FA3CF-1D84-466E-AD55-EE1EB7D0DC2D@colorado.edu>

I meant to add to the other e-mail:  Since we know it has to do with  
the blast setting differences on the NCBI web site versus the  
biopython back-end. How can I get around that? I've tried a few  
things, but have not been successful.

-Mike


From mdehoon at c2b2.columbia.edu  Thu Aug 23 23:01:17 2007
From: mdehoon at c2b2.columbia.edu (Michiel de Hoon)
Date: Fri, 24 Aug 2007 08:01:17 +0900
Subject: [BioPython] qblast + documentation
In-Reply-To: <A58FA3CF-1D84-466E-AD55-EE1EB7D0DC2D@colorado.edu>
References: <A58FA3CF-1D84-466E-AD55-EE1EB7D0DC2D@colorado.edu>
Message-ID: <46CE11BD.2020307@c2b2.columbia.edu>

Have you looked at the qblast function definition in 
http://cvs.biopython.org/cgi-bin/viewcvs/viewcvs.cgi/biopython/Bio/Blast/NCBIWWW.py?rev=1.46&cvsroot=biopython&content-type=text/vnd.viewcvs-markup

I believe all the Blast parameters are there.

--Michiel.

Michael S. Robeson wrote:
> I meant to add to the other e-mail:  Since we know it has to do with  
> the blast setting differences on the NCBI web site versus the  
> biopython back-end. How can I get around that? I've tried a few  
> things, but have not been successful.
> 
> -Mike
> _______________________________________________
> BioPython mailing list  -  BioPython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython



From Michael.Robeson at Colorado.EDU  Fri Aug 24 01:12:30 2007
From: Michael.Robeson at Colorado.EDU (Michael S. Robeson)
Date: Thu, 23 Aug 2007 19:12:30 -0600
Subject: [BioPython] qblast + documentation
In-Reply-To: <46CDFFE8.2040900@maubp.freeserve.co.uk>
References: <A58FA3CF-1D84-466E-AD55-EE1EB7D0DC2D@colorado.edu>
	<46CDFFE8.2040900@maubp.freeserve.co.uk>
Message-ID: <8963513B-811D-458B-BAB8-1BE64D3CA76C@colorado.edu>

> http://cvs.biopython.org/cgi-bin/viewcvs/viewcvs.cgi/biopython/Bio/ 
> Blast/NCBIWWW.py?rev=1.46&cvsroot=biopython&content-type=text/ 
> vnd.viewcvs-markup
Are those new parameters? They do exist in the code I downloaded?  
Guess I will download again from fink.

> If you are familiar with the BLAST terminology this is probably  
> very obvious, but you need to set the NUCL_REWARD and NUCL_PENALTY  
> options in the URL.

Yeah, I did not mean to say it was biopython's fault, but the version  
of the code I have had no parameters under qblast for me to alter  
after we new there was a difference with the web interface end at  
NCBI. The version I have (latest via fink, biopython version:  
1.43-1001) showed this:

def qblast(program, database, sequence,
            ncbi_gi=None, descriptions=None, alignments=None,
            expect=None, matrix=None,
            filter=None, format_type="XML", hitlist_size=None,
            entrez_query='(none)',
            ):

and not:

def qblast(program, database, sequence,
            auto_format=None,composition_based_statistics=None,
            db_genetic_code=None,endpoints=None,entrez_query='(none)',
            expect=10.0,filter=None,gapcosts=None,genetic_code=None,
            hitlist_size=50,i_thresh=None,layout=None,lcase_mask=None,
            matrix_name=None,nucl_penalty=None,nucl_reward=None,
            other_advanced=None,perc_ident=None,phi_pattern=None,
            query_file=None,query_believe_defline=None,query_from=None,
            query_to=None,searchsp_eff=None,service=None,threshold=None,
            ungapped_alignment=None,word_size=None,
            alignments=500,alignment_view=None,descriptions=500,
             
entrez_links_new_window=None,expect_low=None,expect_high=None,
             
format_entrez_query=None,format_object=None,format_type='XML',
            ncbi_gi=None,results_file=None,show_overview=None
            ):

So, there must be a problem with my fink installation or something. I  
will try and uninstall and re-install biopython via fink.

