[BioPython] Changes in NCBI BLAST output format

[Martina]

Hello Michiel,

I got your fix for NCBIWWW.py from the CVS, but now I get a diffrent 
error message:   SyntaxError: Line does not contain 'Database':
.
.
.
File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 47, in parse
   self._scanner.feed(handle, self._consumer)
File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 100, in feed
   self._scan_header(uhandle, consumer)
File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 172, in 
_scan_header
   self._scan_database_info(uhandle, consumer)
File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 190, in 
_scan_database_info
   read_and_call(uhandle, consumer.database_info, contains='Database')
File "C:\Python24\Lib\site-packages\Bio\ParserSupport.py", line 301, in 
read_and_call
   raise SyntaxError, errmsg

This is the sequence I blasted: GGAAGATAATGAACACCAAGA
result_handle = NCBIWWW.qblast('blastn', 'nr', f_record, expect = 100, 
word_size = 7,filter = 'L',entrez_query = 'Homo sapiens 
[ORGN]',descriptions=10,alignments=50)

(I added word_size to qblast, but that doesn't make any difference)

I tried to workout what the problem was, but I don't find it that easy 
to see, what it is the blast parser is exactly doing. I'm wondering why 
nobody else seems to get this error? Thanks for any help!

Martina