From mdehoon at ims.u-tokyo.ac.jp Wed Feb 2 23:04:02 2005 From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] Re: [BioPython] documentation issues In-Reply-To: <41FA0890.3090803@ims.u-tokyo.ac.jp> References: <200501272056.j0RKuV5c026299@guitar.compbio.ucsf.edu> <41FA0890.3090803@ims.u-tokyo.ac.jp> Message-ID: <4201A2B2.4040507@ims.u-tokyo.ac.jp> I asked NCBI about this and it turned out that this was due to an error at NCBI. The error was fixed and the code below works again with Biopython's CVS version. With release 1.30, a different error appears, which was fixed in CVS about six months ago. Maybe it is time for a new release? --Michiel. Michiel Jan Laurens de Hoon wrote: > andrea rossi wrote: > >> from Bio import GenBank >> >> gi_list = GenBank.search_for("Opuntia AND rpl16") >> print " gi_list[0] ", gi_list[0] >> >> I get the message: >> >> gi_list[0] Error: Sequence Viewer does not have any Presentations >> for code='uilist_text' >> >> instead of: >> >> ['6273291', '6273290', '6273289', '6273287', '6273286', '6273285', >> '6273284'] > > > It seems that NCBI no longer accepts the "uilist" identifier. E.g. try > the url > > http://www.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?retmode=text&tool=EUtils_P > > ython_client&db=nucleotide&email=biopython-dev%40biopython.org&rettype=uilist&id > > =6273291 > > Does anybody know what this should be? > > -- Michiel de Hoon, Assistant Professor University of Tokyo, Institute of Medical Science Human Genome Center 4-6-1 Shirokane-dai, Minato-ku Tokyo 108-8639 Japan http://bonsai.ims.u-tokyo.ac.jp/~mdehoon From bugzilla-daemon at portal.open-bio.org Thu Feb 3 06:40:05 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] [Bug 1745] New: Genbank parser and REGION fields Message-ID: <200502031140.j13Be5gu011424@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1745 Summary: Genbank parser and REGION fields Product: Biopython Version: Not Applicable Platform: Sun OS/Version: SunOS Status: NEW Severity: normal Priority: P2 Component: Martel/Mindy AssignedTo: biopython-dev@biopython.org ReportedBy: mkersz@ccr.jussieu.fr The Genbank parser chokes on the REGION field of a Genbank record: Traceback (most recent call last): File "./GenBank2Features.py", line 44, in ? cr = gb_iterator.next() File "/usr/local/lib/python2.4/site-packages/Bio/GenBank/__init__.py", line 129, in next return self._parser.parse(File.StringHandle(data)) File "/usr/local/lib/python2.4/site-packages/Bio/GenBank/__init__.py", line 219, in parse self._scanner.feed(handle, self._consumer) File "/usr/local/lib/python2.4/site-packages/Bio/GenBank/__init__.py", line 1259, in feed self._parser.parseFile(handle) File "/usr/local/lib/python2.4/site-packages/Martel/Parser.py", line 328, in parseFile self.parseString(fileobj.read()) File "/usr/local/lib/python2.4/site-packages/Martel/Parser.py", line 356, in parseString self._err_handler.fatalError(result) File "/usr/local/lib/python2.4/xml/sax/handler.py", line 38, in fatalError raise exception Martel.Parser.ParserPositionException: error parsing at or beyond character 172 The line in question (third one): LOCUS NC_004353 1237870 bp DNA linear INV 19-APR-2004 DEFINITION Drosophila melanogaster chromosome 4, complete sequence. ACCESSION NC_004353 REGION: 1..1237870 With "REGION: 1..1237870" deleted, everything goes fine. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From thamelry at binf.ku.dk Thu Feb 3 01:58:36 2005 From: thamelry at binf.ku.dk (thamelry@binf.ku.dk) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] Re: [BioPython] documentation issues In-Reply-To: <4201A2B2.4040507@ims.u-tokyo.ac.jp> References: <200501272056.j0RKuV5c026299@guitar.compbio.ucsf.edu> <41FA0890.3090803@ims.u-tokyo.ac.jp> <4201A2B2.4040507@ims.u-tokyo.ac.jp> Message-ID: <32780.80.164.86.229.1107413916.squirrel@www.binf.ku.dk> > Maybe it is time for a new release? I sent a mail about this some time ago, but it seems to have been killed by the spam filter. The Bio.PDB version in CVS has been collecting bug fixes and additions for almost a year now - a new release would be very welcome! Cheers, -Thomas From jonathan.taylor at utoronto.ca Thu Feb 3 14:30:44 2005 From: jonathan.taylor at utoronto.ca (Jonathan Taylor) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] New release? In-Reply-To: <200501281105.58133.thamelry@binf.ku.dk> References: <200501272056.j0RKuV5c026299@guitar.compbio.ucsf.edu> <41FA0890.3090803@ims.u-tokyo.ac.jp> <200501281105.58133.thamelry@binf.ku.dk> Message-ID: <42027BE4.9090400@utoronto.ca> My only concern is in a few weeks I am going to submit a CAPS module that looks for differential cutsites in alignments and it would be cool to get this new module in. I'd survive though :) Regards, Jon Taylor. Thomas Hamelryck wrote: > Hi everybody, > > Shouldn't we have a new release of Biopython soon? > The last release dates from May 2004 (!). > > In the case of Bio.PDB for example, the CVS version contains a > whole load of bugfixes and new features. I guess the same applies > to other modules. > > Cheers, > From idoerg at burnham.org Thu Feb 3 16:23:03 2005 From: idoerg at burnham.org (Iddo Friedberg) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] New release? In-Reply-To: <42027BE4.9090400@utoronto.ca> References: <200501272056.j0RKuV5c026299@guitar.compbio.ucsf.edu> <41FA0890.3090803@ims.u-tokyo.ac.jp> <200501281105.58133.thamelry@binf.ku.dk> <42027BE4.9090400@utoronto.ca> Message-ID: <42029637.5050006@burnham.org> Sigh... I guess I'm in the hot seat. Sorry folks, life has been happening to me, but yes, we should get a new release out. I can work on it earnestly after Feb 15. In the meantime, can all developers please check open bugs, and whether your tests are up-to-date with your code. For those of you who do not have CVS access, please send me patches, or new module files. Brad Chapman has been our traditional Windows version roller. Can anyone take over? Likewise, anybody can do a Mac version? On a final note, I've always wanted a Biopython RPM... If there is anybody willing to undertake this exercise, that will be really cool. But we can do that after the reease, of course. Best, Iddo Jonathan Taylor wrote: > My only concern is in a few weeks I am going to submit a CAPS module > that looks for differential cutsites in alignments and it would be > cool to get this new module in. I'd survive though :) > > Regards, > Jon Taylor. > > Thomas Hamelryck wrote: > >> Hi everybody, >> >> Shouldn't we have a new release of Biopython soon? >> The last release dates from May 2004 (!). >> In the case of Bio.PDB for example, the CVS version contains a whole >> load of bugfixes and new features. I guess the same applies to other >> modules. >> >> Cheers, > > > _______________________________________________ > Biopython-dev mailing list > Biopython-dev@biopython.org > http://biopython.org/mailman/listinfo/biopython-dev > > -- Iddo Friedberg, Ph.D. The Burnham Institute 10901 N. Torrey Pines Rd. La Jolla, CA 92037 USA Tel: +1 (858) 646 3100 x3516 Fax: +1 (858) 713 9930 http://ffas.ljcrf.edu/~iddo ========================== The first Automated Function Prediction SIG Detroit, MI June 24, 2005 http://ffas.burnham.org/AFP From idoerg at burnham.org Thu Feb 3 16:23:03 2005 From: idoerg at burnham.org (Iddo Friedberg) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] New release? In-Reply-To: <42027BE4.9090400@utoronto.ca> References: <200501272056.j0RKuV5c026299@guitar.compbio.ucsf.edu> <41FA0890.3090803@ims.u-tokyo.ac.jp> <200501281105.58133.thamelry@binf.ku.dk> <42027BE4.9090400@utoronto.ca> Message-ID: <42029637.5050006@burnham.org> Sigh... I guess I'm in the hot seat. Sorry folks, life has been happening to me, but yes, we should get a new release out. I can work on it earnestly after Feb 15. In the meantime, can all developers please check open bugs, and whether your tests are up-to-date with your code. For those of you who do not have CVS access, please send me patches, or new module files. Brad Chapman has been our traditional Windows version roller. Can anyone take over? Likewise, anybody can do a Mac version? On a final note, I've always wanted a Biopython RPM... If there is anybody willing to undertake this exercise, that will be really cool. But we can do that after the reease, of course. Best, Iddo Jonathan Taylor wrote: > My only concern is in a few weeks I am going to submit a CAPS module > that looks for differential cutsites in alignments and it would be > cool to get this new module in. I'd survive though :) > > Regards, > Jon Taylor. > > Thomas Hamelryck wrote: > >> Hi everybody, >> >> Shouldn't we have a new release of Biopython soon? >> The last release dates from May 2004 (!). >> In the case of Bio.PDB for example, the CVS version contains a whole >> load of bugfixes and new features. I guess the same applies to other >> modules. >> >> Cheers, > > > _______________________________________________ > Biopython-dev mailing list > Biopython-dev@biopython.org > http://biopython.org/mailman/listinfo/biopython-dev > > -- Iddo Friedberg, Ph.D. The Burnham Institute 10901 N. Torrey Pines Rd. La Jolla, CA 92037 USA Tel: +1 (858) 646 3100 x3516 Fax: +1 (858) 713 9930 http://ffas.ljcrf.edu/~iddo ========================== The first Automated Function Prediction SIG Detroit, MI June 24, 2005 http://ffas.burnham.org/AFP From mdehoon at ims.u-tokyo.ac.jp Thu Feb 3 22:10:10 2005 From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] Re: [BioPython] Patch to fix testing failures in biopython-1.30 In-Reply-To: <1106768301.32684.52.camel@tioga.barnard-engineering.com> References: <1106768301.32684.52.camel@tioga.barnard-engineering.com> Message-ID: <4202E792.3020409@ims.u-tokyo.ac.jp> Bill Barnard wrote: > Finally, the Tests/test_SVDSuperimposer.py test does not appear to > run correctly. The function itself appears to be broken, as it runs > for upwards of two hours on my machine (1.8 GHz Athlon XP 2500+) with > no output. I moved the test to a new Tests/broken directory. > >> Thanks for your patch, Bill. The failed test_SVDSuperimposer may be >> due to an incorrect compilation of the Lapack libraries on your >> computer. For example, the default compilation of numerical python on >> Cygwin and possibly Linux results in a broken Lapack, in which some >> linear algebra functions hang forever. The SVD code in Biopython uses >> these functions, so that may be the reason that the test didn't >> finish. Bill checked this and it turned out that the failed test was indeed due to Lapack problems in Numerical Python. So no need to move the test_SVDSuperimposer.py to Tests/broken. --Michiel. From mdehoon at ims.u-tokyo.ac.jp Thu Feb 3 22:17:53 2005 From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] New release? In-Reply-To: <42029637.5050006@burnham.org> References: <200501272056.j0RKuV5c026299@guitar.compbio.ucsf.edu> <41FA0890.3090803@ims.u-tokyo.ac.jp> <200501281105.58133.thamelry@binf.ku.dk> <42027BE4.9090400@utoronto.ca> <42029637.5050006@burnham.org> Message-ID: <4202E961.9000503@ims.u-tokyo.ac.jp> Iddo Friedberg wrote: > Brad Chapman has been our traditional Windows version roller. Can anyone > take over? I've made the Windows installers for the past couple of versions and I'll be happy to make the next ones. > Likewise, anybody can do a Mac version? I don't think it is necessary. I have had no problems installing Biopython with python setup.py install on Mac OS X. --Michiel. From mdehoon at ims.u-tokyo.ac.jp Thu Feb 3 22:35:22 2005 From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] Future plans for Numerical Python Message-ID: <4202ED7A.1090306@ims.u-tokyo.ac.jp> Hi folks, On the Numerical Python mailing list I read the less-than-brilliant idea to remove LinearAlgebra, FFT, and RandomArray from Numerical Python 30.0. LinearAlgebra and RandomArray are used in various parts in Biopython. The numpy developer (who is also a SciPy developer) suggests that people use the corresponding functions in SciPy. However, in my experience SciPy is much harder to install than Numerical Python, so this would result in a major hurdle for Biopython users. Hell, I'm pretty good with Python now, but I haven't been able to figure out how to get SciPy installed. So if you are as concerned about this as I am, please let your voice be heard on the numpy mailing list: numpy-discussion@lists.sourceforge.net Several users have already complained about these plans, but so far the developer has not caved in. Below is the original message. --Michiel. Travis Oliphant wrote: > > I've gotten Numeric3 (equivalent to Numeric 30.0) into a state where > multiarray compiles. > > It is far from production ready. Several sections of the code still > need to be cleaned up to avoid segfaults. But, the general outline > is there. As this is very alpha code (though based on a very mature > code-base) it is named Numeric3 so it does not clobber your current > Numeric installation just in case you accidentally do an install. > You will have to make sure the correct multiarray is being loaded > through your sys.path list (or just point your sys.path to the build > location of Numeric3) if you want to play with it. No array_number > methods have been loaded yet (there is an interface to load your own > if you like). I expect to have ufuncs working with the new > arrayobject by the end of the month. Until then, arrayobjects are > purely structural beasts. > > If anybody would like to comment on the design or direction of > Numeric 30.0, your comments are welcome. If you would like to > checkout the code through CVS you may do that using > > cvs -d:pserver:anonymous@cvs.sourceforge.net:/cvsroot/numpy login > > press when prompted for a password. > > cvs -z3 -d:pserver:anonymous@cvs.sourceforge.net:/cvsroot/numpy co -P > /Numeric3/ > > A rough design document is available by following the link at > http://www.scipy.org/wikis/numdesign/num3news > > The major goal is: > > Numeric 30.0 will have all the important new features of numarray as > well as maintain or improve on the speed of Numeric for all array > types. > > Besides this, Numeric 30.0 will not include any FFT's, LinearAlgebra, > or Random Numbers (these are all provided much more proficiently by > SciPy). Masked Arrays, and Matrices will be provided as standard > subclasses in Python. Ideally, RecordArrays will be provided in the > same way. > > I will not re-invent code that I can borrow from past versions of > Numeric and or numarray. > > Best wishes, > > -Travis Oliphant > > > > > > > > ------------------------------------------------------- This SF.Net > email is sponsored by: IntelliVIEW -- Interactive Reporting Tool for > open source databases. Create drag-&-drop reports. Save time by over > 75%! Publish reports on the web. Export to DOC, XLS, RTF, etc. > Download a FREE copy at http://www.intelliview.com/go/osdn_nl > _______________________________________________ Numpy-discussion > mailing list Numpy-discussion@lists.sourceforge.net > https://lists.sourceforge.net/lists/listinfo/numpy-discussion > > From bugzilla-daemon at portal.open-bio.org Sat Feb 5 00:37:33 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] [Bug 1746] New: Again with the "Unexpected end of stream" when parsing Blast results Message-ID: <200502050537.j155bXjc024086@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1746 Summary: Again with the "Unexpected end of stream" when parsing Blast results Product: Biopython Version: Not Applicable Platform: Macintosh OS/Version: MacOS X Status: NEW Severity: normal Priority: P2 Component: Main Distribution AssignedTo: biopython-dev@biopython.org ReportedBy: plorch@email.unc.edu This was Bug#1627. I just upgraded to 1.3. I rediscovered this bug while running www_blast.py in Bio/Doc/examples. Error code: plorch% python www_blast.py Doing the BLAST and retrieving the results... Parsing the results and extracting info... Traceback (most recent call last): File "www_blast.py", line 37, in ? b_record = b_parser.parse(string_result_handle) File "/Library/Frameworks/Python.framework/Versions/2.3/lib/python2.3/site-packages/Bio/ Blast/NCBIWWW.py", line 47, in parse self._scanner.feed(handle, self._consumer) File "/Library/Frameworks/Python.framework/Versions/2.3/lib/python2.3/site-packages/Bio/ Blast/NCBIWWW.py", line 96, in feed has_re=re.compile(r'.?BLAST')) File "/Library/Frameworks/Python.framework/Versions/2.3/lib/python2.3/site-packages/Bio/ ParserSupport.py", line 335, in read_and_call_until line = safe_readline(uhandle) File "/Library/Frameworks/Python.framework/Versions/2.3/lib/python2.3/site-packages/Bio/ ParserSupport.py", line 411, in safe_readline raise SyntaxError, "Unexpected end of stream." SyntaxError: Unexpected end of stream. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Mon Feb 7 06:34:47 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] [Bug 1745] Genbank parser and REGION fields Message-ID: <200502071134.j17BYlbE009033@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1745 ------- Additional Comments From mdehoon@ims.u-tokyo.ac.jp 2005-02-07 06:34 ------- The latest Drosophila chromosome 4 file in Genbank from 2004.12.12 does not have the REGION keyword: LOCUS NC_004353 1281640 bp DNA linear INV 12-DEC-2004 DEFINITION Drosophila melanogaster chromosome 4, complete sequence. ACCESSION NC_004353 So it looks like this error was caused by an old (and possibly incorrect) Genbank file. --Michiel. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Mon Feb 7 08:23:05 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] [Bug 1745] Genbank parser and REGION fields Message-ID: <200502071323.j17DN5Xf010455@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1745 ------- Additional Comments From mkersz@ccr.jussieu.fr 2005-02-07 08:22 ------- Donloaded TODAY from http://www.ncbi.nlm.nih.gov/mapview/seq_reg.cgi?taxid=7227&chr=4&from=-35006&to=1500519 LOCUS NC_004353 1237870 bp DNA linear INV 19-APR-2004 DEFINITION Drosophila melanogaster chromosome 4, complete sequence. ACCESSION NC_004353 REGION: 1..1237870 VERSION NC_004353.1 GI:24638835 KEYWORDS . SOURCE Drosophila melanogaster (fruit fly) Maybe you download from somewhere else ... ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Mon Feb 7 08:15:14 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] [Bug 1747] New: GenBank parser is very slow and memory hungry for large input files Message-ID: <200502071315.j17DFEXH010375@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1747 Summary: GenBank parser is very slow and memory hungry for large input files Product: Biopython Version: Not Applicable Platform: PC OS/Version: All Status: NEW Severity: major Priority: P2 Component: Main Distribution AssignedTo: biopython-dev@biopython.org ReportedBy: biopython-bugzilla@maubp.freeserve.co.uk Tested on BioPython 1.30 with Python 2.3 The GenBank parser (using Martel) appears to work on all the bacterial genomes I have tested, but only if the machine has sufficent RAM. The memory consumption is incredibly high when attempting to load the larger genbank files. I would argue the severity is "Blocker" on the grounds that the GenBank parser is effectively useless for large genomes. The high memory usage is also suggestive of a severe memory leak. As reported to the mailing list: http://www.biopython.org/pipermail/biopython-dev/2005-January/002881.html http://www.biopython.org/pipermail/biopython-dev/2005-January/002889.html The following times and memory usage figures are on Windows 2000, Python 2.3.3 using the GenBank Iterator (script running from Idle):- NC_003065.gbk 480 kb, 4 seconds, 28 MB RAM NC_003064.gbk 1,217 kb, 11 seconds, 56 MB RAM NC_000854.gbk 3,391 kb, 45 seconds, 165 MB RAM NC_003063.gbk 4,725 kb, 55 seconds, 195 MB RAM NC_003062.gbk 6,574 kb, 88 seconds, 268 MB RAM NC_005966.gbk 8,858 kb, 139 seconds, 372 MB RAM NC_000913.gbk 10,267 kb, 171 seconds, 409 MB RAM NC_000962.gbk 11,010 kb, 200 seconds, 486 MB RAM NC_003997.gbk 12,026 kb, 228 seconds, 496 MB RAM NC_002678.gbk 15,120 kb, 306 seconds, 586 MB RAM NC_005027.gbk 18,211 kb, not enough RAM NC_004463.gbk 19,500 kb, not enough RAM NC_003888.gbk 24,390 kb, not enough RAM The above computer was a 2.26 GHz Intel Pentium 4, with 735 MB RAM. Memory usage figures are recorded by hand from TaskManager's process view at the end of the program run. For larger files (e.g. NC_005027.gbk at 18,211 kb) the system would run out of memory and begin paging to disk. For this particular example, the test eventually completed in half an hour. I repeated this test on a multiuser dual Xeon linux box with Python 2.3.4 for the first few files, to confirm this is not just a windows problem: NC_003065.gbk 480 kb, 5 seconds, ~24 MB RAM NC_003064.gbk 1,217 kb, 13 seconds, ~51 MB RAM NC_000854.gbk 3,391 kb, 54 seconds, ~154 MB RAM NC_003063.gbk 4,725 kb, 62 seconds, ~183 MB RAM NC_003062.gbk 6,574 kb, 97 seconds, ~251 MB RAM The unix "time" command did not report memory usage, the above figures were recorded by hand from watching the process using "top". ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Mon Feb 7 21:17:23 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] [Bug 1745] Genbank parser and REGION fields Message-ID: <200502080217.j182HMDe017183@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1745 ------- Additional Comments From mdehoon@ims.u-tokyo.ac.jp 2005-02-07 21:17 ------- OK, this is a real bug. