From jchang at smi.stanford.edu Wed Oct 2 03:06:03 2002 From: jchang at smi.stanford.edu (Jeffrey Chang) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] Fwd: [Open-Bioinformatics-Foundation] Notice: New OBF CVS server and disruptive infrastructure upgrades Message-ID: <20021002000603.A8064@springfield.stanford.edu> This applies to us. In a nutshell, the CVS repository is going to be moved. Please check in your outstanding changes right now! Jeff ----- Forwarded message from Chris Dagdigian ----- From: Chris Dagdigian To: open-bioinformatics-foundation@open-bio.org Cc: i3c-techarch@bioperl.org, ableasby@hgmp.mrc.ac.uk, Michael Niemi , James Freeman Date: Tue, 1 Oct 2002 13:07:29 -0400 Subject: [Open-Bioinformatics-Foundation] Notice: New OBF CVS server and disruptive infrastructure upgrades ## To avoid active OBF members getting many copies of this message we have constructed an announce-only unique email list culled from all the discussion lists that we operate. This email is going out to 1982 unique addresses. Questions about how/why you received this message should be addressed to 'chris@bioteam.net'. ## To all OBF affiliated developers and mailing list subscribers as well as related parties like I3C.org, biopathways.org and emboss.org: Subject: Significant server downtime beginning on October 2nd Contents: (1) Summary for non-developers (2) Background info & history (3) Details for developers and powerusers OBF Developers, I3C.org members & emboss.org CVS users: There is critical information that you must be aware of in the body of this message. Summary for non-developers ======================= On Wednesday, October 2, 2002 (all day - EDT timezone) we are going to relocate all of our servers including the primary web, email, FTP and sourcecode repositories to a new (and faster) network. This move requires changing all of our server IP addresses and physically moving the machine to a building a short distance away from our current colocation facilities located in Cambridge, Massachusetts. We are also going to take advantage of this relocation to move our primary CVS repositories on to a dedicated developer-access-only machine (details below). The server maintenance and physical relocation are expected to only take a few hours. However it may take up to 48 hours for our new DNS information to propagate around the world and replace the old information that may be aggressively cached by institutions and ISPs. For many of you the primary symptom will be a disruption in email discussion lists that you may be participating in. A good sign that the change has propagated to your network will is being able to resolve the 'bioperl.org' domain name to something other than 199.93.107.70 The reminder of this message is background material and specific information for developers and account holders on our system. We are asking in advance for forgiveness for any inconvenience this rushed-to-avoid-disconnection transition will cause. There may be issues beyond our control (Wyeth routers/firewall, reverse IP mappings with upstream ISPs, domain names we don't control DNS for, etc.) that could cause us minor problems over the next few days. Please hang in there! During the downtime/transition process Chris Dagdigian can be reached directly at 1-617-877-5498 and 'chris@bioteam.net'. Feel free to contact him at any time with questions, problem reports or requests for status updates. Once email is flowing again you can also contact the OBF sysadmin team at 'root-l@open-bio.org'. Background & History ================= One of our longest and most significant supporters has been Genetics Institute (now integrated into Wyeth Research) -- for many years now they have been allowing us to hang our servers off of their corporate internet connection in Cambridge, MA. Over the years this has been a non-trivial gift as the combined OBF websites (particularly bioperl.org and biojava.org) consume a very significant amount of internet bandwidth every day. More bandwidth than we could probably afford to pay for, especially in the early days of our project(s). The connection we have been using for 4+ years is based on a redundant pair of T1 lines connected to the Genuity/BBN backbone. This was the primary corporate internet connection for Wyeth Research in Cambridge until several months ago when the company brought in a new OC3 fiber line offering 12mbit/second internet connectivity. After the company moved its internet usage over to the OC3 line someone at Wyeth began the process of canceling the T1 pair without the knowledge that there were multiple outside-the-firewall servers still dependent on that link. Those of you curious as to why our servers fell off the internet for several days a few weeks ago now know the answer as to what happened. Our internet circuit was shut off by the carrier on orders from Wyeth network admins who thought the lines were unused. The disconnect caused an immediate panic within our sysadmin core -- we knew what happened but were not at all sure if