-Mike


From mdehoon at c2b2.columbia.edu  Fri Aug 24 02:08:29 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Thu, 23 Aug 2007 22:08:29 -0400
Subject: [BioPython] qblast + documentation
References: <A58FA3CF-1D84-466E-AD55-EE1EB7D0DC2D@colorado.edu><46CDFFE8.2040900@maubp.freeserve.co.uk>
	<8963513B-811D-458B-BAB8-1BE64D3CA76C@colorado.edu>
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B60B@mail2.exch.c2b2.columbia.edu>

> > http://cvs.biopython.org/cgi-bin/viewcvs/viewcvs.cgi/biopython/Bio/ 
> > Blast/NCBIWWW.py?rev=1.46&cvsroot=biopython&content-type=text/ 
> > vnd.viewcvs-markup
> Are those new parameters? They do exist in the code I downloaded?  
> Guess I will download again from fink.

It looks like these are coming from a recent improvement of Biopython. So you
won't find this in Biopython release 1.43. You can just take the new
NCBIWWW.py from CVS and copy it over the NCBIWWW.py in Biopython 1.43.

Maybe this is a good time for a new Biopython release?

--Michiel.


Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032






From biopython at maubp.freeserve.co.uk  Fri Aug 24 09:35:16 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Fri, 24 Aug 2007 10:35:16 +0100
Subject: [BioPython] [Fwd: Re:  qblast + documentation]
Message-ID: <46CEA654.1070706@maubp.freeserve.co.uk>

I managed to send this to Michael Robeson only, and not the list.

In the mean time Michiel de Hoon pointed out that support for lots of 
parameters (including NUCL_REWARD and NUCL_PENALTY) was added after the 
release of Biopython 1.43, so you would have to update the file 
Bio/Blast/NCBIWWW.py

If you don't want to bother with CVS, the easy way to do this is backup 
the original and then replace it with the download from here:

http://cvs.biopython.org/cgi-bin/viewcvs/viewcvs.cgi/*checkout*/biopython/Bio/Blast/NCBIWWW.py?rev=HEAD&cvsroot=biopython&content-type=text/x-python

Looking at the history, that shouldn't impact anything else.

Peter

-------- Original Message --------
Subject: Re: [BioPython] qblast + documentation
Date: Thu, 23 Aug 2007 22:45:12 +0100
From: Peter <biopython at maubp.freeserve.co.uk>
Reply-To: biopython at lists.open-bio.org
To: Michael S. Robeson <Michael.Robeson at colorado.edu>
References: <A58FA3CF-1D84-466E-AD55-EE1EB7D0DC2D at colorado.edu>

Michael S. Robeson wrote:
> I meant to add to the other e-mail:  Since we know it has to do with  
> the blast setting differences on the NCBI web site versus the  
> biopython back-end. How can I get around that? I've tried a few  
> things, but have not been successful.

I'd just like to point out this isn't Biopython's fault - its the NCBI
who seem to be using different match/mismatch penalties on their GUI
webserver and their QBLAST web API.

The simple answer for how to get the two queries to agree, is whenever
you do any manual queries on the website, click on "Algorithm
parameters" and under "Scoring Parameters" change "Match/Mismatch
Scores" from "2, -3" to "1, -3" (grin).