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From gaetan.lehmann at jouy.inra.fr Fri Feb 4 04:23:47 2005 From: gaetan.lehmann at jouy.inra.fr (Gaetan Lehmann) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] New release? In-Reply-To: <42029637.5050006@burnham.org> References: <200501272056.j0RKuV5c026299@guitar.compbio.ucsf.edu> <41FA0890.3090803@ims.u-tokyo.ac.jp> <200501281105.58133.thamelry@binf.ku.dk> <42027BE4.9090400@utoronto.ca> <42029637.5050006@burnham.org> Message-ID: Hi, On Thu, 03 Feb 2005 13:23:03 -0800, Iddo Friedberg wrote: > On a final note, I've always wanted a Biopython RPM... If there is > anybody willing to undertake this exercise, that will be really cool. > But we can do that after the reease, of course. I just want to say that biopython is packaged for mandrake since august 2004. I will (in the next few days) add epydoc documentation. I think this package is a good base if you want to build your own package :-) Regards, Gaetan. -- Gaetan Lehmann Tel: +33 1 34 65 22 34 Biologie du D?veloppement et de la Reproduction INRA de Jouy-en-Josas (France) From mit2005 at vreme.yubc.net Sat Feb 5 01:09:08 2005 From: mit2005 at vreme.yubc.net (IPSI-2005 Italy and USA) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] Invitation to Italy and USA 2005; c/ba Message-ID: <200502050609.j15698ot007711@vreme.yubc.net> Dear potential Speaker: On behalf of the organizing committee, I would like to extend a cordial invitation for you to attend one or both of the upcoming IPSI BgD multidisciplinary, interdisciplinary, and transdisciplinary conferences. The first one will take place in Cambridge, Massachusetts, USA: IPSI-2005 USA Hotel@MIT, Cambridge (arrival: 7 July 05 / departure: 10 July 05) New deadlines: 20 February 05 (abstract) / 15 April 05 (full paper) The second one will take place in Loreto Aprutino, Italy: IPSI-2005 ITALY Hotel Castello Chiola (arrival: 27 July 05 / departure: 1 August 05) New deadlines: 20 February 05 (abstract) / 15 April 05 (full paper) All IPSI BgD conferences are non-profit. They bring together the elite of the world science; so far, we have had seven Nobel Laureates speaking at the opening ceremonies. The conferences always take place in some of the most attractive places of the world. All those who come to IPSI conferences once, always love to come back (because of the unique professional quality and the extremely creative atmosphere); lists of past participants are on the web, as well as details of future conferences. These conferences are in line with the newest recommendations of the US National Science Foundation and of the EU research sponsoring agencies, to stress multidisciplinary, interdisciplinary, and transdisciplinary research (M.I.T. research). The speakers and activities at the conferences truly support this type of scientific interaction. One of the main topics of this conference is "E-education and E-business with Special Emphasis on Semantic Web and Web Datamining" Other topics of interest include, but are not limited to: * Internet * Computer Science and Engineering * Mobile Communications/Computing for Science and Business * Management and Business Administration * Education * e-Medicine * e-Oriented Bio Engineering/Science and Molecular Engineering/Science * Environmental Protection * e-Economy * e-Law * Technology Based Art and Art to Inspire Technology Developments * Internet Psychology If you would like more information on either conference, please reply to this e-mail message. If you plan to submit an abstract and paper, please let us know immediately for planning purposes. Note that you can submit your paper also to the IPSI Transactions journal. Sincerely Yours, Prof. V. Milutinovic, Chairman, IPSI BgD Conferences * * * CONTROLLING OUR E-MAILS TO YOU * * * If you would like to continue to be informed about future IPSI BgD conferences, please reply to this e-mail message with a subject line of SUBSCRIBE. If you would like to be removed from our mailing list, please reply to this e-mail message with a subject line of REMOVE. From idoerg at burnham.org Tue Feb 8 00:38:02 2005 From: idoerg at burnham.org (Iddo Friedberg) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] New release? In-Reply-To: Message-ID: Good to know. I'm a Mandrake user and I didn't know that, one more reason to use Mandrake I guess. You're the one doing the packaging? Good for you! Cheers, ./I -- Iddo Friedberg, Ph.D. The Burnham Institute 10901 N. Torrey Pines Rd. La Jolla, CA 92037, USA Tel: +1 (858) 646 3100 x3516 Fax: +1 (858) 646 3171 http://ffas.ljcrf.edu/~iddo ------------------------------------- Automated Protein Function Prediction Meeting, June 24, 2005 http://ffas.burnham.org/AFP On Fri, 4 Feb 2005, Gaetan Lehmann wrote: > > Hi, > > On Thu, 03 Feb 2005 13:23:03 -0800, Iddo Friedberg > wrote: > > > On a final note, I've always wanted a Biopython RPM... If there is > > anybody willing to undertake this exercise, that will be really cool. > > But we can do that after the reease, of course. > > I just want to say that biopython is packaged for mandrake since august > 2004. I will (in the next few days) add epydoc documentation. > I think this package is a good base if you want to build your own package > :-) > > Regards, > > Gaetan. > > -- > Gaetan Lehmann > Tel: +33 1 34 65 22 34 > Biologie du Développement et de la Reproduction > INRA de Jouy-en-Josas (France) > > _______________________________________________ > Biopython-dev mailing list > Biopython-dev@biopython.org > http://biopython.org/mailman/listinfo/biopython-dev > From mkur at gazeta.pl Wed Feb 9 21:25:55 2005 From: mkur at gazeta.pl (Michal Kurowski) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] compass alignment parsing Message-ID: <20050210022555.GA24509@calvados> Hi, We've been using Nick Grishin's Compass for a while and as it turned out there's a small error in the Biopython parserfor it. It makes it not quite usable with legacy alignment data. Basically it's a regexp inefficiency. I'd like to patch it. How to obtain CVS access ? Cheers, -- Michal Kurowski From idoerg at burnham.org Wed Feb 9 23:35:38 2005 From: idoerg at burnham.org (Iddo Friedberg) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] compass alignment parsing In-Reply-To: <20050210022555.GA24509@calvados> Message-ID: Michal, Thanks for doing this. You want to give me the patch or the new module? Iddo -- Iddo Friedberg, Ph.D. The Burnham Institute 10901 N. Torrey Pines Rd. La Jolla, CA 92037, USA Tel: +1 (858) 646 3100 x3516 Fax: +1 (858) 646 3171 http://ffas.ljcrf.edu/~iddo ------------------------------------- Automated Protein Function Prediction Meeting, June 24, 2005 http://ffas.burnham.org/AFP On Thu, 10 Feb 2005, Michal Kurowski wrote: > Hi, > > We've been using Nick Grishin's Compass for a while and as it turned > out there's a small error in the Biopython parserfor it. It makes it > not quite usable with legacy alignment data. Basically it's a regexp > inefficiency. > > I'd like to patch it. How to obtain CVS access ? > > Cheers, > > -- > Michal Kurowski > > > _______________________________________________ > Biopython-dev mailing list > Biopython-dev@biopython.org > http://biopython.org/mailman/listinfo/biopython-dev > From mdehoon at ims.u-tokyo.ac.jp Fri Feb 11 03:41:48 2005 From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] Re: [BioPython] Patch to fix testing failures in biopython-1.30 In-Reply-To: <1106768301.32684.52.camel@tioga.barnard-engineering.com> References: <1106768301.32684.52.camel@tioga.barnard-engineering.com> Message-ID: <420C6FCC.1040009@ims.u-tokyo.ac.jp> I tried these urls today and it seems that both emblfetch and dbfetch work. Were there any problems using the emblfetch urls? --Michiel. Bill Barnard wrote: > The fixed problem is in Bio/dbdefs/pdb.py - the location of the cgi has > changed, and there appears to be an extraneous newline in the returned > text. > > pdb_ebi_cgi = CGIDB( > name="pdb-ebi-cgi", > - cgi="http://www.ebi.ac.uk/cgi-bin/emblfetch", > - url="http://www.ebi.ac.uk/cgi-bin/emblfetch", > + cgi="http://www.ebi.ac.uk/cgi-bin/dbfetch", > + url="http://www.ebi.ac.uk/cgi-bin/dbfetch", > delay=5.0, > params=[("db", "PDB"), > ("format", "default"), # also Fasta, bsml, agave available > ("style", "raw"), > ], > key="id", > - failure_cases=[(not_header_expr, "results do not look like PDB format")] > + failure_cases=[(not_header_expr, "pdb_ebi_cgi results do not look like PDB format")] > ) > From eirik.sonneland at student.umb.no Fri Feb 11 07:44:37 2005 From: eirik.sonneland at student.umb.no (=?ISO-8859-1?Q?Eirik_S=F8nneland?=) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] Bug Message-ID: <420CA8B5.1080508@student.umb.no> Hi! Just wondered how it's possible to handle/bypass the bug: This was Bug#1627. I just upgraded to 1.3. I rediscovered this bug while running www_blast.py in Bio/Doc/examples. Error code: plorch% python www_blast.py Doing the BLAST and retrieving the results... Parsing the results and extracting info... Traceback (most recent call last): File "www_blast.py", line 37, in ? b_record = b_parser.parse(string_result_handle) File "/Library/Frameworks/Python.framework/Versions/2.3/lib/python2.3/site-packages/Bio/ Blast/NCBIWWW.py", line 47, in parse self._scanner.feed(handle, self._consumer) File "/Library/Frameworks/Python.framework/Versions/2.3/lib/python2.3/site-packages/Bio/ Blast/NCBIWWW.py", line 96, in feed has_re=re.compile(r'.?BLAST')) File "/Library/Frameworks/Python.framework/Versions/2.3/lib/python2.3/site-packages/Bio/ ParserSupport.py", line 335, in read_and_call_until line = safe_readline(uhandle) File "/Library/Frameworks/Python.framework/Versions/2.3/lib/python2.3/site-packages/Bio/ ParserSupport.py", line 411, in safe_readline raise SyntaxError, "Unexpected end of stream." SyntaxError: Unexpected end of stream. Thanks! Regards, Eirik From idoerg at burnham.org Sun Feb 13 14:50:00 2005 From: idoerg at burnham.org (Iddo Friedberg) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] Getting ready for a release Message-ID: <420FAF68.2020406@burnham.org> Hi all, It's been pointed out, quite rightly that we are long overdue for a release. I ran some unit tests, and things seem not-too-shabby, surprisingly. Only four failures: test_Compass test_ProtParam test_Registry test_Align (cripes, that's mine I think) Righty-oh: can the responsible parties please have a quick looksee and let us know? Personally my wife passed over a new biopython release as a Valentine's day gift, so I'm in less of a hurry. This Friday will do just fine. ./I -- Iddo Friedberg, Ph.D. The Burnham Institute 10901 N. Torrey Pines Rd. La Jolla, CA 92037 USA Tel: +1 (858) 646 3100 x3516 Fax: +1 (858) 713 9930 http://ffas.ljcrf.edu/~iddo ========================== The First Automated Protein Function Prediction SIG Detroit, MI June 24, 2005 http://ffas.burnham.org/AFP From idoerg at burnham.org Sun Feb 13 17:01:55 2005 From: idoerg at burnham.org (Iddo Friedberg) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] Getting ready for a release, II Message-ID: <420FCE53.1010508@burnham.org> OK, except for the test_Registry problem in the unit-tests, the rest are fixed or getting fixed. Any major bugs open? Bugzilla has 19, but most of them are either not critical, or critical and have been fixed but not removed from Bugzilla. Also, I'd like all developers who made changes since 5/2004 (last release) to list them, with thir names. But it will be difficult to compile features contributed frm this list. We used to have a Wiki, but it is no more. Anybody has an idea for a temporary "sandbox" where all developers can list their latest contributions? After they are all listed, I'll just add the list to the release. Thanks, Iddo -- Iddo Friedberg, Ph.D. The Burnham Institute 10901 N. Torrey Pines Rd. La Jolla, CA 92037 USA Tel: +1 (858) 646 3100 x3516 Fax: +1 (858) 713 9930 http://ffas.ljcrf.edu/~iddo ========================== The First Automated Protein Function Prediction SIG Detroit, MI June 24, 2005 http://ffas.burnham.org/AFP From jeffrey.chang at duke.edu Sun Feb 13 17:51:42 2005 From: jeffrey.chang at duke.edu (Jeffrey Chang) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] Getting ready for a release, II In-Reply-To: <420FCE53.1010508@burnham.org> References: <420FCE53.1010508@burnham.org> Message-ID: On Feb 13, 2005, at 5:01 PM, Iddo Friedberg wrote: > Also, I'd like all developers who made changes since 5/2004 (last > release) to list them, with thir names. But it will be difficult to > compile features contributed frm this list. We used to have a Wiki, > but it is no more. Anybody has an idea for a temporary "sandbox" where > all developers can list their latest contributions? After they are all > listed, I'll just add the list to the release. In case people (ahem, me) have forgotten what they've done since them, you can also get a list of the changes from the CVS logs using: cvs log -b -N -d'>2004-05-01' Jeff From mdehoon at ims.u-tokyo.ac.jp Sun Feb 13 23:01:43 2005 From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] Re: [BioPython] missing databases in Config.py of EUtils In-Reply-To: <42051C59.8020703@usc.edu> References: <200502051812.j15ICqKr031404@portal.open-bio.org> <42051C59.8020703@usc.edu> Message-ID: <421022A7.20006@ims.u-tokyo.ac.jp> Hi Yu Huang, I am now going through recent bugs and patches for Biopython for the upcoming new release of Biopython. I am not very familiar with EUtils. Can you give a small code example that uses your patch? --Michiel. Yu Huang wrote: > Hi > > File location: Bio/EUtils/Config.py. It misses some databases offered by > NCBI. > I used two databases, unigene and gene. So I added them to the file. > > ''' > > Added by yh > > ''' > > databases.UNIGENE = _add_db(DatabaseInfo("unigene", 1)) > > databases.GENE = _add_db(DatabaseInfo("gene", 1)) > > It's great that biopython now has the debian package! > Yu > > > ------------------------------------------------------------------------ > > """Configuration information about NCBI's databases""" > > # Used to figure out if efetch supports the start, stop, strand, and > # complexity fields > PUBLICATION_TYPE = 0 > SEQUENCE_TYPE = 1 > > # Map from database name to database type > class DatabaseInfo: > """stores NCBI's name for the database and its type""" > def __init__(self, db, dbtype): > self.db = db > self.dbtype = dbtype > > class DatabaseDict(dict): > """map from name to DatabaseInfo for that database name > > Entries are also available through attributes like PUBMED, > OMIM, and NUCLEOTIDE. > """ > def gettype(self, db, dbtype = None): > """Given a database name and optional type, return the database type""" > if dbtype not in (None, SEQUENCE_TYPE, PUBLICATION_TYPE): > raise TypeError("Unknown database type: %r" % (dbtype,)) > if dbtype is None: > dbtype = self[db].dbtype > return dbtype > > databases = DatabaseDict() > > def _add_db(x): > databases[x.db] = x > return x.db > > # XXX Try these > # > # > # > # > # > # > # > # > # > # > # > > databases.PUBMED = _add_db(DatabaseInfo("pubmed", 0)) > databases.OMIM = _add_db(DatabaseInfo("omim", 0)) > databases.JOURNALS = _add_db(DatabaseInfo("journals", 0)) > > databases.GENOME = _add_db(DatabaseInfo("genome", 1)) > databases.NUCLEOTIDE = _add_db(DatabaseInfo("nucleotide", 1)) > databases.PROTEIN = _add_db(DatabaseInfo("protein", 1)) > databases.POPSET = _add_db(DatabaseInfo("popset", 1)) > databases.SEQUENCES = _add_db(DatabaseInfo("sequences", 1)) > > ''' > Added by yh > ''' > databases.UNIGENE = _add_db(DatabaseInfo("unigene", 1)) > databases.GENE = _add_db(DatabaseInfo("gene", 1)) > > # Someday I want to make it easier to get a given format. I would > # rather not have to specify the retmode/rettype pair, but I don't > # know what people want from this feature, so skip for now. Plus, > # it's harder than I thought. > > ##class FormatInfo: > ## def __init__(self, name, retmode): > ## self.name = name > ## self.retmode = retmode > ## self.rettype = rettype > > > ------------------------------------------------------------------------ > > _______________________________________________ > BioPython mailing list - BioPython@biopython.org > http://biopython.org/mailman/listinfo/biopython -- Michiel de Hoon, Assistant Professor University of Tokyo, Institute of Medical Science Human Genome Center 4-6-1 Shirokane-dai, Minato-ku Tokyo 108-8639 Japan http://bonsai.ims.u-tokyo.ac.jp/~mdehoon From mdehoon at ims.u-tokyo.ac.jp Mon Feb 14 01:00:52 2005 From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] Getting ready for a release, II In-Reply-To: <420FCE53.1010508@burnham.org> References: <420FCE53.1010508@burnham.org> Message-ID: <42103E94.2030604@ims.u-tokyo.ac.jp> Hi Iddo, Thank you for getting the new release together. Below is a summary of my updates since 2004.08.14. I am trying to handle recently sent in bug reports and patches as much as possible before the release, so there may be some small additions to this list. --Michiel. ---------------------------- date: 2004/08/14 08:22:18; Added the functions 'complement' and 'reverse_complement' to Bio.Seq's Seq and MutableSeq objects. Similar functions previous existed in various locations in BioPython: - forward_complement, reverse_complement in Bio.GFF.easy - complement, antiparallel in Bio.SeqUtils These functions have now been deprecated, and will generate a DeprecationWarning when used. The functions complement and reverse_complement, when applied to a Seq object, will return a new Seq object. The same function applied to a MutableSeq object will modify the MutableSeq object itself, and don't return anything. ============================================================================= ---------------------------- date: 2004/08/26 13:22:58; Bug fix and enhancement from Fred Sohm: Added a method __maketrans in Seq in Seq.complement() and Seq.reverse_complement() replaced seq.alphabet by self.alphabet. Added support for lower case DNA in Seq.complement() and Seq.reverse_complement. Same thing in MutableSeq.complement() ============================================================================= ---------------------------- date: 2005/02/11 08:08:30; The CEL file parser in Bio/Affy/celmodule.cc was replaced by a scanner/consumer in CelFile.py, using Biopython's parser framework. Compilation of the C++ extension celmodule.cc caused problems on some platforms in the past. ---------------------------- ---------------------------- date: 2005/01/21 09:01:08; Removed two lines in setup.py that were causing problems when compiling the C++ extensions under Python 2.3. Compilation of KDTree is now switched off by default because of recurring C++ compilation problems. ---------------------------- date: 2004/05/08 06:32:51; Created Bio.Statistics and added lowess.py as its first file. ============================================================================= date: 2004/06/09 15:22:14; C Clustering Library version 1.27. Clean return from treecluster if insufficient memory was available to complete the calculation. Code cleanup. ============================================================================= Iddo Friedberg wrote: > OK, except for the test_Registry problem in the unit-tests, the rest are > fixed or getting fixed. > > Any major bugs open? Bugzilla has 19, but most of them are either not > critical, or critical and have been fixed but not removed from Bugzilla. > > Also, I'd like all developers who made changes since 5/2004 (last > release) to list them, with thir names. But it will be difficult to > compile features contributed frm this list. We used to have a Wiki, but > it is no more. Anybody has an idea for a temporary "sandbox" where all > developers can list their latest contributions? After they are all > listed, I'll just add the list to the release. > > Thanks, > > Iddo > -- Michiel de Hoon, Assistant Professor University of Tokyo, Institute of Medical Science Human Genome Center 4-6-1 Shirokane-dai, Minato-ku Tokyo 108-8639 Japan http://bonsai.ims.u-tokyo.ac.jp/~mdehoon From bugzilla-daemon at portal.open-bio.org Mon Feb 14 02:54:28 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] [Bug 1733] compiler recognition in setup.py Message-ID: <200502140754.j1E7sSBw031613@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1733 mdehoon@ims.u-tokyo.ac.jp changed: What |Removed |Added ---------------------------------------------------------------------------- Status|NEW |RESOLVED Resolution| |FIXED ------- Additional Comments From mdehoon@ims.u-tokyo.ac.jp 2005-02-14 02:54 ------- The particular bug mentioned here no longer exists with the current setup.py. However, C++ code may continue to cause compilation problems. Currently, the only C++ dependent module in Biopython is Bio.KDTree, whose compilation is switched off on default, since not many users need this module. The C++ code in Bio.Affy has been replaced by pure Python code. So with the current Biopython, this bug should not appear. Note that Python 2.4 has better C++ support than Python 2.3 (which generated the traceback below), so this may be less of a problem if future Biopython extensions contain C++. Closing this bug for now. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bartek at rezolwenta.eu.org Mon Feb 14 04:00:52 2005 From: bartek at rezolwenta.eu.org (bartek wilczynski) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] website error Message-ID: <1108371652.421068c4c9760@imp.rezolwenta.eu.org> Hi, I think there is a problem with the scipts powering biopython website. If I go to http://www.biopython.org everything seems to be fine but trying http://biopython.org gives me an error traceback (appended to the e-mail). Can anyone responsible for the website look at it ? -- cheers Bartek TRACEBACK: Traceback (most recent call last): File "/usr/lib/python2.2/site-packages/quixote/publish.py", line 532, in publish output = self.process_request(request, env) File "/usr/lib/python2.2/site-packages/quixote/publish.py", line 514, in process_request output = self.try_publish(request, env.get('PATH_INFO', '')) File "/usr/lib/python2.2/site-packages/quixote/publish.py", line 462, in try_publish output = object(request) File "/usr/lib/python2.2/site-packages/BioWebsite/index.py", line 20, in _q_index page += news() File "/usr/lib/python2.2/site-packages/BioWebsite/index.py", line 71, in news blog_news = NewsBlog() File "/usr/lib/python2.2/site-packages/BioWebsite/NewsRetrieve.py", line 43, in __init__ self.blog_id = self._get_blog_id() File "/usr/lib/python2.2/site-packages/BioWebsite/NewsRetrieve.py", line 75, in _get_blog_id self.constants.password) File "/usr/lib/python2.2/xmlrpclib.py", line 821, in __call__ return self.__send(self.__name, args) File "/usr/lib/python2.2/xmlrpclib.py", line 975, in __request verbose=self.__verbose File "/usr/lib/python2.2/xmlrpclib.py", line 853, in request return self.parse_response(h.getfile()) File "/usr/lib/python2.2/xmlrpclib.py", line 886, in parse_response response = f.read(1024) File "/usr/lib/python2.2/httplib.py", line 1140, in read assert not self._line_consumed and self._line_left AssertionError Form: Cookies: Environment: DOCUMENT_ROOT /home/websites/biopython.org/ GATEWAY_INTERFACE CGI/1.1 HTTP_ACCEPT text/xml,application/xml,application/xhtml+xml,text/html;q=0.9,text/plain;q=0.8,image/png,*/*;q=0.5 HTTP_ACCEPT_CHARSET ISO-8859-1,utf-8;q=0.7,*;q=0.7 HTTP_ACCEPT_ENCODING gzip,deflate HTTP_ACCEPT_LANGUAGE pl,en-us;q=0.7,en;q=0.3 HTTP_CACHE_CONTROL max-age=27000 HTTP_CONNECTION keep-alive HTTP_HOST biopython.org HTTP_USER_AGENT Mozilla/5.0 (X11; U; Linux i686; en-US; rv:1.7) Gecko/20041013 Firefox/0.9.3 (Ubuntu) HTTP_VIA 1.1 w3cache.mimuw.edu.pl:8080 (squid/2.5.STABLE4) HTTP_X_FORWARDED_FOR 10.1.6.238 PATH /sbin:/usr/sbin:/bin:/usr/bin:/usr/X11R6/bin PATH_INFO / PATH_TRANSLATED /home/websites/biopython.org/biopython.cgi/ QUERY_STRING REMOTE_ADDR 193.0.96.15 REMOTE_PORT 53242 REQUEST_METHOD GET REQUEST_URI / SCRIPT_FILENAME /home/websites/biopython.org/biopython.cgi SCRIPT_NAME SCRIPT_URI http://biopython.org/ SCRIPT_URL / SERVER_ADDR 65.246.187.176 SERVER_ADMIN root-l@open-bio.org SERVER_NAME biopython.org SERVER_PORT 80 SERVER_PROTOCOL HTTP/1.0 SERVER_SIGNATURE
Apache/2.0.40 Server at biopython.org Port 80