we were still welcome at Wyeth Research anymore. We thought that we were going to be forced to find a new home for our systems with zero notice. Fortunately that was not the case. Once Wyeth Research was alerted to our problem there were many employees on both the scientific and IT side who interrupted their busy schedules and went above and beyond their normal duties to (a) bring the T1 circuit back temporarily and (b) work with senior IT staff on a transition plan to bring our servers into an outside-the-firewall managed DMZ zone on the new really fast OC3 internet link. This is a partial list of people at Wyeth Research who helped us out: Charles Richard III -- Vice President, Genomics Steve Howes --- Director of Bioinformatics, Genomics Steve Tenerelli --- Associate Director, Border Network Services Rich Hollenbach -- Firewall Administrator, Border Network Services Jason Blair -- IT Network Engineer Rich DiNunno -- IT Network Engineer Without the efforts of these and other folks we'd probably still be frantically looking for a new hosting facility at this time. Specifics for developers and account holders =================================== (A) CRITICAL INFO FOR DEVELOPERS We are going to take advantage of this planned downtime to bring a new developer server online. You will not be able to CVS commit to the current server after 11am EDT on October 2nd 2002. The new CVS server will be called "dev.open-bio.org" and will be a Sun Netra T1 server running Solaris 8 and directly attached to a large external RAID storage array. As usual we will create DNS entries for "dev.your-project-here.org". DEV.OPEN-BIO.ORG will be for developers only and will be the new home for ALL CVS SOURCECODE REPOSITORIES! Anonymous CVS for non-developers will still be at 'cvs.open-bio.org' and 'cvs.your-project-here.org' The main reason for this move is to get our developers onto a platform with hardware RAID protected storage. The additional benefit is that the system will not be encumbered by any of our other web or email services. How the transition will be managed: (1) The CVS repository on the current main server everyone uses will be made read-only at 11am EDT on Wednesday October 2nd 2002. (2) Shortly after we make the repository unwritable we will disable inbound SSH access to the primary server so new connections or commits will not be possible. (3) The locked-down CVS repositories will be copied onto dev.open-bio.org along with all user accounts, UIDs, GIDs, passwords and home directories. (4) The new machine will be moved to the new OC3 network and brought online as 'dev.open-bio.org'. Additional DNS aliases will follow (5) At the same time the CVS migration occurs we will be updating all of out other servers and physically moving them to the new hosting network. The path of least resistance for developers is to: (a) get your code changes committed prior to the lockdown deadline (b) perform a clean checkout of the codebase from dev.open-bio.org when it comes up and continue future work on it. However it is highly likely that developers may have changes that they will not be able or willing to commit prior to the lockdown deadline. For those users the following example script has been suggested: % find . -name "Root" ! -type d | xargs perl -p -i .orig -e 's/ext:(\S+):/ext:dev.open-bio.org:/ That unix shell command (untested) should put the proper dev.open-bio.org entries into any existing CVS checkout directories that you may have. If you are nervous about performing such an operation then please wait until our servers are back online again and query the OBF sysadmin mailing list ("rool-l@open-bio.org") to see if someone can provide a script that has been used and tested by others. For more information: Since our email lists will be down if at any time you need more information or updates on our progress please feel free to contact me directly at 'chris@bioteam.net' or 1-617-877-5498, (B) Domains that will be directly affected by our relocation We control DNS for the following domains and will be in a position to make quick changes when the IP transition occurs: biodas.org biofetch.org biojava.org biomoby.org bioperl.org biopython.org bior.org biosoap.org biostandards.org bioxml.org open-bio.org We do not control DNS for the following domains: i3c.org -- They will need to update DNS information themselves or face disruption biopathways.org -- Not yet hosting on our servers so not a problem emboss.org -- They only use us for CVS but need to be aware of the new hostname for the cvs server _______________________________________________ Open-Bioinformatics-Foundation mailing list Open-Bioinformatics-Foundation@open-bio.org http://open-bio.org/mailman/listinfo/open-bioinformatics-foundation ----- End forwarded message ----- From idoerg at burnham.org Thu Oct 3 15:43:50 2002 From: idoerg at burnham.org (Iddo Friedberg) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] extension/distutils question References: <20021002000603.A8064@springfield.stanford.edu> Message-ID: <3D9C9DF6.1080503@burnham.org> Hi All, I want to build a SEG module in Python, based on an extension of NCBI's seg program. I am new to extensions & distutils. Basically, I do not know how to define the dependency tree (see the attached Makefile of NCBI's distribution) of the 3 c-source files. If I just use the setup.py file I attached here, I get linker errors (multiple definitions). I couldn't find a mention of this on Python's site or usenet.... Hopefully-this-will-be-answered-before-Chris-moves-server'ly yours, Iddo -- Iddo Friedberg The Burnham Institute 10901 N. Torrey Pines Rd. La Jolla, CA 92037 USA Tel: +1 (858) 646 3100 x3516 Fax: +1 (858) 646 3171 -------------- next part -------------- all : seg seg : seg.c lnfac.h genwin.h genwin.o gcc -O -o seg seg.c genwin.o -lm hiseg : hiseg.c lnfac.h genwin.h genwin.o gcc -O -o hiseg hiseg.c genwin.o -lm genwin.o : genwin.c genwin.h gcc -O -c genwin.c clean: rm -f seg seg.o genwin.o -------------- next part -------------- from distutils.core import setup, Extension pyseg= Extension('pyseg', sources = ['seg.c', 'genwin.c', 'hiseg.c'], libraries = ['m']) setup (name='pyseg', ext_modules=[pyseg]) From biopython-bugs at bioperl.org Tue Oct 8 07:46:57 2002 From: biopython-bugs at bioperl.org (biopython-bugs@bioperl.org) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] Notification: incoming/87 Message-ID: <200210081146.g98Bkv4P000661@pw600a.bioperl.org> JitterBug notification new message incoming/87 Message summary for PR#87 From: rickard.sandberg@mtc.ki.se Subject: genbank_format 2 added tags Date: Tue, 8 Oct 2002 07:46:53 -0400 0 replies 0 followups ====> ORIGINAL MESSAGE FOLLOWS <==== >From rickard.sandberg@mtc.ki.se Tue Oct 8 07:46:57 2002 Received: from localhost (localhost [127.0.0.1]) by pw600a.bioperl.org (8.12.2/8.12.2) with ESMTP id g98Bkr4P000656 for ; Tue, 8 Oct 2002 07:46:57 -0400 Date: Tue, 8 Oct 2002 07:46:53 -0400 Message-Id: <200210081146.g98Bkr4P000656@pw600a.bioperl.org> From: rickard.sandberg@mtc.ki.se To: biopython-bugs@bioperl.org Subject: genbank_format 2 added tags Full_Name: Rickard Sandberg Module: genbank_format.py Version: 1.00a4 OS: linux Submission from: generic2.mtc.ki.se (130.237.137.207) When parsing entries in GenBank (GID:9627127 and 14270686 for example). You get parser Error: Traceback (most recent call last): File "", line 1, in ? File "/usr/lib/python2.2/site-packages/Bio/GenBank/__init__.py", line 1555, in __getitem__ return self.parser.parse(handle) File "/usr/lib/python2.2/site-packages/Bio/GenBank/__init__.py", line 268, in parse self._scanner.feed(handle, self._consumer) File "/usr/lib/python2.2/site-packages/Bio/GenBank/__init__.py", line 1250, in feed self._parser.parseFile(handle) File "/usr/lib/python2.2/site-packages/Martel/Parser.py", line 230, in parseFile self.parseString(fileobj.read()) File "/usr/lib/python2.2/site-packages/Martel/Parser.py", line 258, in parseString self._err_handler.fatalError(result) File "/usr/lib/python2.2/xml/sax/handler.py", line 38, in fatalError raise exception Martel.Parser.ParserPositionException: error parsing at or beyond character 60674 However, I found that the reason being that the 2 documents contained Feature Tags not present in the genbank_format.py file. So, when I added "snoRNA" in feature_key_names and "isolation_source" in the feature_qualifier_names it works. Also, I added the possible use of "linear" in the residue_type in the LOCUS definition, which I think was the reason for parserError in some files I had couple of months ago. Bye From biopython-bugs at bioperl.org Thu Oct 10 13:14:08 2002 From: biopython-bugs at bioperl.org (biopython-bugs@bioperl.org) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] Notification: incoming/88 Message-ID: <200210101714.g9AHE84P030764@pw600a.bioperl.org> JitterBug notification new message incoming/88 Message summary for PR#88 From: WebXperts.Design, "Inc." Subject: We Build The Internet. WebXperts Design, Inc. (Design / Programming / Consultation) Date: Thu, 10 Oct 2002 14:22:56 -0400 0 replies 0 followups ====> ORIGINAL MESSAGE FOLLOWS <==== >From WebBuilders@YourService.com Thu Oct 10 13:14:08 2002 Received: from 52.22.55.10 ([216.91.88.22]) by pw600a.bioperl.org (8.12.2/8.12.2) with SMTP id g9AHE64P030758 for ; Thu, 10 Oct 2002 13:14:06 -0400 Message-Id: <200210101714.g9AHE64P030758@pw600a.bioperl.org> From: WebXperts.Design, "Inc." To: biopython-bugs@bioperl.org Reply-To: WebBuilders@YourService.com Subject: We Build The Internet. WebXperts Design, Inc. (Design / Programming / Consultation) Date: Thu, 10 Oct 2002 14:22:56 -0400 MIME-Version: 1.0 Content-Type: multipart/related; boundary="5779189d-309b-471c-8450-12785acccf5c" This is a multi-part message in MIME format --5779189d-309b-471c-8450-12785acccf5c Content-Type: text/html; charset=iso-8859-1 Content-Transfer-Encoding: quoted-printable We Build The Internet. WebXperts Design, Inc.
If This Flyer does not appear correctly and/or images do not appear, please = click the following link: www.webxwireless.com


