From bugzilla-daemon at portal.open-bio.org  Mon May  2 10:53:07 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Mon May  2 11:21:04 2005
Subject: [Biopython-dev] [Bug 1777] Bio.Emboss.Primer patch for
	hybridization probes
Message-ID: <200505021453.j42Er7rG011078@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1777





------- Additional Comments From jhessel@gmail.com  2005-05-02 10:53 -------
Created an attachment (id=205)
 --> (http://bugzilla.open-bio.org/attachment.cgi?id=205&action=view)
Patches and Tests for Bio.Emboss.Primer




------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.
From bugzilla-daemon at portal.open-bio.org  Mon May  2 10:55:03 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Mon May  2 11:21:05 2005
Subject: [Biopython-dev] [Bug 1777] Bio.Emboss.Primer patch for
	hybridization probes
Message-ID: <200505021455.j42Et3gK011100@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1777





------- Additional Comments From jhessel@gmail.com  2005-05-02 10:55 -------
Created an attachment (id=206)
 --> (http://bugzilla.open-bio.org/attachment.cgi?id=206&action=view)
Flat file with patches, test and sample file concatenated




------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.
From bugzilla-daemon at portal.open-bio.org  Mon May  2 10:50:38 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Mon May  2 11:21:06 2005
Subject: [Biopython-dev] [Bug 1777] New: Bio.Emboss.Primer patch for
	hybridization probes
Message-ID: <200505021450.j42Eoc4W011056@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1777

           Summary: Bio.Emboss.Primer patch for hybridization probes
           Product: Biopython
           Version: Not Applicable
          Platform: All
        OS/Version: Linux
            Status: NEW
          Severity: normal
          Priority: P2
         Component: Main Distribution
        AssignedTo: biopython-dev@biopython.org
        ReportedBy: jhessel@gmail.com


I've patched Bio.Emboss.Primer to correctly parse results from a search for
hybridization probes.  The patch for Primer.py and primer3_format.py is pasted
below.  I've also updated Tests/test_Emboss.py and included a sample file, but
I'm not sure how to submit those (the test runs without errors).

Thanks,
Jay Hesselberth

<snip>
*** Primer.py   Fri Feb 18 13:14:18 2005
--- /usr/lib/python2.3/site-packages/Bio/Emboss/Primer.py       Sun May  1
09:57:08 2005
***************
*** 227,232 ****
--- 227,247 ----
      def reverse_seq(self, seq):
          self._cur_primer.reverse_seq = seq

+     def internal_start(self, start):
+         self._cur_primer.internal_start = int(start)
+
+     def internal_length(self, length):
+         self._cur_primer.internal_length = int(length)
+
+     def internal_tm(self, tm):
+         self._cur_primer.internal_tm = float(tm)
+
+     def internal_gc(self, gc):
+         self._cur_primer.internal_gc = float(gc)
+
+     def internal_seq(self, seq):
+         self._cur_primer.internal_seq = seq
+
      def end_record(self):
          self._add_last_primer()

***************
*** 240,245 ****
--- 255,262 ----
                                "forward_tm", "forward_gc", "forward_seq",
                                "reverse_start", "reverse_length",
                                "reverse_tm", "reverse_gc", "reverse_seq",
+                               "internal_start", "internal_length",
+                               "internal_tm", "internal_gc", "internal_seq",
                                "end_record"]

          expression = Martel.select_names(primer3_format.record,

</snip>
<snip>
*** primer3_format.py   Sun May 11 12:27:46 2003
--- /usr/lib/python2.3/site-packages/Bio/Emboss/primer3_format.py       Sun May
 1 09:59:04 2005
***************
*** 71,76 ****
--- 71,95 ----
                   any_space + reverse_primer_gc + any_space +
                   reverse_primer_seq + Martel.AnyEol())