SERVER_SOFTWARE Apache/2.0.40 (Red Hat Linux) UNIQUE_ID vAUFfkH2u7AAAHRbiaYAAAAG From bugzilla-daemon at portal.open-bio.org Mon Feb 14 04:19:50 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] [Bug 1709] Not using -fPIC to build shared lib. Message-ID: <200502140919.j1E9Jn46032547@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1709 mdehoon@ims.u-tokyo.ac.jp changed: What |Removed |Added ---------------------------------------------------------------------------- Status|NEW |RESOLVED Resolution| |FIXED ------- Additional Comments From mdehoon@ims.u-tokyo.ac.jp 2005-02-14 04:19 ------- The fix for setup.py is not suitable because it is platform-dependent and most likely will cause problems on other platforms. Currently, the only C++ dependent module in Biopython is Bio.KDTree, whose compilation is switched off on default, since not many users need this module. The C++ code in Bio.Affy has been replaced by pure Python code. So with the current Biopython, this bug should not appear. Note that Python 2.4 has better C++ support than Python 2.3 (which generated the traceback below), so this may be less of a problem if future Biopython extensions contain C++. Closing this bug for now. 1. The .dtd file permissions seem to have been fixed. 2. I'm not sure what to do about these. Perhaps a local problem? 3. This seems to be a distutils problem rather than a Biopython problem. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From mdehoon at ims.u-tokyo.ac.jp Mon Feb 14 06:23:23 2005 From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] website error In-Reply-To: <1108371652.421068c4c9760@imp.rezolwenta.eu.org> References: <1108371652.421068c4c9760@imp.rezolwenta.eu.org> Message-ID: <42108A2B.2010104@ims.u-tokyo.ac.jp> I have no problems accessing http://biopython.org. Maybe a temporary failure? --Michiel. bartek wilczynski wrote: > Hi, > > I think there is a problem with the scipts powering biopython website. > > If I go to http://www.biopython.org everything seems to be fine but trying > http://biopython.org gives me an error traceback (appended to the e-mail). > > Can anyone responsible for the website look at it ? -- Michiel de Hoon, Assistant Professor University of Tokyo, Institute of Medical Science Human Genome Center 4-6-1 Shirokane-dai, Minato-ku Tokyo 108-8639 Japan http://bonsai.ims.u-tokyo.ac.jp/~mdehoon From bartek at rezolwenta.eu.org Mon Feb 14 06:29:30 2005 From: bartek at rezolwenta.eu.org (bartek wilczynski) Date: Sat Mar 5 14:43:57 2005 Subject: [Biopython-dev] website error In-Reply-To: <42108A2B.2010104@ims.u-tokyo.ac.jp> References: <1108371652.421068c4c9760@imp.rezolwenta.eu.org> <42108A2B.2010104@ims.u-tokyo.ac.jp> Message-ID: <1108380570.42108b9a323c5@imp.rezolwenta.eu.org> Indeed, It seems that everything is ok now. Sorry for a false alarm and thanks for quick response. -- cheers Bartek Cytowanie Michiel Jan Laurens de Hoon : > I have no problems accessing http://biopython.org. Maybe a temporary > failure? > > --Michiel. > > bartek wilczynski wrote: > > > Hi, > > > > I think there is a problem with the scipts powering biopython website. > > > > If I go to http://www.biopython.org everything seems to be fine but > trying > > http://biopython.org gives me an error traceback (appended to the > e-mail). > > > > Can anyone responsible for the website look at it ? > > -- > Michiel de Hoon, Assistant Professor > University of Tokyo, Institute of Medical Science > Human Genome Center > 4-6-1 Shirokane-dai, Minato-ku > Tokyo 108-8639 > Japan > http://bonsai.ims.u-tokyo.ac.jp/~mdehoon > _______________________________________________ > Biopython-dev mailing list > Biopython-dev@biopython.org > http://biopython.org/mailman/listinfo/biopython-dev > > ------------------------------ > Scanned for viruses by MKS_Vir > Last update: > ------------------------------ > From james.casbon at a4internet.com Mon Feb 14 06:33:47 2005 From: james.casbon at a4internet.com (James Casbon) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Getting ready for a release, II In-Reply-To: <420FCE53.1010508@burnham.org> References: <420FCE53.1010508@burnham.org> Message-ID: <200502141133.47810.james.casbon@a4internet.com> On Sunday 13 February 2005 22:01, Iddo Friedberg wrote: > OK, except for the test_Registry problem in the unit-tests, the rest are > fixed or getting fixed. > > Any major bugs open? Bugzilla has 19, but most of them are either not > critical, or critical and have been fixed but not removed from Bugzilla. Any chance of the SCOP patches and ASTRAL class being applied before release? I filed a bug, but I seem to remember fixing a few bugs since so I can send you a new patch if its going to be accepted. (http://bugzilla.bioperl.org/show_bug.cgi?id=1711). James From james.casbon at a4internet.com Mon Feb 14 06:44:36 2005 From: james.casbon at a4internet.com (James Casbon) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Getting ready for a release, II In-Reply-To: <420FCE53.1010508@burnham.org> References: <420FCE53.1010508@burnham.org> Message-ID: <200502141144.36288.james.casbon@a4internet.com> On Sunday 13 February 2005 22:01, Iddo Friedberg wrote: > OK, except for the test_Registry problem in the unit-tests, the rest are > fixed or getting fixed. > > Any major bugs open? Bugzilla has 19, but most of them are either not > critical, or critical and have been fixed but not removed from Bugzilla. Surely they should be closed if fixed, no? This patch is trivial as well, so I don't see why its not been applied: http://bugzilla.bioperl.org/show_bug.cgi?id=1697 And these two code suggestions seem quite sensible and could easily be applied: http://bugzilla.bioperl.org/show_bug.cgi?id=1716 http://bugzilla.bioperl.org/show_bug.cgi?id=1717 James From biopython-dev at maubp.freeserve.co.uk Mon Feb 14 08:10:55 2005 From: biopython-dev at maubp.freeserve.co.uk (Peter) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Getting ready for a release, II In-Reply-To: <200502141144.36288.james.casbon@a4internet.com> References: <420FCE53.1010508@burnham.org> <200502141144.36288.james.casbon@a4internet.com> Message-ID: <4210A35F.8000208@maubp.freeserve.co.uk> Iddo Friedberg wrote: >> Any major bugs open? Bugzilla has 19, but most of them are either >> not critical, or critical and have been fixed but not removed from >> Bugzilla. (Its down to 17 open bugs now) I filed bug 1747 as "major" and feel it renders the GenBank parser effectively useless for large genomes. http://bugzilla.open-bio.org/show_bug.cgi?id=1747 On the other hand, I don't have a nice fix to suggest. James Casbon wrote: > And these two code suggestions seem quite sensible and could easily > be applied: Well I think so too, but I reported them ;) > http://bugzilla.bioperl.org/show_bug.cgi?id=1716 > http://bugzilla.bioperl.org/show_bug.cgi?id=1717 Plus my third and final tweak to the Fasta dictionary? http://bugzilla.bioperl.org/show_bug.cgi?id=1718 I have been using these three changes (bugs 1716, 1717 and 1718) quite happily on my own setup. Peter -- PhD Student MOAC Doctoral Training Centre University of Warwick, UK From gaetan.lehmann at jouy.inra.fr Mon Feb 14 03:26:24 2005 From: gaetan.lehmann at jouy.inra.fr (Gaetan Lehmann) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Getting ready for a release In-Reply-To: <420FAF68.2020406@burnham.org> References: <420FAF68.2020406@burnham.org> Message-ID: Hi, I have several questions about this release : When will it be released ? New version are freezed tomorrow for mandrake 10.2. If the new release is avaible in a short time (15 days), I can include CVS version today, and switch to official biopython release before the release of mandrake 10.2 community. If the new release is avaible in a short time, what will be the version of this release ? 1.40 ? Regards, Gaetan. On Sun, 13 Feb 2005 11:50:00 -0800, Iddo Friedberg wrote: > Hi all, > > It's been pointed out, quite rightly that we are long overdue for a > release. I ran some unit tests, and things seem not-too-shabby, > surprisingly. Only four failures: > > test_Compass > test_ProtParam > test_Registry > test_Align (cripes, that's mine I think) > > Righty-oh: can the responsible parties please have a quick looksee and > let us know? Personally my wife passed over a new biopython release as a > Valentine's day gift, so I'm in less of a hurry. This Friday will do > just fine. > > ./I > > -- Gaetan Lehmann Tel: +33 1 34 65 22 34 Biologie du D?veloppement et de la Reproduction INRA de Jouy-en-Josas (France) From thamelry at binf.ku.dk Mon Feb 14 08:41:45 2005 From: thamelry at binf.ku.dk (Thomas Hamelryck) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Getting ready for a release, II In-Reply-To: <200502141144.36288.james.casbon@a4internet.com> References: <420FCE53.1010508@burnham.org> <200502141144.36288.james.casbon@a4internet.com> Message-ID: <200502141441.45993.thamelry@binf.ku.dk> On Monday 14 February 2005 12:44, James Casbon wrote: > On Sunday 13 February 2005 22:01, Iddo Friedberg wrote: > > OK, except for the test_Registry problem in the unit-tests, the rest are > > fixed or getting fixed. > > > > Any major bugs open? Bugzilla has 19, but most of them are either not > > critical, or critical and have been fixed but not removed from Bugzilla. > > Surely they should be closed if fixed, no? I just corrected one more 'bug' - which was really a feature request for Bio.PDB! As far as I can see my stuff (Bio.PDB) is ready to be shipped. Cheers, -Thomas From thamelry at binf.ku.dk Mon Feb 14 08:45:10 2005 From: thamelry at binf.ku.dk (Thomas Hamelryck) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Getting ready for a release, II In-Reply-To: <42103E94.2030604@ims.u-tokyo.ac.jp> References: <420FCE53.1010508@burnham.org> <42103E94.2030604@ims.u-tokyo.ac.jp> Message-ID: <200502141445.10516.thamelry@binf.ku.dk> Here's the Bio.PDB change list: Added atom serial number. Epydoc style documentation. Added secondary structure support (through DSSP) Added Accessible Surface Area support (through DSSP) Added Residue Depth support (through MSMS) Added Half Sphere Exposure. Added Fragment classification of the protein backbone (see Kolodny et al., JMB, 2002) Corrected problem on Windows with PDBList (thanks to Matta Dimmic) Added StructureAlignment module to superimpose structures based on a FASTA sequence alignment. Various additions to Polypeptide. Various bug corrections in Vector. Lots of smaller bug corrections and additional features. -Thomas From dalke at dalkescientific.com Mon Feb 14 09:09:06 2005 From: dalke at dalkescientific.com (Andrew Dalke) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Getting ready for a release, II In-Reply-To: <4210A35F.8000208@maubp.freeserve.co.uk> References: <420FCE53.1010508@burnham.org> <200502141144.36288.james.casbon@a4internet.com> <4210A35F.8000208@maubp.freeserve.co.uk> Message-ID: Hi all, Peter: > I filed bug 1747 as "major" and feel it renders the GenBank parser > effectively useless for large genomes. I saw that bug report when it came in a couple weeks ago but I was busy at a client site. One of the fundamental problems with this implementation of Martel is that it parses a record in memory and uses about 4x as much memory as the record. The slowness for large records comes from hitting swap. It can't be fixed without some non-trivial changes to Martel; basically a rewrite. If anyone wants to tackle rewriting a regex engine I have some comments about what needs to be done. As for me I haven't touched the code in years because I haven't needed that capability and other tasks (including paying work) keep me busy. Andrew dalke@dalkescientific.com From bugzilla-daemon at portal.open-bio.org Mon Feb 14 08:28:37 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] [Bug 1697] pdbparser should accpet pipes as well as filenames Message-ID: <200502141328.j1EDSb8l002843@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1697 thamelry@binf.ku.dk changed: What |Removed |Added ---------------------------------------------------------------------------- Status|NEW |RESOLVED Resolution| |FIXED ------- Additional Comments From thamelry@binf.ku.dk 2005-02-14 08:28 ------- PDBParser now accepts a filename or an open file. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Mon Feb 14 08:30:00 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] [Bug 1697] pdbparser should accpet pipes as well as filenames Message-ID: <200502141330.j1EDU0J1002896@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1697 thamelry@binf.ku.dk changed: What |Removed |Added ---------------------------------------------------------------------------- Status|RESOLVED |CLOSED ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From idoerg at burnham.org Mon Feb 14 12:37:20 2005 From: idoerg at burnham.org (Iddo Friedberg) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Getting ready for a release In-Reply-To: References: <420FAF68.2020406@burnham.org> Message-ID: <4210E1D0.5010402@burnham.org> Hi Gaetan, Didn't know that about Mandrake.. dang. I'm aiming for Friday, Feb 18th. Will that be good for your plans? Thanks, Iddo Gaetan Lehmann wrote: > > Hi, > > I have several questions about this release : > When will it be released ? > New version are freezed tomorrow for mandrake 10.2. If the new release > is avaible in a short time (15 days), I can include CVS version > today, and switch to official biopython release before the release of > mandrake 10.2 community. > If the new release is avaible in a short time, what will be the > version of this release ? 1.40 ? > > Regards, > > Gaetan. > > On Sun, 13 Feb 2005 11:50:00 -0800, Iddo Friedberg > wrote: > >> Hi all, >> >> It's been pointed out, quite rightly that we are long overdue for a >> release. I ran some unit tests, and things seem not-too-shabby, >> surprisingly. Only four failures: >> >> test_Compass >> test_ProtParam >> test_Registry >> test_Align (cripes, that's mine I think) >> >> Righty-oh: can the responsible parties please have a quick looksee >> and let us know? Personally my wife passed over a new biopython >> release as a Valentine's day gift, so I'm in less of a hurry. This >> Friday will do just fine. >> >> ./I >> >> > > > -- Iddo Friedberg, Ph.D. The Burnham Institute 10901 N. Torrey Pines Rd. La Jolla, CA 92037 USA Tel: +1 (858) 646 3100 x3516 Fax: +1 (858) 713 9930 http://ffas.ljcrf.edu/~iddo ========================== The First Automated Protein Function Prediction SIG Detroit, MI June 24, 2005 http://ffas.burnham.org/AFP From bugzilla-daemon at portal.open-bio.org Mon Feb 14 12:49:40 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] [Bug 1688] Restriction.py problem with catalyze method Message-ID: <200502141749.j1EHneCr006073@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1688 idoerg@burnham.org changed: What |Removed |Added ---------------------------------------------------------------------------- Status|NEW |ASSIGNED ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. You are on the CC list for the bug, or are watching someone who is. From bugzilla-daemon at portal.open-bio.org Mon Feb 14 12:54:22 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] [Bug 1688] Restriction.py problem with catalyze method Message-ID: <200502141754.j1EHsMge006119@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1688 idoerg@burnham.org changed: What |Removed |Added ---------------------------------------------------------------------------- Status|ASSIGNED |RESOLVED Resolution| |FIXED ------- Additional Comments From idoerg@burnham.org 2005-02-14 12:54 ------- Checked in Frederic Sohm's correction ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. You are on the CC list for the bug, or are watching someone who is. From jonathan.taylor at utoronto.ca Mon Feb 14 19:23:55 2005 From: jonathan.taylor at utoronto.ca (Jonathan Taylor) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Bio.CAPS module submission Message-ID: <4211411B.2020405@utoronto.ca> I have been doing a fair amount of work using CAPS markers for genotyping. A CAPS marker is essentially a pair (snp, enzyme) where the snp is the location in a set of sequences (an alignment) in which a polymorphism causes an enzyme to cut differentially. I'm interested in contributing a module that does most of the work for me. I am willing to maintain it and provide documentation. It already has a few unittest test cases. The module's main function is in the CAPS.CAPSMap class. This class takes a Bio.Align.Alignment object and uses the Bio.Restriction package to find all the (possible) CAPS markers within the alignment and to provide information to build caps marker based programs. The module is at: http://bbc.botany.utoronto.ca/~jtaylor/CAPS/ Regards, Jonathan Taylor. University of Toronto Botany Department. From bugzilla-daemon at portal.open-bio.org Mon Feb 14 21:17:28 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] [Bug 1716] Fasta.Dictionary should throw KeyError for invalid keys Message-ID: <200502150217.j1F2HROD012535@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1716 ------- Additional Comments From mdehoon@ims.u-tokyo.ac.jp 2005-02-14 21:17 ------- Bugs 1716, 1717, 1718 would not occur if a Fasta.Dictionary inherits from an ordinary dictionary object. So rather than replicate the code for a dictionary, I would suggest to use inheritance instead. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From idoerg at burnham.org Tue Feb 15 01:22:37 2005 From: idoerg at burnham.org (Iddo Friedberg) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Remaining regression tests Message-ID: Hi all, Getting there.. thanks for all the enthusiasm and traffic that's been going around. I am still getting this on the regression tests: ====================================================================== FAIL: test_Registry ---------------------------------------------------------------------- Traceback (most recent call last): File "run_tests.py", line 148, in runTest self.runSafeTest() File "run_tests.py", line 185, in runSafeTest expected_handle) File "run_tests.py", line 285, in compare_output assert expected_line == output_line, \ AssertionError: Output : 'Retrieval of PDB data from various locations. ... ERROR\n' Expected: 'Retrieval of PDB data from various locations. ... ok\n' ====================================================================== FAIL: test_Restriction ---------------------------------------------------------------------- Traceback (most recent call last): File "run_tests.py", line 148, in runTest self.runSafeTest() File "run_tests.py", line 185, in runSafeTest expected_handle) File "run_tests.py", line 285, in compare_output assert expected_line == output_line, \ AssertionError: Output : 'Test basic cutting with EcoRI. ... FAIL\n' Expected: 'Test basic cutting with EcoRI. ... ok\n' ---------------------------------------------------------------------- Thanks, Iddo -- Iddo Friedberg, Ph.D. The Burnham Institute 10901 N. Torrey Pines Rd. La Jolla, CA 92037, USA Tel: +1 (858) 646 3100 x3516 Fax: +1 (858) 646 3171 http://ffas.ljcrf.edu/~iddo ------------------------------------- Automated Protein Function Prediction Meeting, June 24, 2005 http://ffas.burnham.org/AFP From bugzilla-daemon at portal.open-bio.org Tue Feb 15 06:10:54 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] [Bug 1711] Enhancements to Bio.SCOP module Message-ID: <200502151110.j1FBAo0R020518@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1711 j.a.casbon@qmul.ac.uk changed: What |Removed |Added ---------------------------------------------------------------------------- Status|NEW |RESOLVED Resolution| |FIXED ------- Additional Comments From j.a.casbon@qmul.ac.uk 2005-02-15 06:10 ------- Now committed to CVS. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Tue Feb 15 07:20:37 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] [Bug 1716] Fasta.Dictionary should throw KeyError for invalid keys Message-ID: <200502151220.j1FCKaXP021354@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1716 ------- Additional Comments From j.a.casbon@qmul.ac.uk 2005-02-15 07:20 ------- Created an attachment (id=193) --> (http://bugzilla.open-bio.org/attachment.cgi?id=193&action=view) fixes three fasta bugs I followed the suggestion of subclassing a dict. I just load all keys at instantiation with None values, and load as needed. As far as I can tell this fixes the three bugs. Can someone cast a critical eye over the patch. If you think its good, I will commit. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Tue Feb 15 08:24:16 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] [Bug 1716] Fasta.Dictionary should throw KeyError for invalid keys Message-ID: <200502151324.j1FDOGse021847@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1716 ------- Additional Comments From mdehoon@ims.u-tokyo.ac.jp 2005-02-15 08:24 ------- Patch looks fine to me. If it passes the tests in Bio/Tests, you can go ahead and commit. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Tue Feb 15 08:50:33 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] [Bug 1717] Fasta.Dictionary should support has_key Message-ID: <200502151350.j1FDoX9q022072@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1717 j.a.casbon@qmul.ac.uk changed: What |Removed |Added ---------------------------------------------------------------------------- Status|NEW |RESOLVED Resolution| |FIXED ------- Additional Comments From j.a.casbon@qmul.ac.uk 2005-02-15 08:50 ------- Patched dictionary to inherit from dict. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Tue Feb 15 08:50:15 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] [Bug 1716] Fasta.Dictionary should throw KeyError for invalid keys Message-ID: <200502151350.j1FDoFoI022062@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1716 j.a.casbon@qmul.ac.uk changed: What |Removed |Added ---------------------------------------------------------------------------- Status|NEW |RESOLVED Resolution| |FIXED ------- Additional Comments From j.a.casbon@qmul.ac.uk 2005-02-15 08:50 ------- Patched dictionary to inherit from dict. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Tue Feb 15 08:50:48 2005 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] [Bug 1718] Fasta.Dictionary should support "in" (the __contains__ method) Message-ID: <200502151350.j1FDomdY022082@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=1718 j.a.casbon@qmul.ac.uk changed: What |Removed |Added ---------------------------------------------------------------------------- Status|NEW |RESOLVED Resolution| |FIXED ------- Additional Comments From j.a.casbon@qmul.ac.uk 2005-02-15 08:50 ------- Patched dictionary to inherit from dict. ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From idoerg at burnham.org Tue Feb 15 16:20:06 2005 From: idoerg at burnham.org (Iddo Friedberg) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Nexus parser In-Reply-To: <1108500603.5114.23.camel@osiris.biology.duke.edu> References: <1108500603.5114.23.camel@osiris.biology.duke.edu> Message-ID: <42126786.3030804@burnham.org> Hi all, Good News: Frank Kauff & Cymon Cox has contributed a Nexus parser to Biopython, for our next release. It's a mighty useful and nifty package if you are into trees (the phylogenetic ones, not the ones in the forest). He put a lot of effort into this to get this ready for Biopython 1.40 Bad news: it's for Python 2.4. Please read on and I'd like to have your opinion on whether we should include this in the upcoming release. Python 2.4 stable has only been released less that 3 months ago, and many of our users may not have upgraded yet. Heck, I haven't (but I can). All current Linux distros use a <=2.3 version, and 2.3 does not have Sets. One thing we could do is put a Python version check in the setup.py file, and not include Nexus in the build if Python is not >=2.4. However, the RPM builders should probably do without it. Anyhow, please let me have your opinions about this. Thanks, all. And thanks Frank & Cymon for your contribution. Iddo >Hi Iddo, > >here's the baby (please note that this is the result of a cooperation >with Cymon J. Cox) > >Nexus.py - the actual nexus parser, >Trees.py - the module for reading and manipulating phylogenetic trees >(used by Nexus.py) >Nodes.py - provides a linked list which is the backbone of tree storage >in Trees.py (but might be useful for other purposes as well) >cnexus.c - a c extension that does the first round of parsing through a >nexus input file. Nexus.py works without cnexus.c, but is awfully slow >with larger files (and Nexus files can be large). > >Assuming that it will live in Bio.Nexus, the import statements might >need some adjustments. > >I also added test routines test_Nexus.py, the corresponding input file >in Nexus/test_Nexus_input.nex and the correct output in >output/text_Nexus. > >It just appears to me that it needs Python 2.4, because it uses sets, >and it uses them in 2.4 syntax. Is this a problem? Is the next release >of biopython still distributed for 2.2? > > >Nexus files come in lots of different flavors, and people use them for >very different purposes. I expect a lot of bug reports (guess in >contrast to the Ace and Phd parser we submitted earlier people might >actually use it :-) ) - many of them probably due to the fact that a lot >of programs writes "Nexus-like" output files completely ignoring the >quasi-official Nexus standard from Maddison/Swofford/Maddison... As I >don't have cvs access, I guess I'll send bugfixes to you? > >I'll do my best and write some cookbook introduction later this month. >The parser has accumulated quite a few functions over time (esp. >Trees.py), some of them might benefit from a few words of explanation. >However, the basic functionality like > > > >>>n=Nexus('input_file.nex') >>>print n.nchar, n.ntax, n.charpartitions >>> >>> > >is pretty straightforward. > > >Hope all this makes some sense, let me know if you need some more info. > >Thanks for all your work with the new release! > >All the best, >Frank > > > > -- Iddo Friedberg, Ph.D. The Burnham Institute 10901 N. Torrey Pines Rd. La Jolla, CA 92037 USA Tel: +1 (858) 646 3100 x3516 Fax: +1 (858) 713 9930 http://ffas.ljcrf.edu/~iddo ========================== The First Automated Protein Function Prediction SIG Detroit, MI June 24, 2005 http://ffas.burnham.org/AFP From hoffman at ebi.ac.uk Tue Feb 15 16:37:34 2005 From: hoffman at ebi.ac.uk (Michael Hoffman) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Nexus parser In-Reply-To: <42126786.3030804@burnham.org> References: <1108500603.5114.23.camel@osiris.biology.duke.edu> <42126786.3030804@burnham.org> Message-ID: On Tue, 15 Feb 2005, Iddo Friedberg wrote: > Good News: Frank Kauff & Cymon Cox has contributed a Nexus parser to > Biopython, for our next release. It's a mighty useful and nifty package if > you are into trees (the phylogenetic ones, not the ones in the forest). Yay! > All current Linux distros use a <=2.3 version, and 2.3 does not have > Sets. Actually, it does: $ python2.3 Python 2.3.4 (#1, Feb 2 2005, 12:11:53) [GCC 3.4.2 20041017 (Red Hat 3.4.2-6.fc3)] on linux2 Type "help", "copyright", "credits" or "license" for more information. >>> import sets >>> sets.Set("biopython") Set(['b', 'i', 'h', 'o', 'n', 'p', 't', 'y']) It just doesn't have the built-in sets of Python 2.4: $ python2.4 Python 2.4 (#1, Nov 30 2004, 11:25:14) [GCC 3.4.2 20041017 (Red Hat 3.4.2-6.fc3)] on linux2 Type "help", "copyright", "credits" or "license" for more information. >>> set("biopython") set(['b', 'i', 'h', 'o', 'n', 'p', 't', 'y']) That said, my vote is to include the module, even in its requiring-2.4 version. -- Michael Hoffman European Bioinformatics Institute From fkauff at duke.edu Tue Feb 15 16:58:21 2005 From: fkauff at duke.edu (Frank Kauff) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Nexus parser In-Reply-To: References: <1108500603.5114.23.camel@osiris.biology.duke.edu> <42126786.3030804@burnham.org> Message-ID: <1108504701.5114.33.camel@osiris.biology.duke.edu> On Tue, 2005-02-15 at 21:37 +0000, Michael Hoffman wrote: > On Tue, 15 Feb 2005, Iddo Friedberg wrote: > > > Good News: Frank Kauff & Cymon Cox has contributed a Nexus parser to > > Biopython, for our next release. It's a mighty useful and nifty package if > > you are into trees (the phylogenetic ones, not the ones in the forest). > > Yay! > > > All current Linux distros use a <=2.3 version, and 2.3 does not have > > Sets. > > Actually, it does: > > $ python2.3 > Python 2.3.4 (#1, Feb 2 2005, 12:11:53) > [GCC 3.4.2 20041017 (Red Hat 3.4.2-6.fc3)] on linux2 > Type "help", "copyright", "credits" or "license" for more information. > >>> import sets > >>> sets.Set("biopython") > Set(['b', 'i', 'h', 'o', 'n', 'p', 't', 'y']) > > It just doesn't have the built-in sets of Python 2.4: > Out of the top of my head - I think built-in set syntax is the only python2.4 feature I use in Nexus.py (but I'd have to check). If we would opt for 2.3 relase, a simple search replace of set with sets.Set and an import sets should do the trick, right? Frank > $ python2.4 > Python 2.4 (#1, Nov 30 2004, 11:25:14) > [GCC 3.4.2 20041017 (Red Hat 3.4.2-6.fc3)] on linux2 > Type "help", "copyright", "credits" or "license" for more information. > >>> set("biopython") > set(['b', 'i', 'h', 'o', 'n', 'p', 't', 'y']) > > That said, my vote is to include the module, even in its requiring-2.4 > version. -- Frank Kauff Dept. of Biology Duke University Box 90338 Durham, NC 27708 USA Phone 919-660-7382 Fax 919-660-7293 Web http://www.lutzonilab.net/member/frankkauff.shtml From idoerg at burnham.org Tue Feb 15 16:58:51 2005 From: idoerg at burnham.org (Iddo Friedberg) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Nexus parser In-Reply-To: References: <1108500603.5114.23.camel@osiris.biology.duke.edu> <42126786.3030804@burnham.org> Message-ID: <4212709B.7020308@burnham.org> Michael Hoffman wrote: > Iddo: >> All current Linux distros use a <=2.3 version, and 2.3 does not have >> Sets. > > > Actually, it does: > > $ python2.3 > Python 2.3.4 (#1, Feb 2 2005, 12:11:53) [GCC 3.4.2 20041017 (Red Hat > 3.4.2-6.fc3)] on linux2 > Type "help", "copyright", "credits" or "license" for more information. > >>>> import sets >>>> sets.Set("biopython") >>> > Set(['b', 'i', 'h', 'o', 'n', 'p', 't', 'y']) > > It just doesn't have the built-in sets of Python 2.4: > Will that still break your code, Frank? Can you make it Python 2.3? Sounds like you should be changing a couple of import statements, but can leave the rest of the code unchanged. Also, that means that Biopython should use Python 2.3 at least. However, I see no problem with that.... does anybody? > > That said, my vote is to include the module, even in its requiring-2.4 > version. Vote noted. I have a Diebold machine here.. somewhere... ./I -- Iddo Friedberg, Ph.D. The Burnham Institute 10901 N. Torrey Pines Rd. La Jolla, CA 92037 USA Tel: +1 (858) 646 3100 x3516 Fax: +1 (858) 713 9930 http://ffas.ljcrf.edu/~iddo ========================== The First Automated Protein Function Prediction SIG Detroit, MI June 24, 2005 http://ffas.burnham.org/AFP From jonathan.taylor at utoronto.ca Tue Feb 15 17:30:11 2005 From: jonathan.taylor at utoronto.ca (Jonathan Taylor) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Nexus parser In-Reply-To: <42126786.3030804@burnham.org> References: <1108500603.5114.23.camel@osiris.biology.duke.edu> <42126786.3030804@burnham.org> Message-ID: <421277F3.9070704@utoronto.ca> My view is that we should not change the dependency to python 2.4 yet. I think adding a conditional install is acceptable though and its awesome to have since I have had to do some of this nexus parsing by hand in the past. Cheers. Jon. Iddo Friedberg wrote: > Hi all, > > Good News: Frank Kauff & Cymon Cox has contributed a Nexus parser to > Biopython, for our next release. It's a mighty useful and nifty package > if you are into trees (the phylogenetic ones, not the ones in the > forest). He put a lot of effort into this to get this ready for > Biopython 1.40 > > Bad news: it's for Python 2.4. Please read on and I'd like to have your > opinion on whether we should include this in the upcoming release. > Python 2.4 stable has only been released less that 3 months ago, and > many of our users may not have upgraded yet. Heck, I haven't (but I > can). All current Linux distros use a <=2.3 version, and 2.3 does not > have Sets. One thing we could do is put a Python version check in the > setup.py file, and not include Nexus in the build if Python is not > >=2.4. However, the RPM builders should probably do without it. > > Anyhow, please let me have your opinions about this. > > Thanks, all. And thanks Frank & Cymon for your contribution. > > Iddo > >> Hi Iddo, >> >> here's the baby (please note that this is the result of a cooperation >> with Cymon J. Cox) >> Nexus.py - the actual nexus parser, >> Trees.py - the module for reading and manipulating phylogenetic trees >> (used by Nexus.py) >> Nodes.py - provides a linked list which is the backbone of tree storage >> in Trees.py (but might be useful for other purposes as well) >> cnexus.c - a c extension that does the first round of parsing through a >> nexus input file. Nexus.py works without cnexus.c, but is awfully slow >> with larger files (and Nexus files can be large). >> >> Assuming that it will live in Bio.Nexus, the import statements might >> need some adjustments. >> >> I also added test routines test_Nexus.py, the corresponding input file >> in Nexus/test_Nexus_input.nex and the correct output in >> output/text_Nexus. >> >> It just appears to me that it needs Python 2.4, because it uses sets, >> and it uses them in 2.4 syntax. Is this a problem? Is the next release >> of biopython still distributed for 2.2? >> >> >> Nexus files come in lots of different flavors, and people use them for >> very different purposes. I expect a lot of bug reports (guess in >> contrast to the Ace and Phd parser we submitted earlier people might >> actually use it :-) ) - many of them probably due to the fact that a lot >> of programs writes "Nexus-like" output files completely ignoring the >> quasi-official Nexus standard from Maddison/Swofford/Maddison... As I >> don't have cvs access, I guess I'll send bugfixes to you? >> >> I'll do my best and write some cookbook introduction later this month. >> The parser has accumulated quite a few functions over time (esp. >> Trees.py), some of them might benefit from a few words of explanation. >> However, the basic functionality like >> >> >>>> n=Nexus('input_file.nex') >>>> print n.nchar, n.ntax, n.charpartitions >>>> >> >> >> is pretty straightforward. >> >> >> Hope all this makes some sense, let me know if you need some more info. >> Thanks for all your work with the new release! >> >> All the best, >> Frank >> >> >> >> From fkauff at duke.edu Tue Feb 15 18:00:37 2005 From: fkauff at duke.edu (Frank Kauff) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Nexus parser In-Reply-To: <1108504701.5114.33.camel@osiris.biology.duke.edu> References: <1108500603.5114.23.camel@osiris.biology.duke.edu> <42126786.3030804@burnham.org> <1108504701.5114.33.camel@osiris.biology.duke.edu> Message-ID: <1108508437.5114.38.camel@osiris.biology.duke.edu> On Tue, 2005-02-15 at 16:58 -0500, Frank Kauff wrote: > On Tue, 2005-02-15 at 21:37 +0000, Michael Hoffman wrote: > > On Tue, 15 Feb 2005, Iddo Friedberg wrote: > > > > > Good News: Frank Kauff & Cymon Cox has contributed a Nexus parser to > > > Biopython, for our next release. It's a mighty useful and nifty package if > > > you are into trees (the phylogenetic ones, not the ones in the forest). > > > > Yay! > > > > > All current Linux distros use a <=2.3 version, and 2.3 does not have > > > Sets. > > > > Actually, it does: > > > > $ python2.3 > > Python 2.3.4 (#1, Feb 2 2005, 12:11:53) > > [GCC 3.4.2 20041017 (Red Hat 3.4.2-6.fc3)] on linux2 > > Type "help", "copyright", "credits" or "license" for more information. > > >>> import sets > > >>> sets.Set("biopython") > > Set(['b', 'i', 'h', 'o', 'n', 'p', 't', 'y']) > > > > It just doesn't have the built-in sets of Python 2.4: > > > > Out of the top of my head - I think built-in set syntax is the only > python2.4 feature I use in Nexus.py (but I'd have to check). If we would > opt for 2.3 relase, a simple search replace of set with sets.Set and an > import sets should do the trick, right? > So I did this (by hand, not with a global replace...) and it passes all tests with python2.3.4. Could have thought earlier of this issue, sorry for the confusion. Iddo, I'll send you the new module in a minute. F. > Frank > > > $ python2.4 > > Python 2.4 (#1, Nov 30 2004, 11:25:14) > > [GCC 3.4.2 20041017 (Red Hat 3.4.2-6.fc3)] on linux2 > > Type "help", "copyright", "credits" or "license" for more information. > > >>> set("biopython") > > set(['b', 'i', 'h', 'o', 'n', 'p', 't', 'y']) > > > > That said, my vote is to include the module, even in its requiring-2.4 > > version. > > -- Frank Kauff Dept. of Biology Duke University Box 90338 Durham, NC 27708 USA Phone 919-660-7382 Fax 919-660-7293 Web http://www.lutzonilab.net/member/frankkauff.shtml From idoerg at burnham.org Tue Feb 15 22:00:00 2005 From: idoerg at burnham.org (Iddo Friedberg) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Almost there... In-Reply-To: <1108508437.5114.38.camel@osiris.biology.duke.edu> References: <1108500603.5114.23.camel@osiris.biology.duke.edu> <42126786.3030804@burnham.org> <1108504701.5114.33.camel@osiris.biology.duke.edu> <1108508437.5114.38.camel@osiris.biology.duke.edu> Message-ID: <4212B730.8080902@burnham.org> OK, we have a Nexus parser now. And Biopython is now compatible with Python versions >= 2.3 Thanks to Frank Kauff and Cymon Cox. Thanks to James Casbon and Michiel for getting rid of that pesky Fasta.Dictionary bug. I fixed the silly AlignInfo Information Content bug. CAPS module on its way. Still have these left: 1) test_PDB: Thomas? test_PDB ... WARNING: disordered atom found with blanc altloc before line 31. WARNING: Residue (' ', 4, ' ') redefined at line 41. WARNING: Residue (' ', 10, ' ') redefined at line 73. WARNING: Residue (' ', 14, ' ') redefined at line 104. WARNING: Residue (' ', 16, ' ') redefined at line 133. WARNING: Residue (' ', 80, ' ') redefined at line 631. WARNING: Residue (' ', 81, ' ') redefined at line 644. 2) Warnings in the GFF: Michael? test_GFF ... /home/idoerg/biopy_cvs/biopython/build/lib.linux-i686-2.3/Bio/GFF/easy.py:595: DeprecationWarning: forward_complement in Bio.GFF is deprecated; please use complement in Bio.Seq instead category=DeprecationWarning) /home/idoerg/biopy_cvs/biopython/build/lib.linux-i686-2.3/Bio/GFF/easy.py:640: DeprecationWarning: reverse_complement in Bio.GFF is deprecated; please use reverse_complement in Bio.Seq instead category=DeprecationWarning) 3) And failures in test_Registry and test_Restriction... Frederic and Jeff? ====================================================================== FAIL: test_Registry ---------------------------------------------------------------------- Traceback (most recent call last): File "run_tests.py", line 148, in runTest self.runSafeTest() File "run_tests.py", line 185, in runSafeTest expected_handle) File "run_tests.py", line 285, in compare_output assert expected_line == output_line, \ AssertionError: Output : 'Retrieval of PDB data from various locations. ... ERROR\n' Expected: 'Retrieval of PDB data from various locations. ... ok\n' ====================================================================== FAIL: test_Restriction ---------------------------------------------------------------------- Traceback (most recent call last): File "run_tests.py", line 148, in runTest self.runSafeTest() File "run_tests.py", line 185, in runSafeTest expected_handle) File "run_tests.py", line 285, in compare_output assert expected_line == output_line, \ AssertionError: Output : 'Test basic cutting with EcoRI. ... FAIL\n' Expected: 'Test basic cutting with EcoRI. ... ok\n' ---------------------------------------------------------------------- Ran 91 tests in 182.965s -- Iddo Friedberg, Ph.D. The Burnham Institute 10901 N. Torrey Pines Rd. La Jolla, CA 92037 USA Tel: +1 (858) 646 3100 x3516 Fax: +1 (858) 713 9930 http://ffas.ljcrf.edu/~iddo ========================== The First Automated Protein Function Prediction SIG Detroit, MI June 24, 2005 http://ffas.burnham.org/AFP From hoffman at ebi.ac.uk Wed Feb 16 01:31:44 2005 From: hoffman at ebi.ac.uk (Michael Hoffman) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Almost there... In-Reply-To: <4212B730.8080902@burnham.org> References: <1108500603.5114.23.camel@osiris.biology.duke.edu> <42126786.3030804@burnham.org> <1108504701.5114.33.camel@osiris.biology.duke.edu> <1108508437.5114.38.camel@osiris.biology.duke.edu> <4212B730.8080902@burnham.org> Message-ID: On Tue, 15 Feb 2005, Iddo Friedberg wrote: > DeprecationWarning: forward_complement in Bio.GFF is deprecated; please use > complement in Bio.Seq instead > category=DeprecationWarning) > /home/idoerg/biopy_cvs/biopython/build/lib.linux-i686-2.3/Bio/GFF/easy.py:640: > DeprecationWarning: reverse_complement in Bio.GFF is deprecated; please use > reverse_complement in Bio.Seq instead > category=DeprecationWarning) These should work now without warning. -- Michael Hoffman European Bioinformatics Institute From ralph_s_v_a at yahoo.com Wed Feb 16 04:27:39 2005 From: ralph_s_v_a at yahoo.com (Vineeth S) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] ENSEMBL 3' UTR Message-ID: <20050216092739.55864.qmail@web31006.mail.mud.yahoo.com> Hi all, I have looked fro some way to get the co-ordinates for the UTR regions for ENSEMBL genes quite unsucessfully. The Genbank dumps from ENSEMBL arent as straightforward as the NCBI Genbank dumps, and to get ENSEMBL 3' regions as fasta from the Mart one has to click through each chromosome. Is there anyway to get around this ? Or would it be useful to write a module to do tblastn of the protein against the corresponding gene and then get the 3' UTR region from that ? Vineeth PS : Someday I wish the twain will meet and make life for anybody doing sequence analysis easier. __________________________________________________ Do You Yahoo!? Tired of spam? Yahoo! Mail has the best spam protection around http://mail.yahoo.com From biopython-dev at maubp.freeserve.co.uk Wed Feb 16 05:54:53 2005 From: biopython-dev at maubp.freeserve.co.uk (Peter) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Nexus parser and Newick tree format In-Reply-To: <42126786.3030804@burnham.org> References: <1108500603.5114.23.camel@osiris.biology.duke.edu> <42126786.3030804@burnham.org> Message-ID: <4213267D.1010309@maubp.freeserve.co.uk> Iddo Friedberg wrote: > Hi all, > > Good News: Frank Kauff & Cymon Cox has contributed a Nexus parser to > Biopython, for our next release. It's a mighty useful and nifty package > if you are into trees (the phylogenetic ones, not the ones in the > forest). He put a lot of effort into this to get this ready for > Biopython 1.40 This sounds really good. I have been dealing with Newick trees (e.g. the .dnd files produced by Clustal) using the Python Newick module by Thomas Mailund (Bioinformatics Research Center, University of Aarhus): http://www.daimi.au.dk/~mailund/newick.html A bit of googling tells me that the NEXUS format incorporates the Newick treefile data plus additional text. http://workshop.molecularevolution.org/resources/fileformats/tree_formats.php Can/will the new Bio.Nexus module cope with "plain" Newick files as well as the more complicated Nexus format? Peter P.S. A trivial "bug", you have used "hsitorical" in class Tree, file Trees.py -- PhD Student MOAC Doctoral Training Centre University of Warwick, UK From hoffman at ebi.ac.uk Wed Feb 16 06:18:13 2005 From: hoffman at ebi.ac.uk (Michael Hoffman) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] ENSEMBL 3' UTR In-Reply-To: <20050216092739.55864.qmail@web31006.mail.mud.yahoo.com> References: <20050216092739.55864.qmail@web31006.mail.mud.yahoo.com> Message-ID: On Wed, 16 Feb 2005, Vineeth S wrote: > I have looked fro some way to get the co-ordinates for > the UTR regions for ENSEMBL genes quite unsucessfully. > The Genbank dumps from ENSEMBL arent as > straightforward as the NCBI Genbank dumps, and to get > ENSEMBL 3' regions as fasta from the Mart one has to > click through each chromosome. You should be able to do it with MartShell. But this is not working for me right now for some reason. Might be my own user error. You can use Ensembl/Jython (part of Ensj) until MartShell is fixed: $ jython Jython 2.1 on java1.4.2 (JIT: null) Type "copyright", "credits" or "license" for more information. >>> import ensembl >>> gene = ensembl.fetch("ENSG00000139618") >>> transcript = gene.transcripts[0] # this gene only has one transcript >>> transcript.translation.fivePrimeUTR [chromosome_NCBI35:13:31787617-31787804:1, chromosome_NCBI35:13:31788559-31788597:1] >>> transcript.translation.threePrimeUTR [chromosome_NCBI35:13:31870908-31871347:1, chromosome_NCBI35:13:31871746-31871805:1] Note that the UTRs here are lists because there is an intron in the middle of each one. You can iterate through all the genes in human using ensembl.human.all_genes(). And of course that method exists for other species as well. > Is there anyway to get around this ? Or would it be > useful to write a module to do tblastn of the protein > against the corresponding gene and then get the 3' UTR > region from that ? Doing a computationally-expensive alignment does not seem like a good way of extracting information that already exists. Especially if you have to do a lot of them. > PS : Someday I wish the twain will meet and make life for anybody > doing sequence analysis easier. You wish what would meet? Also, unless you are further discussing a new Biopython module, this discussion is probably not on-topic for this mailing list anymore. Feel free to send Ensembl/Jython queries directly to me and other queries to helpdesk@ensembl.org. -- Michael Hoffman European Bioinformatics Institute From fkauff at duke.edu Wed Feb 16 09:57:48 2005 From: fkauff at duke.edu (Frank Kauff) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Nexus parser and Newick tree format In-Reply-To: <4213267D.1010309@maubp.freeserve.co.uk> References: <1108500603.5114.23.camel@osiris.biology.duke.edu> <42126786.3030804@burnham.org> <4213267D.1010309@maubp.freeserve.co.uk> Message-ID: <1108565869.5091.14.camel@osiris.biology.duke.edu> On Wed, 2005-02-16 at 10:54 +0000, Peter wrote: > Iddo Friedberg wrote: > > Hi all, > > > > Good News: Frank Kauff & Cymon Cox has contributed a Nexus parser to > > Biopython, for our next release. It's a mighty useful and nifty package > > if you are into trees (the phylogenetic ones, not the ones in the > > forest). He put a lot of effort into this to get this ready for > > Biopython 1.40 > > This sounds really good. > > I have been dealing with Newick trees (e.g. the .dnd files produced by > Clustal) using the Python Newick module by Thomas Mailund > (Bioinformatics Research Center, University of Aarhus): > > http://www.daimi.au.dk/~mailund/newick.html > > A bit of googling tells me that the NEXUS format incorporates the Newick > treefile data plus additional text. > > http://workshop.molecularevolution.org/resources/fileformats/tree_formats.php > > Can/will the new Bio.Nexus module cope with "plain" Newick files as well > as the more complicated Nexus format? > Yes, it works fine with both plain trees, and trees that have branch length and/or support added. As the parser initially doesn't know if a value is meant to be a branch length or support (e.g. from a bootstrap), single values are assumed to be branchlengths, but there is a method branchlength2support that puts it into the right place. It reads trees from mrbayes and paup, and can output them in plain newick or including branchlength and support, if present. One drawback: if trees are rerooted, branchlengths and support get screwed up - the root_with_outgroup method just doesn't care about them. I might add derooted trees in the future that can handle rerooting while keeping branchlengths more easily, or just extend the above method. Frank > Peter > > P.S. A trivial "bug", you have used "hsitorical" in class Tree, file > Trees.py > -- Frank Kauff Dept. of Biology Duke University Box 90338 Durham, NC 27708 USA Phone 919-660-7382 Fax 919-660-7293 Web http://www.lutzonilab.net/member/frankkauff.shtml From idoerg at burnham.org Wed Feb 16 12:39:05 2005 From: idoerg at burnham.org (Iddo Friedberg) Date: Sat Mar 5 14:43:58 2005 Subject: [Biopython-dev] Re: Question to code In-Reply-To: <4213568D.60406@student.umb.no> Message-ID: Eirik, It used to be a bug, but it shouldn't be anymore. I'll check this later today. In the meantime, if you are still up, you may want to retest this code with our latest CVS version. http://biopython.org/cvs Also, we are planning to roll a new Biopython (1.40) release Friday. So if you can wait until then... in any case, I'm forwarding this to the developers list. I am not near a computer where I can test this, and won't be for a few hours Sorry for your trouble, but this is either solved or wil be solved soon. Best, Iddo -- Iddo Friedberg, Ph.D. The Burnham Institute 10901 N. Torrey Pines Rd. La Jolla, CA 92037, USA Tel: +1 (858) 646 3100 x3516 Fax: +1 (858) 646 3171 http://ffas.ljcrf.edu/~iddo ------------------------------------- Automated Protein Function Prediction Meeting, June 24, 2005 http://ffas.burnham.org/AFP On Wed, 16 Feb 2005, [ISO-8859-1] Eirik Sřnneland wrote: > Dear Freidberg, > > I've been having problems parsing my output from NCBI using the example > code given in Biopython Cookbook. Therefore I tried to follow your code > described in "Genome Informatics 14(2003). Still I get an error message > connected to the parsing. Could you please give a hint on what is wrong? > Is this a bug?? Code and output as follows: > > Code: > > from Bio.Blast import NCBIWWW > from Bio import Fasta > > file_for_blast = open('Fastaformat.txt', 'r') > f_iterator = Fasta.Iterator(file_for_blast) > f_record = f_iterator.next() > > b_results = NCBIWWW.blast('blastn', 'nr', f_record).read() > > b_record = NCBIWWW.BlastParser().parse_str(b_results) > > Output(Have cut out the beginning, only pasted the last part of output): > > > Score = 40.1 bits (20), Expect = 6.3 > Identities = 20/20 (100%) > Strand = Plus / Minus > > > Query: 29 ctgcagctcgggctcctgcc 48 > |||||||||||||||||||| > Sbjct: 150928 ctgcagctcgggctcctgcc 150909 > > > >
> > 
> Lambda     K      H
>     1.37    0.711     1.31
> 
> Gapped
> Lambda     K      H
>     1.37    0.711     1.31
> 
> Matrix: blastn matrix:1 -3
> Gap Penalties: Existence: 5, Extension: 2
> Number of Sequences: 2894376
> Number of Hits to DB: 6,089,259
> Number of extensions: 328661
> Number of successful extensions: 6259
> Number of sequences better than 10.0: 2
> Number of HSP's better than 10.0 without gapping: 2
> Number of HSP's gapped: 6259
> Number of HSP's successfully gapped: 2
> Number of extra gapped extensions for HSPs above 10.0: 6255
> Length of query: 600
> Length of database: 13,294,103,689
> Length adjustment: 22
> Effective length of query: 578
> Effective length of database: 13,230,427,417
> Effective search space: 7647187047026
> Effective search space used: 7647187047026
> A: 0
> X1: 11 (21.8 bits)
> X2: 15 (30.0 bits)
> X3: 25 (50.0 bits)
> S1: 14 (25.0 bits)
> S2: 20 (40.1 bits)
> 
> 
> 
> 
> Traceback (most recent call last):
>   File "C:\Python24\MyWorkspace.py", line 50, in -toplevel-
>     b_record = NCBIWWW.BlastParser().parse_str(b_results)
>   File "C:\Python24\Lib\site-packages\Bio\ParserSupport.py", line 52, in 
> parse_str
>     return self.parse(File.StringHandle(string))
>   File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 47, in 
> parse
>     self._scanner.feed(handle, self._consumer)
>   File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 99, in 
> feed
>     self._scan_rounds(uhandle, consumer)
>   File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 242, 
> in _scan_rounds
>     self._scan_alignments(uhandle, consumer)
>   File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 322, 
> in _scan_alignments
>     raise SyntaxError, "Cannot resolve location at line:\n%s" % line1
> SyntaxError: Cannot resolve location at line:
> 
> 
>  >>>
> 
> Thanks!
> 
> Regards,
> Eirik
> 
> 