Your email address was obtained from a ====> MESSAGE TRUNCATED AT 8192 <==== From biopython-bugs at bioperl.org Wed Oct 16 05:35:24 2002 From: biopython-bugs at bioperl.org (biopython-bugs@bioperl.org) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] Notification: incoming/89 Message-ID: <200210160935.g9G9ZO4P031762@pw600a.bioperl.org> JitterBug notification new message incoming/89 Message summary for PR#89 From: andreas.kuntzagk@mdc-berlin.de Subject: Error in Indexing w/ Mindy Date: Wed, 16 Oct 2002 05:35:23 -0400 0 replies 0 followups ====> ORIGINAL MESSAGE FOLLOWS <==== >From andreas.kuntzagk@mdc-berlin.de Wed Oct 16 05:35:24 2002 Received: from localhost (localhost [127.0.0.1]) by pw600a.bioperl.org (8.12.2/8.12.2) with ESMTP id g9G9ZN4P031757 for ; Wed, 16 Oct 2002 05:35:24 -0400 Date: Wed, 16 Oct 2002 05:35:23 -0400 Message-Id: <200210160935.g9G9ZN4P031757@pw600a.bioperl.org> From: andreas.kuntzagk@mdc-berlin.de To: biopython-bugs@bioperl.org Subject: Error in Indexing w/ Mindy Full_Name: Andreas Kuntzagk Module: Mindy.FlatDB Version: OS: Linux Submission from: tahiti.bioinf.mdc-berlin.de (141.80.80.11) When I try the Scripts/Index/indexing_ex.py I get following error: Traceback (most recent call last): File "indexing_ex.py", line 45, in ? sys.exit(main(index_type, args, db_name)) File "indexing_ex.py", line 26, in main create_index(files, db_name) File "/home/kuntzagk/lib/python2.2/site-packages/Bio/Mindy/SimpleSeqRecord.py", line 111, in create_flatdb creator = FlatDB.create(db_name, unique_name, alias_names) File "/home/kuntzagk/lib/python2.2/site-packages/Bio/Mindy/FlatDB.py", line 297, in create return open(dbname, "rw") File "/home/kuntzagk/lib/python2.2/site-packages/Bio/Mindy/FlatDB.py", line 304, in open return MemoryFlatDB(dbname) File "/home/kuntzagk/lib/python2.2/site-packages/Bio/Mindy/FlatDB.py", line 130, in __init__ BaseFlatDB.__init__(self, dbname, INDEX_TYPE) TypeError: __init__() takes exactly 2 arguments (3 given) Seems the error is in Mindy.MemoryFlatDB.__init__ From acornet at emory.edu Wed Oct 16 15:01:20 2002 From: acornet at emory.edu (Ben Cornett) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] Tutorial.tex (patch) Message-ID: <20021016150120.B122454@heisenbug.chem.emory.edu> Recent cvs builds don't install a Bio/Tools module, but the tutorial still references Bio.Tools. This patch corrects those references. Ben --- Tutorial.tex 2002/07/01 07:22:21 1.27 +++ Tutorial.tex 2002/10/16 18:47:07 @@ -454,10 +454,16 @@ MutableSeq('CGCTAAAAGCTAGGATATATCCGGGTTGCAG', IUPACUnambiguousDNA()) \end{verbatim} -Now that the nature of the sequence object makes some sense, the next thing to look at is what kind of things we can do with a sequence. The \verb|Bio/Tools| directory contains two useful modules to transcribe and translate a sequence object. These tools work based on the alphabet of the sequence. For instance, let's supposed we want to transcribe our \verb|my_seq| object. Remember that this contains an unambiguous alphabet, so to transcribe we would do the following: +Now that the nature of the sequence object makes some sense, the next +thing to look at is what kind of things we can do with a sequence. The +\verb|Bio| directory contains two useful modules to transcribe and +translate a sequence object. These tools work based on the alphabet of +the sequence. For instance, let's supposed we want to transcribe our +\verb|my_seq| object. Remember that this contains an unambiguous +alphabet, so to transcribe we would do the following: \begin{verbatim} ->>> from Bio.Tools import Transcribe +>>> from Bio import Transcribe >>> transcriber = Transcribe.unambiguous_transcriber >>> my_rna_seq = transcriber.transcribe(my_seq) >>> print my_rna_seq @@ -478,7 +484,7 @@ To translate our DNA object we have quite a few choices. First, we can use any number of translation tables depending on what we know about our DNA sequence. The translation tables available in biopython were taken from information at \ahrefurl{\url{ftp://ncbi.nlm.nih.gov/entrez/misc/data/gc.prt}}. So, you have tons of choices to pick from. For this, let's just focus on two choices: the Standard translation table, and the Translation table for Vertebrate Mitochondriall DNA. These tables are labelled with id numbers 1 and 2, respectively. Now that we know what tables we are looking to get, we're all set to perform a basic translation. First, we need to get our translators that use these tables. Since we are still dealing with our unambiguous DNA object, we want to fetch translators that take this into account: \begin{verbatim} ->>> from Bio.Tools import Translate +>>> from Bio import Translate >>> standard_translator = Translate.unambiguous_dna_by_id[1] >>> mito_translator = Translate.unambiguous_dna_by_id[2] \end{verbatim} From jchang at smi.stanford.edu Wed Oct 16 23:31:09 2002 From: jchang at smi.stanford.edu (Jeffrey Chang) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] Tutorial.tex (patch) In-Reply-To: <20021016150120.B122454@heisenbug.chem.emory.edu>; from acornet@emory.edu on Wed, Oct 16, 2002 at 03:01:20PM -0400 References: <20021016150120.B122454@heisenbug.chem.emory.edu> Message-ID: <20021016203109.E42456@springfield.stanford.edu> Thanks a lot! I've committed your fixes. Jeff On Wed, Oct 16, 2002 at 03:01:20PM -0400, Ben Cornett wrote: > Recent cvs builds don't install a Bio/Tools module, but the tutorial > still references Bio.Tools. This patch corrects those references. > > Ben > > > > > > > --- Tutorial.tex 2002/07/01 07:22:21 1.27 > +++ Tutorial.tex 2002/10/16 18:47:07 > @@ -454,10 +454,16 @@ > MutableSeq('CGCTAAAAGCTAGGATATATCCGGGTTGCAG', IUPACUnambiguousDNA()) > \end{verbatim} > > -Now that the nature of the sequence object makes some sense, the next thing to look at is what kind of things we can do with a sequence. The \verb|Bio/Tools| directory contains two useful modules to transcribe and translate a sequence object. These tools work based on the alphabet of the sequence. For instance, let's supposed we want to transcribe our \verb|my_seq| object. Remember that this contains an unambiguous alphabet, so to transcribe we would do the following: > +Now that the nature of the sequence object makes some sense, the next > +thing to look at is what kind of things we can do with a sequence. The > +\verb|Bio| directory contains two useful modules to transcribe and > +translate a sequence object. These tools work based on the alphabet of > +the sequence. For instance, let's supposed we want to transcribe our > +\verb|my_seq| object. Remember that this contains an unambiguous > +alphabet, so to transcribe we would do the following: > > \begin{verbatim} > ->>> from Bio.Tools import Transcribe > +>>> from Bio import Transcribe > >>> transcriber = Transcribe.unambiguous_transcriber > >>> my_rna_seq = transcriber.transcribe(my_seq) > >>> print my_rna_seq > @@ -478,7 +484,7 @@ > To translate our DNA object we have quite a few choices. First, we can use any number of translation tables depending on what we know about our DNA sequence. The translation tables available in biopython were taken from information at \ahrefurl{\url{ftp://ncbi.nlm.nih.gov/entrez/misc/data/gc.prt}}. So, you have tons of choices to pick from. For this, let's just focus on two choices: the Standard translation table, and the Translation table for Vertebrate Mitochondriall DNA. These tables are labelled with id numbers 1 and 2, respectively. Now that we know what tables we are looking to get, we're all set to perform a basic translation. First, we need to get our translators that use these tables. Since we are still dealing with our unambiguous DNA object, we want to fetch translators that take this into account: > > \begin{verbatim} > ->>> from Bio.Tools import Translate > +>>> from Bio import Translate > >>> standard_translator = Translate.unambiguous_dna_by_id[1] > >>> mito_translator = Translate.unambiguous_dna_by_id[2] > \end{verbatim} > > > > _______________________________________________ > Biopython-dev mailing list > Biopython-dev@biopython.org > http://biopython.org/mailman/listinfo/biopython-dev From abc at palantir.chem.emory.edu Fri Oct 18 08:01:39 2002 From: abc at palantir.chem.emory.edu (abc@palantir.chem.emory.edu) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] Error in tutorial program Message-ID: <20021018120139.GA32302@palantir.chem.emory.edu> Hi, I've been working through the Tutorial document and I noticed that the Cypripedioideae FASTA parsing example is somewhat broken. The Doc/examples/fasta_consumer.py script works if you use the ls_orchid.fasta file from the same directory. However, if you do your own Entrez search and run the script on it you will get an error like this: Traceback (most recent call last): File "./x.py", line 32, in ? extract_organisms('/home/abc/x.fasta', 95) File "./x.py", line 27, in extract_organisms scanner.feed(file_to_parse, consumer) File "/usr/local/lib/python2.2/site-packages/Bio/Fasta/__init__.py", line 225, in feed self._scan_record(uhandle, consumer) File "/usr/local/lib/python2.2/site-packages/Bio/Fasta/__init__.py", line 229, in _scan_record self._scan_title(uhandle, consumer) File "/usr/local/lib/python2.2/site-packages/Bio/Fasta/__init__.py", line 234, in _scan_title read_and_call(uhandle, consumer.title, start='>') File "/usr/local/lib/python2.2/site-packages/Bio/ParserSupport.py", line 331, in read_and_call