+ #     INTERNAL OLIGO     197   20  59.96  40.00  AATTGCACATAACGGATGCA
+
+ internal_oligo_start = Martel.Group("internal_start",
+                                    any_integer)
+ internal_oligo_length = Martel.Group("internal_length",
+                                      any_integer)
+ internal_oligo_tm = Martel.Group("internal_tm",
+                                  any_float)
+ internal_oligo_gc = Martel.Group("internal_gc",
+                                  any_float)
+ internal_oligo_seq = Martel.Group("internal_seq",
+                                   sequence)
+ internal_line = Martel.Group("internal_line",
+                  primer_space + Martel.Str("INTERNAL OLIGO") +
+                  any_space + internal_oligo_start + any_space +
+                  internal_oligo_length + any_space + internal_oligo_tm +
+                  any_space + internal_oligo_gc + any_space +
+                  internal_oligo_seq + Martel.AnyEol())
+

  # XXX This record definition is ugly. But it works :-)
  record = Martel.Group("primer3_record",
***************
*** 90,97 ****
                                        reverse_line + blank_line,
                             # case 2b1. Reverse primer
                                        reverse_line + blank_line,
!                             # case 2b2, Forward primer
!                                       forward_line + blank_line)) +
                             blank_line + blank_line + Martel.Rep(blank_line)))


--- 109,118 ----
                                        reverse_line + blank_line,
                             # case 2b1. Reverse primer
                                        reverse_line + blank_line,
!                            # case 2b2, Forward primer
!                                       forward_line + blank_line,
!                            # case 2b3, Internal oligo
!                                       internal_line + blank_line)) +
                             blank_line + blank_line + Martel.Rep(blank_line)))
</snip>



------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.
From Frederic.Sohm at iaf.cnrs-gif.fr  Wed May 11 07:20:50 2005
From: Frederic.Sohm at iaf.cnrs-gif.fr (=?iso-8859-1?b?RnLpZOlyaWM=?= Sohm)
Date: Wed May 11 07:16:09 2005
Subject: [Biopython-dev] Rethinking Seq objects
Message-ID: <1115810450.4281ea922610d@mail.iaf.cnrs-gif.fr>

Hi Michiel and everyone,

I have no problem with suppressing the mutable Seq object. The solution proposed
should be OK.

But last time I posted something and forgot the subject so it got lost in the
mailing list instead of coming to the right place, here is the proposition :

Just a thought, don't flame me for that.
Since you will be making a new Seq object, will it be worth making it behave
more like a typical object :

But first a disclaimer, I realise the proposed change could mean breaking a
lot of code, so it might a very bad idea in the end.

When I did first used Biopython, I have been surprised by the behaviour of
 Seq object, in regards of the use of the built-in str() and repr() functions
 (I should have read the manual first, but hey...) :

Ok here is a the Seq behaviour :
>>> from Bio.Seq import Seq
>>> a = 'a'*80
>>> a
'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaa'
>>> s = Seq(a)
>>> s
Seq('aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaa', Alphabet())
>>> str(s)
"Seq('aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaa ...', Alphabet())"
>>> repr(s)
"Seq('aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaa', Alphabet())"
>>> s.tostring()
'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaa'

Now here is  what I was expecting at the time following the respective
 meaning of str and repr

>>> a = 'a'*80
>>> a
'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaa'
>>> s = Seq(a)
>>> s
Seq('aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaa', Alphabet())
>>> str(s)
'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaa'
>>> repr(s)
"Seq('aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaa', Alphabet())"


So what I would propose is to :
     - change str(seq) to return the actual sequence as do seq.tostring() right
       now. leave repr(seq) as it is,
     - make seq.tostring()  return str(seq) for backward compatibity. (Would be
       eventually removed).
     - add a new function Seq.short() for example which would behave like the     
       actual str(Seq).

I don't have any idea how much code this would break. And the feasability of
it will as well depends on the way the new Seq will be release (I mean do you
plan to have the actual Seq and the new one co-existing for a while or to
directly replace the old Seq?).
If the later is the way we go this change is certainly not desirable,
otherwise it might be something to consider.