Or, if you want to change the gap penalties in the qblast call, what
Biopython is doing is providing a python interface to this URL scheme:

http://www.ncbi.nlm.nih.gov/BLAST/Doc/node5.html

If you are familiar with the BLAST terminology this is probably very
obvious, but you need to set the NUCL_REWARD and NUCL_PENALTY options in
the URL.

i.e. In Biopython use the optional nucl_reward and nucl_penalty
arguments to the Bio.Blast.NCBIWWW.qblast function.

from Bio.Blast.NCBIWWW import qblast
seq_string = "TGTGATGGATATCTGCAGAATTCGCCCTTTAAACTTCAGGGTGACCAAAA" \
             + "AATCAAAATAAATGTTGAAATAATACTGGATCTCCACCACCACTAACTTC" \
             + "AAAAAATGTTGTATTAAAATTTCTATCAGTTAATAACATTGTTATAGCAC" \
             + "CCCCTAATACTGGTAATGATAATAATAATAATCATGCTGTTATAAATACA" \
             + "GCTCAAACAAATAAAGGTAACTTAAACATACTCATACCAGGTGTTCGCAT" \
             + "ATTAATAACAGTAACAATAAAATTTATTGAACCTAATATTGATGATATAC" \
             + "CAGCTAAATGTAAACTAAATATTGCACATTCTATTGAACCTCCTGAATGT" \
             + "GAAAATATACCAGATAATGGTGGATAAACAGTTCAACCTGTACCTGCCCC" \
             + "CATCTCGACTACAGATGATCAAATTAATAAAAAAAATGATGGTACTAATA" \
             + "ATCAAAAACTTATATTATTTAATCTTGGGAATGCCATATCAGGAGCTCCT" \
             + "ATCATTAAAGGTAAAAATCAATTACCAAAACCACCCATTAATGCAGGCAT" \
             + "AACCATAAAAAATATCATTATTAAAGCATGTGCTGTTATTAACACATTAT" \
             + "ATGCTTGATGATTGTAATTTAATATTACTGCACCAGCATCTGATAATTCT" \
             + "ATACGTATTAATATAGATCAAAATGTTCCTATTAAACCTGCTAAAAATGC" \
             + "AAATATTAAATATAATGTTCCAATATCTTTATGATTTGTTGACCAAGGGC" \
             + "GAATTCCAGCACACTGGCGGCCGTTACTAG"

#filename, format = "test.html", "HTML"
#filename, format = "test.txt",  "Text"
filename, format = "test.xml",  "XML"

result_handle = qblast('blastn', 'nr', seq_string, format_type=format,
                        nucl_reward=2, nucl_penalty=-3)
output_handle = open(filename, "w")
output_handle.write(result_handle.read())
output_handle.close()

print "Done"


And this does seem to agree with the results from doing the query by
hand on their website with the default settings.

Peter




From biopython at maubp.freeserve.co.uk  Mon Aug 27 18:48:55 2007
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Mon, 27 Aug 2007 19:48:55 +0100
Subject: [BioPython] Making the Seq object act more like a string
In-Reply-To: <6243BAA9F5E0D24DA41B27997D1FD14402B609@mail2.exch.c2b2.columbia.edu>
References: <46CC50BB.1090902@maubp.freeserve.co.uk><b43bf2080708220841s7ba6bf7cof74a99866e4ef93a@mail.gmail.com>	<46CC5C17.4000709@maubp.freeserve.co.uk>
	<6243BAA9F5E0D24DA41B27997D1FD14402B609@mail2.exch.c2b2.columbia.edu>
Message-ID: <46D31C97.1070200@maubp.freeserve.co.uk>

Michiel De Hoon wrote:
> Peter wrote:
>> However, if SeqRecord acted more like a Seq (and therefore more like a 
>> string) then you could do this which does avoid the lambda:
>>
>> seguid_dict = SeqIO.to_dict(SeqIO.parse(open("ls_orchid.gbk"), \
>>                              "genbank"), seguid)
>>
>> Or, we could enhance your the CheckSum functions to cope with a 
>> SeqRecord, a Seq or a string - right now they cope with a Seq or a string.
>>
> Nice example.
> 
> The SeqRecord class is one of those classes in Biopython for which I never
> understood why they exist. A SeqRecord is nothing more than a Seq with some
> attributes attached. If we add those attributes to the Seq class directly,
> then we can get rid of the SeqRecord class. Then, functions such as those in
> CheckSum only need to cope with strings.
> 
> --Micheil.