raise SyntaxError, errmsg SyntaxError: Line does not start with '>': TCAGCGGTGGCTCACTGACTGGGTTGCATCCAAGTGGCCGTCACCGCCCATGGGGTTGACGTGCCTCCAA The problem occurs because the individual records in the search output that I get aren't separated by newlines like the ones in ls_orchid.fasta. The Bio.Fasta._Scanner class can't handle this format unless the file handle you pass to it implements the `saveline' method (even though it doesn't say this). fasta_consumer.py just passes a regular python file object. Below are a couple of simple fixes. The _Scanner patch potentially breaks existing code, so maybe it's not so good. Regards, Ben --- Doc/examples/fasta_consumer.py 2001/02/01 05:45:28 1.3 +++ Doc/examples/fasta_consumer.py 2002/10/17 15:31:36 @@ -1,6 +1,8 @@ from Bio.ParserSupport import AbstractConsumer from Bio import Fasta +from Bio.File import UndoHandle + import string class SpeciesExtractor(AbstractConsumer): @@ -19,9 +21,9 @@ def extract_organisms(file, num_records): scanner = Fasta._Scanner() consumer = SpeciesExtractor() - - file_to_parse = open(file, 'r') + file_to_parse = UndoHandle(open(file, 'r')) + for fasta_record in range(num_records): scanner.feed(file_to_parse, consumer) --- Bio/Fasta/__init__.py 2001/07/05 23:56:49 1.4 +++ Bio/Fasta/__init__.py 2002/10/17 15:30:47 @@ -211,15 +211,12 @@ def feed(self, handle, consumer): """feed(self, handle, consumer) - Feed in FASTA data for scanning. handle is a file-like object - containing FASTA data. consumer is a Consumer object that will - receive events as the FASTA data is scanned. + Feed in FASTA data for scanning. handle is an instance of + File.UndoHandle containing FASTA data. consumer is a Consumer + object that will receive events as the FASTA data is scanned. """ - if isinstance(handle, File.UndoHandle): - uhandle = handle - else: - uhandle = File.UndoHandle(handle) + assert isinstance(handle, File.UndoHandle): if uhandle.peekline(): self._scan_record(uhandle, consumer) From abc at palantir.chem.emory.edu Fri Oct 18 10:33:12 2002 From: abc at palantir.chem.emory.edu (abc@palantir.chem.emory.edu) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] Error in tutorial program (correction) Message-ID: <20021018143312.GB32302@palantir.chem.emory.edu> Oops. Correction on that correction. Ben --- Bio/Fasta/__init__.py 2001/07/05 23:56:49 1.4 +++ Bio/Fasta/__init__.py 2002/10/17 18:03:52 @@ -211,15 +211,12 @@ def feed(self, handle, consumer): """feed(self, handle, consumer) - Feed in FASTA data for scanning. handle is a file-like object - containing FASTA data. consumer is a Consumer object that will - receive events as the FASTA data is scanned. + Feed in FASTA data for scanning. handle is an instance of + File.UndoHandle containing FASTA data. consumer is a Consumer + object that will receive events as the FASTA data is scanned. """ - if isinstance(handle, File.UndoHandle): - uhandle = handle - else: - uhandle = File.UndoHandle(handle) + assert isinstance(handle, File.UndoHandle) if uhandle.peekline(): self._scan_record(uhandle, consumer) From biopython-bugs at bioperl.org Mon Oct 21 12:28:08 2002 From: biopython-bugs at bioperl.org (biopython-bugs@bioperl.org) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] Notification: incoming/90 Message-ID: <200210211628.g9LGS86J021862@pw600a.bioperl.org> JitterBug notification new message incoming/90 Message summary for PR#90 From: "WALL STREET BULLETIN..46727" Subject: New Stock Pick: NNCO UP 112%..................................................... qov Date: Mon, 21 Oct 2002 12:35:39 -0500 0 replies 0 followups ====> ORIGINAL MESSAGE FOLLOWS <==== >From Subscriber_Services78045@yahoo.com Mon Oct 21 12:28:08 2002 Received: from 202.108.234.94 ([61.143.3.130]) by pw600a.bioperl.org (8.12.2/8.12.2) with SMTP id g9LGRr6J021848 for ; Mon, 21 Oct 2002 12:28:01 -0400 Message-Id: <200210211628.g9LGRr6J021848@pw600a.bioperl.org> Received: from [203.186.145.225] by hotmail.com (3.2) with ESMTP id MHotMailBE7297E1009B400437E7CBBA91E10D0B0; Oct, 21 2002 12:20:20 PM -0000 Received: from 36.185.61.158 ([36.185.61.158]) by f64.law4.hotmail.com with QMQP; Oct, 21 2002 11:29:19 AM -0300 Received: from 177.139.227.166 ([177.139.227.166]) by sparc.isl.net with QMQP; Oct, 21 2002 10:27:16 AM +0600 Received: from [159.218.252.32] by n7.groups.yahoo.com with SMTP; Oct, 21 2002 9:23:07 AM -0100 From: "WALL STREET BULLETIN..46727" To: Subscriber.Acct.#99633 Cc: Subject: New Stock Pick: NNCO UP 112%..................................................... qov Sender: "WALL STREET BULLETIN..46727" Mime-Version: 1.0 Content-Type: text/html; charset="iso-8859-1" Date: Mon, 21 Oct 2002 12:35:39 -0500 X-Mailer: The Bat! (v1.52f) Business X-Priority: 1