From idoerg at burnham.org  Wed Feb 16 14:48:41 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:58 2005
Subject: [Fwd: Re: [Biopython-dev] Bio.CAPS module submission]
Message-ID: <4213A399.6020500@burnham.org>

Jonathan Taylor floated an idea to add unit testing in addition to 
regression testing. Seems useful, and the change to setup.py is minor. 
There should be no changes to the test_MODULE.py files, or the current 
behavior of run_tests.py


Does anybody see any problem with this? I don't.

Best,

Iddo

-------- Original Message --------
Subject: 	Re: [Biopython-dev] Bio.CAPS module submission
Date: 	Tue, 15 Feb 2005 17:58:38 -0500
From: 	Jonathan Taylor 
To: 	Iddo Friedberg 
References: 
 
<421264EF.70903@utoronto.ca> <421269FE.50407@burnham.org>



Ah I see after looking what this is.  The regression tests provide an 
easy way to provide sanity tests.  I agree that simply having my 
unittests run and have the output "All tests ok" in output/test_CAPS is 
a little less than useful if a problem does arise.  Of course it does at 
least give warning if there is a problem.  So I spent the last little 
while batting around some ideas to allow biopython developers use both 
"regression tests" and regular unittest's.  Heres what I came up with.

By changing the testing procedure a bit as below to search each 
test_MODULE for a suite() method, we can allow developers aggregate some 
real unittests in their files by simply providing a suite() method. 
(SEE BELOW FOR A UNIFIED DIFF OF run_tests.py).

Thus I added:

def suite():
  suite = unittest.TestSuite()
  suite.addTest(UnevenAlignment("test"))
  return suite

to my test_CAPS.py file.  That way we get these tests run in addition to 
the standard regression test as below:

nullset@coder:~/projects/biopython/Tests $ python run_tests.py test_CAPS
test (test_CAPS.UnevenAlignment) ... ok
test_CAPS ... ok

----------------------------------------------------------------------
Ran 2 tests in 0.054s

OK

Clearly I still need to add the rest of my tests to the suite() method. 
 What do you think of this idea?  Maybe I should post this to the list. 
 I am working against biopython cvs here so when we are all done and 
agreed I can send you a patch file to the main tree. ;)

Cheers.
Jon.

nullset@coder:~/projects/biopython/Tests $ cvs diff -u run_tests.py
Index: run_tests.py
===================================================================
RCS file: /home/repository/biopython/biopython/Tests/run_tests.py,v
retrieving revision 1.7
diff -u -r1.7 run_tests.py
--- run_tests.py        2 Jul 2003 15:04:18 -0000       1.7
+++ run_tests.py        15 Feb 2005 22:49:18 -0000
@@ -117,7 +117,12 @@
     test_suite = unittest.TestSuite()

     for test in all_tests:
-        # add the test to the test suite
+        # add any provided test cases
+        m = __import__(test)
+        if 'suite' in dir(m):
+          test_suite.addTest(m.suite())
+
+        # add the regression test to the test suite
         test_suite.addTest(RegressionTest(test))

     return test_suite
@@ -313,6 +318,7 @@
         line = line.replace(newline_to_replace, "\\n")

     return line
+

 if __name__ == "__main__":
     sys.exit(main(sys.argv))





Iddo Friedberg wrote:
> Jonathan Taylor wrote:
> 
>> The tests are mostly for developers though.  If the rest of biopython 
>> works on a users machine, then this will.  Maybe I am misunderstanding 
>> something.
>>
> 
> The regression test module, run_tests.py depends on some sort of output 
> comparison with a test file (in your case, test_CAPS.py). You can also 
> place your input in a file as well. Actually, the tests are run 
> (optionally) upon install by the users. We have discovered several bugs 
> in the past by having users run the tests and receiving different 
> outputs than expected, due to the vagaries of their OS and or Python 
> version. Also, it serves as a sanity check for the user. You can keep 
> the format of your internal testing, and just generate a file which says 
> "Tested OK". Although something more verbose would be nice. If, for some 
> reason, the module breaks on a user's machine, the test will fail.
> 
> Thanks,
> 
> Iddo
> 




-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP


From hoffman at ebi.ac.uk  Wed Feb 16 14:53:52 2005
From: hoffman at ebi.ac.uk (Michael Hoffman)
Date: Sat Mar  5 14:43:58 2005
Subject: [Fwd: Re: [Biopython-dev] Bio.CAPS module submission]
In-Reply-To: <4213A399.6020500@burnham.org>
References: <4213A399.6020500@burnham.org>
Message-ID: 

On Wed, 16 Feb 2005, Iddo Friedberg wrote:

> Jonathan Taylor floated an idea to add unit testing in addition to regression 
> testing. Seems useful, and the change to setup.py is minor. There should be 
> no changes to the test_MODULE.py files, or the current behavior of 
> run_tests.py
>
> Does anybody see any problem with this? I don't.

Sure, except I think "suite" as a name doesn't really explain very
much and I hate to get stuck with it.

I have used doctests before but just wrapped them in the existing
regression testing framework. See test_GFF. In general, Jonathan's
method is superior.
-- 
Michael Hoffman 
European Bioinformatics Institute

From jonathan.taylor at utoronto.ca  Wed Feb 16 15:57:46 2005
From: jonathan.taylor at utoronto.ca (Jonathan Taylor)
Date: Sat Mar  5 14:43:58 2005
Subject: [Fwd: Re: [Biopython-dev] Bio.CAPS module submission]
In-Reply-To: 
References: <4213A399.6020500@burnham.org>
	
Message-ID: <4213B3CA.1030204@utoronto.ca>

I chose suite() because in the pyunit documentation they say its a good
idea to include such a callable object (read method) named suite.

http://pyunit.sourceforge.net/pyunit.html#SUITES

 From the page:
--- SNIP ---
  For the ease of running tests, as we will see later, it is a good idea
to provide in each test module a 'callable' object that returns a
pre-built test suite:

        def suite():
            suite = unittest.TestSuite()
            suite.addTest(WidgetTestCase("testDefaultSize"))
            suite.addTest(WidgetTestCase("testResize"))
            return suite
--- SNIP ---

Cheers.
Jon.

Michael Hoffman wrote:
> On Wed, 16 Feb 2005, Iddo Friedberg wrote:
> 
>> Jonathan Taylor floated an idea to add unit testing in addition to 
>> regression testing. Seems useful, and the change to setup.py is minor. 
>> There should be no changes to the test_MODULE.py files, or the current 
>> behavior of run_tests.py
>>
>> Does anybody see any problem with this? I don't.
> 
> 
> Sure, except I think "suite" as a name doesn't really explain very
> much and I hate to get stuck with it.
> 
> I have used doctests before but just wrapped them in the existing
> regression testing framework. See test_GFF. In general, Jonathan's
> method is superior.



From hoffman at ebi.ac.uk  Wed Feb 16 16:10:37 2005
From: hoffman at ebi.ac.uk (Michael Hoffman)
Date: Sat Mar  5 14:43:58 2005
Subject: [Fwd: Re: [Biopython-dev] Bio.CAPS module submission]
In-Reply-To: <4213B3CA.1030204@utoronto.ca>
References: <4213A399.6020500@burnham.org>
	
	<4213B3CA.1030204@utoronto.ca>
Message-ID: 

> I chose suite() because in the pyunit documentation they say its a good
> idea to include such a callable object (read method) named suite.

Hmmmm, that is the example name they use, but I don't see where they
say that it has to be called suite. In fact they use several other
names for suites:

        suite1 = module1.TheTestSuite()
        suite2 = module2.TheTestSuite()
        alltests = unittest.TestSuite((suite1, suite2))

My main problem with the name "suite" is that it is what is used in
the Python grammar and in other Python discussion fora
(comp.lang.python) to refer to any block of code.

http://docs.python.org/ref/compound.html#tok-suite
-- 
Michael Hoffman 
European Bioinformatics Institute

From jonathan.taylor at utoronto.ca  Wed Feb 16 16:44:18 2005
From: jonathan.taylor at utoronto.ca (Jonathan Taylor)
Date: Sat Mar  5 14:43:58 2005
Subject: [Fwd: Re: [Biopython-dev] Bio.CAPS module submission]
In-Reply-To: 
References: <4213A399.6020500@burnham.org>		<4213B3CA.1030204@utoronto.ca>
	
Message-ID: <4213BEB2.1040708@utoronto.ca>

True.  I am fine with another name?  how about test_suite() ?

Jon.


Michael Hoffman wrote:
>> I chose suite() because in the pyunit documentation they say its a good
>> idea to include such a callable object (read method) named suite.
> 
> 
> Hmmmm, that is the example name they use, but I don't see where they
> say that it has to be called suite. In fact they use several other
> names for suites:
> 
>        suite1 = module1.TheTestSuite()
>        suite2 = module2.TheTestSuite()
>        alltests = unittest.TestSuite((suite1, suite2))
> 
> My main problem with the name "suite" is that it is what is used in
> the Python grammar and in other Python discussion fora
> (comp.lang.python) to refer to any block of code.
> 
> http://docs.python.org/ref/compound.html#tok-suite


From hoffman at ebi.ac.uk  Wed Feb 16 16:59:17 2005
From: hoffman at ebi.ac.uk (Michael Hoffman)
Date: Sat Mar  5 14:43:58 2005
Subject: [Biopython-dev] Re: Bio.CAPS module submission
In-Reply-To: <4213BEB2.1040708@utoronto.ca>
References: <4213A399.6020500@burnham.org>
	
	<4213B3CA.1030204@utoronto.ca>
	
	<4213BEB2.1040708@utoronto.ca>
Message-ID: 

Jonathan Taylor wrote:

> True.  I am fine with another name?  how about test_suite() ?

I think that would be preferable.
--
Michael Hoffman 
European Bioinformatics Institute

From idoerg at burnham.org  Wed Feb 16 17:02:11 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:58 2005
Subject: [Biopython-dev] [Fwd: Question to code]
Message-ID: <4213C2E3.8030609@burnham.org>

OK, this is a real bug. NCBIWWW seems to be broken.

I'm having a looksee, but I'd like someone more versed in this than me 
to do so.

Thanks,

Iddo



-------- Original Message --------
Subject: 	Question to code
Date: 	Wed, 16 Feb 2005 15:19:57 +0100
From: 	Eirik S?nneland 
To: 	idoerg



Dear Freidberg,

I've been having problems parsing my output from NCBI using the example 
code given in Biopython Cookbook. Therefore I tried to follow your code 
described in "Genome Informatics 14(2003). Still I get an error message 
connected to the parsing. Could you please give a hint on what is wrong? 
Is this a bug?? Code and output as follows:

Code:

from Bio.Blast import NCBIWWW
from Bio import Fasta

file_for_blast = open('Fastaformat.txt', 'r')
f_iterator = Fasta.Iterator(file_for_blast)
f_record = f_iterator.next()

b_results = NCBIWWW.blast('blastn', 'nr', f_record).read()

b_record = NCBIWWW.BlastParser().parse_str(b_results)

Output(Have cut out the beginning, only pasted the last part of output):


 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29     ctgcagctcgggctcctgcc 48
              ||||||||||||||||||||
Sbjct: 150928 ctgcagctcgggctcctgcc 150909

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 2894376
Number of Hits to DB: 6,089,259
Number of extensions: 328661
Number of successful extensions: 6259
Number of sequences better than 10.0: 2
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's gapped: 6259
Number of HSP's successfully gapped: 2
Number of extra gapped extensions for HSPs above 10.0: 6255
Length of query: 600
Length of database: 13,294,103,689
Length adjustment: 22
Effective length of query: 578
Effective length of database: 13,230,427,417
Effective search space: 7647187047026
Effective search space used: 7647187047026
A: 0
X1: 11 (21.8 bits)
X2: 15 (30.0 bits)
X3: 25 (50.0 bits)
S1: 14 (25.0 bits)
S2: 20 (40.1 bits)




Traceback (most recent call last):
  File "C:\Python24\MyWorkspace.py", line 50, in -toplevel-
    b_record = NCBIWWW.BlastParser().parse_str(b_results)
  File "C:\Python24\Lib\site-packages\Bio\ParserSupport.py", line 52, in 
parse_str
    return self.parse(File.StringHandle(string))
  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 47, in 
parse
    self._scanner.feed(handle, self._consumer)
  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 99, in 
feed
    self._scan_rounds(uhandle, consumer)
  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 242, 
in _scan_rounds
    self._scan_alignments(uhandle, consumer)
  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 322, 
in _scan_alignments
    raise SyntaxError, "Cannot resolve location at line:\n%s" % line1
SyntaxError: Cannot resolve location at line:


 >>>

Thanks!

Regards,
Eirik


-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP


From fkauff at duke.edu  Wed Feb 16 17:23:32 2005
From: fkauff at duke.edu (Frank Kauff)
Date: Sat Mar  5 14:43:58 2005
Subject: [Biopython-dev] [Fwd: Question to code]
In-Reply-To: <4213C2E3.8030609@burnham.org>
References: <4213C2E3.8030609@burnham.org>
Message-ID: <1108592612.5091.32.camel@osiris.biology.duke.edu>

Eirik,

Try if the code works with

b_results = NCBIWWW.qblast('blastn', 'nr', f_record).read()

instead of 

> b_results = NCBIWWW.blast('blastn', 'nr', f_record).read()
> 

I think that issue appeared a couple of months ago on the biopython list, essentially saying that
qblast is the blast NCBI wants people to use for blast scripts? After that, qblast method was added
to NCBIWWW, and it's what I'm using in my blast scripts.

Hope this helps,
Frank

On Wed, 2005-02-16 at 14:02 -0800, Iddo Friedberg wrote:
> OK, this is a real bug. NCBIWWW seems to be broken.
> 
> I'm having a looksee, but I'd like someone more versed in this than me 
> to do so.
> 
> Thanks,
> 
> Iddo
> 
> 
> 
> -------- Original Message --------
> Subject: 	Question to code
> Date: 	Wed, 16 Feb 2005 15:19:57 +0100
> From: 	Eirik S?nneland 
> To: 	idoerg
> 
> 
> 
> Dear Freidberg,
> 
> I've been having problems parsing my output from NCBI using the example 
> code given in Biopython Cookbook. Therefore I tried to follow your code 
> described in "Genome Informatics 14(2003). Still I get an error message 
> connected to the parsing. Could you please give a hint on what is wrong? 
> Is this a bug?? Code and output as follows:
> 
> Code:
> 
> from Bio.Blast import NCBIWWW
> from Bio import Fasta
> 
> file_for_blast = open('Fastaformat.txt', 'r')
> f_iterator = Fasta.Iterator(file_for_blast)
> f_record = f_iterator.next()
> 
> b_results = NCBIWWW.blast('blastn', 'nr', f_record).read()
> 
> b_record = NCBIWWW.BlastParser().parse_str(b_results)
> 
> Output(Have cut out the beginning, only pasted the last part of output):
> 
> 
>  Score = 40.1 bits (20), Expect = 6.3
>  Identities = 20/20 (100%)
>  Strand = Plus / Minus
> 
>                                  
> Query: 29     ctgcagctcgggctcctgcc 48
>               ||||||||||||||||||||
> Sbjct: 150928 ctgcagctcgggctcctgcc 150909
>
> > >
> > 
> Lambda     K      H
>     1.37    0.711     1.31
> 
> Gapped
> Lambda     K      H
>     1.37    0.711     1.31
> 
> Matrix: blastn matrix:1 -3
> Gap Penalties: Existence: 5, Extension: 2
> Number of Sequences: 2894376
> Number of Hits to DB: 6,089,259
> Number of extensions: 328661
> Number of successful extensions: 6259
> Number of sequences better than 10.0: 2
> Number of HSP's better than 10.0 without gapping: 2
> Number of HSP's gapped: 6259
> Number of HSP's successfully gapped: 2
> Number of extra gapped extensions for HSPs above 10.0: 6255
> Length of query: 600
> Length of database: 13,294,103,689
> Length adjustment: 22
> Effective length of query: 578
> Effective length of database: 13,230,427,417
> Effective search space: 7647187047026
> Effective search space used: 7647187047026
> A: 0
> X1: 11 (21.8 bits)
> X2: 15 (30.0 bits)
> X3: 25 (50.0 bits)
> S1: 14 (25.0 bits)
> S2: 20 (40.1 bits)
> 
> 
> 
> 
> Traceback (most recent call last):
>   File "C:\Python24\MyWorkspace.py", line 50, in -toplevel-
>     b_record = NCBIWWW.BlastParser().parse_str(b_results)
>   File "C:\Python24\Lib\site-packages\Bio\ParserSupport.py", line 52, in 
> parse_str
>     return self.parse(File.StringHandle(string))
>   File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 47, in 
> parse
>     self._scanner.feed(handle, self._consumer)
>   File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 99, in 
> feed
>     self._scan_rounds(uhandle, consumer)
>   File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 242, 
> in _scan_rounds
>     self._scan_alignments(uhandle, consumer)
>   File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 322, 
> in _scan_alignments
>     raise SyntaxError, "Cannot resolve location at line:\n%s" % line1
> SyntaxError: Cannot resolve location at line:
> 
> 
>  >>>
> 
> Thanks!
> 
> Regards,
> Eirik
> 
> 
-- 
Frank Kauff
Dept. of Biology
Duke University
Box 90338
Durham, NC 27708
USA

Phone 919-660-7382
Fax 919-660-7293
Web http://www.lutzonilab.net/member/frankkauff.shtml





From idoerg at burnham.org  Wed Feb 16 17:24:51 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:58 2005
Subject: [Biopython-dev] Re: Bio.CAPS module submission
In-Reply-To: 
References: <4213A399.6020500@burnham.org>		<4213B3CA.1030204@utoronto.ca>		<4213BEB2.1040708@utoronto.ca>
	
Message-ID: <4213C833.7010708@burnham.org>

OK, we'll patch in the test_suite() code.

Jonathan, email it to me once it is ready, OK?

Thanks,

Iddo


Michael Hoffman wrote:

> Jonathan Taylor wrote:
>
>> True.  I am fine with another name?  how about test_suite() ?
>
>
> I think that would be preferable.
> -- 
> Michael Hoffman 
> European Bioinformatics Institute
> _______________________________________________
> Biopython-dev mailing list
> Biopython-dev@biopython.org
> http://biopython.org/mailman/listinfo/biopython-dev
>
>



-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP


From bugzilla-daemon at portal.open-bio.org  Wed Feb 16 16:53:03 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Sat Mar  5 14:43:58 2005
Subject: [Biopython-dev] [Bug 1715] Bio.Blast.NCBIStandalone does not
	support standalone NCBI RPS-Blast (rpsblast) output
Message-ID: <200502162153.j1GLr2tk022950@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1715

biopython-bugzilla@maubp.freeserve.co.uk changed:

           What    |Removed                     |Added
----------------------------------------------------------------------------
 Attachment #188 is|0                           |1
           obsolete|                            |



------- Additional Comments From biopython-bugzilla@maubp.freeserve.co.uk  2005-02-16 16:53 -------
Created an attachment (id=194)
 --> (http://bugzilla.open-bio.org/attachment.cgi?id=194&action=view)
Edited version of NCBIStandalone.py based on CVS revision 1.57

This is a revised version of my previous "patch" to deal with iterating over
multiple RPS-BLAST outputs.

The implementation of the RPS Blast iteration is in my opinion ugly, but
functional.

It saves the database line (which is not repeated in RPS-BLAST output) and
re-inserts it before each Query= line (which marks the start of subsequent
results).

I have used this file extensively for parsing multi-query RPS Blast 2.0.10
output on both linux, Windows 2000, and to a lesser extent, Windows XP without
problem.

I doubt this code is worth of including in BioPython as is in the long term,
but maybe could be included BioPython 1.40 until something nicer is produced.

Alternatively, the previous version (without the Iterator cludge) is quite nice
code wise, and should provide full rpsblast support except for multiple input
queries.

Review?



------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.

From idoerg at burnham.org  Wed Feb 16 17:34:17 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] [Fwd: Question to code]
In-Reply-To: <1108592612.5091.32.camel@osiris.biology.duke.edu>
References: <4213C2E3.8030609@burnham.org>
	<1108592612.5091.32.camel@osiris.biology.duke.edu>
Message-ID: <4213CA69.5020105@burnham.org>

I tried qblast with blastp, didn't work.

Didn't try with blastn, though, but that's moot.

Cheers,

./I


Frank Kauff wrote:

>Eirik,
>
>Try if the code works with
>
>b_results = NCBIWWW.qblast('blastn', 'nr', f_record).read()
>
>instead of 
>
>  
>
>>b_results = NCBIWWW.blast('blastn', 'nr', f_record).read()
>>
>>    
>>
>
>I think that issue appeared a couple of months ago on the biopython list, essentially saying that
>qblast is the blast NCBI wants people to use for blast scripts? After that, qblast method was added
>to NCBIWWW, and it's what I'm using in my blast scripts.
>
>Hope this helps,
>Frank
>
>On Wed, 2005-02-16 at 14:02 -0800, Iddo Friedberg wrote:
>  
>
>>OK, this is a real bug. NCBIWWW seems to be broken.
>>
>>I'm having a looksee, but I'd like someone more versed in this than me 
>>to do so.
>>
>>Thanks,
>>
>>Iddo
>>
>>
>>
>>-------- Original Message --------
>>Subject: 	Question to code
>>Date: 	Wed, 16 Feb 2005 15:19:57 +0100
>>From: 	Eirik S?nneland 
>>To: 	idoerg
>>
>>
>>
>>Dear Freidberg,
>>
>>I've been having problems parsing my output from NCBI using the example 
>>code given in Biopython Cookbook. Therefore I tried to follow your code 
>>described in "Genome Informatics 14(2003). Still I get an error message 
>>connected to the parsing. Could you please give a hint on what is wrong? 
>>Is this a bug?? Code and output as follows:
>>
>>Code:
>>
>>from Bio.Blast import NCBIWWW
>>from Bio import Fasta
>>
>>file_for_blast = open('Fastaformat.txt', 'r')
>>f_iterator = Fasta.Iterator(file_for_blast)
>>f_record = f_iterator.next()
>>
>>b_results = NCBIWWW.blast('blastn', 'nr', f_record).read()
>>
>>b_record = NCBIWWW.BlastParser().parse_str(b_results)
>>
>>Output(Have cut out the beginning, only pasted the last part of output):
>>
>>
>> Score = 40.1 bits (20), Expect = 6.3
>> Identities = 20/20 (100%)
>> Strand = Plus / Minus
>>
>>                                 
>>Query: 29     ctgcagctcgggctcctgcc 48
>>              ||||||||||||||||||||
>>Sbjct: 150928 ctgcagctcgggctcctgcc 150909
>>
>> >> >>
>> >>
>>Lambda     K      H
>>    1.37    0.711     1.31
>>
>>Gapped
>>Lambda     K      H
>>    1.37    0.711     1.31
>>
>>Matrix: blastn matrix:1 -3
>>Gap Penalties: Existence: 5, Extension: 2
>>Number of Sequences: 2894376
>>Number of Hits to DB: 6,089,259
>>Number of extensions: 328661
>>Number of successful extensions: 6259
>>Number of sequences better than 10.0: 2
>>Number of HSP's better than 10.0 without gapping: 2
>>Number of HSP's gapped: 6259
>>Number of HSP's successfully gapped: 2
>>Number of extra gapped extensions for HSPs above 10.0: 6255
>>Length of query: 600
>>Length of database: 13,294,103,689
>>Length adjustment: 22
>>Effective length of query: 578
>>Effective length of database: 13,230,427,417
>>Effective search space: 7647187047026
>>Effective search space used: 7647187047026
>>A: 0
>>X1: 11 (21.8 bits)
>>X2: 15 (30.0 bits)
>>X3: 25 (50.0 bits)
>>S1: 14 (25.0 bits)
>>S2: 20 (40.1 bits)
>>
>>
>>
>>
>>Traceback (most recent call last):
>>  File "C:\Python24\MyWorkspace.py", line 50, in -toplevel-
>>    b_record = NCBIWWW.BlastParser().parse_str(b_results)
>>  File "C:\Python24\Lib\site-packages\Bio\ParserSupport.py", line 52, in 
>>parse_str
>>    return self.parse(File.StringHandle(string))
>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 47, in 
>>parse
>>    self._scanner.feed(handle, self._consumer)
>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 99, in 
>>feed
>>    self._scan_rounds(uhandle, consumer)
>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 242, 
>>in _scan_rounds
>>    self._scan_alignments(uhandle, consumer)
>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 322, 
>>in _scan_alignments
>>    raise SyntaxError, "Cannot resolve location at line:\n%s" % line1
>>SyntaxError: Cannot resolve location at line:
>>
>>
>> >>>
>>
>>Thanks!
>>
>>Regards,
>>Eirik
>>
>>
>>    
>>


-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP


From idoerg at burnham.org  Wed Feb 16 18:49:49 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] [Fwd: Question to code]
In-Reply-To: <1108592612.5091.32.camel@osiris.biology.duke.edu>
References: <4213C2E3.8030609@burnham.org>
	<1108592612.5091.32.camel@osiris.biology.duke.edu>
Message-ID: <4213DC1D.9070306@burnham.org>


OK, I fixed that.

Eirik, you can check out a copy fom CVS, or wait for the Friday release.