Personally I have mix filling about it, but I think it is worth discussing
 the matter now.

This change would make the Seq objects behave more like a Python programmer
would expect, on the other hand Biopython have been built on the current
model and this might be a bad idea to change after so much time.


Since the only real problem with this is the replacement of the str() method
all boiled down to how frequently people use the actual string method of Seq
in their code?
I do not have the impression it is very frequent but ...

What do you think ?

Fred

-- 
Fr?d?ric Sohm
Equipe INRA U1126 "Morphogen?se du syst?me nerveux des Chord?s"
UPR 2197 DEPSN, CNRS
Institut de Neurosciences A. Fessard
1 Avenue de la Terrasse
91 198 GIF-SUR-YVETTE
FRANCE
Phone: +33 (0) 1 69 82 34 12
Fax:+33 (0) 1 69 82 34 47

From hoffman at ebi.ac.uk  Wed May 11 07:42:04 2005
From: hoffman at ebi.ac.uk (Michael Hoffman)
Date: Wed May 11 07:36:43 2005
Subject: [Biopython-dev] Rethinking Seq objects
In-Reply-To: <1115810450.4281ea922610d@mail.iaf.cnrs-gif.fr>
References: <1115810450.4281ea922610d@mail.iaf.cnrs-gif.fr>
Message-ID: <Pine.LNX.4.62.0505111240540.15707@qnzvnan.rov.np.hx>

On Wed, 11 May 2005, Fr?d?ric Sohm wrote:

>     - change str(seq) to return the actual sequence as do seq.tostring() right
>       now.

+1

>     - make seq.tostring()  return str(seq) for backward compatibity. (Would be
>       eventually removed).

+1

>     - add a new function Seq.short() for example which would behave like the
>       actual str(Seq).

Actually, if this is just for programmer/debugging use, it would be
much better for this behavior to be in repr.
-- 
Michael Hoffman <hoffman@ebi.ac.uk>
European Bioinformatics Institute
From Frederic.Sohm at iaf.cnrs-gif.fr  Wed May 11 09:04:57 2005
From: Frederic.Sohm at iaf.cnrs-gif.fr (=?iso-8859-1?b?RnLpZOlyaWM=?= Sohm)
Date: Wed May 11 08:57:53 2005
Subject: [Biopython-dev] Rethinking Seq objects
Message-ID: <1115816697.428202f9c79f5@mail.iaf.cnrs-gif.fr>



>>     - add a new function Seq.short() for example which would behave like the
>>       actual str(Seq).
>
>Actually, if this is just for programmer/debugging use, it would be
>much better for this behavior to be in repr.

personally I would not change repr, as it should returns a string which can be
used with the built-in eval(). But it is true this can make the repr string very
long.

-- 
Fr?d?ric Sohm
Equipe INRA U1126 "Morphogen?se du syst?me nerveux des Chord?s"
UPR 2197 DEPSN, CNRS
Institut de Neurosciences A. Fessard
1 Avenue de la Terrasse
91 198 GIF-SUR-YVETTE
FRANCE
Phone: +33 (0) 1 69 82 34 12
Fax:+33 (0) 1 69 82 34 47

From bugzilla-daemon at portal.open-bio.org  Sat May 21 02:08:17 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Sat May 21 02:26:04 2005
Subject: [Biopython-dev] [Bug 1801] New: Enhanced speed for the isoelectric
	point calculation in the ProteinAnalysis module
Message-ID: <200505210608.j4L68Gxn011937@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1801

           Summary: Enhanced speed for the isoelectric point calculation in
                    the ProteinAnalysis module
           Product: Biopython
           Version: Not Applicable
          Platform: PC
        OS/Version: All
            Status: NEW
          Severity: enhancement
          Priority: P2
         Component: Main Distribution
        AssignedTo: biopython-dev@biopython.org
        ReportedBy: victor.hr@gmail.com


I've reworked the algorithm to calculate the isoelectric point to make it
faster. I'll include a test. The reworked algorithm twice as fast as the old one.