NEW ISSUE - Volume 6, Issue 37 - October 2002

CLICK HERE

 

 

I no longer wish to receive your newsletter click here

uqueltpreeoqerbonpjvjt From biopython-bugs at bioperl.org Wed Oct 23 11:09:14 2002 From: biopython-bugs at bioperl.org (biopython-bugs@bioperl.org) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] Notification: incoming/91 Message-ID: <200210231509.g9NF9E6J011490@pw600a.bioperl.org> JitterBug notification new message incoming/91 Message summary for PR#91 From: "WALL STREET BULLETIN..46950" Subject: NEW STOCK PICK: PRCT - LAST PICK UP 233%, NNCO...................................................................................................................................................................................................... rirk Date: Wed, 23 Oct 2002 11:16:44 -0500 0 replies 0 followups ====> ORIGINAL MESSAGE FOLLOWS <==== >From Subscriber_Services78058@corecom.net Wed Oct 23 11:09:13 2002 Received: from 210.0.202.162 ([211.251.201.62]) by pw600a.bioperl.org (8.12.2/8.12.2) with SMTP id g9NF966J011482 for ; Wed, 23 Oct 2002 11:09:10 -0400 Message-Id: <200210231509.g9NF966J011482@pw600a.bioperl.org> Received: from unknown (74.38.244.167) by asy100.as122.sol.superonline.com with NNFMP; Oct, 23 2002 10:48:15 AM +0300 Received: from [118.189.136.119] by smtp-server1.cfl.rr.com with NNFMP; Oct, 23 2002 10:09:17 AM -0200 Received: from [174.223.185.169] by rly-xl05.mx.aol.com with NNFMP; Oct, 23 2002 9:15:37 AM +0700 Received: from rly-yk04.mx.aol.com ([99.100.131.137]) by rly-xw01.mx.aol.com with NNFMP; Oct, 23 2002 7:47:18 AM +0700 From: "WALL STREET BULLETIN..46950" To: Subscriber.Acct.#99578 Cc: Subject: NEW STOCK PICK: PRCT - LAST PICK UP 233%, NNCO...................................................................................................................................................................................................... rirk Sender: "WALL STREET BULLETIN..46950" Mime-Version: 1.0 Content-Type: text/html; charset="iso-8859-1" Date: Wed, 23 Oct 2002 11:16:44 -0500 X-Mailer: The Bat! (v1.52f) Business X-Priority: 1

Did you miss out on NNCO, UP 233% IN JUST 2 DAYS?

If so, Here's another pick - Another Short Play

CLICK HERE

 

 