./I


Frank Kauff wrote:

>Eirik,
>
>Try if the code works with
>
>b_results = NCBIWWW.qblast('blastn', 'nr', f_record).read()
>
>instead of 
>
>  
>
>>b_results = NCBIWWW.blast('blastn', 'nr', f_record).read()
>>
>>    
>>
>
>I think that issue appeared a couple of months ago on the biopython list, essentially saying that
>qblast is the blast NCBI wants people to use for blast scripts? After that, qblast method was added
>to NCBIWWW, and it's what I'm using in my blast scripts.
>
>Hope this helps,
>Frank
>
>On Wed, 2005-02-16 at 14:02 -0800, Iddo Friedberg wrote:
>  
>
>>OK, this is a real bug. NCBIWWW seems to be broken.
>>
>>I'm having a looksee, but I'd like someone more versed in this than me 
>>to do so.
>>
>>Thanks,
>>
>>Iddo
>>
>>
>>
>>-------- Original Message --------
>>Subject: 	Question to code
>>Date: 	Wed, 16 Feb 2005 15:19:57 +0100
>>From: 	Eirik S?nneland 
>>To: 	idoerg
>>
>>
>>
>>Dear Freidberg,
>>
>>I've been having problems parsing my output from NCBI using the example 
>>code given in Biopython Cookbook. Therefore I tried to follow your code 
>>described in "Genome Informatics 14(2003). Still I get an error message 
>>connected to the parsing. Could you please give a hint on what is wrong? 
>>Is this a bug?? Code and output as follows:
>>
>>Code:
>>
>>from Bio.Blast import NCBIWWW
>>from Bio import Fasta
>>
>>file_for_blast = open('Fastaformat.txt', 'r')
>>f_iterator = Fasta.Iterator(file_for_blast)
>>f_record = f_iterator.next()
>>
>>b_results = NCBIWWW.blast('blastn', 'nr', f_record).read()
>>
>>b_record = NCBIWWW.BlastParser().parse_str(b_results)
>>
>>Output(Have cut out the beginning, only pasted the last part of output):
>>
>>
>> Score = 40.1 bits (20), Expect = 6.3
>> Identities = 20/20 (100%)
>> Strand = Plus / Minus
>>
>>                                 
>>Query: 29     ctgcagctcgggctcctgcc 48
>>              ||||||||||||||||||||
>>Sbjct: 150928 ctgcagctcgggctcctgcc 150909
>>
>> >> >>
>> >>
>>Lambda     K      H
>>    1.37    0.711     1.31
>>
>>Gapped
>>Lambda     K      H
>>    1.37    0.711     1.31
>>
>>Matrix: blastn matrix:1 -3
>>Gap Penalties: Existence: 5, Extension: 2
>>Number of Sequences: 2894376
>>Number of Hits to DB: 6,089,259
>>Number of extensions: 328661
>>Number of successful extensions: 6259
>>Number of sequences better than 10.0: 2
>>Number of HSP's better than 10.0 without gapping: 2
>>Number of HSP's gapped: 6259
>>Number of HSP's successfully gapped: 2
>>Number of extra gapped extensions for HSPs above 10.0: 6255
>>Length of query: 600
>>Length of database: 13,294,103,689
>>Length adjustment: 22
>>Effective length of query: 578
>>Effective length of database: 13,230,427,417
>>Effective search space: 7647187047026
>>Effective search space used: 7647187047026
>>A: 0
>>X1: 11 (21.8 bits)
>>X2: 15 (30.0 bits)
>>X3: 25 (50.0 bits)
>>S1: 14 (25.0 bits)
>>S2: 20 (40.1 bits)
>>
>>
>>
>>
>>Traceback (most recent call last):
>>  File "C:\Python24\MyWorkspace.py", line 50, in -toplevel-
>>    b_record = NCBIWWW.BlastParser().parse_str(b_results)
>>  File "C:\Python24\Lib\site-packages\Bio\ParserSupport.py", line 52, in 
>>parse_str
>>    return self.parse(File.StringHandle(string))
>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 47, in 
>>parse
>>    self._scanner.feed(handle, self._consumer)
>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 99, in 
>>feed
>>    self._scan_rounds(uhandle, consumer)
>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 242, 
>>in _scan_rounds
>>    self._scan_alignments(uhandle, consumer)
>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 322, 
>>in _scan_alignments
>>    raise SyntaxError, "Cannot resolve location at line:\n%s" % line1
>>SyntaxError: Cannot resolve location at line:
>>
>>
>> >>>
>>
>>Thanks!
>>
>>Regards,
>>Eirik
>>
>>
>>    
>>


-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP


From idoerg at burnham.org  Wed Feb 16 19:01:30 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Change to NCBIWWW BLast Parser
Message-ID: <4213DEDA.8020109@burnham.org>

Hi all,

I made a change to the NCBIWWW parser which seems to fix the error Eirik 
reported. However, if you can check out the new copy from CVS (revision 
1.36) and import it into your existing modules which use NCBIWWW  just 
as a sanity check, I'd be grateful.

Best,

Iddo

-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP


From idoerg at burnham.org  Wed Feb 16 19:11:53 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] A little BLAST testing please?
Message-ID: <4213E149.9030306@burnham.org>


Here is the code bit which used to break because of BlastParser. I think 
it is fixed, but since we want to get a release out in two days time, I 
just want people to have a quick run looksee:

-------- begin testwwwblast.py --------------------
import sys
from Bio.Blast import NCBIWWW
from Bio import Fasta

print sys.argv[1]
file_for_blast = open(sys.argv[1], 'r')
f_iterator = Fasta.Iterator(file_for_blast)
f_record = f_iterator.next()

b_results = NCBIWWW.qblast('blastp', 'nr', f_record).read()

b_record = NCBIWWW.BlastParser().parse_str(b_results)

----------- end -----------------------

Just run this using:

% python testwwwblast.py your_favorite_fasta_file

(Make sure that you change 'blastp' to 'blastn' or 'tblastx' or somesuch 
if you are running a nucleotide file).

If you don't get a horrible Exception, then things are OK.

If you get a horrible exception, let me know.

Best,

Iddo

-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP


From bugzilla-daemon at portal.open-bio.org  Wed Feb 16 18:42:13 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] [Bug 1654] SyntaxError in NCBIWWW.BlastParser
Message-ID: <200502162342.j1GNgDYa024653@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1654

idoerg@burnham.org changed:

           What    |Removed                     |Added
----------------------------------------------------------------------------
             Status|NEW                         |RESOLVED
         Resolution|                            |FIXED



------- Additional Comments From idoerg@burnham.org  2005-02-16 18:42 -------
Change made to BlastParser. Also, remember that blast is deprecated, use qblast
instead



------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.

From idoerg at burnham.org  Thu Feb 17 12:15:02 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] [Fwd: Important info for all Open-Bio affiliated
 developers (people with CVS write access...)]
Message-ID: <4214D116.8010804@burnham.org>



-------- Original Message --------
Subject: 	[BioPython] Important info for all Open-Bio affiliated 
developers (people with CVS write access...)
Date: 	Thu, 17 Feb 2005 08:50:55 -0500
From: 	Chris Dagdigian 
Organization: 	Bioteam Inc.
To: 	BioPerl , biojava-l@biojava.org, 
biopython@biopython.org, moby-l@biomoby.org, das@biodas.org, 
bioruby@bioruby.org



Hi folks, apologies for the large cross-posting.

Really short summary:

We are going to migrate to newer server hardware over the next few 
months. If you are an OBF developer (someone who has a login account on 
"pub" with CVS write permission to one or more repositories) then you'll 
need to make sure we have your most current email address so we can 
communicate the transition plan directly without spamming N number of 
mailing lists.

We need updated contact info in order to manage the transition.

Details below.

Long winded details:

Our existing servers (the developer CVS repository and the 2nd system 
that handles websites & mailing lists) are getting a bit old and more 
importantly are running older Linux distributions that are long past 
official support dates and are difficult to update, secure and maintain.

We have 2 brand new servers sitting online in a Boston area colocation 
facility and the various OBF sysadmins are starting to think about 
planning for transitioning services and user accounts.

First to move (I suspect) is going to be the pub.open-bio.org system 
which is the main CVS sourcecode repository for our various projects 
such as biojava, bioperl, moby, etc.

We think the transition will be pretty quick and transparent. It should 
not be all that hard to migrate the user accounts and copy over the CVS 
repository tree. We'll be writing scripts to automate the process and 
can run repeated migration tests before officially switching on the new 
system.

What CVS committers and developers need to do
=============================================
1. SSH login to pub.open-bio.org
2. Run the "chfn" command to edit your user info
3. Make sure a good email address is listed for the Office: or Phone: 
field. Info about your project and institution would be great as well 
but is not required.

In a week's time I'm going to capture all the email addresses listed and 
will insert them into a mailing list that we'll use to communicate our 
plans. This way we can speak to developers directly without cross 
posting to many mailing lists.

Any user account without a full name and working email address will 
still be migrated but we are going to lockout the password until we hear 
from the person in question.


What OBF Project Leaders need to do
====================================
1. Login to pub.open-bio.org

2. Check /etc/groups for your project name and examine the users who 
have write access to your repository -- Email root-l@open-bio.org with 
the usernames of any inactive members who can safely be deleted.



Regards,
Chris
one of the open-bio admins (root-l@open-bio.org)



-- 
Chris Dagdigian, 
BioTeam  - Independent life science IT & informatics consulting
Office: 617-665-6088, Mobile: 617-877-5498, Fax: 425-699-0193
PGP KeyID: 83D4310E iChat/AIM: bioteamdag  Web: http://bioteam.net
_______________________________________________
BioPython mailing list  -  BioPython@biopython.org
http://biopython.org/mailman/listinfo/biopython




-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP


From idoerg at burnham.org  Thu Feb 17 21:22:26 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Faling tests
Message-ID: <42155162.1050903@burnham.org>


test_Register is still failing.

Also, test_NCBIWWW is rather irrelevant. I need to set up a new one.


Anyhow, who can take over to look at the Register module? I can't do both?

Thanks,

Iddo



-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP


From mdehoon at ims.u-tokyo.ac.jp  Thu Feb 17 22:51:19 2005
From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Faling tests
In-Reply-To: <42155162.1050903@burnham.org>
References: <42155162.1050903@burnham.org>
Message-ID: <42156637.60806@ims.u-tokyo.ac.jp>

OK I'll look at the Register module. I'll have to leave in a few hours, so if I 
can't fix it on time I'll write a message to biopython-dev.

--Michiel.

Iddo Friedberg wrote:

> 
> test_Register is still failing.
> 
> Also, test_NCBIWWW is rather irrelevant. I need to set up a new one.
> 
> 
> Anyhow, who can take over to look at the Register module? I can't do both?
> 
> Thanks,
> 
> Iddo
> 
> 
> 

-- 
Michiel de Hoon, Assistant Professor
University of Tokyo, Institute of Medical Science
Human Genome Center
4-6-1 Shirokane-dai, Minato-ku
Tokyo 108-8639
Japan
http://bonsai.ims.u-tokyo.ac.jp/~mdehoon

From mdehoon at ims.u-tokyo.ac.jp  Thu Feb 17 22:59:13 2005
From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Bio.Nexus
Message-ID: <42156811.8050502@ims.u-tokyo.ac.jp>

Bio/Nexus/cnexus.c contains a "main" function that doesn't seem to be needed in 
Biopython. Can I remove it? Since this function is exported, it may (in theory 
at least) cause a conflict. Also, my compiler complains about it that "int main" 
doesn't return an int.

--Michiel

-- 
Michiel de Hoon, Assistant Professor
University of Tokyo, Institute of Medical Science
Human Genome Center
4-6-1 Shirokane-dai, Minato-ku
Tokyo 108-8639
Japan
http://bonsai.ims.u-tokyo.ac.jp/~mdehoon

From idoerg at burnham.org  Thu Feb 17 23:17:59 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Bio.Nexus
In-Reply-To: <42156811.8050502@ims.u-tokyo.ac.jp>
Message-ID: 

Michiel, James, thanks a lot.

Frank: can you address Michiel's comment on Nexus' C extension?

I managed to get NCBIWWW working with qblast for blastn and blastp. qblast
fails with blastx, tblastx. I am tempted to keep this as is in the
release, put a comment that qblast only works with blasp/blastn, and fix
stuff later, in a bugfix release. 

./I


--
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037, USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 646 3171
http://ffas.ljcrf.edu/~iddo
-------------------------------------
Automated Protein Function Prediction Meeting, June 24, 2005
http://ffas.burnham.org/AFP




From idoerg at burnham.org  Thu Feb 17 23:36:04 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Faling tests
In-Reply-To: <4215616B.3040803@a4internet.com>
Message-ID: 

test_Registry is "only" failing on PDB and Swissprot.

So far: we have a crippled NCBIWWW (blastn and blastp only for qblast) and
an 85% working retrieval. Not fantastic, but workable. 

Should we go ahead with the release? Any other things hitting the fan I
should know of? :)

./I

--
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037, USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 646 3171
http://ffas.ljcrf.edu/~iddo
-------------------------------------
Automated Protein Function Prediction Meeting, June 24, 2005
http://ffas.burnham.org/AFP

On Fri, 18 Feb 2005, James Casbon wrote:

> Iddo Friedberg wrote:
> > 
> > test_Register is still failing.
> 
> Seems ebi have changed their interface or something:.  Compare:
> 
>  >>> db['pdb'].objs[0].cgi
> 'http://www.rcsb.org/pdb/cgi/export.cgi'
>  >>> h = db['pdb'].objs[0]['1BG2']
> 
> to:
> 
>  >>> db['pdb'].objs[1].url
> 'http://www.ebi.ac.uk/cgi-bin/emblfetch'
>  >>> h = db['pdb'].objs[1]['1BG2']
> ...
> KeyError: 'results do not look like PDB format'
> 
> Easiest bug fix is to remove the ebi source, but maybe someone knows how 
> to get the db object to spit out what it is receving so we can get an 
> idea of what is going wrong?
> 
> 
> Swissprot fails as well, two failiures: www.expash.ch produces a 403, 
> us.expasy.org seems to result in some more serious stuff (see below).
> 
> 
> Hope this helps,
> James
> 
>  >>> print db["swissprot"].objs[0].cgi
> http://www.expasy.ch/cgi-bin/get-sprot-raw.pl
>  >>> print db["swissprot"].objs[0][ "MTHC_DROME" ].read(100)
> 
> 
> 403 Forbidden
> 
>  >>> print db["swissprot"].objs[1].cgi
> http://us.expasy.org/cgi-bin/get-sprot-raw.pl
>  >>> print db["swissprot"].objs[1][ "MTHC_DROME" ].read(100)
> Traceback (most recent call last):
>    File "", line 1, in ?
>    File "/home/james/biopython/Bio/config/DBRegistry.py", line 89, in 
> __getitem__    return self._get(key)
>    File "/home/james/biopython/Bio/config/_support.py", line 138, in 
> __call__
>      if handle.poll():
>    File "/home/james/biopython/Bio/MultiProc/copen.py", line 217, in poll
>      self._cleanup_child()
>    File "/home/james/biopython/Bio/MultiProc/copen.py", line 238, in 
> _cleanup_child
>      raise AssertionError, "Error in child process:\n\n%s" % error
> AssertionError: Error in child process:
> 
> Traceback (most recent call last):
>    File "/home/james/biopython/Bio/MultiProc/copen.py", line 70, in copen_fn
>      output = func(*args, **keywords)
>    File "/home/james/biopython/Bio/config/_support.py", line 131, in 
> _call_fn
>      retval = self.fn(*args, **keywds)
>    File "/home/james/biopython/Bio/config/_support.py", line 107, in 
> __call__
>      return self.fn(*args, **keywds)
>    File "/home/james/biopython/Bio/config/DBRegistry.py", line 310, in _get
>      handle = self._check_for_errors(handle, self.failure_cases)
>    File "/home/james/biopython/Bio/config/DBRegistry.py", line 246, in 
> _check_for_errors
>      raise KeyError, errormsg
> KeyError: 'no results'
> 


From idoerg at burnham.org  Fri Feb 18 00:30:59 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Re: Who's the dude?
In-Reply-To: 
Message-ID: 

Michal,

test_Compass is failing its regression test. Can you have a look?

Thanks,

Iddo


[idoerg@hotdog:biopython/Tests]> python test_Compass.py
testAlignmentParsingOne (__main__.CompassTest) ... FAIL
testAlignmentParsingTwo (__main__.CompassTest) ... ok
testCompassIteratorEasy (__main__.CompassTest) ... ok
testCompassIteratorHard (__main__.CompassTest) ... ok
testCompassParser (__main__.CompassTest) ... ok
testCompassScanAndConsume (__main__.CompassTest) ... ok

======================================================================
FAIL: testAlignmentParsingOne (__main__.CompassTest)
----------------------------------------------------------------------
Traceback (most recent call last):
  File "test_Compass.py", line 100, in testAlignmentParsingOne
    self.assertEquals("++ ++++++", com_record.positives)
  File "/usr/lib/python2.3/unittest.py", line 302, in failUnlessEqual
    raise self.failureException, \
AssertionError: '++ ++++++' != '++ ++++++\n'

----------------------------------------------------------------------
Ran 6 tests in 0.009s

FAILED (failures=1)


--

Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037, USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 646 3171
http://ffas.ljcrf.edu/~iddo
-------------------------------------
Automated Protein Function Prediction Meeting, June 24, 2005
http://ffas.burnham.org/AFP

On Fri, 11 Feb 2005, Iddo Friedberg wrote:

> Michal,
> 
> Thanks.
> 
> Just send me oyur patch, or the fixed module. I'll commit it.
> 
> Best,
> 
> Iddo
> 
> 
> --
> Iddo Friedberg, Ph.D.
> The Burnham Institute
> 10901 N. Torrey Pines Rd.
> La Jolla, CA 92037, USA
> Tel: +1 (858) 646 3100 x3516
> Fax: +1 (858) 646 3171
> http://ffas.ljcrf.edu/~iddo
> -------------------------------------
> Automated Protein Function Prediction Meeting, June 24, 2005
> http://ffas.burnham.org/AFP
> 
> On Fri, 11 Feb 2005, Michal Kurowski wrote:
> 
> > Iddo Friedberg  wrote:
> > >
> > > Do you know Michal Kurowski? He posted something on the biopython list a
> > > couple of days ago, but when I tried to reply, his address
> > > mkur@gazeta.pl gave a "unknown user". Thought you'll be able to help.
> > 
> > Hi Iddo - sorry for that.
> > 
> > The "gazeta.pl" is my anti-spamers address I use on public mailing
> > lists. I use "genesilico.pl" for all real stuff. 
> >  
> > I'm puzzled your original reply was unsuccessful though. Probably
> > because of differences between headers and the envelope.
> > 
> > What about the Bio.Compass module (and his maintenance) ? 
> > 
> > Cheers,
> >  
> > -- 
> > Michal Kurowski
> > 
> > 
> 
> 


From idoerg at burnham.org  Fri Feb 18 02:09:02 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] As of now (Thursday night, California)
Message-ID: 


Nexus and CAPS, our new modules seem to be working fine.

Compass has a problem: Michal, thanks for the patch. But we need an
updated regression test.

NCBIWWW.qblast is only good for blastp and blastn now. I'll write up the
regression testing Friday.

test_Registry: I commented out the PDB and Swissprot sections.

Everything is in CVS now.

OK, I'm going to bed. If any one would like to look into the stuff in
test_Registry or in NCBIWWW please do.

Thanks,

Iddo


--
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037, USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 646 3171
http://ffas.ljcrf.edu/~iddo
-------------------------------------
Automated Protein Function Prediction Meeting, June 24, 2005
http://ffas.burnham.org/AFP



From mdehoon at ims.u-tokyo.ac.jp  Fri Feb 18 04:06:50 2005
From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] As of now (Thursday night, California)
In-Reply-To: 
References: 
Message-ID: <4215B02A.90103@ims.u-tokyo.ac.jp>

Iddo Friedberg wrote:
> test_Registry: I commented out the PDB and Swissprot sections.

I had a look at the PDB section in test_Registry. One problem seems to be the 
url. Now we are using

http://www.ebi.ac.uk/cgi-bin/emblfetch?db=PDB&format=default&style=raw&id=1BG3

but as Bill Barnard noticed a couple of weeks ago, this should be

http://www.ebi.ac.uk/cgi-bin/dbfetch?db=PDB&format=default&style=raw&id=1BG3

I fixed this in Bio/dbdefs/pdb.py.

The test_Registry still fails though. This seems to be due to the \n at the top 
of the EBI file at the second url. But this code seems to behave strangely 
anyway. Some sections in test_Registry (other than PDB and Swissprot) return a 
ParserPositionException in _parse_elements in Martel/Parser.py. How the test can 
pass anyway is a mystery to me.

Sorry, that's all I can say. Gotta run!

--Michiel.

-- 
Michiel de Hoon, Assistant Professor
University of Tokyo, Institute of Medical Science
Human Genome Center
4-6-1 Shirokane-dai, Minato-ku
Tokyo 108-8639
Japan
http://bonsai.ims.u-tokyo.ac.jp/~mdehoon

From mdehoon at ims.u-tokyo.ac.jp  Fri Feb 18 04:28:23 2005
From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Bio.Nexus
In-Reply-To: <42156811.8050502@ims.u-tokyo.ac.jp>
References: <42156811.8050502@ims.u-tokyo.ac.jp>
Message-ID: <4215B537.4040602@ims.u-tokyo.ac.jp>

I replaced the C++-style comments (//) in cnexus.c by ANSI-C style comments (/* 
*/). Strictly ANSI-compliant compilers (particularly on UNIX) may fail to 
compile this code otherwise.

--Michiel.

Michiel Jan Laurens de Hoon wrote:

> Bio/Nexus/cnexus.c contains a "main" function that doesn't seem to be 
> needed in Biopython. Can I remove it? Since this function is exported, 
> it may (in theory at least) cause a conflict. Also, my compiler 
> complains about it that "int main" doesn't return an int.
> 
> --Michiel
> 

-- 
Michiel de Hoon, Assistant Professor
University of Tokyo, Institute of Medical Science
Human Genome Center
4-6-1 Shirokane-dai, Minato-ku
Tokyo 108-8639
Japan
http://bonsai.ims.u-tokyo.ac.jp/~mdehoon

From fkauff at duke.edu  Fri Feb 18 09:09:21 2005
From: fkauff at duke.edu (Frank Kauff)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Bio.Nexus
In-Reply-To: <42156811.8050502@ims.u-tokyo.ac.jp>
References: <42156811.8050502@ims.u-tokyo.ac.jp>
Message-ID: <1108735761.5094.11.camel@osiris.biology.duke.edu>

Hi Michiel,

On Fri, 2005-02-18 at 12:59 +0900, Michiel Jan Laurens de Hoon wrote:
> Bio/Nexus/cnexus.c contains a "main" function that doesn't seem to be needed in 
> Biopython. Can I remove it? Since this function is exported, it may (in theory 
> at least) cause a conflict. Also, my compiler complains about it that "int main" 
> doesn't return an int.
> 

Not sure -  I simply strictly followed the Python documentation about
extensions: http://docs.python.org/ext/methodTable.html, because it's
the first extension I've ever written :-) The docs say that I need the
main function for calling the initialization function that passes the
method table to the interpreter.
But seems it's not needed within biopython - I works fine when I import
from Bio.Nexus (but not when importing Nexus.py directly from my own
Directory, it complains that it didn't define init function.
 

> I replaced the C++-style comments (//) in cnexus.c by ANSI-C style
comments (/* 
> */). Strictly ANSI-compliant compilers (particularly on UNIX) may fail
to 
> compile this code otherwise.

Good point, thanks.

Frank

 

> --Michiel
> 
-- 
Frank Kauff
Dept. of Biology
Duke University
Box 90338
Durham, NC 27708
USA

Phone 919-660-7382
Fax 919-660-7293
Web http://www.lutzonilab.net/member/frankkauff.shtml





From reg at plaguerats.net  Fri Feb 18 13:10:00 2005
From: reg at plaguerats.net (Matt Dimmic)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] SeqRecord and Alignment inconsistencies
Message-ID: <000701c515e5$12e4b640$8eaaec84@CuriousGeorge>

In the storm of fixes leading up to the next BioPython release, I have a
basic design question. There seems to be some inconsistency when it
comes to the use of the name, id, and description fields of the FASTA
format in the Alignment class. 

The FASTA format itself is ambiguous, but in general I expect the title
of the sequence to be a variant of one of these:

>id|description
>id description
>id

The important thing is that the description is optional, and the
SeqRecord() object can be instantiated with id and/or description (and
also a 'name', which makes things even more confusing!).

