[Bioperl-l] how to get the information of Strand = Plus / Plus from blastn report by bioperl.
Frank Schwach
fs5 at sanger.ac.uk
Fri Jan 13 16:43:58 EST 2012
Hi Pawan,
Can you show your code? Is it basically following the structure shown in
http://www.bioperl.org/wiki/HOWTO:SearchIO#Using_SearchIO
?
If that is the case
$hsp->strand('query')
is exactly what you need.
To check if hit and query are on different strands you can do:
if ( $hsp->strand('query')
* $hsp->strand('hit') == -1){
# do whatever you need to do if they are on opposite strands
}
Hope that helps
Frank
On 13/01/12 16:46, kakchingtabam pawankumar sharma wrote:
> Hi,
> Using Bio::SearchIO module I am parsing the following Blast result.
> I have used the option- $hsp->strand('query').
>
> But I cannot get detail of alignment.
>
> I need to know if my hit is forward (Strand = Plus / Plus)
> or reverse ( Strand = Plus / Minus)...
> Can anyone help me to get report as Plus or Minus for query or hit.
>
> thanks in advanced.
>
> With regards,
> Pawan
>
>
>
> BLASTN 2.2.18 [Dec-23-2011]
>
>
> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
> "Gapped BLAST and PSI-BLAST: a new generation of protein database search
> programs", Nucleic Acids Res. 25:3389-3402.
>
> Query= 000013_c10079-9984
> (50 letters)
>
> Database: Cyano_Probe.fasta
> 4760 sequences; 238,000 total letters
>
> Searching..................................................done
>
>
>
> Score E
> Sequences producing significant alignments: (bits) Value
>
> 000013_c10079-9984
> 100 7e-024
> 002619_2689273-2690037
> 24 0.36
> 001126_c1123720-1123385
> 24 0.36
> 003211_c3326737-3326480
> 22 1.4
> 002415_2471082-2471420
> 22 1.4
> 002269_2321276-2322463
> 22 1.4
> 001328_c1326535-1326164
> 22 1.4
>
>> 000013_c10079-9984
> Length = 50
>
> Score = 99.6 bits (50), Expect = 7e-024
> Identities = 50/50 (100%)
> Strand = Plus / Plus
>
>
> Query: 1 agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
> ||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct: 1 agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
--
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
More information about the Bioperl-l
mailing list