I no longer wish to receive your newsletter click here

lrejgulyyofefraatocldxysxxbilsoynnvgnhw From jchang at smi.stanford.edu Thu Oct 24 19:56:00 2002 From: jchang at smi.stanford.edu (Jeffrey Chang) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] Error in tutorial program In-Reply-To: <20021018120139.GA32302@palantir.chem.emory.edu>; from abc@palantir.chem.emory.edu on Fri, Oct 18, 2002 at 08:01:39AM -0400 References: <20021018120139.GA32302@palantir.chem.emory.edu> Message-ID: <20021024165559.O65276@springfield.stanford.edu> Hi Ben, Yep, you're right. The example doesn't work, since the information in the UndoHandle created by the scanner is lost in every iteration. Thanks for the patch. I have committed it. Please let me know if there are any further problems! Jeff On Fri, Oct 18, 2002 at 08:01:39AM -0400, abc@palantir.chem.emory.edu wrote: > Hi, > > I've been working through the Tutorial document and I noticed that the > Cypripedioideae FASTA parsing example is somewhat broken. The > Doc/examples/fasta_consumer.py script works if you use the > ls_orchid.fasta file from the same directory. However, if you do your own > Entrez search and run the script on it you will get an error like this: > > > Traceback (most recent call last): > File "./x.py", line 32, in ? > extract_organisms('/home/abc/x.fasta', 95) > File "./x.py", line 27, in extract_organisms > scanner.feed(file_to_parse, consumer) > File "/usr/local/lib/python2.2/site-packages/Bio/Fasta/__init__.py", line 225, in feed > self._scan_record(uhandle, consumer) > File "/usr/local/lib/python2.2/site-packages/Bio/Fasta/__init__.py", line 229, in _scan_record > self._scan_title(uhandle, consumer) > File "/usr/local/lib/python2.2/site-packages/Bio/Fasta/__init__.py", line 234, in _scan_title > read_and_call(uhandle, consumer.title, start='>') > File "/usr/local/lib/python2.2/site-packages/Bio/ParserSupport.py", line 331, in read_and_call > raise SyntaxError, errmsg > SyntaxError: Line does not start with '>': > TCAGCGGTGGCTCACTGACTGGGTTGCATCCAAGTGGCCGTCACCGCCCATGGGGTTGACGTGCCTCCAA > > The problem occurs because the individual records in the search output that I > get aren't separated by newlines like the ones in ls_orchid.fasta. The > Bio.Fasta._Scanner class can't handle this format unless the file handle you > pass to it implements the `saveline' method (even though it doesn't say this). > fasta_consumer.py just passes a regular python file object. > > Below are a couple of simple fixes. The _Scanner patch potentially breaks > existing code, so maybe it's not so good. > > Regards, > > Ben > > > > > --- Doc/examples/fasta_consumer.py 2001/02/01 05:45:28 1.3 > +++ Doc/examples/fasta_consumer.py 2002/10/17 15:31:36 > @@ -1,6 +1,8 @@ > from Bio.ParserSupport import AbstractConsumer > from Bio import Fasta > +from Bio.File import UndoHandle > > + > import string > > class SpeciesExtractor(AbstractConsumer): > @@ -19,9 +21,9 @@ > def extract_organisms(file, num_records): > scanner = Fasta._Scanner() > consumer = SpeciesExtractor() > - > - file_to_parse = open(file, 'r') > > + file_to_parse = UndoHandle(open(file, 'r')) > + > for fasta_record in range(num_records): > scanner.feed(file_to_parse, consumer) > > > > > > --- Bio/Fasta/__init__.py 2001/07/05 23:56:49 1.4 > +++ Bio/Fasta/__init__.py 2002/10/17 15:30:47 > @@ -211,15 +211,12 @@ > def feed(self, handle, consumer): > """feed(self, handle, consumer) > > - Feed in FASTA data for scanning. handle is a file-like object > - containing FASTA data. consumer is a Consumer object that will > - receive events as the FASTA data is scanned. > + Feed in FASTA data for scanning. handle is an instance of > + File.UndoHandle containing FASTA data. consumer is a Consumer > + object that will receive events as the FASTA data is scanned. > > """ > - if isinstance(handle, File.UndoHandle): > - uhandle = handle > - else: > - uhandle = File.UndoHandle(handle) > + assert isinstance(handle, File.UndoHandle): > > if uhandle.peekline(): > self._scan_record(uhandle, consumer) > > _______________________________________________ > Biopython-dev mailing list > Biopython-dev@biopython.org > http://biopython.org/mailman/listinfo/biopython-dev From biopython-bugs at bioperl.org Wed Oct 30 11:12:50 2002 From: biopython-bugs at bioperl.org (biopython-bugs@bioperl.org) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] Notification: incoming/92 Message-ID: <200210301612.g9UGCo6J025786@pw600a.bioperl.org> JitterBug notification new message incoming/92 Message summary for PR#92 From: "WALL STREET BULLETIN..46664" Subject: NEW STOCK PICK: NNCO - LAST PICK UP 300% IN JUST 2 DAYS............................................................................................................................................................................ yhtq Date: Wed, 30 Oct 2002 10:08:16 -0600 0 replies 0 followups ====> ORIGINAL MESSAGE FOLLOWS <==== >From Subscriber_Services78047@execpc.com Wed Oct 30 11:12:49 2002 Received: from 200.165.242.240 (RJ242240.user.veloxzone.com.br [200.165.242.240]) by pw600a.bioperl.org (8.12.2/8.12.2) with SMTP id g9UGCe6J025782 for ; Wed, 30 Oct 2002 11:12:47 -0500 Message-Id: <200210301612.g9UGCe6J025782@pw600a.bioperl.org> Received: from a231242.upc-a.chello.nl ([96.216.72.224]) by m10.grp.snv.yahoo.com with NNFMP; Oct, 30 2002 9:53:59 AM -0800 Received: from mta6.snfc21.pbi.net ([39.26.127.61]) by ssymail.ssy.co.kr with esmtp; Oct, 30 2002 8:48:10 AM +0300 Received: from [183.62.39.149] by m10.grp.snv.yahoo.com with QMQP; Oct, 30 2002 7:45:48 AM +1100 Received: from [72.62.68.193] by rly-yk04.mx.aol.com with asmtp; Oct, 30 2002 6:52:05 AM -0100 From: "WALL STREET BULLETIN..46664" To: Subscriber.Acct.#99156 Cc: Subject: NEW STOCK PICK: NNCO - LAST PICK UP 300% IN JUST 2 DAYS............................................................................................................................................................................ yhtq Sender: "WALL STREET BULLETIN..46664" Mime-Version: 1.0 Content-Type: text/html; charset="iso-8859-1" Date: Wed, 30 Oct 2002 10:08:16 -0600 X-Mailer: AOL 7.0 for Windows US sub 118 X-Priority: 1

Did you miss out on PRCT, UP 300% IN JUST 2 DAYS?

If so, Here's another pick - Another Short Play

CLICK HERE

 

 

I no longer wish to receive your newsletter click here

tuwbnnswanblfqbssxmo From sugino at brandeis.edu Thu Oct 31 16:33:00 2002 From: sugino at brandeis.edu (Ken Sugino) Date: Sat Mar 5 14:43:16 2005 Subject: [Biopython-dev] Re: Biopython-dev -- confirmation of subscription -- request 552137 In-Reply-To: <20021031175615.5095.53667.Mailman@pw600a.bioperl.org> References: <20021031175615.5095.53667.Mailman@pw600a.bioperl.org> Message-ID: <20021031163300.5c9556d3.sugino@brandeis.edu> On Thu, 31 Oct 2002 12:56:15 -0500 biopython-dev-request@biopython.org wrote: > Biopython-dev -- confirmation of subscription -- request 552137 > > We have received a request from egret.bio.brandeis.edu for > subscription of your email address, , to the > biopython-dev@biopython.org mailing list. To confirm the request, > please send a message to biopython-dev-request@biopython.org, and > either: > > - maintain the subject line as is (the reply's additional "Re:" is > ok), > > - or include the following line - and only the following line - in the > message body: > > confirm 552137 > > (Simply sending a 'reply' to this message should work from most email > interfaces, since that usually leaves the subject line in the right > form.) > > If you do not wish to subscribe to this list, please simply disregard > this message. Send questions to biopython-dev-admin@biopython.org.