Unfortunately the Alignment class is not consistent with this
formatting. Its __init__() function asks for a descriptor, and then when
a sequence is being added to the Alignment in Alignment.add_sequence()
it uses this:

new_record = SeqRecord(new_seq, description = descriptor)

The id is never requested. The result of this inconsistency can be seen
in the following code. Consider the following two sequences in
foo.fasta:

>human
ATGGCAGCGGGGTTCGGG

>chimp
GTCCTGAGAAGTATCGGC

My instinct is to do this:
# -----
from Bio.SeqIO.FASTA import FastaReader
from Bio.Fasta.FastaAlign import FastaAlignment
from Bio.Alphabet import IUPAC

reader = FastaReader(open('foo.fasta',"r"),alphabet=IUPAC.ambiguous_dna)
alignment = FastaAlignment(alphabet=IUPAC.ambiguous_dna)
for seqRec in reader:
    alignment.add_sequence(sequence=seqRec.seq.data,\
            descriptor=seqRec.description)
print alignment
# -----

but this yields:

>
ATGGCAGCGGGGTTCGGG

>
GTCCTGAGAAGTATCGGC

This is because 'human' and 'chimp' are the id, not the description. Of
course one can get around this problem by simply passing the
SeqRecord.id into add_sequence(), but the SeqRecords stored in the
Alignment object are still messed up.

Is this behaviour intentional? If not, I'd recommend the following
changes:

1. Change the Alignment.add_sequence() signature to accommodate name,
id, and description.

2. Within add_sequence(), pass these to the internal SeqRecord object.

Unfortunately, derived classes like FastaAlignment have accommodated
this by simply using each SeqRecord's description as the id (see e.g.
FastaAlign.py, line 71). So any derived classes which are used for
output will also need to change so that they correctly use the id as the
primary name. This is therefore a radical change and is likely to break
some user code since it occurs in such a widely-applicable class.

I also would like to see a few other additions to the generic Alignment
class:

3. an add_sequence_record() method
4. a dictionary which keys each SeqRecord by id
5. a get_seq_by_id() method

I have made these changes in my local copy of the code, and if the
BioPython developers think these changes would be warranted I would be
happy to provide the updated Alignment class (Generic.py). As for the
derived classes, only FastaAlignment and ClustalAlignment are directly
derived, but there may be other methods which assume the description is
the id and would have to be changed. For example, searching for 'import
Alignment' shows that Saf.Record and example_ais2 both seem to depend on
this behavior. Hopefully regression testing would catch these.

Am I just being pedantic here, or has this confusion caused as many
subtle bugs for other people as it has for me?

Thanks,
Matt Dimmic



From biopython-dev at maubp.freeserve.co.uk  Fri Feb 18 13:55:08 2005
From: biopython-dev at maubp.freeserve.co.uk (Peter)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] SeqRecord and Alignment inconsistencies
In-Reply-To: <000701c515e5$12e4b640$8eaaec84@CuriousGeorge>
References: <000701c515e5$12e4b640$8eaaec84@CuriousGeorge>
Message-ID: <42163A0C.8020107@maubp.freeserve.co.uk>

Matt Dimmic wrote:
> In the storm of fixes leading up to the next BioPython release, I
> have a basic design question. There seems to be some inconsistency
> when it comes to the use of the name, id, and description fields of
> the FASTA format in the Alignment class.

You are probably right - and not just the Alignment class, but I would
suspect its too late to change this for the new release, and that any
last minute change like this would cause lots of backwards compatibility
problems for existing code using BioPython.

Maybe for a "big version jump" like a hypothetical BioPython 2.0 this
would make more sense.

> The FASTA format itself is ambiguous, but in general I expect the
> title of the sequence to be a variant of one of these:
> 
> id|description
 > id description
 > id
 >

Your first example with a "|" is not a good idea - the "important" bit
is up to the first space.  This first word is often subdivided with the
"|" (pipe or bar) character.

For some examples, read the "FASTA Defline Format" section of this:

ftp://ftp.ncbi.nih.gov/blast/documents/formatdb.txt

> The important thing is that the description is optional, and the 
> SeqRecord() object can be instantiated with id and/or description
> (and also a 'name', which makes things even more confusing!).

For yet more terminology, The FASTA record parser uses the terms "title"
and "sequence", where the first word of the title is important (which I
personally call the name or id) and the rest is optional.

i.e. title = id + optional description?

On the other hand, I'm sure I have seen the term "description" applied
to the whole ">" line of a FASTA file...

Peter

From idoerg at burnham.org  Fri Feb 18 15:32:56 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Freeze contributions please
Message-ID: <421650F8.9030204@burnham.org>

Hi all,

I am rolling out the version now. Please freeze all CVS deposits for 
now. If you really want ot put something in, let me know first.

thanks,

Iddo

-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP


From jonathan.taylor at utoronto.ca  Fri Feb 18 15:23:44 2005
From: jonathan.taylor at utoronto.ca (Jonathan Taylor)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] We need better doc strings for primer records so
	here is a diff
Message-ID: <42164ED0.4030306@utoronto.ca>

I think my first post got blocked because I attached a diff.  Can we 
please turn off all protection to the list now that it is registered 
users only?

The diff I attached is at:

http://bbc.botany.utoronto.ca/~jtaylor/primer.diff

Gosh, I wish someone had put in a description of the Primer records in
Bio.Emboss.Primer.Primer3Record.  In any case heres a patch, that should
be applied in Bio/Emboss

I think this is very useful to have included especially in the generated
html documentation.

Jon.


From idoerg at burnham.org  Fri Feb 18 15:59:52 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Freeze contributions please
In-Reply-To: <421650F8.9030204@burnham.org>
References: <421650F8.9030204@burnham.org>
Message-ID: <42165748.3050502@burnham.org>

New Modules since 1.30:

Affy
CAPS
Nexus

What did I miss?

./I

Iddo Friedberg wrote:

> Hi all,
>
> I am rolling out the version now. Please freeze all CVS deposits for 
> now. If you really want ot put something in, let me know first.
>
> thanks,
>
> Iddo
>



-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP


From idoerg at burnham.org  Sat Feb 19 01:41:25 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Biopython 1.40 beta pre-release
Message-ID: 

Hi all,

OK, it's out. Thank you for all your work on this, and making this
release happen. Great job!

I think this release should be a beta, as we know there is stuff to fix,
and it is not yet production quality. Compass, Registry, NCBIWWW need some
improvement.

What I would like you all to do if you have time over the weekend is check
this release for fatal problems. You can download it from the downloads
page on the biopython.org website.

Also, I would like to have the list of major corrections, and especially
of new modules inserted since Biopython 1.30. Michiel and Thomas already
gave me. Sifting through a cvs lo file is a bit tiresome.

I will wait with the official announcement until Monday.

Thanks again,

Iddo

--
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037, USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 646 3171
http://ffas.ljcrf.edu/~iddo
-------------------------------------
Automated Protein Function Prediction Meeting, June 24, 2005
http://ffas.burnham.org/AFP


From mdehoon at ims.u-tokyo.ac.jp  Sun Feb 20 04:42:03 2005
From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Bio.Nexus
In-Reply-To: <1108735761.5094.11.camel@osiris.biology.duke.edu>
References: <42156811.8050502@ims.u-tokyo.ac.jp>
	<1108735761.5094.11.camel@osiris.biology.duke.edu>
Message-ID: <42185B6B.4080309@ims.u-tokyo.ac.jp>

Frank Kauff wrote:
> Hi Michiel,
> 
> On Fri, 2005-02-18 at 12:59 +0900, Michiel Jan Laurens de Hoon wrote:
> 
>>Bio/Nexus/cnexus.c contains a "main" function that doesn't seem to be needed in 
>>Biopython. Can I remove it? Since this function is exported, it may (in theory 
>>at least) cause a conflict. Also, my compiler complains about it that "int main" 
>>doesn't return an int.
>>
> 
> 
> Not sure -  I simply strictly followed the Python documentation about
> extensions: http://docs.python.org/ext/methodTable.html, because it's
> the first extension I've ever written :-) The docs say that I need the
> main function for calling the initialization function that passes the
> method table to the interpreter.

You need the "main" function when you're embedding python (so when you write 
your own program that contains the Python interpreter). Here you're extending 
python, so you don't need the main function. The initialization function is 
calling by the Python interpreter when you import your module.

--Michiel.

-- 
Michiel de Hoon, Assistant Professor
University of Tokyo, Institute of Medical Science
Human Genome Center
4-6-1 Shirokane-dai, Minato-ku
Tokyo 108-8639
Japan
http://bonsai.ims.u-tokyo.ac.jp/~mdehoon

From mdehoon at ims.u-tokyo.ac.jp  Sun Feb 20 08:13:50 2005
From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Biopython 1.40 beta pre-release
In-Reply-To: 
References: 
Message-ID: <42188D0E.9060108@ims.u-tokyo.ac.jp>

Windows installers for Biopython 1.40b are now available on the Biopython 
website. I made installers for Python 2.3 and 2.4 -- let me know if you need an 
installer for older Python versions.

--Michiel.

Iddo Friedberg wrote:

> Hi all,
> 
> OK, it's out. Thank you for all your work on this, and making this
> release happen. Great job!
> 
> I think this release should be a beta, as we know there is stuff to fix,
> and it is not yet production quality. Compass, Registry, NCBIWWW need some
> improvement.
> 
> What I would like you all to do if you have time over the weekend is check
> this release for fatal problems. You can download it from the downloads
> page on the biopython.org website.
> 
> Also, I would like to have the list of major corrections, and especially
> of new modules inserted since Biopython 1.30. Michiel and Thomas already
> gave me. Sifting through a cvs lo file is a bit tiresome.
> 
> I will wait with the official announcement until Monday.
> 
> Thanks again,
> 
> Iddo
> 
> --
> Iddo Friedberg, Ph.D.
> The Burnham Institute
> 10901 N. Torrey Pines Rd.
> La Jolla, CA 92037, USA
> Tel: +1 (858) 646 3100 x3516
> Fax: +1 (858) 646 3171
> http://ffas.ljcrf.edu/~iddo
> -------------------------------------
> Automated Protein Function Prediction Meeting, June 24, 2005
> http://ffas.burnham.org/AFP
> 
> _______________________________________________
> Biopython-dev mailing list
> Biopython-dev@biopython.org
> http://biopython.org/mailman/listinfo/biopython-dev
> 
> 

-- 
Michiel de Hoon, Assistant Professor
University of Tokyo, Institute of Medical Science
Human Genome Center
4-6-1 Shirokane-dai, Minato-ku
Tokyo 108-8639
Japan
http://bonsai.ims.u-tokyo.ac.jp/~mdehoon

From mdehoon at ims.u-tokyo.ac.jp  Sun Feb 20 08:23:04 2005
From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] We need better doc strings for primer records
	so	here is a diff
In-Reply-To: <42164ED0.4030306@utoronto.ca>
References: <42164ED0.4030306@utoronto.ca>
Message-ID: <42188F38.9060309@ims.u-tokyo.ac.jp>

Jonathan Taylor wrote:

> I think my first post got blocked because I attached a diff.  Can we 
> please turn off all protection to the list now that it is registered 
> users only?
> 

Who knows the password to the mailing list? The one we're supposed to fill in at

http://biopython.org/mailman/admin/biopython-dev

It seems that the mailing list admins are not actively involved with Biopython 
at the moment. If you're still reading the list, please let us know.

--Michiel.


-- 
Michiel de Hoon, Assistant Professor
University of Tokyo, Institute of Medical Science
Human Genome Center
4-6-1 Shirokane-dai, Minato-ku
Tokyo 108-8639
Japan
http://bonsai.ims.u-tokyo.ac.jp/~mdehoon

From jonathan.taylor at utoronto.ca  Fri Feb 18 14:56:44 2005
From: jonathan.taylor at utoronto.ca (Jonathan Taylor)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Better doc strings for Primers patch
Message-ID: <4216487C.8000501@utoronto.ca>

Gosh, I wish someone had put in a description of the Primer records in 
Bio.Emboss.Primer.Primer3Record.  In any case heres a patch, that should 
be applied in Bio/Emboss

I think this is very useful to have included especially in the generated 
html documentation.

Jon.
-------------- next part --------------
A non-text attachment was scrubbed...
Name: primer.diff
Type: text/x-patch
Size: 893 bytes
Desc: not available
Url : http://portal.open-bio.org/pipermail/biopython-dev/attachments/20050218/b4c3bc56/primer.bin
From thamelry at binf.ku.dk  Wed Feb 16 03:20:24 2005
From: thamelry at binf.ku.dk (thamelry@binf.ku.dk)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] Almost there...
In-Reply-To: <4212B730.8080902@burnham.org>
References: 	<1108500603.5114.23.camel@osiris.biology.duke.edu>	<42126786.3030804@burnham.org>		<1108504701.5114.33.camel@osiris.biology.duke.edu>
	<1108508437.5114.38.camel@osiris.biology.duke.edu>
	<4212B730.8080902@burnham.org>
Message-ID: <32787.83.92.3.59.1108542024.squirrel@www.binf.ku.dk>


> test_PDB ... WARNING: disordered atom found with blanc altloc before
> line 31.
> WARNING: Residue (' ', 4, ' ') redefined at line 41.
> WARNING: Residue (' ', 10, ' ') redefined at line 73.
> WARNING: Residue (' ', 14, ' ') redefined at line 104.
> WARNING: Residue (' ', 16, ' ') redefined at line 133.
> WARNING: Residue (' ', 80, ' ') redefined at line 631.
> WARNING: Residue (' ', 81, ' ') redefined at line 644.

That's a feature: the PDB parser warns that there is problem
with the PDB format. The test passes, isn'it?

Cheers,

-Thomas


From idoerg at burnham.org  Sun Feb 20 10:18:56 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] We need better doc strings for primer records
	so here is a diff
In-Reply-To: <42188F38.9060309@ims.u-tokyo.ac.jp>
Message-ID: 

I'll see what I can do about getting admin access from the OBF admins.

./I


--
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037, USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 646 3171
http://ffas.ljcrf.edu/~iddo
-------------------------------------
Automated Protein Function Prediction Meeting, June 24, 2005
http://ffas.burnham.org/AFP

On Sun, 20 Feb 2005, Michiel Jan Laurens de Hoon wrote:

> Jonathan Taylor wrote:
> 
> > I think my first post got blocked because I attached a diff.  Can we 
> > please turn off all protection to the list now that it is registered 
> > users only?
> > 
> 
> Who knows the password to the mailing list? The one we're supposed to fill in at
> 
> http://biopython.org/mailman/admin/biopython-dev
> 
> It seems that the mailing list admins are not actively involved with Biopython 
> at the moment. If you're still reading the list, please let us know.
> 
> --Michiel.
> 
> 
> -- 
> Michiel de Hoon, Assistant Professor
> University of Tokyo, Institute of Medical Science
> Human Genome Center
> 4-6-1 Shirokane-dai, Minato-ku
> Tokyo 108-8639
> Japan
> http://bonsai.ims.u-tokyo.ac.jp/~mdehoon
> _______________________________________________
> Biopython-dev mailing list
> Biopython-dev@biopython.org
> http://biopython.org/mailman/listinfo/biopython-dev
> 


From jeffrey.chang at duke.edu  Sun Feb 20 10:23:44 2005
From: jeffrey.chang at duke.edu (Jeffrey Chang)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] We need better doc strings for primer records
	so	here is a diff
In-Reply-To: <42188F38.9060309@ims.u-tokyo.ac.jp>
References: <42164ED0.4030306@utoronto.ca> <42188F38.9060309@ims.u-tokyo.ac.jp>
Message-ID: <26a0ad878c22acab8bc335d876440641@duke.edu>

On Feb 20, 2005, at 8:23 AM, Michiel Jan Laurens de Hoon wrote:

> Jonathan Taylor wrote:
>
>> I think my first post got blocked because I attached a diff.  Can we 
>> please turn off all protection to the list now that it is registered 
>> users only?

Yes, this is possible.  However, we do get spams where the "From" 
address has been forged to be someone on the list (my address has been 
used before).  Without the spam filter, those would go through.  It's 
not a huge source of spam, but they do come through occasionally, and 
usually the person whose address has been forged receives an email 
about a blocked spam, and writes us to see what's going on.


> Who knows the password to the mailing list? The one we're supposed to 
> fill in at
>
> http://biopython.org/mailman/admin/biopython-dev

I have the password for this, and I can add someone else to the admin 
list if needed.  Please let me know.

Jeff


From idoerg at burnham.org  Sun Feb 20 10:30:46 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:43:59 2005
Subject: [Biopython-dev] We need better doc strings for primer records
	so here is a diff
In-Reply-To: <26a0ad878c22acab8bc335d876440641@duke.edu>
Message-ID: 

Jeff: If you could add me, that would be great.

All: I still want to compile that list of new modules and major changes
since 1.30. gawking through the CVS log didn't give me much.

Thanks,

Iddo



--
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037, USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 646 3171
http://ffas.ljcrf.edu/~iddo
-------------------------------------
Automated Protein Function Prediction Meeting, June 24, 2005
http://ffas.burnham.org/AFP

On Sun, 20 Feb 2005, Jeffrey Chang wrote:

> On Feb 20, 2005, at 8:23 AM, Michiel Jan Laurens de Hoon wrote:
> 
> > Jonathan Taylor wrote:
> >
> >> I think my first post got blocked because I attached a diff.  Can we 
> >> please turn off all protection to the list now that it is registered 
> >> users only?
> 
> Yes, this is possible.  However, we do get spams where the "From" 
> address has been forged to be someone on the list (my address has been 
> used before).  Without the spam filter, those would go through.  It's 
> not a huge source of spam, but they do come through occasionally, and 
> usually the person whose address has been forged receives an email 
> about a blocked spam, and writes us to see what's going on.
> 
> 
> > Who knows the password to the mailing list? The one we're supposed to 
> > fill in at
> >
> > http://biopython.org/mailman/admin/biopython-dev
> 
> I have the password for this, and I can add someone else to the admin 
> list if needed.  Please let me know.
> 
> Jeff
> 
> _______________________________________________
> Biopython-dev mailing list
> Biopython-dev@biopython.org
> http://biopython.org/mailman/listinfo/biopython-dev
> 


From jonathan.taylor at utoronto.ca  Sun Feb 20 15:42:38 2005
From: jonathan.taylor at utoronto.ca (Jonathan Taylor)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] We need better doc strings for primer records
	so here is a diff
In-Reply-To: 
References: 
Message-ID: <4218F63E.2000001@utoronto.ca>

Well for me it is obviously the CAPS module and the support for fastacmd 
  (of the blastall suite) and ability to retrieve the return code from 
applications.

cheers.
Jon.


Iddo Friedberg wrote:
> Jeff: If you could add me, that would be great.
> 
> All: I still want to compile that list of new modules and major changes
> since 1.30. gawking through the CVS log didn't give me much.
> 
> Thanks,
> 
> Iddo
> 
> 
> 
> --
> Iddo Friedberg, Ph.D.
> The Burnham Institute
> 10901 N. Torrey Pines Rd.
> La Jolla, CA 92037, USA
> Tel: +1 (858) 646 3100 x3516
> Fax: +1 (858) 646 3171
> http://ffas.ljcrf.edu/~iddo
> -------------------------------------
> Automated Protein Function Prediction Meeting, June 24, 2005
> http://ffas.burnham.org/AFP
> 
> On Sun, 20 Feb 2005, Jeffrey Chang wrote:
> 
> 
>>On Feb 20, 2005, at 8:23 AM, Michiel Jan Laurens de Hoon wrote:
>>
>>
>>>Jonathan Taylor wrote:
>>>
>>>
>>>>I think my first post got blocked because I attached a diff.  Can we 
>>>>please turn off all protection to the list now that it is registered 
>>>>users only?
>>
>>Yes, this is possible.  However, we do get spams where the "From" 
>>address has been forged to be someone on the list (my address has been 
>>used before).  Without the spam filter, those would go through.  It's 
>>not a huge source of spam, but they do come through occasionally, and 
>>usually the person whose address has been forged receives an email 
>>about a blocked spam, and writes us to see what's going on.
>>
>>
>>
>>>Who knows the password to the mailing list? The one we're supposed to 
>>>fill in at
>>>
>>>http://biopython.org/mailman/admin/biopython-dev
>>
>>I have the password for this, and I can add someone else to the admin 
>>list if needed.  Please let me know.
>>
>>Jeff
>>
>>_______________________________________________
>>Biopython-dev mailing list
>>Biopython-dev@biopython.org
>>http://biopython.org/mailman/listinfo/biopython-dev
>>
> 
> 
> _______________________________________________
> Biopython-dev mailing list
> Biopython-dev@biopython.org
> http://biopython.org/mailman/listinfo/biopython-dev
> 


From fkauff at duke.edu  Sun Feb 20 16:59:13 2005
From: fkauff at duke.edu (Frank Kauff)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] Biopython 1.40 beta pre-release
In-Reply-To: 
References: 
Message-ID: <1108936757.5094.1.camel@cpe-024-211-246-168.nc.rr.com>

On Fri, 2005-02-18 at 22:41 -0800, Iddo Friedberg wrote:
> Hi all,
> 
> OK, it's out. Thank you for all your work on this, and making this
> release happen. Great job!
> 
> I think this release should be a beta, as we know there is stuff to fix,
> and it is not yet production quality. Compass, Registry, NCBIWWW need some
> improvement.

> What I would like you all to do if you have time over the weekend is check
> this release for fatal problems. You can download it from the downloads
> page on the biopython.org website.
> 

While writing the Cookbook chapter for Nexus.py, I found some typos and
a missing default option, which I fixed in CVS.

F.

> Also, I would like to have the list of major corrections, and especially
> of new modules inserted since Biopython 1.30. Michiel and Thomas already
> gave me. Sifting through a cvs lo file is a bit tiresome.
> 
> I will wait with the official announcement until Monday.
> 
> Thanks again,
> 
> Iddo
> 
> --
> Iddo Friedberg, Ph.D.
> The Burnham Institute
> 10901 N. Torrey Pines Rd.
> La Jolla, CA 92037, USA
> Tel: +1 (858) 646 3100 x3516
> Fax: +1 (858) 646 3171
> http://ffas.ljcrf.edu/~iddo
> -------------------------------------
> Automated Protein Function Prediction Meeting, June 24, 2005
> http://ffas.burnham.org/AFP
> 
> _______________________________________________
> Biopython-dev mailing list
> Biopython-dev@biopython.org
> http://biopython.org/mailman/listinfo/biopython-dev
-- 
Frank Kauff
Dept. of Biology
Duke University
Box 90338
Durham, NC 27708
USA

Phone 919-660-7382
Fax 919-660-7293
Web http://www.lutzonilab.net/member/frankkauff.shtml





From fkauff at duke.edu  Sun Feb 20 17:05:56 2005
From: fkauff at duke.edu (Frank Kauff)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] Bio.Nexus
In-Reply-To: <42185B6B.4080309@ims.u-tokyo.ac.jp>
References: <42156811.8050502@ims.u-tokyo.ac.jp>
	<1108735761.5094.11.camel@osiris.biology.duke.edu>
	<42185B6B.4080309@ims.u-tokyo.ac.jp>
Message-ID: <1108937168.5094.7.camel@cpe-024-211-246-168.nc.rr.com>

On Sun, 2005-02-20 at 18:42 +0900, Michiel Jan Laurens de Hoon wrote:
> Frank Kauff wrote:
> > Hi Michiel,
> > 
> > On Fri, 2005-02-18 at 12:59 +0900, Michiel Jan Laurens de Hoon wrote:
> > 
> >>Bio/Nexus/cnexus.c contains a "main" function that doesn't seem to be needed in 
> >>Biopython. Can I remove it? Since this function is exported, it may (in theory 
> >>at least) cause a conflict. Also, my compiler complains about it that "int main" 
> >>doesn't return an int.
> >>
> > 
> > 
> > Not sure -  I simply strictly followed the Python documentation about
> > extensions: http://docs.python.org/ext/methodTable.html, because it's
> > the first extension I've ever written :-) The docs say that I need the
> > main function for calling the initialization function that passes the
> > method table to the interpreter.
> 
> You need the "main" function when you're embedding python (so when you write 
> your own program that contains the Python interpreter). Here you're extending 
> python, so you don't need the main function. The initialization function is 
> calling by the Python interpreter when you import your module.
> 

Still I don't really get it - using the main() function is what's
described in the python docs as the thing to do when extending. But it
seems to work without from within Biopython, but not when I just keep
the files somewhere else and import them from there (as done during
develpment of cnexus and the rest of the parser).
Anyway, when it works without main() from Bio.Nexus, it's fine with me
to remove it.

Frank

> --Michiel.
> 
-- 
Frank Kauff
Dept. of Biology
Duke University
Box 90338
Durham, NC 27708
USA

Phone 919-660-7382
Fax 919-660-7293
Web http://www.lutzonilab.net/member/frankkauff.shtml





From mdehoon at ims.u-tokyo.ac.jp  Sun Feb 20 21:56:52 2005
From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] We need better doc strings for primer records
	so	here is a diff
In-Reply-To: <42164ED0.4030306@utoronto.ca>
References: <42164ED0.4030306@utoronto.ca>
Message-ID: <42194DF4.5010507@ims.u-tokyo.ac.jp>

A better way to submit patches would be through bugzilla, accessable through the 
Biopython home page. Patches tend to get lost if they're submitted by email.