------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.
From bugzilla-daemon at portal.open-bio.org  Sat May 21 02:18:30 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Sat May 21 02:26:07 2005
Subject: [Biopython-dev] [Bug 1801] Enhanced speed for the isoelectric point
	calculation in the ProteinAnalysis module
Message-ID: <200505210618.j4L6IUKJ013095@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1801





------- Additional Comments From victor.hr@gmail.com  2005-05-21 02:18 -------
Created an attachment (id=213)
 --> (http://bugzilla.open-bio.org/attachment.cgi?id=213&action=view)
Benchmark for the new algorithm and the old one 




------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.
From bugzilla-daemon at portal.open-bio.org  Sat May 21 02:16:59 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Sat May 21 02:26:08 2005
Subject: [Biopython-dev] [Bug 1801] Enhanced speed for the isoelectric point
	calculation in the ProteinAnalysis module
Message-ID: <200505210616.j4L6Gxkg013014@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1801





------- Additional Comments From victor.hr@gmail.com  2005-05-21 02:16 -------
Created an attachment (id=212)
 --> (http://bugzilla.open-bio.org/attachment.cgi?id=212&action=view)
The re-worked IsoelectricPoint module




------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.
From idoerg at burnham.org  Sun May 29 02:13:37 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sun May 29 02:06:38 2005
Subject: [Biopython-dev] Re: [BioPython] Tool for Biomolecular data edition
 and analysis in Python
In-Reply-To: <BAY20-F3925198F6A696B4AD93EA8BF010@phx.gbl>
Message-ID: <Pine.SGI.4.10.10505282300380.3022179-100000@pines2.ljcrf.edu>

Frederico,

This looks like a really useful tool, thanks for sharing.

One way I can see this fitting into Biopython is as an addition to the
Align module. We'll have to think exactly how.

However, I am wondering if this really fits within biopython: you have
what seems to me as a standalone program. Biopython's goal is to provide
buiding blocks for such tools. So your code is the next step: you have
constructed a house (a very fine one, may I add), Biopython provides
lumber, bricks, etc. etc.

Like I said, I'll have to look at it. But with ISMB coming up, it will
probably not be for a month. If someone else has any thoughts on the
matter, please share.

Cheers, and thanks again,

Iddo




--
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037, USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 646 3171
http://ffas.ljcrf.edu/~iddo
-------------------------------------
Automated Protein Function Prediction Meeting, June 24, 2005
http://ffas.burnham.org/AFP

On Sat, 28 May 2005, Frederico Arnoldi wrote:


> Hello,
> 
>    My name is Frederico G. Colombo Arnoldi, I am Phd student (subject:
> Molecular Evolution) in Brazil.
>   I have been developing a software for Biomolecular data edition and
> analysis in python, mainly for gene analysis. It started as a little
> tool to help me and became a more serious work. Actually this tool is
> formed by a GTK interface that allows the user to align sequences with
> Malign and Clustalw; color sequences previously aligned according
> conservation and residues characteristics; create reverse,
> reverse/complement and consensus sequences; search for conserved
> regions and determined sequences inside a bigger (like restriction
> enzymes sites and ORF's); generate alignments colored reports and
> others.
>    The program and Its portal has been written in English, although,
> as anyone can see in my bad english, I'm not a native english speaker.
>     I would like to know about the possibility and the interest of
> integrate it to biopython. The portal is : 
> http://mpalign.incubadora.fapesp.br/portal
> 



>     Thanks a lot.
>     Frederico
> 
> _________________________________________________________________
> MSN Messenger: converse online com seus amigos .  
> http://messenger.msn.com.br
> 
> _______________________________________________
> BioPython mailing list  -  BioPython@biopython.org
> http://biopython.org/mailman/listinfo/biopython
>