[Bioperl-l] blast results: how to get forward/reverse strand info?

[Dave Messina]

Hi Friedhelm,

Ah, yes, I've been bitten by that, too. You need to specify whether you want
the strand for query or hit, a la:

      $hsp->strand('hit');

Here are the docs for that method, from Bio::Search::HSP::HSPI

 Title   : strand
 Usage   : $hsp->strand('query')
 Function: Retrieves the strand for the HSP component requested
 Returns : +1 or -1 (0 if unknown)
 Args    : 'hit' or 'subject' or 'sbjct' to retrieve the strand of the
subject
           'query' to retrieve the query strand (default)
           'list' or 'array' to retreive both query and hit together


Dave




On Thu, Apr 7, 2011 at 17:35, <fpf at biochem.mpg.de> wrote:

> Dear BioPerl specialists,
>
> At the end is part of a blast result which I want to parse:
>
> Blast version: BLASTN 2.2.24 [Aug-08-2010]
>
> BioPerl call:
> use Bio::SearchIO ;
> ...
>  my $stringfh = new IO::String ($blaststring);
>  my $in = new Bio::SearchIO (-format => 'blast', -fh => $stringfh)
>        or die "parsing blast output string failed";
>
> I need to know if my hit is forward (Strand = Plus / Plus)
> or reverse ( Strand = Plus / Minus)
>
> As I did not see how this information is returned, I checked if
> hit_end is > or < hit_start. However, the hit_start and hit_end coordinates
> are given "(in original hit sequence coords)" as stated in e.g.
> http://search.cpan.org/~cjfields/BioPerl-1.6.1/Bio/Search/HSP/GenericHSP.pm
>
> In the example below,
> hit_start is 24885
> hit_end is 25902
>
> How to find out if the hit is to the forward or reverse strand?
> I tried "->strand" but without success (always returns 1)
>
> Thanks for your help
>
> Friedhelm Pfeiffer
> fpf at biochem.mpg.de
>
>
> here is blaststring (central alignment section removed)
>
>  Hfvol_pHV3 haloVolc1_dna pHV3
>>
>          Length = 437906
>
>  Score = 1905 bits (961), Expect = 0.0
>  Identities = 1009/1021 (98%), Gaps = 3/1021 (0%)
>  Strand = Plus / Minus
>
> Query: 27    cggcgatgccgaggatttcggaccgccggacgcgcagggaaacgccgtcgacggcgcgga
> 86
>             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct: 25902 cggcgatgccgaggatttcggaccgccggacgcgcagggaaacgccgtcgacggcgcgga
> 25843
>
> ...
>
> Query: 986   tcaggtcccgggccctggaattcgatgctggccggattcaacggaacctttgctggggag
> 1045
>             ||||||||| ||||||||||||||||||| ||||||||| ||||| || |||||||||||
> Sbjct: 24942 tcaggtccc-ggccctggaattcgatgct-gccggattcgacggagccgttgctggggag
> 24885
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>