Currently, however, it is not possible to add an attachment to a bug report 
posted with bugzilla. From the bugzilla documentation, it seems that it is 
possible to add attachments, so maybe our bugzilla is simply not configured for 
that.

To change the bugzilla configuration, I think we need to change some templates 
in /home/websites/bugzilla on biopython.org. But we don't have permission to 
those files, and this may be set up jointly for the bio* projects.

Unless somebody can come up with a better patch submission system, I'll go ask 
around on the bioperl mailing list.

--Michiel.

Jonathan Taylor wrote:
> I think my first post got blocked because I attached a diff.  Can we 
> please turn off all protection to the list now that it is registered 
> users only?
> 
> The diff I attached is at:
> 
> http://bbc.botany.utoronto.ca/~jtaylor/primer.diff
> 

-- 
Michiel de Hoon, Assistant Professor
University of Tokyo, Institute of Medical Science
Human Genome Center
4-6-1 Shirokane-dai, Minato-ku
Tokyo 108-8639
Japan
http://bonsai.ims.u-tokyo.ac.jp/~mdehoon

From idoerg at burnham.org  Sun Feb 20 23:05:58 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] We need better doc strings for primer records
	so here is a diff
In-Reply-To: <42194DF4.5010507@ims.u-tokyo.ac.jp>
Message-ID: 

Actually, it is possible to post attachments to bug reports, and also to
tag them specifically as patches, I just tested it. An attachment cannot
be posted when creating the bug report, but it can be posted later, upon
assignment.


Therefore I suggest we keep the non-attachment policy on the mailing
lists as-is.

./I


--
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037, USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 646 3171
http://ffas.ljcrf.edu/~iddo
-------------------------------------
Automated Protein Function Prediction Meeting, June 24, 2005
http://ffas.burnham.org/AFP

On Mon, 21 Feb 2005, Michiel Jan Laurens de Hoon wrote:

> A better way to submit patches would be through bugzilla, accessable through the 
> Biopython home page. Patches tend to get lost if they're submitted by email.
> 
> Currently, however, it is not possible to add an attachment to a bug report 
> posted with bugzilla. From the bugzilla documentation, it seems that it is 
> possible to add attachments, so maybe our bugzilla is simply not configured for 
> that.
> 
> To change the bugzilla configuration, I think we need to change some templates 
> in /home/websites/bugzilla on biopython.org. But we don't have permission to 
> those files, and this may be set up jointly for the bio* projects.
> 
> Unless somebody can come up with a better patch submission system, I'll go ask 
> around on the bioperl mailing list.
> 
> --Michiel.
> 
> Jonathan Taylor wrote:
> > I think my first post got blocked because I attached a diff.  Can we 
> > please turn off all protection to the list now that it is registered 
> > users only?
> > 
> > The diff I attached is at:
> > 
> > http://bbc.botany.utoronto.ca/~jtaylor/primer.diff
> > 
> 
> -- 
> Michiel de Hoon, Assistant Professor
> University of Tokyo, Institute of Medical Science
> Human Genome Center
> 4-6-1 Shirokane-dai, Minato-ku
> Tokyo 108-8639
> Japan
> http://bonsai.ims.u-tokyo.ac.jp/~mdehoon
> _______________________________________________
> Biopython-dev mailing list
> Biopython-dev@biopython.org
> http://biopython.org/mailman/listinfo/biopython-dev
> 


From mdehoon at ims.u-tokyo.ac.jp  Sun Feb 20 23:30:47 2005
From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] We need better doc strings for primer records
	so here is a diff
In-Reply-To: 
References: 
Message-ID: <421963F7.6040606@ims.u-tokyo.ac.jp>

That's good to know. I agree then to keep the non-attachment policy on 
the mailing list.

--Michiel.

Iddo Friedberg wrote:
> Actually, it is possible to post attachments to bug reports, and also to
> tag them specifically as patches, I just tested it. An attachment cannot
> be posted when creating the bug report, but it can be posted later, upon
> assignment.
> 
> 
> Therefore I suggest we keep the non-attachment policy on the mailing
> lists as-is.
> 
> ./I
> 
> 
> --
> Iddo Friedberg, Ph.D.
> The Burnham Institute
> 10901 N. Torrey Pines Rd.
> La Jolla, CA 92037, USA
> Tel: +1 (858) 646 3100 x3516
> Fax: +1 (858) 646 3171
> http://ffas.ljcrf.edu/~iddo
> -------------------------------------
> Automated Protein Function Prediction Meeting, June 24, 2005
> http://ffas.burnham.org/AFP
> 
> On Mon, 21 Feb 2005, Michiel Jan Laurens de Hoon wrote:
> 
> 
>>A better way to submit patches would be through bugzilla, accessable through the 
>>Biopython home page. Patches tend to get lost if they're submitted by email.
>>
>>Currently, however, it is not possible to add an attachment to a bug report 
>>posted with bugzilla. From the bugzilla documentation, it seems that it is 
>>possible to add attachments, so maybe our bugzilla is simply not configured for 
>>that.
>>
>>To change the bugzilla configuration, I think we need to change some templates 
>>in /home/websites/bugzilla on biopython.org. But we don't have permission to 
>>those files, and this may be set up jointly for the bio* projects.
>>
>>Unless somebody can come up with a better patch submission system, I'll go ask 
>>around on the bioperl mailing list.
>>
>>--Michiel.
>>
>>Jonathan Taylor wrote:
>>
>>>I think my first post got blocked because I attached a diff.  Can we 
>>>please turn off all protection to the list now that it is registered 
>>>users only?
>>>
>>>The diff I attached is at:
>>>
>>>http://bbc.botany.utoronto.ca/~jtaylor/primer.diff
>>>
>>
>>-- 
>>Michiel de Hoon, Assistant Professor
>>University of Tokyo, Institute of Medical Science
>>Human Genome Center
>>4-6-1 Shirokane-dai, Minato-ku
>>Tokyo 108-8639
>>Japan
>>http://bonsai.ims.u-tokyo.ac.jp/~mdehoon
>>_______________________________________________
>>Biopython-dev mailing list
>>Biopython-dev@biopython.org
>>http://biopython.org/mailman/listinfo/biopython-dev
>>
> 
> 
> 
> 


From bugzilla-daemon at portal.open-bio.org  Sun Feb 20 22:57:19 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] [Bug 1751] Not a bug: testing attachments to
	bugzilla
Message-ID: <200502210357.j1L3vJBo020902@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1751





------- Additional Comments From idoerg@burnham.org  2005-02-20 22:57 -------
Created an attachment (id=195)
 --> (http://bugzilla.open-bio.org/attachment.cgi?id=195&action=view)
test attachment

not a real bug. Not a real patch



------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.

From bugzilla-daemon at portal.open-bio.org  Sun Feb 20 23:02:30 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] [Bug 1751] Not a bug: testing attachments to
	bugzilla
Message-ID: <200502210402.j1L42U3b021064@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1751

idoerg@burnham.org changed:

           What    |Removed                     |Added
----------------------------------------------------------------------------
             Status|NEW                         |RESOLVED
         Resolution|                            |INVALID



------- Additional Comments From idoerg@burnham.org  2005-02-20 23:02 -------
Not a bug. Just tested the post attachment capability. It works.



------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.

From bugzilla-daemon at portal.open-bio.org  Sun Feb 20 22:52:22 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] [Bug 1751] New: Not a bug: testing attachments to
	bugzilla
Message-ID: <200502210352.j1L3qMZs020841@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1751

           Summary: Not a bug: testing attachments to bugzilla
           Product: Biopython
           Version: Not Applicable
          Platform: All
        OS/Version: All
            Status: NEW
          Severity: trivial
          Priority: P2
         Component: Other
        AssignedTo: biopython-dev@biopython.org
        ReportedBy: idoerg@burnham.org


can't see a place to post attachments



------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.

From Frederic.Sohm at iaf.cnrs-gif.fr  Mon Feb 21 03:27:34 2005
From: Frederic.Sohm at iaf.cnrs-gif.fr (Frederic Sohm)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] Freeze contributions please
In-Reply-To: <42165748.3050502@burnham.org>
References: <421650F8.9030204@burnham.org> <42165748.3050502@burnham.org>
Message-ID: <200502210927.34733.Frederic.Sohm@iaf.cnrs-gif.fr>

Hi,

The Restriction package have been added since 1.30 as well.

Felicitation for the release.


Fred



On Friday 18 February 2005 21:59, Iddo Friedberg wrote:
> New Modules since 1.30:
>
> Affy
> CAPS
> Nexus
>
> What did I miss?
>
> ./I
>
> Iddo Friedberg wrote:
> > Hi all,
> >
> > I am rolling out the version now. Please freeze all CVS deposits for
> > now. If you really want ot put something in, let me know first.
> >
> > thanks,
> >
> > Iddo

-- 
Fr?d?ric Sohm
Equipe INRA U1126 "Morphogen?se du syst?me nerveux des Chord?s"
UPR 2197 DEPSN, CNRS
Institut de Neurosciences A. Fessard
1 Avenue de la Terrasse
91 198 GIF-SUR-YVETTE
FRANCE
Phone: +33 (0) 1 69 82 34 12
Fax:+33 (0) 1 69 82 34 47



From biopython-dev at maubp.freeserve.co.uk  Mon Feb 21 05:39:01 2005
From: biopython-dev at maubp.freeserve.co.uk (Peter)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] Bug patches
In-Reply-To: 
References: 
Message-ID: <4219BA45.50807@maubp.freeserve.co.uk>

Iddo Friedberg wrote:
> Actually, it is possible to post attachments to bug reports, and also to
> tag them specifically as patches, I just tested it.

When creating an attachment what exactly does the "patch" flag do?  Is 
it for reporting (e.g. show me open bugs with a patch).  Should it only 
be used when attaching a "diff"?

This isn't discussed on the bug writing help:

http://bugzilla.open-bio.org/bugwritinghelp.html

Is there a similar page anywhere for bug fixers?

In particular I would like to know how the developers would prefer any 
"diff" files to be created.  A simple step by step example using two 
example files ("cvs_version.py" and "my_version.py") would be great.

So far, I have been offering any small suggested fixes as a few lines of 
code in the report, and trying to explain as clearly as possible where 
they should go.

For bigger changes I have resorted to attaching entire edited python 
files, stating which CVS revision they are based on.

 > An attachment cannot be posted when creating the bug report, but it
 > can be posted later, upon assignment.

This setup that forces any contributor with a new bug an fix to make two 
postings on bugzilla (one to create the bug, one to add the patch) is a 
bit odd, but is also used on Mozilla.

I guess the default setup assumes the bug report and fixer are usually 
different people.

Thank you

Peter

-- 
PhD Student
MOAC Doctoral Training Centre
University of Warwick, UK

From bartek at rezolwenta.eu.org  Tue Feb 22 17:55:10 2005
From: bartek at rezolwenta.eu.org (bartek wilczynski)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] CompareACE support in biopython
In-Reply-To: <421B77A2.60308@burnham.org>
References: <421650F8.9030204@burnham.org>
	<1109082274.421b40a2df6e8@imp.rezolwenta.eu.org>
	<421B77A2.60308@burnham.org>
Message-ID: <1109112910.421bb84e851a6@imp.rezolwenta.eu.org>

Hi all,

In order to get it into the 1.4 release, I've just uploaded a small extension of
mine Bio.AlignAce module. It's a very simple interface for CompareACE,  a
program for comparing different sequence motifs.

As the module is very simple it should not cause any problems with the release.

-- 
cheers
   Bartek


From bugzilla-daemon at portal.open-bio.org  Wed Feb 23 15:11:00 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] [Bug 1753] New: Bio.PDB: parse_pdb_header.py last
	mod'd 9/05/2004
Message-ID: <200502232011.j1NKB0qD008766@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1753

           Summary: Bio.PDB: parse_pdb_header.py last mod'd 9/05/2004
           Product: Biopython
           Version: Not Applicable
          Platform: PC
        OS/Version: Windows XP
            Status: NEW
          Severity: normal
          Priority: P2
         Component: Other
        AssignedTo: biopython-dev@biopython.org
        ReportedBy: dgaffney@uvm.edu


parse_pdb_header() def takes a file handle according to the FAQ doc; the code
looks like it wants to open a filename. Might change line 111-120 to accept a
filename, keeping in mind that the FAQ should be changed too as well as the
__main__ test function (see further below):

***** PROPOSED CHANGE AT LINE 111-120:
def parse_pdb_header(fname):
    """
    Returns the header lines of a pdb file as a dictionary.

    Dictionary keys are: head, deposition_date, release_date, structure_method,
    resolution, structure_reference, journal_reference, author and
    compound.
    """
    header=[]
    f=open(fname,'r')

***** PROPOSED CHANGE AT LINES 252-257:
if __name__=='__main__':
    """
    Reads a PDB file passed as argument, parses its header, extracts
    some data and returns it as a dictionary.
    """
    dict = parse_pdb_header(sys.argv[1])



------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.

From bugzilla-daemon at portal.open-bio.org  Wed Feb 23 15:49:39 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] [Bug 1753] Bio.PDB: parse_pdb_header.py last mod'd
	9/05/2004
Message-ID: <200502232049.j1NKndAj009236@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1753

thamelry@binf.ku.dk changed:

           What    |Removed                     |Added
----------------------------------------------------------------------------
             Status|NEW                         |RESOLVED
         Resolution|                            |FIXED



------- Additional Comments From thamelry@binf.ku.dk  2005-02-23 15:49 -------
parse_pdb_header now accepts a filename or an open file,
just like PDBParser.



------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.

From bugzilla-daemon at portal.open-bio.org  Wed Feb 23 15:49:53 2005
From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon@portal.open-bio.org)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] [Bug 1753] Bio.PDB: parse_pdb_header.py last mod'd
	9/05/2004
Message-ID: <200502232049.j1NKnrkN009268@portal.open-bio.org>

http://bugzilla.open-bio.org/show_bug.cgi?id=1753

thamelry@binf.ku.dk changed:

           What    |Removed                     |Added
----------------------------------------------------------------------------
             Status|RESOLVED                    |CLOSED





------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.

From idoerg at burnham.org  Wed Feb 23 21:51:19 2005
From: idoerg at burnham.org (Iddo Friedberg)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] Biopython 1.40 beta released
Message-ID: <421D4127.7010004@burnham.org>

We are pleased to announce the release of  Biopython 1.40 beta. It has 
been nine months since the last official release, and there are numerous 
changes, bugfixes, enhancements, goodies and new contributors. Most 
notable are the addition of the Nexus parser (Frank Kauff w/ Cymon Cox) 
, the CAPS module (Jonathan Taylor), the Restriction enzyme package 
(Frederic Sohm), hefty improvements to Bio.PDB (Thomas Hamelryck), 
MutableSeq (Michiel de Hoon), and more. The delay in the release was 
caused by day jobs creeping into the lives of most core developers. So 
we are very happy with this release finally out, and we hope to have the 
non-beta out soon.

Too many people to thank, so I'll mention only handful: Michiel and 
Thomas, thanks for keeping tabs on things during the release process; 
Jonathan and Frank, thanks for the new modules. Jeff Chang, thanks for 
all the help and pointers in getting the release out, and for the 
documentation you wrote for theat purpose. Thanks to all the developers 
for making this happen, and apologies for not mentioning you all by name 
and work. There are >170 members on the developers mailing list,  46 
people in the CONTRIB file, and if you feel you should be there and 
you're not, let me know. Finally, thanks to Jeff (again) Andrew and Brad 
for making this project so robust that even putting me in charge did not 
screw it up.


Peace,

Iddo

-- 

Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037
Tel: (858) 646 3100 x3516
Fax: (858) 713 9930
http://ffas.ljcrf.edu/~iddo


From jeffrey.chang at duke.edu  Thu Feb 24 00:21:17 2005
From: jeffrey.chang at duke.edu (Jeffrey Chang)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] Re: [BioPython] Biopython 1.40 beta released
In-Reply-To: <421D4127.7010004@burnham.org>
References: <421D4127.7010004@burnham.org>
Message-ID: 

Fantastic job.  Congratulations!  It's a lot of work, lots of stuff to 
keep track of to get a release out.  It's definitely a good thing to 
get a new version out there for people to work with.

Jeff


On Feb 23, 2005, at 9:51 PM, Iddo Friedberg wrote:

> We are pleased to announce the release of  Biopython 1.40 beta. It has 
> been nine months since the last official release, and there are 
> numerous changes, bugfixes, enhancements, goodies and new 
> contributors. Most notable are the addition of the Nexus parser (Frank 
> Kauff w/ Cymon Cox) , the CAPS module (Jonathan Taylor), the 
> Restriction enzyme package (Frederic Sohm), hefty improvements to 
> Bio.PDB (Thomas Hamelryck), MutableSeq (Michiel de Hoon), and more. 
> The delay in the release was caused by day jobs creeping into the 
> lives of most core developers. So we are very happy with this release 
> finally out, and we hope to have the non-beta out soon.
>
> Too many people to thank, so I'll mention only handful: Michiel and 
> Thomas, thanks for keeping tabs on things during the release process; 
> Jonathan and Frank, thanks for the new modules. Jeff Chang, thanks for 
> all the help and pointers in getting the release out, and for the 
> documentation you wrote for theat purpose. Thanks to all the 
> developers for making this happen, and apologies for not mentioning 
> you all by name and work. There are >170 members on the developers 
> mailing list,  46 people in the CONTRIB file, and if you feel you 
> should be there and you're not, let me know. Finally, thanks to Jeff 
> (again) Andrew and Brad for making this project so robust that even 
> putting me in charge did not screw it up.
>
>
> Peace,
>
> Iddo
>
> -- 
>
> Iddo Friedberg, Ph.D.
> The Burnham Institute
> 10901 N. Torrey Pines Rd.
> La Jolla, CA 92037
> Tel: (858) 646 3100 x3516
> Fax: (858) 713 9930
> http://ffas.ljcrf.edu/~iddo
>
> _______________________________________________
> BioPython mailing list  -  BioPython@biopython.org
> http://biopython.org/mailman/listinfo/biopython


From dalke at dalkescientific.com  Thu Feb 24 01:50:31 2005
From: dalke at dalkescientific.com (Andrew Dalke)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] Biopython 1.40 beta released
In-Reply-To: <421D4127.7010004@burnham.org>
References: <421D4127.7010004@burnham.org>
Message-ID: <606A80BB-8630-11D9-A3B1-000A956826C8@dalkescientific.com>

I'll second Jeff on this.

I am very impressed and humbled that this idea he and I had back
in 1999 has turned into the Biopython of today with all its
functionality along with an active development and user community.

Iddo, you did an excellent job in rounding up everyone and everything
to get this release out.  Good work!

					Andrew
					dalke@dalkescientific.com


From biopython-dev at maubp.freeserve.co.uk  Thu Feb 24 05:18:23 2005
From: biopython-dev at maubp.freeserve.co.uk (Peter)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] Minor update to "Installation on Windows"
	instructions
In-Reply-To: <606A80BB-8630-11D9-A3B1-000A956826C8@dalkescientific.com>
References: <421D4127.7010004@burnham.org>
	<606A80BB-8630-11D9-A3B1-000A956826C8@dalkescientific.com>
Message-ID: <421DA9EF.5010109@maubp.freeserve.co.uk>

I notice that the HTML and PDF instructions need updating:

http://www.biopython.org/docs/install/Installation.html#htoc5

> 2.2  Installation on Windows
> 
> Installation on Windows is most easily done using handy windows
> installers. As described above in the UNIX section, you should go
> to the webpage for the current stable version of Python to
> download this installer. At the current time, you'd go to
> http://www.python.org/2.2.3/ and download Python-2.2.3.exe.

Python 2.4 is the current production version of Python, but I would 
personally also include the links to 2.3.5 as well:

http://www.python.org/2.3.5/

Peter

From mdehoon at ims.u-tokyo.ac.jp  Thu Feb 24 06:55:01 2005
From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] Minor update to "Installation on
	Windows"	instructions
In-Reply-To: <421DA9EF.5010109@maubp.freeserve.co.uk>
References: <421D4127.7010004@burnham.org>	<606A80BB-8630-11D9-A3B1-000A956826C8@dalkescientific.com>
	<421DA9EF.5010109@maubp.freeserve.co.uk>
Message-ID: <421DC095.2090505@ims.u-tokyo.ac.jp>

It seems the the HTML and PDF instructions were created from the same source 
file, but I couldn't find such a source file on the web server. It doesn't seem 
that this part of the website is written by quixote. Does anybody have the 
source file for the installation instructions? Jeff, perhaps?

--Michiel.

Peter wrote:
> I notice that the HTML and PDF instructions need updating:
> 
> http://www.biopython.org/docs/install/Installation.html#htoc5
> 
>> 2.2  Installation on Windows
>>
>> Installation on Windows is most easily done using handy windows
>> installers. As described above in the UNIX section, you should go
>> to the webpage for the current stable version of Python to
>> download this installer. At the current time, you'd go to
>> http://www.python.org/2.2.3/ and download Python-2.2.3.exe.
> 
> 
> Python 2.4 is the current production version of Python, but I would 
> personally also include the links to 2.3.5 as well:
> 
> http://www.python.org/2.3.5/
> 
> Peter
> _______________________________________________
> Biopython-dev mailing list
> Biopython-dev@biopython.org
> http://biopython.org/mailman/listinfo/biopython-dev
> 
> 

-- 
Michiel de Hoon, Assistant Professor
University of Tokyo, Institute of Medical Science
Human Genome Center
4-6-1 Shirokane-dai, Minato-ku
Tokyo 108-8639
Japan
http://bonsai.ims.u-tokyo.ac.jp/~mdehoon

From mdehoon at ims.u-tokyo.ac.jp  Sun Feb 27 02:30:40 2005
From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] Minor update to "Installation
	on	Windows"	instructions
In-Reply-To: <421DC095.2090505@ims.u-tokyo.ac.jp>
References: <421D4127.7010004@burnham.org>	<606A80BB-8630-11D9-A3B1-000A956826C8@dalkescientific.com>	<421DA9EF.5010109@maubp.freeserve.co.uk>
	<421DC095.2090505@ims.u-tokyo.ac.jp>
Message-ID: <42217720.5050207@ims.u-tokyo.ac.jp>

Never mind -- I found them. The source file was in CVS. I have updated 
the installation instructions at 
http://www.biopython.org/docs/install/Installation.html and 
http://www.biopython.org/docs/install/Installation.pdf.

--Michiel.

Michiel Jan Laurens de Hoon wrote:
> It seems the the HTML and PDF instructions were created from the same 
> source file, but I couldn't find such a source file on the web server. 
> It doesn't seem that this part of the website is written by quixote. 
> Does anybody have the source file for the installation instructions? 
> Jeff, perhaps?
> 
> --Michiel.
> 
> Peter wrote:
> 
>> I notice that the HTML and PDF instructions need updating:
>>
>> http://www.biopython.org/docs/install/Installation.html#htoc5

From mdehoon at ims.u-tokyo.ac.jp  Mon Feb 28 21:00:49 2005
From: mdehoon at ims.u-tokyo.ac.jp (Michiel Jan Laurens de Hoon)
Date: Sat Mar  5 14:44:00 2005
Subject: [Biopython-dev] Biopython-dev mailing freeze for spam removal
Message-ID: <4223CCD1.9090902@ims.u-tokyo.ac.jp>

I went through the biopython-dev mailing list archive to remove the spam 
messages. To replace the archive with the new spam-free one, we need to 
replace the message box file on the server and regenerate the archive. 
To make sure no messages are lost during the file replacement, it may be 
a good idea to stop sending new messages to biopython-dev until after 
the file replacement has been completed.

For future reference, this is what needs to be done to update the archive:

o) remove the /home/mailman/archives/private/mailinglistname directory
o) edit the mailinglistname.mbox file at 
/home/mailman/archives/private/mailinglistname.mbox/mailinglistname.mbox
o) run /home/mailman/bin/arch mailinglistname

To edit the biopython-dev.mbox file, I used netscape mail. By putting 
the file in the same directory as where netscape stores its message 
folders, biopython-dev.mbox will look like an ordinary message folder. 
You can then use netscape mail to go through the messages and delete the 
spam. When you're done, you go to File > Compact Folders to actually 
update the biopython-dev.mbox file.

The only glitch that I found with this is that if a line in a message 
starts with "From", netscape mail will interpret this as the start of a 
new email message. I found this in only 2 messages in about 3000, so it 
can be fixed by hand easily.

--Michiel.