I think having SeqRecord subclass Seq is nicer than simply adding 
annotation to the Seq class. Seq objects would (still) just have a 
sequence and alphabet, the SeqRecord becomes a rich/annotated Seq object.

I think this would be close to BioPerl's Seq and RichSeq objects.

I have filed an enhancement on Bugzilla to hold any suggested patches 
etc (I hope to upload something later tonight):

Bug 2351 - Make SeqRecord subclass Seq subclass string?
http://bugzilla.open-bio.org/show_bug.cgi?id=2351

Peter



From mdehoon at c2b2.columbia.edu  Thu Aug 30 02:20:01 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Wed, 29 Aug 2007 22:20:01 -0400
Subject: [BioPython] Bio.MarkupEditor
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B60D@mail2.exch.c2b2.columbia.edu>

Does anybody use this module? It is not used anywhere in Biopython. If it is
not being used, I suggest to deprecate it.

--Michiel.


Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032




From jimmy.musselwhite at gmail.com  Thu Aug 30 03:46:51 2007
From: jimmy.musselwhite at gmail.com (Jimmy Musselwhite)
Date: Wed, 29 Aug 2007 23:46:51 -0400
Subject: [BioPython] Cluster problem keeping me from getting started
Message-ID: <86e5e8970708292046m55ffa549p4544d2a1ffd2c294@mail.gmail.com>

Hi everyone
I'm trying to start an assignment I have using BioPython but a critical
functionality is not working for me. When I do

python run_tests.py

It "hangs" at

test_Cluster ...

and if I run test_Cluster.py by itself it does not complete properly.

I installed Cluster 3.0 from the bonsai website and then I even re-installed
PyCluster from the source there. I don't know what else could be wrong here!
I really need Cluster to work. It's pretty much the point of my assignment.

Thanks!


From mdehoon at c2b2.columbia.edu  Thu Aug 30 03:59:51 2007
From: mdehoon at c2b2.columbia.edu (Michiel De Hoon)
Date: Wed, 29 Aug 2007 23:59:51 -0400
Subject: [BioPython] Cluster problem keeping me from getting started
References: <86e5e8970708292046m55ffa549p4544d2a1ffd2c294@mail.gmail.com>
Message-ID: <6243BAA9F5E0D24DA41B27997D1FD14402B60F@mail2.exch.c2b2.columbia.edu>

This was fixed in CVS. If you pick up the new Bio.Cluster source files from
here:

http://cvs.biopython.org/cgi-bin/viewcvs/viewcvs.cgi/biopython/Bio/Cluster/?c
vsroot=biopython

copy them over the corresponding files in the biopython-1.43 distribution,
and reinstall, the test should run to completion. If it doesn't, please let
me know.

--Michiel.


Michiel de Hoon
Center for Computational Biology and Bioinformatics
Columbia University
1150 St Nicholas Avenue
New York, NY 10032



-----Original Message-----
From: biopython-bounces at lists.open-bio.org on behalf of Jimmy Musselwhite
Sent: Wed 8/29/2007 11:46 PM
To: biopython at lists.open-bio.org
Subject: [BioPython] Cluster problem keeping me from getting started
 
Hi everyone
I'm trying to start an assignment I have using BioPython but a critical
functionality is not working for me. When I do

python run_tests.py

It "hangs" at

test_Cluster ...

and if I run test_Cluster.py by itself it does not complete properly.

I installed Cluster 3.0 from the bonsai website and then I even re-installed
PyCluster from the source there. I don't know what else could be wrong here!
I really need Cluster to work. It's pretty much the point of my assignment.

Thanks!
_______________________________________________
BioPython mailing list  -  BioPython at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biopython