[BioPython] Sequence numbering. Moving on...

[Thomas.Sicheritz@molbio.uu.se]

Andrew Dalke writes:
 > Thomas.Sicheritz@molbio.uu.se said:
 > >Again - for practical reasons, why not an additional
 > >return_seqReverse method ?
 > >    MySlice(7,30).return_seqReverse().translate()
 > 
 > Does this mean it returns a new (reversed) sequence, or that it
 > does the reverse and returns itself?

more like the sequence object is keeping a reference to 
self.reversed string representation (caching ?) ...

(next question: does seqReverse - reverse and complement = antiparallel ? 
   if not, the right call should have been
      MySlice(7,30).return_seqReverse().return_seqComplement().translate()
   or    
      MySlice(7,30).return_seqAntiparallel().translate()

   even if raw reverse is a rare biological sequence operation we still need 
   seqReverse, seqComplement and seqAntiparallel
)


... but the better and in my opinion more 'right' solution to this
particular translation problem is that the translation method can handle
all 6 frames
like:

seq = seqobj("ATGACAAAGCTAATTATTCACTTGGTTTCAGACTCTTCTGTGCAAACTGCAAAACATGC")

for frame in [-3,-2,-1,1,2,3]:
    print "Frame %d:%s" % (frame, seq.MySlice(7,30).translate(frame))

Frame -3: KPSE*LA
Frame -2: ETK*IIS
Frame -1: *NQVNN*
Frame 1: S*LFTWF
Frame 2: ANYSLGF
Frame 3: LIIHLVS

print seq.MySlice(7,30)
'AGCTAATTATTCACTTGGTTTCA'

print seq.MySlice(7,30).reverse()
"ACTTTGGTTCACTTATTAATCGA"

print seq.MySlice(7,30).complement()
'TCGATTAATAACTGAACCAAAGT'

print seq.MySlice(7,30).antiparallel()
'TGAAACCAAGTGAATAATTAGCT'




 > Take a look at
 >    ftp://ftp.ks.uiuc.edu/pub/group/dalke/line_lexer.tar.gz
 > The code isn't well documented, and I did it in one evening to
 > see if the idea of building the parse tree off of Python's
 > parser worked.  It did.  Then I tried to see if I could make
 > it support a simple file format.  It did.  It does not work for
 > more complicated formats, though swissprot shouldn't be a problem.
 > That's where an NFA should be used instead.
 > 
 > In other words, beware!

beware ... ? @shudder@ ... I finally found your file. It was on display in
the bottom of a locked filing cabinet stuck in a disused lavatory with a
sign on the door saying Beware of the Leopard." :-)

... sorry, couldn't resist ... 'beware' always triggers hitchhiker syndromes ...
Thx for the link - I'll play with it tonight.

-thomas
-- 
Sicheritz Ponten Thomas E.  Linnaeus Centre for Bioinformatics
blippblopp@linux.nu         BMC, Uppsala University
BMC:  +46 18 4714214        BOX 590 S-751 24 UPPSALA Sweden
Fax   +46 18  557723        http://evolution.bmc.uu.se/~thomas
Molecular Python:  http://evolution.bmc.uu.se/~thomas/python
Molecular Linux: http://evolution.bmc.uu.se/~thomas/mol_linux

	De Chelonian Mobile ... The Turtle Moves ...