[BioPython] (fwd) Python module for DNA to amino acid and reverse complement translation.

[Jeffrey Chang]

Andrew has posted a reply.  It should show up on usenet as well:
http://www.python.org/pipermail/python-list/2000-September/115888.html

Andrew, is there stuff in the C code that we can use, and works well with
the stuff we already have?  It would be nice to get a quick speed-up, if
it's general and easy to integrate.

Jeff



On Mon, 4 Sep 2000, Johann Visagie wrote:

> Found on Usenet (excuse the formatting):
> 
> -- forwarded message --
> From: Alex <cut_me_out@hotmail.com>
> Newsgroups: comp.lang.python,bionet.biology.computational
> Subject: Python module for DNA to amino acid and reverse complement translation.
> Date: 2 Sep 2000 03:46:53 +0100
> 
> 
> 
> Hi.  Here is a python wrapper around some simple C functions that
> translate DNA sequences into amino acid residues and give their reverse
> complements.  I guess it's something like 10 times faster than the pure
> python versions, but I haven't done any benchmarking.
> 
> No doubt there is already a module out there that does these things.
> Apologies to whoever's work I'm duplicating.
> 
> Use this any way you see fit.  Let me know if you have any problems with
> it, but of course there's no warranty.  
> 
> You can get it at
> 
> http://puffin.lcs.mit.edu:8080/sequences.tgz
> 
> You need Distutils to install it, at the moment.  You can get that at 
> 
> http://www.python.org/sigs/distutils-sig/download.html
> 
> ...or just be an instance of whichever gender identity you atavistically
> associate with intelligence and courage, and upgrade to the latest
> version of python2.0.
> 
> Once you have a python with Distutils in it and have downloaded
> sequences.tgz, untar it and cd into the sequencees directory.  Then run
> the command python setup.py install, and you should be all set.  Then
> you can do things like
> 
> Python 2.0b1 (#98, Aug 30 2000, 19:11:17) <snip>
> Copyright 1991-1995 Stichting Mathematisch Centrum, Amsterdam
> Copyright 1995-2000 Corporation for National Research Initiatives (CNRI)
> >>> import sequences
> >>> sequences.translate('ATATGTACTCCCATGGGGACAAATATCCTTCTGAGGGGCCACAGTCATCAC')
> 'ICTPMGTNILLRGHSHH'
> >>> sequences.reverse_complement('ATATGTACTCCCATGGGGACAAATATCCTTCTGA')
> 'TCAGAAGGATATTTGTCCCCATGGGAGTACATAT'
> >>> 
> 
> Alex.
> 
> -- 
> The chain of destiny can only be grasped one link at a time.  
> -- Sir Winston Churchill
> 
> 
> -- end of forwarded message --
> _______________________________________________
> BioPython mailing list  -  BioPython@biopython.org
> http://biopython.org/mailman/listinfo/biopython
>